DOCSLIB.ORG

Tracing the Origin and Evolution of Pseudokinases Across the Tree of Life

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tracing the Origin and Evolution of Pseudokinases Across the Tree of Life SCIENCE SIGNALING | RESEARCH RESOURCE BIOCHEMISTRY Copyright © 2019 The Authors, some rights reserved; Tracing the origin and evolution of pseudokinases exclusive licensee American Association AQ1 across the tree of life for the Advancement Annie Kwon1,2, Steven Scott2,3, Rahil Taujale1,2, Wayland Yeung1,2, Krys J. Kochut4, of Science. No claim 5 1,2 to original U.S. AQ2 Patrick A. Eyers , Natarajan Kannan * Government Works AQ4 Protein phosphorylation by eukaryotic protein kinases (ePKs) represents a fundamental mechanism of cell signaling in all organisms. In model vertebrates, ~10% of ePKs are classified as pseudokinases, which have amino acid changes within the catalytic machinery of the kinase domain that distinguish them from their canonical kinase counterparts. However, pseudokinases still regulate various signaling pathways, usually doing so in the absence of their own catalytic output. To investigate the prevalence, evolutionary relationships, and biological diversity of these pseudo- enzymes, we performed a comprehensive analysis of putative pseudokinase sequences in available eukaryotic, bac- terial, and archaeal proteomes. We found that pseudokinases are present across all domains of life, and we classified nearly 30,000 eukaryotic, 1500 bacterial, and 20 archaeal pseudokinase sequences into 86 pseudokinase families, including ~30 families that were previously unknown. We uncovered a rich variety of pseudokinases with notable expansions not only in animals but also in plants, fungi, and bacteria, where pseudokinases have previously received cursory attention. These expansions are accompanied by domain shuffling, which suggests roles for pseudo- kinases in plant innate immunity, plant-fungal interactions, and bacterial signaling. Mechanistically, the ancestral kinase fold has diverged in many distinct ways through the enrichment of unique sequence motifs to generate AQ5 new families of pseudokinases in which the kinase domain is repurposed for noncanonical nucleotide binding or to stabilize unique, inactive kinase conformations. We further provide a collection of annotated pseudokinase se- quences in the Protein Kinase Ontology (ProKinO) as a new mineable resource for the signaling community. INTRODUCTION Protein pseudokinases represent the best understood members Protein phosphorylation catalyzed by eukaryotic protein kinases of the growing classes of pseudoenzymes, which include pseudo- AQ6 (ePKs) controls multiple aspects of prokaryotic- and eukaryotic- phosphatases (31) and pseudoproteases (32), both of which are also based cell signaling (1, 2), and its dysregulation contributes to many predicted to have lost canonical catalytic function but nonetheless major diseases. The conserved architecture of the ePK domain is perform critical non-enzymatic roles (9, 20, 33, 34). By definition, very well understood from both structural (3–5) and biochemical pseudokinases lack canonical phosphotransferase activity, and they (6–8) perspectives, and the versatility of the kinase fold has been can be predicted bioinformatically by identifying sequences that exploited many times during evolution to impart mechanistic con- lack at least one key amino acid normally required for metal and trol over diverse cell signaling processes (9, 10). A vast amount of adenosine triphosphate (ATP) binding and for catalysis (3, 7, 8, 18–20). AQ7 genomic and proteomic datasets can now be mined to map the Prominent catalytic motifs include the “catalytic triad” residues, evolution of kinases and their associated signaling pathways composed of the ATP-binding b3-lysine, the catalytic aspartate across multiple species (11–17). In this context, some 10% of model within the catalytic loop His-Arg-Asp-X-X-X-X-Gln (HRDXXXXN) vertebrate ePKs contain amino acid changes at specific positions motif, and the metal-binding aspartate of the activation loop Asp- that are predicted to lead to catalytic inactivation, which led to the Phe-Gly (DFG) motif. Some examples of human pseudokinases coining of the term “pseudokinase” (5, 15, 18–21). A number of with variations at these catalytic triad residues are summarized in well-studied pseudokinases are thought to play central roles in Table 1. Loss of these canonical residues does not always abolish T1 signaling despite impaired catalytic function (22–26), for exam- nucleotide binding or phosphoryl transfer, and in some