UNIVERSITY of CALIFORNIA RIVERSIDE Control

UNIVERSITY OF CALIFORNIA RIVERSIDE

Control of Cyst Burden in the Brain During Chronic Toxoplasma gondii Infection

A Dissertation submitted in partial satisfaction of the requirements for the degree of

Doctor of Philosophy

Cell, Molecular, and Developmental Biology

John Philip Nance Jr.

June 2012

Dissertation Committee:

Dr. Emma H. Wilson, Chairperson Dr. Monica J. Carson Dr. Neal L. Schiller

The Dissertation of John Philip Nance Jr. is approved:

______

Committee Chairperson

University of California, Riverside

ACKNOWLEDGEMENTS

My deepest appreciation and respect go to my advisor Dr. Emma Wilson for all of the direction, advice, and freedom to pursue this project over the last four years. She has encouraged me from the beginning to present my research to my peers at UCR and at various conferences and this has produced multiple collaborations that my research and development as a scientist have benefited from. I could not imagine a better mentor both personally and professionally and I will always be grateful to her for this training opportunity.

I am thankful to Dr. Neal Schiller for providing me with my first rotation here at

UCR and generously providing me with knowledge and advice as a committee member throughout my graduate career. I will always be grateful to Dr. Monica Carson for serving as a committee member and mentor to me for the past four years. Dr. Carson has constantly expected the best from me and I have greatly benefitted from her knowledge, honesty, advice, and humor.

I wish to thank my labmates, Shahani Noor, Clement David, and Kathryn

McGovern for all of the help, support, and fun over the years. One could not ask for a better group of colleagues to work with on a daily basis.

None of this would have been possible without the support, encouragement, and love from my family. To Aimee, Jessica, and Emma: Words cannot express my gratitude for your sacrifice. I love and appreciate you more than you can imagine!

DEDICATION

My Wife,

Aimee

ABSTRACT OF THE DISSERTATION

Control of Cyst Burden in the Brain During Chronic Toxoplasma gondii Infection

John Philip Nance Jr.

Doctor of Philosophy, Graduate Program in Cell, Molecular and Developmental Biology University of California, Riverside, June 2012 Dr. Emma H. Wilson, Chairperson

As an immune-privileged site, the brain represents a particularly challenging area when it comes to controlling infection and inflammation. Toxoplasma gondii provides us with a model of a chronic infection in the CNS that represents an efficient and balanced response from the healthy immune system. The effector functions of immune cells coupled with the ability to effectively migrate to and within the brain to sites of infection is essential in controlling the replication of the parasite in the brain. Impairment of this immune response results in parasite reactivation and fatal encephalitis, as seen in AIDS patients. Immune-compromised patients are currently subject to lifelong drug therapies that do not result in cyst clearance, presenting a constant danger of reactivation.

Therefore, the identification of new mechanisms of cyst control is particularly important as it may lead to new and effective therapies. This dissertation examines two novel mechanisms of parasite control in the CNS during chronic infection.

Previously published data has shown that a reticular network of fibers is present in Toxoplasma infected brains and absent in naïve brains which T cells migrate along.

SPARC (secreted protein acidic and rich in cysteine) is a multifunctional glycoprotein that has been shown to be involved in the production and maintenance of similar fiber networks. Here, data will be presented demonstrating upregulation of SPARC in the brain following infection and association of this molecule with a seminal fibrous network in the CNS as well as with cysts and migrating cells. Furthermore, a requirement for

SPARC in protective immunity and matrix assembly will be demonstrated in vivo, using infection studies with SPARC-null mice and live imaging in the brain.

The exact mechanisms and cells involved in the clearance and control of cysts from the brain remain poorly defined. Data presented here will demonstrate the presence of a population of alternatively activated macrophages (AAMϕ) in the infected brain that maintain control of the cyst burden through the secretion of the chitolytic enzyme, acidic mammalian chitinase (AMCase). This mechanism is demonstrated in vitro by both chemical and genetic inhibition of the enzyme and the requirement for protective immunity is shown through infection of AMCase-null mice.

These mechanisms of parasite control during chronic T. gondii infection represent two novel areas of study that provide hopeful therapeutic targets in combating this chronic infection.

vii

TABLE OF CONTENTS

List of Figures...... ix

Chapter One Introduction

1.1 Background...... 2 1.2 Materials and Methods...... 15 1.3 Figures and Legends ...... 24

Chapter Two SPARC is Required for Efficient Cell Migration and Protective Immunity in the CNS During Chronic T. gondii Infection

2.1 Abstract...... 35 2.2 Introduction...... 36 2.3 Results...... 40 2.4 Discussion...... 51 2.5 Figures and Legends ...... 56

Chapter Three Macrophage-derived Acidic Mammalian Chitinase is Required to Control Cyst Burden in the Brain During Chronic T. gondii Infection

3.1 Abstract...... 67 3.2 Introduction...... 68 3.3 Results...... 71 3.4 Discussion...... 85 3.5 Figures and Legends ...... 90

Chapter Four Conclusions and Perspectives...... 108

Reference ...... 112

viii

LIST OF FIGURES

Figure 1-1 Worldwide seroprevalence of the parasite Toxoplasma gondii...... 25

Figure 1-2 The life cycle of T. gondii...... 27

Figure 1-3 The protective immune response to T. gondii...... 29

Figure 1-4 The multifaceted role of the matricellular protein SPARC...... 31

Figure 1-5 Macrophage phenotype and function...... 33

Figure 2-1 Expression of SPARC in the CNS during chronic T. gondii infection...... 57

Figure 2-2 SPARC-null mice have no defect in cytokine production during acute T. gondii infection...... 59

Figure 2-3 SPARC-null mice have no defect in immune cell migration to the brain during chronic infection...... 61

Figure 2-4 SPARC-null mice have higher parasite burden in the brain and increased cellular accumulation in perivascular spaces...... 63

Figure 2-5 SPARC-null mice have compromised reticular fiber network in the brain during chronic T.gondii infection...... 65

Figure 3-1 Expression of CXCR3 and its ligands during chronic T. gondii infection.

