DOCSLIB.ORG

Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. A link to any extended data will be provided when the final version is posted online. Research Articles: Neurobiology of Disease Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability Emin Kuliyev1, Sebastien Gingras2, Clifford S. Guy1, Sherie Howell3, Peter Vogel4 and Stephane Pelletier1 1Department of Immunology, St. Jude Children's Research Hospital, Memphis, TN 38105 2Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213 3Department of Pathology, St. Jude Children's Research Hospital, Memphis, TN 38105; 4Veterinary Pathology Core, Advanced Histology Core, St. Jude Children's Research Hospital, Memphis, TN 38105, USA. DOI: 10.1523/JNEUROSCI.2282-17.2018 Received: 11 August 2017 Revised: 23 December 2017 Accepted: 31 January 2018 Published: 7 February 2018 Author contributions: E.K., S.G., C.S.G., S.H., P.V., and S.P. performed research; E.K., S.G., C.S.G., S.H., P.V., and S.P. analyzed data; E.K., S.G., and S.P. wrote the paper; S.G. and S.P. designed research; S.P. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This work was supported by ALSAC. We thank Dr. Vani Shanker for editing the manuscript. We also thank members of the Veterinary Pathology Core Laboratory, the Histology Laboratory, the Hartwell Center for Bioinformatics and Biotechnology, and the Transgenic/Gene Knockout Shared Resource, particularly Jack Sublett, Ling Li, and Taylor Walker, for their help in generating and characterizing mouse lines. Corresponding author: Stephane Pelletier, PhD, Department of Immunology, St. Jude Children's Research Hospital, Memphis, TN 38105, USA, E-mail: [email protected], Phone: (901) 595-6705, Fax: (901) 595-5766 Cite as: J. Neurosci ; 10.1523/JNEUROSCI.2282-17.2018 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process. Copyright © 2018 the authors 1 2 Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability 3 4 Abbreviated title: SCYL1 and SCYL3 Maintain Motor Neuron Viability 5 6 Emin Kuliyev1, Sebastien Gingras2, Clifford S. Guy1, Sherie Howell3, Peter Vogel4 and Stephane 7 Pelletier1,* 8 9 1Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN 38105; 10 2Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, PA 11 15213; 3Department of Pathology, St. Jude Children’s Research Hospital, Memphis, TN 38105; 12 and 4Veterinary Pathology Core, Advanced Histology Core, St. Jude Children’s Research 13 Hospital, Memphis, TN 38105, USA. 14 15 *Corresponding author: 16 Stephane Pelletier, PhD 17 Department of Immunology 18 St. Jude Children’s Research Hospital, Memphis, TN 38105, USA 19 E-mail: [email protected] 20 Phone: (901) 595-6705 21 Fax: (901) 595-5766 22 23 Number of pages: 58 1 24 Number of figures: 9 25 Number of Tables: 3 26 Number of movies: 4 27 Number of words (Abstract): 220 28 Number of words (Significance statement): 119 29 Number of words (Introduction) (max 500): 472 30 Number of words (Discussion) (max1500): 1281 31 32 FINANCIAL INTERESTS OR CONFLICTS OF INTEREST 33 The authors declare no competing financial interest. 34 35 ACKNOWLEDGEMENTS 36 37 This work was supported by ALSAC. We thank Dr. Vani Shanker for editing the manuscript. We 38 also thank members of the Veterinary Pathology Core Laboratory, the Histology Laboratory, the 39 Hartwell Center for Bioinformatics and Biotechnology, and the Transgenic/Gene Knockout 40 Shared Resource, particularly Jack Sublett, Ling Li, and Taylor Walker, for their help in 41 generating and characterizing mouse lines. 