cases, residual ple, through allosteric modulation of other active kinases or the kinase activity or ATP binding may fulfill a unique functional role. transduction of cellular signals via dynamic scaffolding functions However, we still define these catalytically competent proteins as (9, 19, 21, 27–30). However, whether pseudokinases have evolved to pseudokinases, in recognition of their noncanonical amino acid control fundamental aspects of signaling across all organisms has composition. For example, in the human epidermal growth factor never been scrutinized in depth, and much remains to be under- receptor (EGFR)–related receptor pseudokinase HER3, where the AQ8 stood about the origin of pseudokinases and how they became catalytic triad is conserved except for the substitution of the catalytic embedded in signaling networks during prokaryotic and eukaryotic HRD-aspartate for asparagine, low amounts of catalytic activity AQ9 evolution. support HER3 trans-autophosphorylation in vitro, although this vestigial activity is insufficient for phosphorylation of exogenous substrates in cells (22, 35, 36). In other cases, degenerated catalytic 1Institute of Bioinformatics, University of Georgia, Athens, GA 30602, USA. 2Depart- residues can be compensated by similar amino acids found else- ment of Biochemistry and Molecular Biology, University of Georgia, Athens, GA where in the active site to rescue catalytic function. This is best illustrated 3 30602, USA. Department of Genetics, University of Georgia, Athens, GA 30602, by the with-no-lysine kinases (WNKs), which lack the canonical AQ10 USA. 4Department of Computer Science, University of Georgia, Athens, GA 30602, 5 b3-lysine but maintain ATP binding and catalytic activity via a USA. Department of Biochemistry, Institute of Integrative Biology, University of AQ3 Liverpool, Liverpool L69 7ZB, UK. conserved compensatory lysine in the glycine-rich loop (37–39). *Corresponding author. Email: [email protected] Less predictably, pseudokinases contain coevolving amino acids Kwon et al., Sci. Signal. 12, eaav3810 (2019) 23 April 2019 1 of 19 MS no: RSaav3810/SA/BIOCHEM SCIENCE SIGNALING | RESEARCH RESOURCE AQ16 to simple eukaryotes, fungi, plants, and vertebrates. On the basis of AQ65AQ66 Table 1. Examples of human pseudokinases. Degraded catalytic triad the well-understood catalytic machinery in canonical ePKs (6), we residues and the amino acids that replace them in each pseudokinase are find that ePK-like pseudokinase sequences can even be detected in noted. ILK, integrin-linked kinase; VRK, vaccinia-related kinase. some archaeal and bacterial proteomes, although they are much Degraded catalytic Human pseudokinase Observed residue(s) rarer than in eukaryotic proteomes, where they appear to be ubiqui- residue(s) tous. Corroborating previous kinome studies, we also find that the KSR1, KSR2 K R number of pseudokinases remains relatively constant among verte- WNK1, WNK2, WNK3, WNK4 K C brates and correlates with the relative size of the kinome. Our broad HER3 HRD-D N analysis permits us to establish that ~10% of ePK members should be classified as pseudokinases in swathes of vertebrate animal spe- JAK1 (domain2) HRD-D N cies. In several phyla, specific pseudokinase expansions linked to JAK2 (domain2) HRD-D N lifestyle are observed within the different kinase families, whose ILK HRD-D A shared sequence signatures and domain structures permit specific TRIB3 DFG-D N functions to be deciphered. In particular, we note the expansions of TRIB2 DFG-D S interleukin-1 receptor–associated kinase (IRAK)–like pseudokinases in plants, increases of tyrosine kinase–like (TKL) pseudokinases in CASK DFG-D G fungi, and a diversified family of protein kinase B (PknB) pseudo- AQ17 GCN2 (domain2) K, HRD-D Y, V kinases in bacteria. Most pseudokinases exhibit lineage-specific ULK4 K, DFG-D L, N sequence variations that might facilitate previously unknown modes VRK3 HRD-D, DFG-D N, G of ATP binding, unusual catalytic outputs, and/or allosteric cou- MLKL HRD-D, DFG-D K, G pling between distal protein binding and regulatory sites. Hence, pseudokinases cannot be remnants of evolution but must instead STRADB (STLK6) HRD-D, DFG-D S, G operate as fundamental, and function-specific, signaling proteins EphB6 K, HRD-D, DFG-D Q, S, R across organisms covering some 4 billion years of evolution. Our SCYL1, SCYL2, SCYL3 K, HRD-D, DFG-D F, N, G analysis includes a minable, comprehensive classification of pseu- NRBP1, NRBP2 K, HRD-D, DFG-D N, N, S dokinase sequences from diverse organisms, providing a conceptual starting point for future hypothesis-driven characterization of pseudo- kinase signaling from bacteria to humans. that are far removed from the active site and contribute critical non- catalytic signaling roles, as described recently for the Tribbles (TRIB) family of pseudokinases, where a coevolved C-terminal tail docking RESULTS site in the pseudokinase domain negatively regulates binding of the Identification of pseudokinomes across the domains of life AQ11AQ12E3 ubiquitin–protein ligase COP1 (26, 40–42). Last, amino acid To detect the prevalence of pseudokinases across the domains of