...... 91

Figure 3-2 CXCR3 is required for efficient macrophage migration to the CNS during chronic infection...... 93

Figure 3-3 Alternatively activated macrophages in the brain during chronic T. gondii infection...... 95

Figure 3-4 Macrophages produce active chitinase in the CNS in response to the presence of cysts...... 97

Figure 3-5 Chitinase expressing AAMΦ are in close association with cysts in the

CNS...... 99

Figure 3-6 Macrophage chitinase is required to lyse cysts in vitro...... 101

Figure 3-7 Acidic mammalian chitinase is required to lyse cysts in vitro...... 103

Figure 3-8 AMCase-/- mice have a higher parasite burden in the brain and succumb to infection during the chronic stage of infection...... 105

Figure 3-9 Transcripts for tachyzoite, bradyzoite and cyst genes are increased in the brains of AMCase-null mice...... 107

CHAPTER ONE

Introduction

1 1.1 BACKGROUND

1.1.1 Introduction to Toxoplasma gondii

Toxoplasma gondii is an obligate intracellular protozoan parasite capable of infecting any nucleated cell in warm-blooded hosts. This parasite is considered to be one of the most successful protozoans, as it is able to persist in the brain of an immunocompetent host with very little pathology (Melo et al., 2011). T. gondii can infect any mammalian species and is one of the most common human infections in the world with up to 10-20% seroprevalence in the U.S. and up to 80% seroprevalence in parts of Europe and South America (Figure 1-1) (Pappas et al., 2009). As an apicomplexan parasite, T. gondii has a complex lifecycle that requires a definitive host for survival (Figure 1-2). Sexual reproduction of the parasite occurs only in the stomach of cats and results in the excretion of highly resistant oocysts that enter the food chain by contamination of soil and water (Dabritz et al., 2007). Once ingested, oocysts convert to fast-replicating tachyzoites, which are capable of invading any nucleated cell, thus causing a rapid systemic infection (Dubey, 1986). In the immune competent host, a robust immune response characterized by the production of IFN- γ by Th-1 cells effectively controls parasite replication, thus converting tachyzoites to slow replicating bradyzoites (Denkers and Gazzinelli, 1998). Bradyzoites can encyst in any type of tissue, but they are predominately found in the brain and will remain there for the life of the host resulting in a sustained chronic infection (Ferguson and Hutchison, 1987).

2 1.1.2 Disease and Immunity

As an opportunistic pathogen, T. gondii most commonly causes disease in immune deficient individuals. In addition, congenital Toxoplasmosis through maternal- fetal transmission remains one of the leading causes of congenital death and birth defects in the US (Cook, 1990). In the 1980s when the AIDS crisis started, we began to see large numbers of people with severe neurological disease resulting from the reactivation of T. gondii cysts in the brain (Luft et al., 1984). Treatment for TE usually consists of a regimen of sulfonamides coupled with pyrimethamine (Luft and Remington, 1992).

Although these drugs are effective in controlling tachyzoite replication, they are toxic and do not clear the chronic cyst form of the parasite, requiring life-long drug therapy. These patients and laboratory studies have shown us the importance of T cells and in particular, their production of IFN-γ in preventing the reactivation of cysts. This adaptive immune response is dependent on the innate production of IL-12 by macrophages and dendritic cells. Macrophages also directly inhibit parasite replication by phagocytosis and the production of reactive oxygen and nitrogen species as well as GTPases that have direct microbicidal effects on the parasite (Figure 1-3) (Gazzinelli et al., 1994; Nathan and

Shiloh, 2000; Scharton-Kersten et al., 1997). In addition to being an important source of proinflammatory cytokines and mediators, macrophages are also involved in limiting inflammation. Secretion of cytokines such as IL-10 by macrophages prevents the development of severe immunopathology during both acute and chronic stages of T. gondii infection (Drogemuller et al., 2008; Gazzinelli et al., 1996; Wilson et al., 2005).

CNS resident cells including microglia, astrocytes, and neurons have also been shown to

3 play a major protective role in immunity to T. gondii (Drogemuller et al., 2008; Hunter et al., 1993; Yap and Sher, 1999b). Microglia are the resident macrophage of the CNS and become highly activated following infection. Much like macrophages, microglia are also an important source of cytokines and microbicidal effector molecules (Chao et al., 1994;

Deckert-Schluter et al., 1999; Kang and Suzuki, 2001).

1.1.3 ECM and Cell Migration

The extracellular matrix (ECM) is a scaffold consisting of collagen and other associated proteins that serves to provide structural integrity to tissues (Bosman and

Stamenkovic, 2003). This dynamic and adaptive complex is continuously remodeled during development and in response to injury, inflammation and infection (Tsang et al.,

2009). In recent years, an understanding of the ECM has evolved from simply a structural scaffold, to a complex network of proteins that affect a multitude of cellular processes including, survival, migration, activation, signaling, and differentiation

(Sorokin, 2010). The structure and function of the ECM is regulated by a diverse array of matricellular proteins that modulate assembly, degradation, and maintenance as well as the physical properties of this structure (Chiodoni et al., 2010). This family of proteins, distinguished by their non-structural properties and the ability to regulate cell-matrix interactions, include thrombospondins (TSP), osteopontin (OPN), tenascin-C, CCNs, and

SPARC (Bornstein and Sage, 2002).

The ECM has also shown to be in important modulator migrating immune cells.

Leukocyte migration from the bloodstream to peripheral tissues is a tightly controlled

4 process that can be either beneficial or detrimental to the host. On one hand, the efficient migration of immune cells to the site of infection is critical in the control and/or clearance of an invading pathogen. Conversely, unchecked migration of leukocytes into tissues can result in tissue damage and other immune-related pathologies such as Crohn’s disease and multiple sclerosis (Mackay, 2008). The ECM is an important modulator of immune cell migration, providing both substrate and barrier for leukocytes (Sorokin, 2010). The endothelial basement membrane is composed of a cross-linked network of collagen IV and other glycoproteins that serves, in part, as a barrier between blood and tissue