42 43 2 44 ABSTRACT 45 46 Members of the SCY1-like (SCYL) family of protein kinases are evolutionarily conserved and 47 ubiquitously expressed proteins characterized by an N-terminal pseudokinase domain, centrally 48 located HEAT repeats, and an overall disorganized C-terminal segment. In mammals, 3 family 49 members encoded by genes Scyl1, Scyl2, and Scyl3 have been described. Studies have pointed to 50 a role for SCYL1 and SCYL2 in regulating neuronal function and viability in mice and humans, 51 but little is known about the biological function of SCYL3. Here, we show that the biochemical 52 and cell biological properties of SCYL3 are similar to those of SCYL1 and both proteins work in 53 conjunction to maintain motor neuron viability. Specifically, although lack of Scyl3 in mice has 54 no apparent effect on embryogenesis and postnatal life, it accelerates the onset of the motor 55 neuron disorder caused by Scyl1 deficiency. Growth abnormalities, motor dysfunction, hindlimb 56 paralysis, muscle wasting, neurogenic atrophy, motor neuron degeneration, and loss of large- 57 caliber axons in peripheral nerves occurred at an earlier age in Scyl1/Scyl3 double-deficient mice 58 than in Scyl1-deficient mice. Disease onset also correlated with the mislocalization of TDP-43 in 59 spinal motor neurons, suggesting that SCYL1 and SCYL3 regulate TDP-43 proteostasis. 60 Together, our results demonstrate an overlapping role for SCYL1 and SCYL3 in vivo and 61 highlight the importance the SCYL family of proteins in regulating neuronal function and 62 survival. Only male mice were used in this study. 63 64 65 3 66 SIGNIFICANCE STATEMENT 67 68 SCYL1 and SCYL2, members of the SCY1-like family of pseudokinases, have well-established 69 roles in neuronal function. Herein, we uncover the role of SCYL3 in maintaining motor neuron 70 viability. Although targeted disruption of Scyl3 in mice had little or no effect on embryonic 71 development and postnatal life, it accelerated disease onset associated with the loss of Scyl1, a 72 novel motor neuron disease gene in humans. Scyl1 and Scyl3 double-deficient mice had neuronal 73 defects characteristic of amyotrophic lateral sclerosis, including TDP-43 pathology, at an earlier 74 age than did Scyl1-deficient mice. Thus, we show that SCYL1 and SCYL3 play overlapping 75 roles in maintaining motor neuronal viability in vivo and confirm that SCYL family members are 76 critical regulators of neuronal function and survival. 77 4 78 INTRODUCTION 79 80 Members of the SCY1-like family of protein kinases, which comprises SCYL1, SCYL2, and 81 SCYL3, are evolutionarily conserved and ubiquitously expressed proteins characterized by an N- 82 terminal kinase domain; centrally located Huntingtin, elongation factor 3, protein phosphatase 83 2A, yeast kinase TOR1 (HEAT) repeats; and an overall disorganized C-terminal segment. Unlike 84 functional protein kinases that catalyze the transfer of phosphate groups to protein substrates, 85 kinase domains of SCYL proteins are likely inactive and possibly serve other functions, such as 86 modulation of active kinases or assembly of signaling pathways (Boudeau et al., 2006; Pelletier, 87 2016). 88 89 Genetic studies in humans and mice have begun to elucidate the biological function of SCYL 90 proteins. Disruptive mutations in SCYL1 are associated with a rare syndrome characterized by 91 liver failure, cerebellar atrophy, ataxia and, most importantly peripheral neuropathy (Schmidt et 92 al., 2015). In mice, spontaneous or targeted deletion of Scyl1 causes an early onset motor neuron 93 disorder characterized by progressive loss of motor function, muscle wasting, loss of large- 94 caliber axons in the periphery, and loss of lower motor neurons in the ventral horn of the spinal 95 cord (Blot et al., 1995; Schmidt et al., 2007; Pelletier et al., 2012). The disease is neural cell- 96 autonomous and involves molecular pathways associated with other motor neuron disorders such 97 as amyotrophic lateral sclerosis (ALS) (Pelletier et al., 2012). Mislocalization of the RNA- 98 binding protein (RBP) TDP-43 from the nucleus to cytoplasmic inclusions, a hallmark of ALS 99 and fronto-temporal lobar degeneration, occurs in lower motor neurons of Scyl1-deficient mice 100 and correlates with disease onset (Pelletier et al., 2012). Similarly, targeted disruption of Scyl2 in 5 101 mice causes severe neurological disorders, including impaired suckling behavior, which result in 102 premature death of most newborn mice (Gingras et al., 2015). In surviving mice, the absence of 103 Scyl2 results in the degeneration of several neuronal populations, most notably CA3 pyramidal 104 neurons of the hippocampus (Gingras et al., 2015). The degenerative process associated with the 105 loss of SCYL2 is also neural cell-autonomous and caused by excessive excitatory signaling 106 (Gingras et al., 2015). 