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Inhibiting TRK Proteins in Clinical Cancer Therapy
    cancers Review Inhibiting TRK Proteins in Clinical Cancer Therapy Allison M. Lange 1 and Hui-Wen Lo 1,2,* 1 Department of Cancer Biology, Wake Forest University School of Medicine, Winston-Salem, NC 27157, USA; [email protected] 2 Comprehensive Cancer Center, Wake Forest University School of Medicine, Winston-Salem, NC 27157, USA * Correspondence: [email protected] Received: 25 February 2018; Accepted: 29 March 2018; Published: 4 April 2018 Abstract: Gene rearrangements resulting in the aberrant activity of tyrosine kinases have been identified as drivers of oncogenesis in a variety of cancers. The tropomyosin receptor kinase (TRK) family of tyrosine receptor kinases is emerging as an important target for cancer therapeutics. The TRK family contains three members, TRKA, TRKB, and TRKC, and these proteins are encoded by the genes NTRK1, NTRK2, and NTRK3, respectively. To activate TRK receptors, neurotrophins bind to the extracellular region stimulating dimerization, phosphorylation, and activation of downstream signaling pathways. Major known downstream pathways include RAS/MAPK/ERK, PLCγ, and PI3K/Akt. While being rare in most cancers, TRK fusions with other proteins have been well-established as oncogenic events in specific malignancies, including glioblastoma, papillary thyroid carcinoma, and secretory breast carcinomas. TRK protein amplification as well as alternative splicing events have also been described as contributors to cancer pathogenesis. For patients harboring alterations in TRK expression or activity, TRK inhibition emerges as an important therapeutic target. To date, multiple trials testing TRK-inhibiting compounds in various cancers are underway. In this review, we will summarize the current therapeutic trials for neoplasms involving NTKR gene alterations, as well as the promises and setbacks that are associated with targeting gene fusions.
    [Show full text]
  • Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability
    The Journal of Neuroscience, March 7, 2018 • 38(10):2615–2630 • 2615 Neurobiology of Disease Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability Emin Kuliyev,1 Sebastien Gingras,4 XClifford S. Guy,1 Sherie Howell,2 Peter Vogel,3 and XStephane Pelletier1 1Departments of Immunology, 2Pathology, 3Veterinary Pathology Core, Advanced Histology Core, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, and 4Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213 Members of the SCY1-like (SCYL) family of protein kinases are evolutionarily conserved and ubiquitously expressed proteins character- ized by an N-terminal pseudokinase domain, centrally located Huntingtin, elongation factor 3, protein phosphatase 2A, yeast kinase TOR1 repeats, and an overall disorganized C-terminal segment. In mammals, three family members encoded by genes Scyl1, Scyl2, and Scyl3 have been described. Studies have pointed to a role for SCYL1 and SCYL2 in regulating neuronal function and viability in mice and humans, but little is known about the biological function of SCYL3. Here, we show that the biochemical and cell biological properties of SCYL3aresimilartothoseofSCYL1andbothproteinsworkinconjunctiontomaintainmotorneuronviability.Specifically,althoughlack of Scyl3 in mice has no apparent effect on embryogenesis and postnatal life, it accelerates the onset of the motor neuron disorder caused by Scyl1 deficiency. Growth abnormalities, motor dysfunction, hindlimb paralysis, muscle wasting, neurogenic atrophy, motor neuron degeneration, and loss of large-caliber axons in peripheral nerves occurred at an earlier age in Scyl1/Scyl3 double-deficient mice than in Scyl1-deficientmice.DiseaseonsetalsocorrelatedwiththemislocalizationofTDP-43inspinalmotorneurons,suggestingthatSCYL1and SCYL3 regulate TDP-43 proteostasis. Together, our results demonstrate an overlapping role for SCYL1 and SCYL3 in vivo and highlight the importance the SCYL family of proteins in regulating neuronal function and survival.