(Nourshargh et al., 2010). Migration across this barrier is tightly regulated and requires a high degree of cross talk between the migrating immune cell, endothelial cells, endothelial junctions, basement membrane, chemokines and cytokines. The proper signals result in the arrest, adhesion and extravasation of the cell from the bloodstream into the tissue stroma (Vestweber, 2007). The mechanisms of leukocyte migration within tissues are less understood, however recent advances in intravital imaging have yielded some insight (Cahalan and Gutman, 2006). In the lymph node, there is a constitutive reticular network of chemokine-coated collagen conduits, which guide the migration of lymphocytes and dendritic cells (DC) and facilitate antigen presentation (Bajenoff et al.,

2007; Okada and Cyster, 2007). In tumors, cancer cells migrate along ECM fibers composed of long collagen fibrils (Condeelis and Segall, 2003). Preliminary studies following T. gondii infection have shown the existence of a substantial extracellular network not present in naïve mice (Wilson et al., 2009). This is revealed by second harmonic generation (SHG), a phenomenon during multi-photon microscopy that has

5 been ascribed to materials with first-order nonlinear susceptibility: highly ordered noncentrosymetric structures such as collagen. Importantly this is not a parasite specific event as we observe similar structures in the spinal cord during experimental autoimmune encephalomyelitis (EAE). In addition, following transfer of GFP+ T cells we observe that they closely associate and the majority seem to actively migrate along these fibers. At present we do not know the nature of this extracellular matrix but hypothesize that it plays a similar role to the organized structure found in the lymph node and could be an important aspect of maintaining inflammation at the site of infection.

1.1.4 SPARC and the ECM

SPARC, (secreted protein acidic rich in cysteine), is a highly conserved glycoprotein that is expressed during development and tissue remodeling (Bradshaw,

2009). SPARC is not a structural protein itself but has been shown to be an important regulator of ECM by modulating collagen assembly, signaling through integrins, and acting as an anti-adhesive (Figure 1-4) (Motamed and Sage, 1998; Murphy-Ullrich et al.,

1995). SPARC production can thus affect not only ECM assembly, but cell migration, proliferation, survival, and cytokine production. In tumors, SPARC has been associated with increased metastasis, including gliomas (Golembieski et al., 2008; Yunker et al.,

2008). Stabilin-1 is the only known receptor for SPARC and is expressed by alternatively activated macrophages and endothelial cells. This scavenger receptor regulates levels of

SPARC by endocytosis and degradation (Kzhyshkowska et al., 2006b). SPARC-null mice show increased clearance of mycobacteria due to poor granuloma formation,

6 increased dendritic cell migration and increased T cell priming (Sangaletti et al., 2005).

In addition, these molecules are secreted and therefore have the capacity to bind to the inflammatory-induced migratory network we see in the brain. SPARC has been shown to be produced by many cell types including fibroblasts, endothelial cells, vascular smooth muscles cells, astrocytes and macrophages (Brekken and Sage, 2001). In the developing

CNS, SPARC is produced by astrocytes during tissue remodeling in the retina and cerebellum (Vincent et al., 2008; Yan and Sage, 1999).

SPARC has been continuously associated with regulation of the ECM. Initially characterized as a bone-specific protein involved in binding mineral to type I collagen

(Termine et al., 1981), more recent studies have since revealed the ability of this protein to bind and interact with multiple components of the extracellular environment. Perhaps best characterized, is the Ca2+ -dependent binding of SPARC to collagen (Sasaki et al.,

1998). SPARC is able to bind multiple collagens, including fibrillar collagens I, II, III, and V, and basal lamina collagen IV. It interacts with collagen through its extracellular calcium-binding domain, the affinity of which is increased substantially through cleavage by matrix metalloproteases (MMP) at the binding cleft (Sasaki et al., 1997).

1.1.5 SPARC and Collagen assembly

SPARC plays an important role on the proper assembly and maintenance of both fibrillar collagens (I, II, III, V) as well as collagen IV in the basal lamina (Bradshaw,

2009). The coexpression of collagens and SPARC is observed in basement membranes during development as well as at sites of tissue remodeling and wound repair (Mason et

7 al., 1986; Reed et al., 1993). Additionally, SPARC-null mice compared to wild-type show significantly smaller collagen I fibrils resulting in decreased dermal tensile strength

(Bradshaw et al., 2003). These studies and others suggest that SPARC is necessary for the secretion and initial assembly of collagen, acting as a chaperone to regulate its proper folding and distribution (Martinek et al., 2007). However, recent evidence suggests that

SPARC may act as a molecular chaperone involved, instead, in the degradation of these complexes and the transport of ECM proteins into the cell (Chlenski et al., 2011). In this study, it is shown that at high extracellular concentrations of Ca2+, SPARC binds and mediates the disassembly of ECM and then shuttles it inside the cell, presumably through its receptor Stabilin-1 (Kzhyshkowska et al., 2006c). In the cytoplasm, lower Ca2+ concentrations trigger the release of the ECM product and SPARC is recycled back outside of the cell. Although this study appears to be in contrast with the reduced collagen deposition, early onset cataracts and osteopenia seen in SPARC-null mice

(Bradshaw et al., 2003; Delany et al., 2000; Norose et al., 1998), however, the authors postulate that this “scavenging” is necessary for the proper maintenance and remodeling of the ECM.

1.1.6 SPARC as an Anti-adhesive Molecule

SPARC has been consistently described as an anti-adhesive molecule, however the mechanism by which SPARC regulates cell adhesion is not fully understood. In vitro studies have shown that fibroblasts and endothelial cells treated with SPARC do not lose total adhesiveness, but retain a rounded shape and fail to spread (Lane and Sage, 1990;

8 Sage et al., 1989). This intermediate state of cell adhesion induced by SPARC is thought to be due to disruption of focal adhesions coupled with disregulation of actin fibers

(Bradshaw et al., 1999; Murphy-Ullrich et al., 1995). Fibronectin is an important structural and adhesive component of the ECM that is critical for efficient cell migration through its binding with integrins and is also involved in the formation of collagen fibrils

(George et al., 1993; Magnusson and Mosher, 1998). The site on collagen-I where

SPARC binds overlaps with binding sites for fibronectin as well as α1β1 integrins (Wang et al., 2005). Thus, SPARC is able to modulate cell migration by binding to the matrix as well as directly interacting with cell surface integrins.