107 108 Although these studies clearly established SCYL1 and SCYL2 as critical regulators of neuronal 109 function and survival, the biological function of SCYL3 has remained elusive. In this study, we 110 use a combination of biochemical, cell biological and genetic approaches to elucidate the 111 function of SCYL3 in mammalian development and physiology. We show that SCYL3 is a 112 widely expressed Golgi membrane–associated protein with biochemical and cell biological 113 properties similar to those of SCYL1 and both proteins play an overlapping role in maintaining 114 motor neuron viability in mice. Although targeted disruption of Scyl3 in mice did not produce 115 overt abnormalities, absence of Scyl3 accelerated the onset of the motor phenotype associated 116 with loss of Scyl1. Disease onset in Scyl1 and Scyl3 double-deficient mice also correlated with 117 TDP-43 pathology in spinal motor neurons suggesting a link between SCYL1, SCYL3 and TDP- 118 43 proteostasis. 119 120 121 6 122 MATERIALS AND METHODS 123 124 SCYL3 antibody 125 A peptide corresponding to amino acids 7–27 (ALKSYTLRESPFTLPSGLAVY [serum 7688]) 126 of SCYL3 was synthesized by the Hartwell Center for Bioinformatics and Biotechnology at St. 127 Jude Children’s Research Hospital (St. Jude) and conjugated to glutaraldehyde-activated keyhole 128 limpet hemocyanin (KLH).
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Inhibiting TRK Proteins in Clinical Cancer Therapy
    cancers Review Inhibiting TRK Proteins in Clinical Cancer Therapy Allison M. Lange 1 and Hui-Wen Lo 1,2,* 1 Department of Cancer Biology, Wake Forest University School of Medicine, Winston-Salem, NC 27157, USA; [email protected] 2 Comprehensive Cancer Center, Wake Forest University School of Medicine, Winston-Salem, NC 27157, USA * Correspondence: [email protected] Received: 25 February 2018; Accepted: 29 March 2018; Published: 4 April 2018 Abstract: Gene rearrangements resulting in the aberrant activity of tyrosine kinases have been identified as drivers of oncogenesis in a variety of cancers. The tropomyosin receptor kinase (TRK) family of tyrosine receptor kinases is emerging as an important target for cancer therapeutics. The TRK family contains three members, TRKA, TRKB, and TRKC, and these proteins are encoded by the genes NTRK1, NTRK2, and NTRK3, respectively. To activate TRK receptors, neurotrophins bind to the extracellular region stimulating dimerization, phosphorylation, and activation of downstream signaling pathways. Major known downstream pathways include RAS/MAPK/ERK, PLCγ, and PI3K/Akt. While being rare in most cancers, TRK fusions with other proteins have been well-established as oncogenic events in specific malignancies, including glioblastoma, papillary thyroid carcinoma, and secretory breast carcinomas. TRK protein amplification as well as alternative splicing events have also been described as contributors to cancer pathogenesis. For patients harboring alterations in TRK expression or activity, TRK inhibition emerges as an important therapeutic target. To date, multiple trials testing TRK-inhibiting compounds in various cancers are underway. In this review, we will summarize the current therapeutic trials for neoplasms involving NTKR gene alterations, as well as the promises and setbacks that are associated with targeting gene fusions.