    [Show full text]
  • Recount Brain Example with Data from SRP027383
    recount_brain example with data from SRP027383 true Abstract This is an example on how to use recount_brain applied to the SRP027383 study. We show how to download data from recount2, add the sample metadata from recount_brain, explore the sample metadata and the gene expression data, and perform a gene expression analysis. Introduction This document is an example of how you can use recount_brain. We will use the data from the SRA study SRP027383 which is described in “RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas” (Bao, Chen, Yang, Zhang, et al., 2014). As you can see in Figure @ref(fig:runselector) a lot of the metadata for these samples is missing from the SRA Run Selector which makes it a great case for using recount_brain. We will show how to add the recount_brain metadata and perform a gene differential expression analysis using this information. Sample metadata Just like any study in recount2 (Collado-Torres, Nellore, Kammers, Ellis, et al., 2017), we first need to download the gene count data using recount::download_study(). Since we will be using many functions from the recount package, lets load it first1. ## Load the package library('recount') Download gene data Having loaded the package, we next download the gene-level data. if(!file.exists(file.path('SRP027383', 'rse_gene.Rdata'))) { download_study('SRP027383') } load(file.path('SRP027383', 'rse_gene.Rdata'), verbose = TRUE) ## Loading objects: ## rse_gene 1If you are a first time recount user, we recommend first reading the package vignette at bioconductor.org/packages/recount. 1 Figure 1: SRA Run Selector information for study SRP027383.
    [Show full text]
  • Pseudokinases-Remnants of Evolution Or Key Allosteric Regulators? Elton Zeqiraj1,2 and Daan MF Van Aalten3
    Available online at www.sciencedirect.com Pseudokinases-remnants of evolution or key allosteric regulators? Elton Zeqiraj1,2 and Daan MF van Aalten3 Protein kinases provide a platform for the integration of signal for catalytic activity [3,4,5,6,7,8,9](Figure 1a and b). transduction networks. A key feature of transmitting these These comprise residues that are required for nucleotide cellular signals is the ability of protein kinases to activate one (ATP) binding, metal ion (Mg2+) binding and residues another by phosphorylation. A number of kinases are required for phosphoryl group transfer. There are 518 predicted by sequence homology to be incapable of known human protein kinases [10], representing phosphoryl group transfer due to degradation of their approximately 2–2.5% of the estimated total number of catalytic motifs. These are termed pseudokinases and genes in the human genome [11] and the third most because of the assumed lack of phosphoryltransfer activity common functional domain [12]. Intriguingly, 10% of their biological role in cellular transduction has been the kinome appear to lack at least one of the motifs mysterious. Recent structure–function studies have required for catalysis and have been termed pseudoki- uncovered the molecular determinants for protein kinase nases [10,13]. inactivity and have shed light to the biological functions and evolution of this enigmatic subset of the human kinome. Inactive pseudokinases or simply unusual Pseudokinases act as signal transducers by bringing together active kinases? components of signalling networks, as well as allosteric The subject of pseudokinases has generated much atten- activators of active protein kinases. tion recently [14–17] and remains controversial.