1.1.7 SPARC and Cell Signaling

Matricellular proteins have the ability to modulate immune cell signals in multiple ways. This family of proteins can act as ligands and directly signal through cell surface receptors, modulate growth factor and cytokine activity, regulate the bioavailability of extracellular proteins, and regulate the activity of proteases such as MMPs (Bornstein and

Sage, 2002). Direct signaling occurs through interactions with specific surface receptors as well as engagement of integrins (Chiodoni et al., 2010). Integrins are known for their role in cellular adhesion, but are also involved in “outside-in” signaling, influencing an array of pathways important in immunity, including MAPK, JAK-STAT, NF-κB, and

TGF-β (Schwartz, 2001). Downstream effects of these pathways include production of cytokines, chemokines, and growth factors, all of which are modulated by matricellular protein expression (Llera et al., 2009).

9 The myriad role that SPARC plays in the regulation of leukocyte signaling can be partially attributed to its ability to interact with multiple binding partners (Brekken and

Sage, 2001). In addition to ECM components, SPARC’s binding targets include MMP2,

PDGF, VEGF, integrin β1, and stabilin-1 (Gilles et al., 1998; Kupprion et al., 1998;

Kzhyshkowska et al., 2006a; Nie et al., 2008; Raines et al., 1992). Consequently,

SPARC can influence a variety of immune signaling pathways such as NF-κB, TGF-β, and integrin-linked kinase (ILK) activity (Said et al., 2008; Schellings et al., 2009; Shi et al., 2007).

1.1.4 The role of Macrophages in Infection and Inflammation

Macrophages are involved in not only direct killing of the pathogen, but also wound repair, tissue homeostasis and secretion of cytokines that act as effectors for the subsequent adaptive immune response (Mosser and Edwards, 2008). In the model of classical macrophage activation (CAMϕ), production of IFN-γ by Th1 cells and NK cells activates macrophages to secrete potent microbicidal mediators that directly target intracellular pathogens (Dalton et al., 1993; Nathan and Shiloh, 2000). The production of nitric oxide has been shown to be essential for the control of such pathogens and is dependent on the metabolism of arginine by iNOS (MacMicking et al., 1997; Scharton-

Kersten et al., 1997). In the past decade, evidence has accumulated to support the idea that there are multiple macrophage phenotypes with varying functions that arise in response to different types of stimuli (Figure 1-5) (Mosser and Edwards, 2008). A regulatory macrophage (RMϕ) has been identified that functions to inhibit the

10 transcription of pro-inflammatory genes mainly through the production of IL-10 (Gerber and Mosser, 2001). This anti-inflammatory phenotype can be activated by the presence of immune complexes, apoptotic cells, and glucocorticoids and does not contribute to the production of the ECM. Alternatively activated macrophages (AAMϕ) were first characterized during helminth infection and are associated with the secretion of IL-4 and

IL-13 by Th2 cells (Loke et al., 2002; Stein et al., 1992; Wirth et al., 1989). These cytokines in combination with recognition of exogenous molecules such as chitin (Reese et al., 2007) induce an alternative phenotype involved in worm expulsion, control of inflammation and wound repair (Kreider et al., 2007). Chitin is common in insects, fungi and crustaceans, but is also a component of the T. gondii cyst wall (Boothroyd et al.,

1997). AA-MΦ are characterized by the expression of scavenger receptors such as mannose receptor and stabilin-1, both of which have been shown to be involved in the endocytosis and secretion of components of the ECM (Kzhyshkowska et al., 2006c;

Martinez-Pomares et al., 2006). These cells also produce arginase-1 (ARG1), an enzyme that competes with iNOS for arginine binding and thus inhibits NO production associated with CA-MΦ (Munder et al., 1998). Furthermore, ornathine, a product of arginine conversion by ARG1, is a precursor to proline, which is required for the synthesis of

ECM associated proteins such as collagen (Kreider et al., 2007).

1.1.5 Chitin and Chitinases

Chitin is an abundant polysaccharide found in the cell walls of fungi, the exoskeletons of crustaceans, and the sheaths of nematodes (Lee et al., 2011). The

11 purpose of this polymer is to provide structural support as well as environmental protection to these organisms. Chitin biosynthesis and degradation is regulated by a chitin synthases and chitinases, respectively, produced by these life forms. Although mammals do not produce chitin or chitin, synthases, chitin can be recognized and degraded in response to invasion by chitin-containing pathogens (Funkhouser and

Aronson, 2007). Indeed, mammals produce a variety of chitinase and chitinase-like proteins (CLP), which play a role in degradation of chitin as well as immune signaling

(Lee et al., 2011). True chitinases, such as acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1), contain a chitin-binding domain as well as an enzymatically active domain, which hydrolyzes β (1-4) linkages in chitin polymers (Boot et al., 2001; van Eijk et al., 2005). The family of CLPs, including BRP-39, YKL-39 and YM1, lack this enzymatically active domain, yet these proteins still play an important role in immune signaling processes (Bleau et al., 1999).

1.1.6 The Immune Response to Chitin

The presence of chitin has been shown to induce a potent immune response in mammals (Reese et al., 2007; Shibata et al., 2000; Shibata et al., 1997a; Shibata et al.,

1997b; Sohn et al., 2010). The exact nature of this immune response is varied, and is thought to be dependant on the size of the chitin particle as well as the presence of other antigens (Da Silva et al., 2009). The mechanisms of chitin recognition are poorly defined, however it has been suggested that this process involves pattern recognition by a combination of dectin-1, mannose receptor, and TLR-2 (Da Silva et al., 2009; Da Silva et

12 al., 2008). Indeed, the administration of small chitin particles (1-10µm) has been shown to induce the production of proinflammatory cytokines such as IL-12, TNF-α, and IL-18

(Shibata et al., 1997b). Furthermore, particles of this size inhibit Th2 immune responses and allergic hypersensitivity (Shibata et al., 2000). In contrast, the administration of chitin-coated beads induced the accumulation of IL-4 producing cells, including eosinophils, basophils, and AAMΦ in the lungs of treated mice (Reese et al., 2007).