    [Show full text]
  • Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability
    The Journal of Neuroscience, March 7, 2018 • 38(10):2615–2630 • 2615 Neurobiology of Disease Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability Emin Kuliyev,1 Sebastien Gingras,4 XClifford S. Guy,1 Sherie Howell,2 Peter Vogel,3 and XStephane Pelletier1 1Departments of Immunology, 2Pathology, 3Veterinary Pathology Core, Advanced Histology Core, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, and 4Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213 Members of the SCY1-like (SCYL) family of protein kinases are evolutionarily conserved and ubiquitously expressed proteins character- ized by an N-terminal pseudokinase domain, centrally located Huntingtin, elongation factor 3, protein phosphatase 2A, yeast kinase TOR1 repeats, and an overall disorganized C-terminal segment. In mammals, three family members encoded by genes Scyl1, Scyl2, and Scyl3 have been described. Studies have pointed to a role for SCYL1 and SCYL2 in regulating neuronal function and viability in mice and humans, but little is known about the biological function of SCYL3. Here, we show that the biochemical and cell biological properties of SCYL3aresimilartothoseofSCYL1andbothproteinsworkinconjunctiontomaintainmotorneuronviability.Specifically,althoughlack of Scyl3 in mice has no apparent effect on embryogenesis and postnatal life, it accelerates the onset of the motor neuron disorder caused by Scyl1 deficiency. Growth abnormalities, motor dysfunction, hindlimb paralysis, muscle wasting, neurogenic atrophy, motor neuron degeneration, and loss of large-caliber axons in peripheral nerves occurred at an earlier age in Scyl1/Scyl3 double-deficient mice than in Scyl1-deficientmice.DiseaseonsetalsocorrelatedwiththemislocalizationofTDP-43inspinalmotorneurons,suggestingthatSCYL1and SCYL3 regulate TDP-43 proteostasis. Together, our results demonstrate an overlapping role for SCYL1 and SCYL3 in vivo and highlight the importance the SCYL family of proteins in regulating neuronal function and survival.
    [Show full text]
  • Recount Brain Example with Data from SRP027383
    recount_brain example with data from SRP027383 true Abstract This is an example on how to use recount_brain applied to the SRP027383 study. We show how to download data from recount2, add the sample metadata from recount_brain, explore the sample metadata and the gene expression data, and perform a gene expression analysis. Introduction This document is an example of how you can use recount_brain. We will use the data from the SRA study SRP027383 which is described in “RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas” (Bao, Chen, Yang, Zhang, et al., 2014). As you can see in Figure @ref(fig:runselector) a lot of the metadata for these samples is missing from the SRA Run Selector which makes it a great case for using recount_brain. We will show how to add the recount_brain metadata and perform a gene differential expression analysis using this information. Sample metadata Just like any study in recount2 (Collado-Torres, Nellore, Kammers, Ellis, et al., 2017), we first need to download the gene count data using recount::download_study(). Since we will be using many functions from the recount package, lets load it first1. ## Load the package library('recount') Download gene data Having loaded the package, we next download the gene-level data. if(!file.exists(file.path('SRP027383', 'rse_gene.Rdata'))) { download_study('SRP027383') } load(file.path('SRP027383', 'rse_gene.Rdata'), verbose = TRUE) ## Loading objects: ## rse_gene 1If you are a first time recount user, we recommend first reading the package vignette at bioconductor.org/packages/recount. 1 Figure 1: SRA Run Selector information for study SRP027383.
    [Show full text]
  • Long Non-Coding RNA Landscape in Prostate Cancer Molecular Subtypes: a Feature Selection Approach
    International Journal of Molecular Sciences Article Long Non-Coding RNA Landscape in Prostate Cancer Molecular Subtypes: A Feature Selection Approach Simona De Summa 1,* , Antonio Palazzo 2 , Mariapia Caputo 1, Rosa Maria Iacobazzi 3 , Brunella Pilato 1, Letizia Porcelli 3, Stefania Tommasi 1 , Angelo Virgilio Paradiso 4,† and Amalia Azzariti 3,† 1 Molecular Diagnostics and Pharmacogenetics Unit, IRCCS IstitutoTumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] (M.C.); [email protected] (B.P.); [email protected] (S.T.) 2 Laboratory of Nanotechnology, IRCCS IstitutoTumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] 3 Laboratory of Experimental Pharmacology, IRCCS Istituto Tumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] (R.M.I.); [email protected] (L.P.); [email protected] (A.A.) 4 Scientific Directorate, IRCCS Istituto Tumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] * Correspondence: [email protected] † Co-senior authors. Abstract: Prostate cancer is one of the most common malignancies in men. It is characterized by a high molecular genomic heterogeneity and, thus, molecular subtypes, that, to date, have not been used in clinical practice. In the present paper, we aimed to better stratify prostate cancer patients through the selection of robust long non-coding RNAs. To fulfill the purpose of the study, a bioinformatic approach focused on feature selection applied to a TCGA dataset was used. In such a way, LINC00668 and long non-coding(lnc)-SAYSD1-1, able to discriminate ERG/not-ERG subtypes, Citation: De Summa, S.; Palazzo, A.; were demonstrated to be positive prognostic biomarkers in ERG-positive patients.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/19 (2006.01) C12Q 1/02 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/81 (2006.01) C07K 14/47 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, PCT/US20 15/049674 MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (22) International Filing Date: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 11 September 2015 ( 11.09.201 5) SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, 62/050,045 12 September 2014 (12.09.2014) US TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (71) Applicant: WHITEHEAD INSTITUTE FOR BIOMED¬ DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, ICAL RESEARCH [US/US]; Nine Cambridge Center, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Cambridge, Massachusetts 02142-1479 (US).