    [Show full text]
  • Long Non-Coding RNA Landscape in Prostate Cancer Molecular Subtypes: a Feature Selection Approach
    International Journal of Molecular Sciences Article Long Non-Coding RNA Landscape in Prostate Cancer Molecular Subtypes: A Feature Selection Approach Simona De Summa 1,* , Antonio Palazzo 2 , Mariapia Caputo 1, Rosa Maria Iacobazzi 3 , Brunella Pilato 1, Letizia Porcelli 3, Stefania Tommasi 1 , Angelo Virgilio Paradiso 4,† and Amalia Azzariti 3,† 1 Molecular Diagnostics and Pharmacogenetics Unit, IRCCS IstitutoTumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] (M.C.); [email protected] (B.P.); [email protected] (S.T.) 2 Laboratory of Nanotechnology, IRCCS IstitutoTumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] 3 Laboratory of Experimental Pharmacology, IRCCS Istituto Tumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] (R.M.I.); [email protected] (L.P.); [email protected] (A.A.) 4 Scientific Directorate, IRCCS Istituto Tumori Giovanni Paolo II, 70124 Bari, Italy; [email protected] * Correspondence: [email protected] † Co-senior authors. Abstract: Prostate cancer is one of the most common malignancies in men. It is characterized by a high molecular genomic heterogeneity and, thus, molecular subtypes, that, to date, have not been used in clinical practice. In the present paper, we aimed to better stratify prostate cancer patients through the selection of robust long non-coding RNAs. To fulfill the purpose of the study, a bioinformatic approach focused on feature selection applied to a TCGA dataset was used. In such a way, LINC00668 and long non-coding(lnc)-SAYSD1-1, able to discriminate ERG/not-ERG subtypes, Citation: De Summa, S.; Palazzo, A.; were demonstrated to be positive prognostic biomarkers in ERG-positive patients.
    [Show full text]
  • Pseudokinases-Remnants of Evolution Or Key Allosteric Regulators? Elton Zeqiraj1,2 and Daan MF Van Aalten3
    Author's personal copy Available online at www.sciencedirect.com Pseudokinases-remnants of evolution or key allosteric regulators? Elton Zeqiraj1,2 and Daan MF van Aalten3 Protein kinases provide a platform for the integration of signal for catalytic activity [3,4,5,6,7,8,9](Figure 1a and b). transduction networks. A key feature of transmitting these These comprise residues that are required for nucleotide cellular signals is the ability of protein kinases to activate one (ATP) binding, metal ion (Mg2+) binding and residues another by phosphorylation. A number of kinases are required for phosphoryl group transfer. There are 518 predicted by sequence homology to be incapable of known human protein kinases [10], representing phosphoryl group transfer due to degradation of their approximately 2–2.5% of the estimated total number of catalytic motifs. These are termed pseudokinases and genes in the human genome [11] and the third most because of the assumed lack of phosphoryltransfer activity common functional domain [12]. Intriguingly, 10% of their biological role in cellular transduction has been the kinome appear to lack at least one of the motifs mysterious. Recent structure–function studies have required for catalysis and have been termed pseudoki- uncovered the molecular determinants for protein kinase nases [10,13]. inactivity and have shed light to the biological functions and evolution of this enigmatic subset of the human kinome. Inactive pseudokinases or simply unusual Pseudokinases act as signal transducers by bringing together active kinases? components of signalling networks, as well as allosteric The subject of pseudokinases has generated much atten- activators of active protein kinases.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • The Tritryp Phosphatome: Analysis of the Protein Phosphatase Catalytic
    BMC Genomics BioMed Central Research article Open Access The TriTryp Phosphatome: analysis of the protein phosphatase catalytic domains Rachel Brenchley1,2, Humera Tariq1, Helen McElhinney3, Balázs Szö?r3, Julie Huxley-Jones4, Robert Stevens2, Keith Matthews3 and Lydia Tabernero*1 Address: 1Faculty of Life Sciences, Michael Smith, University of Manchester, M13 9PT, UK, 2Computer Science, University of Manchester, M13 9PT, UK, 3Institute of Immunology and Infection Research, University of Edinburgh, EH9 3JT, UK and 4GlaxoSmithKline Pharmaceuticals, Essex, CM19 5AW, UK Email: Rachel Brenchley ? [email protected]; Humera Tariq ? [email protected]; Helen McElhinney ? [email protected]; Balázs Szö?r ? [email protected]; Julie Huxley-Jones ? [email protected]; Robert Stevens ? [email protected]; Keith Matthews ? [email protected]; Lydia Tabernero* ? [email protected] * Corresponding author Published: 26 November 2007 Received: 21 August 2007 Accepted: 26 November 2007 BMC Genomics 2007, 8:434 doi:10.1186/1471-2164-8-434 This article is available from: http://www.biomedcentral.com/1471-2164/8/434 © 2007 Brenchley et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The genomes of the three parasitic protozoa Trypanosoma cruzi, Trypanosoma brucei and Leishmania major are the main subject of this study. These parasites are responsible for devastating human diseases known as Chagas disease, African sleeping sickness and cutaneous Leishmaniasis, respectively, that affect millions of people in the developing world.