These studies are in line with others that observe a high prevalence of asthma in workers that are chronically exposed to chitin (Desjardins et al., 1995). To examine the size- dependent role of chitin as an immune modulator in mice, Da Silva and colleagues administered chitin particles or beads of different sizes and observed the immune response (Da Silva et al., 2009). This study revealed that small chitin particles activated the NF-κB pathway through a combination of TLR-2, dectin-1, and mannose receptor ligation. Intermediate sized chitin particles only involved dectin-1 and TLR-2 recognition, and resulted in the production of both pro- and anti-inflammatory cytokines, depending on the route of administration. The presence of chitin-containing pathogens such as nematodes and fungi have also been shown to induce a robust immune response in the host (Muzzarelli, 1999; Nair et al., 2005; Satoh et al., 2010). The production of active chitinases by macrophages in response to the presence of chitin is thought to play a role in this immune response by breaking down the fungal cell wall or nematode sheaths and aid in the clearance of these pathogens (Boot et al., 2001; van Eijk et al., 2005). The role of chitolytic activity in protozoan infections is less clear. However, since chitin is a major component of the T. gondii cyst wall (Boothroyd et al., 1997; Coppin et al., 2003),

13 it is tempting to speculate that active chitinases have the potential to assist in the clearance or control of cysts during chronic infection.

1.1.7 Chronic infection in the CNS

Chronic Toxoplasma gondii infection in the brain represents a balanced “stand- off” resulting in relatively limited pathology from either the replicating parasite or the immune system of the healthy host (Yap and Sher, 1999a). This remarkable phenomenon that takes place in the delicate environment of the CNS, contributes to the extraordinary success of the parasite and provides us with an incredibly useful model in understanding chronic infection. The persistence of T. gondii in the CNS also poses a constant danger to its host of reactivation and severe disease in the event of immune deficiency, as seen in multiple cases involving AIDS patients (Luft and Remington, 1992). Immune deficient patients are subject to a lifetime regimen of sulfadiazine in combination with pyrimethamine, which commonly leads to adverse effects or even relapse (Fung and

Kirschenbaum, 1996). To date, no therapies have proven to be effective in clearing the parasite, thus understanding how the competent immune system is able to control the replicating parasite in the brain is of utmost importance. This dissertation describes two novel mechanisms of parasite control in the CNS. Using a variety of in vitro, in vivo, and advanced imaging techniques, new and distinct roles for the glycoprotein SPARC and the enzyme AMCase will be identified.

14 1.2 Materials and Methods

Mice and Parasites

T. gondii Pruigniund and RH strains were maintained in vitro as previously described

(Noor et al., 2010). Soluble Toxoplasma antigen (STAg) was prepared from RH strain tachyzoites as previously described (Sharma et al., 1983). The Me49 strain of T. gondii was maintained in infected Swiss Webster and CBA/CaJ mice. For infection, brains from infected mice were removed placed in 3ml sterile 1xPBS and passed 3 -5 times through an 18.5 gauge followed by 20.5 and 22.5 gauge needle. The number of cysts in a 30µl aliquot was determined microscopically. Brain suspensions were adjusted to 100 cysts/ml and mice were infected each with 20 cysts intraperitoneally. C57Bl/6, CBA/CaJ

(Jackson, Bar Harbor, ME) and Swiss Webster mice (Charles River, Wilmington, MA) were maintained in a pathogen free environment under IACUC established protocols at the University of California Riverside. SPARC-null (Jackson, Bar Harbor, ME) mice were backcrossed with C57Bl/6 mice for at least 9 generations. AMCase-null mice were generated by targeting exon 5 using loxP/CRE recombination as previously described

(Fitz et al., 2011). The AMCase gene deleted mice were of a mixed background,

C57BL/6NTac:129SvEvBrd, and were backcrossed to C57/BL6 for at least 10 generations. These mice were generated and maintained under IACUC protocols established by Pfizer.

15 Preparation of splenocyte, Lymph node, PECS and brain mononuclear cell (BMNCs) suspensions

A single cell suspension from spleens and lymph nodes was prepared by passing through a nylon 40µm cell strainer (BD, San Jose, CA). Suspensions were washed with RPMI complete (10% FCS, 1%Penicilin/Streptomycin, 1% Glutamine, 1% Sodium Pyruvate,

1% nonessential amino acids, 0.1% B-mercaptoethanol) (Life Technologies, Grand

Island, NY) and centrifuged for 5 minutes at 1200 RPM at 4°C. Red Blood Cells were lysed using 0.86% ammonium chloride solution, centrifuged and resuspended in RPMI complete. Peritoneal exudate cells (PECS) were harvested by injecting 3ml of sterile PBS into the peritoneal cavity, gently agitating the abdomen, and slowly drawing up the suspension with the syringe. BMNCs were prepared as previously described (Noor et al.,

2010).

Flow Cytometry

BMNCs or splenic cells were stained with various conjugated antibodies against CXCR3,

CD3, CD4, CD8, CD11b, CD11c, CD40, CD44, CD62L, Ly6c, Ly6g, MHCII, IL-10, and

CD45, (eBioscience, San Diego, CA), MMR (Biolegend, San Diego, CA), MHC I-Ova dextramer (Immudex, Denmark), and MHC II-toxo tetramer (NIH, Bethesda, MD). Cells were analyzed using the BD FACSCanto II flowcytometer (BD Biosciences, San Jose,

CA) and FlowJo analysis software v.8.7.3 (Treestar Software, Ashland, OR). Cell populations were determined by gating on CD4+, CD8+, CD45hi/CD11b+ (macrophages) and CD45int/CD11b+ (microglia) from live cell gate.