    [Show full text]
  • Dual Specificity Phosphatases from Molecular Mechanisms to Biological Function
    International Journal of Molecular Sciences Dual Specificity Phosphatases From Molecular Mechanisms to Biological Function Edited by Rafael Pulido and Roland Lang Printed Edition of the Special Issue Published in International Journal of Molecular Sciences www.mdpi.com/journal/ijms Dual Specificity Phosphatases Dual Specificity Phosphatases From Molecular Mechanisms to Biological Function Special Issue Editors Rafael Pulido Roland Lang MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade Special Issue Editors Rafael Pulido Roland Lang Biocruces Health Research Institute University Hospital Erlangen Spain Germany Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal International Journal of Molecular Sciences (ISSN 1422-0067) from 2018 to 2019 (available at: https: //www.mdpi.com/journal/ijms/special issues/DUSPs). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number, Page Range. ISBN 978-3-03921-688-8 (Pbk) ISBN 978-3-03921-689-5 (PDF) c 2019 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons license CC BY-NC-ND. Contents About the Special Issue Editors ....................................
    [Show full text]
  • Page 1 Exploring the Understudied Human Kinome For
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.02.022277; this version posted June 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Exploring the understudied human kinome for research and therapeutic opportunities Nienke Moret1,2,*, Changchang Liu1,2,*, Benjamin M. Gyori2, John A. Bachman,2, Albert Steppi2, Rahil Taujale3, Liang-Chin Huang3, Clemens Hug2, Matt Berginski1,4,5, Shawn Gomez1,4,5, Natarajan Kannan,1,3 and Peter K. Sorger1,2,† *These authors contributed equally † Corresponding author 1The NIH Understudied Kinome Consortium 2Laboratory of Systems Pharmacology, Department of Systems Biology, Harvard Program in Therapeutic Science, Harvard Medical School, Boston, Massachusetts 02115, USA 3 Institute of Bioinformatics, University of Georgia, Athens, GA, 30602 USA 4 Department of Pharmacology, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 5 Joint Department of Biomedical Engineering at the University of North Carolina at Chapel Hill and North Carolina State University, Chapel Hill, NC 27599, USA Key Words: kinase, human kinome, kinase inhibitors, drug discovery, cancer, cheminformatics, † Peter Sorger Warren Alpert 432 200 Longwood Avenue Harvard Medical School, Boston MA 02115 [email protected] cc: [email protected] 617-432-6901 ORCID Numbers Peter K. Sorger 0000-0002-3364-1838 Nienke Moret 0000-0001-6038-6863 Changchang Liu 0000-0003-4594-4577 Ben Gyori 0000-0001-9439-5346 John Bachman 0000-0001-6095-2466 Albert Steppi 0000-0001-5871-6245 Page 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.02.022277; this version posted June 30, 2020.