    [Show full text]
  • WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/19 (2006.01) C12Q 1/02 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/81 (2006.01) C07K 14/47 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, PCT/US20 15/049674 MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (22) International Filing Date: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 11 September 2015 ( 11.09.201 5) SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, 62/050,045 12 September 2014 (12.09.2014) US TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (71) Applicant: WHITEHEAD INSTITUTE FOR BIOMED¬ DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, ICAL RESEARCH [US/US]; Nine Cambridge Center, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Cambridge, Massachusetts 02142-1479 (US).
    [Show full text]
  • Dual Specificity Phosphatases from Molecular Mechanisms to Biological Function
    International Journal of Molecular Sciences Dual Specificity Phosphatases From Molecular Mechanisms to Biological Function Edited by Rafael Pulido and Roland Lang Printed Edition of the Special Issue Published in International Journal of Molecular Sciences www.mdpi.com/journal/ijms Dual Specificity Phosphatases Dual Specificity Phosphatases From Molecular Mechanisms to Biological Function Special Issue Editors Rafael Pulido Roland Lang MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade Special Issue Editors Rafael Pulido Roland Lang Biocruces Health Research Institute University Hospital Erlangen Spain Germany Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal International Journal of Molecular Sciences (ISSN 1422-0067) from 2018 to 2019 (available at: https: //www.mdpi.com/journal/ijms/special issues/DUSPs). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number, Page Range. ISBN 978-3-03921-688-8 (Pbk) ISBN 978-3-03921-689-5 (PDF) c 2019 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons license CC BY-NC-ND. Contents About the Special Issue Editors ....................................
    [Show full text]
  • The Evolving Roles of Tribbles Pseudokinases In
    1 Tribbles in the 21st Century: The evolving roles of Tribbles pseudokinases in 2 biology and disease 3 Patrick A Eyers1* Karen Keeshan2* and Natarajan Kannan3* 4 1 Department of Biochemistry, Institute of Integrative Biology, University of Liverpool, 5 Liverpool L69 7ZB, UK 6 2 Paul O’ Gorman Leukemia Research Centre, Institute of Cancer Sciences, College of 7 Medical, Veterinary and Life Sciences, University of Glasgow, UK 8 3 Institute of Bioinformatics, University of Georgia, Athens, GA 30602 and Department of 9 Biochemistry and Molecular Biology, University of Georgia, Athens, USA 10 11 12 Co-Corresponding authors: 13 *Patrick Eyers ([email protected]) 14 *Natarajan Kannan ([email protected]) 15 *Karen Keeshan ([email protected]) 16 17 18 1 19 Abstract 20 The Tribbles pseudokinases control multiple aspects of eukaryotic cell biology 21 and evolved unique features distinguishing them from all other protein kinases. The 22 atypical pseudokinase domain retains a regulated binding platform for substrates, which 23 are ubiquitinated by context-specific E3 ligases. This plastic configuration has also been 24 exploited as a scaffold to support modulation of canonical MAPK and AKT modules. In 25 this review, we discuss evolution of TRIBs and their roles in vertebrate cell biology. 26 TRIB2 is the most ancestral member of the family, whereas the explosive emergence of 27 TRIB3 homologs in mammals supports additional biological roles, many of which are 28 currently being dissected. Given their pleiotropic role in diseases, the unusual TRIB 29 pseudokinase conformation provides a highly attractive opportunity for drug design. 30 31 Keywords: Tribbles, Trb, TRIB, TRIB1, TRIB2, TRIB3, pseudokinase, signaling, cancer, 32 evolution, ubiquitin, E3 ligase 33 Conflicts of Interest: No conflicts of interest are declared by the authors.
    [Show full text]