Quantitative Reverse transcription PCR (qRT-PCR)

Total RNA from brain tissue samples was extracted with TRIzol reagent (Life

Technologies, Grand Island, NY). DNase1 treatment and first strand cDNA synthesis was performed using cDNA synthesis kit (BioRad, Hercules, CA) according to the manufacturer’s instructions. SPARC, CXCR3, CXCL9, CXCL10, CCL2, CCL5,

AMCase, Arg1, and Chit1 specific primers for Real Time PCR were purchased from

IDT's primer Quest (http://www.idtdna.com/Scitools/ Applications/Primerquest/). Primer sequences were as follows: CXCR3, forward, 5′-TGTAGCCCTCACCTGCATAGTTGT-

3′; reverse, 5′-GTTGTACTGGCAATGGGTGGCATT-3′, CXCL9, forward, 5′-

TCAGATCTGGGCAAGTGTCCCTTT-3′; reverse, 5′-

TTTGGTGACGTGAGCCTCAGAAGT-3′, CXCL10, forward, 5′-

TGGCTAGTCCTAATTGCCCTTGGT-3′; reverse, 5′-

TCAGGACCATGGCTTGACCATCAT-3′, CCL2 forward, 5’-

TCACCTGCTGCTACTCATTCA-3’; reverse, 5’-TACAGCTTCTTTGGGACACCT-3’,

CCL5 forward, 5’-TCGTGCCCACGTCAAGGAGTA-3’; reverse, 5’-

TCTTCTCTGGGTTGGCACACA-3’, AMCase forward, 5’-

TTTCCACTTCTCAGAACCGCC-3’; reverse, 5’-TGTTGCTCTCAATAGCCTCCT-3’,

CHIT1 forward, 5’-AGTTCGGTTCTTTCCCAGGGA-3’; reverse, 5’-

GCTGATGGTTGTCCATTCCAG -3’, Arg1 forward, 5’-

TGGCTTTAACCTTGGCTTGCT-3’; reverse, 5’- AAAGAACAAGCCCTTGGGAGG-

3’, SAG1 forward, 5’- CGACAGCCGCGGTCATTCTC-3’; reverse, 5’-

17 GCAACCAGTCAGCGTCGTCC-3’, SAG4 forward, 5’-

CTGCTTTCGTCTGTCTTCAAC-3’; reverse, 5’-CTTCTTCACTGGCAATGAACTC-

3’, MAG1 forward, 5’-TGAGAACTCAGAGGACGTTGC-3’; reverse,

TCTGACTCAAGCTCGTCTGCT-3’, SPARC forward, 5’-

ATTAGGCTGTTGGTTCAAA-3’; reverse, 5’-AGCCCTGGTTCTCCAAAA-3’. Real- time PCR was performed using the iQ5 real-time PCR Detection System (Bio-Rad,

Hercules, CA) in total 25µl reaction mixture with 12.5µl SYBR Green qPCR Master Mix

(2x) (Bio-Rad, Hercules, CA) and 300nM primer. The reaction conditions were as follows: 10 min at 95°C, followed by 40 cycles of 15s at 95°C and 60s at 60°C. The

HPRT (Hypoxine Phosphoribosyl- Transferase) forward primer (5′-

CCCTCTGGTAGATTGTCGCTTA-3′) and reverse primer (5′-

AGATGCTGTTACTGATAGGAAATTGA -3′) were used as an endogenous control.

Quantified results represent the fold induction of target gene expression at different days post infection in comparison to the target gene expression in naïve cDNA samples.

Analysis on 1.5% agarose gels was performed to exclude nonspecific amplification.

NTC, no-template control (reagent alone without template) was included in each assay to detect any possible contamination of the PCR reagents.

Immunohistochemistry

Immediately following excision, brains were bisected sagitally and flash-frozen in cold isopentane. Frozen brains were then put into standard Tissue-Tek cryomold and filled with Optimal Cutting Temperature (OCT) solution (Tissue-Tek, Torrance, CA) and put

18 on dry ice and subsequently stored at -80°C. Serial sections of 10-20µm were prepared on a standard Cryostat machine (LEICA/CM1850, Simi Valley, CA). Frozen tissue sections were fixed 75% acetone/25% ethanol then blocked in 10% donkey serum prior to incubation with purified antibodies. Purified primary antibodies for SPARC (Abcam,

Cambridge, MA), Iba-1 (Wako, Richmond, VA), CXCR3 (Life Technologies, Grand

Island, NY), MMR (AbD Serotec, Raleigh, NC) arginase-1, AMCase, stabilin-1 (Santa

Cruz Biotechnology, Santa Cruz, CA), as well as biotinylated tomato lectin (Sigma-

Aldrich, St. Louis, MO) were incubated with tissue samples for 2h at RT or overnight at

4°C, and followed with appropriate secondary antibodies conjugated to Alexa 488, Alexa

568, or Alexa 647 at 2µg/mL (Life Technologies, Grand Island, NY). Samples were mounted in Prolong Gold with DAPI (Life Technologies, Grand Island, NY) for nuclear counterstaining. Images were collected on a Leica SP2 scanning confocol microscope

(Leica Optics, Germany), and analyzed using Improvision Volocity 5.0 (Perkin-Elmer,

Waltham, MA).

Quantification of T. gondii burden by quantitative PCR (qPCR)

Parasite burden was measured by amplifying the T. gondii genes B1, SAG1, SAG4, or

MAG1 by real-time PCR as previously described (Contini et al., 2002; Noor et al., 2010).

In vivo peptide blocking

C57BL/6 mice were infected i.p. with 104 Pruigniund tachyzoites. At day 21, 23, 25, and

27 post infection, the animals were injected i.p. with either 0.5ml α-CXCL10

19 (0.5mg/mL), 0.5mL α-CXCR3 (polyclonal), or 0.5ml PBS as previously published (Liu et al., 2001; Stiles et al., 2006). The mice were sacrificed on day 28 p.i. and brains were excised for flow cytometric analysis, and parasite burden as described.

Urea Assay

Supernatants from infected macrophage cultures were added to a 96 well UV plate at

50µl per sample in triplicates. Urea reagents A and B were mixed from quantichrom urea assay kit (Bioassay systems, Hayward, CA) and 200µl of mixture added to each well.

Included standard was used starting at 50mg/ml and diluted two fold. Samples were incubated for 30 min at room temperature and plates were read at 520nm to determine urea concentration.

Chitinase Assay

In order to quantitate chitinolytic activity, 10µg of protein from lysates was added to the fluourogenic substrates 4-Methylumbelliferyl N,N′-diacetyl-β-D chitobioside, 4-

Methylumbelliferyl N-acetyl-β-D-glucosaminide, or 4-Methylumbelliferyl β-D-N,N′,N′′- triacetylchitotriose (Sigma-Aldrich, St. Louis, MO). The samples were incubated at 37°C for 30 minutes and the reactions were stopped by adding 200µl sodium carbonate. The fluorescent intensity of free 4-methylumbelliferone (4MU) was measured on a fluorimeter at excitation of 360nm and emission of 450nm. A standard curve was generated using serial dilutions of 4MU.