    [Show full text]
  • Dynamics of Dual Specificity Phosphatases and Their Interplay with Protein Kinases in Immune Signaling Yashwanth Subbannayya1,2, Sneha M
    bioRxiv preprint doi: https://doi.org/10.1101/568576; this version posted March 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dynamics of dual specificity phosphatases and their interplay with protein kinases in immune signaling Yashwanth Subbannayya1,2, Sneha M. Pinto1,2, Korbinian Bösl1, T. S. Keshava Prasad2 and Richard K. Kandasamy1,3,* 1Centre of Molecular Inflammation Research (CEMIR), and Department of Clinical and Molecular Medicine (IKOM), Norwegian University of Science and Technology, N-7491 Trondheim, Norway 2Center for Systems Biology and Molecular Medicine, Yenepoya (Deemed to be University), Mangalore 575018, India 3Centre for Molecular Medicine Norway (NCMM), Nordic EMBL Partnership, University of Oslo and Oslo University Hospital, N-0349 Oslo, Norway *Correspondence: Richard K. Kandasamy ([email protected]) Abstract Dual specificity phosphatases (DUSPs) have a well-known role as regulators of the immune response through the modulation of mitogen activated protein kinases (MAPKs). Yet the precise interplay between the various members of the DUSP family with protein kinases is not well understood. Recent multi-omics studies characterizing the transcriptomes and proteomes of immune cells have provided snapshots of molecular mechanisms underlying innate immune response in unprecedented detail. In this study, we focused on deciphering the interplay between members of the DUSP family with protein kinases in immune cells using publicly available omics datasets. Our analysis resulted in the identification of potential DUSP- mediated hub proteins including MAPK7, MAPK8, AURKA, and IGF1R. Furthermore, we analyzed the association of DUSP expression with TLR4 signaling and identified VEGF, FGFR and SCF-KIT pathway modules to be regulated by the activation of TLR4 signaling.
    [Show full text]
  • Predict AID Targeting in Non-Ig Genes Multiple Transcription Factor
    Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021 is online at: average * The Journal of Immunology published online 20 March 2013 from submission to initial decision 4 weeks from acceptance to publication Multiple Transcription Factor Binding Sites Predict AID Targeting in Non-Ig Genes Jamie L. Duke, Man Liu, Gur Yaari, Ashraf M. Khalil, Mary M. Tomayko, Mark J. Shlomchik, David G. Schatz and Steven H. Kleinstein J Immunol http://www.jimmunol.org/content/early/2013/03/20/jimmun ol.1202547 Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2013/03/20/jimmunol.120254 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 26, 2021. Published March 20, 2013, doi:10.4049/jimmunol.1202547 The Journal of Immunology Multiple Transcription Factor Binding Sites Predict AID Targeting in Non-Ig Genes Jamie L. Duke,* Man Liu,†,1 Gur Yaari,‡ Ashraf M. Khalil,x Mary M. Tomayko,{ Mark J. Shlomchik,†,x David G.
    [Show full text]
  • Using Regulatory Genomics Data to Interpret the Function of Disease Variants and Prioritise Genes from Expression Studies[Versio
    F1000Research 2018, 7:121 Last updated: 04 OCT 2021 METHOD ARTICLE Using regulatory genomics data to interpret the function of disease variants and prioritise genes from expression studies [version 2; peer review: 2 approved] Enrico Ferrero Computational Biology, GSK, Medicines Research Centre, Stevenage, SG1 2NY, UK v2 First published: 29 Jan 2018, 7:121 Open Peer Review https://doi.org/10.12688/f1000research.13577.1 Latest published: 23 Feb 2018, 7:121 https://doi.org/10.12688/f1000research.13577.2 Reviewer Status Invited Reviewers Abstract The identification of therapeutic targets is a critical step in the 1 2 research and developement of new drugs, with several drug discovery programmes failing because of a weak linkage between target and version 2 disease. (revision) report Genome-wide association studies and large-scale gene expression 23 Feb 2018 experiments are providing insights into the biology of several common diseases, but the complexity of transcriptional regulation version 1 mechanisms often limits our understanding of how genetic variation 29 Jan 2018 report report can influence changes in gene expression. Several initiatives in the field of regulatory genomics are aiming to close this gap by systematically identifying and cataloguing regulatory elements such 1. Aaron T. L. Lun , University of Cambridge, as promoters and enhacers across different tissues and cell types. Cambridge, UK In this Bioconductor workflow, we will explore how different types of regulatory genomic data can be used for the functional interpretation 2. Vincent J. Carey , Brigham and Women's of disease-associated variants and for the prioritisation of gene lists Hospital and Harvard Medical School, Boston, from gene expression experiments.
    [Show full text]