20 Bone Marrow Derived Macrophages

Femurs and tibias were obtained from 6–12 week old C57BL/6 mice. After euthanasia, the mice were sprayed with 70% ethanol and the femurs and tibias were dissected using scissors. Muscles connected to the bone were removed using scissors, and the femurs were placed into a 50mL tube containing sterile DMEM on ice. In a tissue culture hood, the bones were washed in sterile DMEM and then both epiphyses were removed using sterile scissors and forceps. The bone marrow was flushed out with a 10ml syringe filled with BM20 differentiation media (DMEM supplemented with 10% fetal bovine serum,

20% L929 supernatant, 5% horse serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine) (Life Technologies, Grand Island, NY) into a 50 mL sterile tube.

The tube was vortexed gently and topped off to 50mL with fresh BM20. 10mL of cell suspension was plated out on 100cm untreated dishes and incubated for 7 days at 37°C,

5% CO2 with fresh media added at day 4. Cells were then washed, counted and plated at

106 cells/mL in BM10 media (DMEM supplemented with 10% fetal bovine serum 10%

L929 supernatant, 5% horse serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine) (Life Technologies, Grand Island, NY) into a 50 mL sterile tube and allowed to rest for 3 days. Macrophages were stimulated overnight with either recombinant IL-4 (10ng/ml), LPS (50ng/ml) or IFN-γ (100U/ml) (all from R&D Systems,

Minneapolis, MN), stAg (100µg/ml) or cystAg (100µg/ml) in complete DMEM.

Macrophage/Cyst Assays

To observe the interaction of macrophages and cysts in vitro, cysts were isolated from the

21 brains of chronically infected mice. Fifty cysts were added per well to 96 well plates containing 2x105 bone marrow derived macrophages. Cysts and cells were viewed using a BD HT Pathway 855 microscope (BD Biosciences, San Jose, CA) in a climate- controlled chamber (37°C, 5% CO2). Nine cysts were identified per condition and photographed every 10 minutes for 14 or 16 hours. Movies were compiled using ImageJ software (NIH, Bethesda, MD) and cyst survival time was determined.

Multiphoton microscopy and SHG analysis

For preparation of brain tissue for live imaging, mice were euthanized by CO2 asphyxiation, the brain was removed, placed in a 35mm glass bottom dish and immediately transferred into an incubating chamber with RPMI complete (RPMI plus

10% fetal-calf serum, 1% pen/strep, 1% glutamine, 1% HEPES, 1% nonessential amino acids, and 0.1% β-mercaptoethanol), and maintained at 37°C, 5% CO2. Imaging was performed on a Leica 710 LSM microscope equipped with 60× (NA 0.8) water objective.

The setup included external nondescanned dual-channel/fluorescence detectors and a diode-pumped, wideband mode-locked Ti:Sapphire femtosecond laser (720–980 nm,

<140 fs; 90 MHz; Coherent Chameleon). Samples were exposed to polarized laser light at a wavelength of 920 nm. Emitted light was separated with a filter set (primary dichroic mirror, followed by dichroic mirrors at 520 nm, 495 nm, and 575 nm). Four photo multiplier tubes collected light at wavelengths: 457–487 nm; 503–537 nm; 525–570 nm, and 580–652 nm. To quantify the density of SHG, we generated 30µm z stacks with a step size of 1 µm. We used Volocity to measure the volume, skeletal length, and skeletal

22 diameter keeping intensity a constant and using a size filter of >50 µm. Mean density, total skeletal length, and mean skeletal diameter were calculated from at least six z stacks from five infected WT and SPARC -/- mice.

Statistics

For statistical analysis of survival data, the log-rank test was used. For all other data, an unpaired, two-tailed Student’s t test, or ANOVA test with a 95% confidence interval was used (Prism; GraphPad Software, Inc., La Jolla, CA). All data are represented as means

± SEM.

23 1-3 FIGURES AND LEGENDS

Figure 1-1. Worldwide seroprevalence of the parasite Toxoplasma gondii. Global statistics for T. gondii seroprevalence by country. Burgundy = > 60% seroprevalence, red = 40 – 40%, yellow = 20 – 40%, blue = 10 – 20%, green = < 10%. Countries in white

= no data. Adapted from (Pappas et al., 2009).

24 > 60% 40 - 60% 20 - 40% 10 - 20% < 10%

25 Figure 1-2. The life cycle of T. gondii. A) Members of the family Felidae (domestic cats and their relatives) are the only known definitive host to T. gondii. Sexual replication of the parasite occurs only in the stomach of its definitive host. B) Oocysts are shed in the feces of the cat and can endure in the environment for long periods of time. C) Intermediate hosts become infected through grazing or foraging. Small animals and birds can transmit the parasite back to its definitive host when they are preyed on by cats, thus completing the life cycle. Human infection typically occurs by ingestion of tissue cysts in undercooked meat. D) Humans may also become infected by ingesting contaminated produce, drinking water, or by close contact with cat feces. E) Upon ingestion, oocysts convert to fast replicating tachyzoites, resulting in an acute systemic infection. F) Chronic infection develops when the tachyzoites convert to slow-replicating bradyzoite tissue cysts, which reside predominantly in the brain for the life of the host.

G) Congenital transmission occurs when a woman is infected during pregnancy and can result in severe birth defects.

F E

G C D A

Figure 1-3. The protective immune response to T. gondii. A) The presence of tachyzoites rapidly induces an acute systemic infection in the host. B) Antigen presenting cells are activated through TLR ligation resulting in the production of inflammatory mediators by the transcription factor, NF-κB. C) The production of IL-12 induces activation of Th-1 response. D) T cells produce the cytokine IFNγ, essential for protective immunity to the parasite. E) IFNγ induces the production of nitric oxide (NO) and immunity-related GTPases (IRGs) which directly kill the parasite and control replication. F) Tachyzoites convert to bradyzoite cysts, which reside predominantly in the brain for the life of its host.

28 Chronic Infection NO + IRGs control parasite replication

Bradyzoites

IFN-!

APCs

Tachyzoites CD4 + CD8 IL-12

Acute Infection

29 Figure 1-4. The multifaceted role of the matricellular protein SPARC. Known roles for SPARC include: 1) Collagen assembly. SPARC acts at a chaperone by directly binding collagen fibrils during ECM remodeling. Stabilin-1 regulates bioavailability of

SPARC through uptake and recycling. 2) Integrin signaling. SPARC can bind and signal through integrin receptors, modulating cell responses such as proliferation, survival, migration and cytokine production. 3) Anti-adhesion. SPARC blocks the formation focal adhesions by binding directly with fibronectin and preventing aggregation of integrins.

30 proliferation uptake and survival recycling migration TGF-! focal adhesion

stabilin-1 /%0&1#/%)

*+,-.) !"#$%&'(%) SPARC SPARC anti- collagen integrin adhesion assembly signaling

31 Figure 1-5. Macrophage phenotype and function. Macrophage phenotypes according to function include: 1) Classically Activated Macrophages, involved in Th1 responses, are activated by TLR ligation and the presence of the pro-inflammatory cytokines IFNγ and TNFα. These cells secrete IL-12, IL-23, TNFα, IL-1β, and reactive oxygen species (ROS) in response to intracellular pathogens. 2) Regulatory macrophages are activated by and secrete the anti-inflammatory cytokine, IL-10 and are involved in immune suppression. 3) Alternatively activated macrophages are activated by the Th2 cytokines IL-4 and IL-13 as well as the exogenous polysaccharide chitin. These cells produce arginase-1, RELMα, chitinase and chitinase-like proteins (CLP), and are involved in immunity to helminth infection, allergic responses, and wound healing.

32 Classical (M1, CaM!) IL-12 IL-23 LPS TNF" IFN$ Th1 Responses IL-1# TNF" ROS intracellular pathogens

IL-4 IL-13 chitin Th2 Responses Anti-inflammatory IL-10 helminths, allergy, immune Arg1 wound healing suppression RELM" Chitinases CLPs scavenger Alternative Regulatory receptors (M2a, AAM!) (RM!, M2c)

33 CHAPTER TWO

SPARC is required for Efficient Cell Migration and Protective Immunity in

the CNS during Chronic T. gondii Infection

34 2.1 Abstract

Control of chronic T. gondii infection in the brain requires the continuous presence of IFN-γ producing T cells to prevent reactivation of the parasite, however, we have limited understanding of how these cells migrate within the parenchyma of the brain. It has recently been demonstrated that a network of extracellular matrix fibers, not present in naïve mice, exists in the brain after infection with T. gondii.

This network, revealed using multiphoton microscopy and second harmonic generation (SHG), is thought to act as a substrate for migrating T cells to reach sites of infection within the parenchyma. SPARC is a secreted glycoprotein associated with remodeling of the extracellular matrix (ECM) and cell migration. Here we show upregulation of SPARC in the frontal cortex and immunostaining reveals long fibrous strands associated with parasite cysts and migrating cells similar in nature to the network that we have previously observed. Despite no apparent defect in the recruitment or activation of immune cells, there is a significant increase in parasite burden in the brain and increased cellular accumulation in the perivascular space, suggesting a defect in cell migration within the parenchyma. These data suggest that SPARC may play a role in the assembly of the migratory network of fibers in the brain. Indeed, the volume of these fibers is significantly reduced in the brains of

SPARC-null mice following infection. Together, these data identify the glycoprotein, SPARC, as an important regulatory component of immune cell migration and responses in the CNS.

35 2.2 Introduction

An effective immune response critically depends on the ability of effector cells to migrate to sites of infection. This process is tightly regulated and involves recognition and presentation of antigen, production of cytokines and chemokines, activation of innate and adaptive immune cells, and migration of these cells from the bloodstream into tissues

(Friedl and Weigelin, 2008). The mechanisms of cell migration within tissues remain poorly defined. However, recent advances in intravital imaging have begun to shed light on these processes. Multiphoton microscopy offers the advantage of deep imaging in live tissue. Using this method, we have been able to observe the migration of fluorescently- tagged cells through tissues in real time (Phan and Bullen, 2010). In addition, components of the extracellular matrix (ECM) can also be observed through a phenomenon known as second harmonic generation (SHG). SHG can be used to visualize noncentrosymetric reticular structures such as collagen fibers (Schenke-

Layland, 2008). Studies using this technique in the lymph node have revealed the presence of collagen conduits, coated in the chemokine CCL21 which T cells and dendritic cells migrate along (Asperti-Boursin et al., 2007; Bajenoff et al., 2006; Okada and Cyster, 2007; Worbs et al., 2007). This structure provides a physical scaffold for migrating leukocytes and allows for efficient and sustained antigen presentation. Similar structures associated with migrating cells have also been observed in tumors and granulomas (Condeelis and Segall, 2003; Egen et al., 2008). These studies and others have highlighted a central role for the ECM in facilitating cell migration. Indeed, our

36 understanding of the ECM has evolved from a static structural scaffold to a dynamic and receptive network capable of modulating cell migration, cell signaling, as well the bioavailability of effector molecules (Sorokin, 2010).

The structure and function of the ECM is regulated by matricellular proteins that modulate its assembly, degradation, maintenance and physical properties (Chiodoni et al.,

2010). This family of proteins, distinguished by their non-structural properties and the ability to regulate cell-matrix interactions, include thrombospondins (TSP), matrix metalloproteases (MMP), osteopontin (OPN), and the glycoprotein SPARC (secreted protein acidic and rich in cysteine) (Bornstein and Sage, 2002). SPARC is best known for its ability to bind multiple types of collagen and regulate its deposition during development and in response to tissue damage or disease (Lane and Sage, 1994). In addition, SPARC can bind and interact with integrins, growth factors and cytokines, thus affecting a multitude of cellular functions (Arnold and Brekken, 2009). SPARC has been shown to play a major role in immune cell migration and activation in multiple models of cancer, inflammation and infection (Chlenski and Cohn, 2010; Piconese et al., 2011;

Rotta et al., 2008; Sangaletti et al., 2005).

Toxoplasma gondii is an obligate intracellular protozoan pathogen that leads to a persistent infection in its host. In the presence of a competent immune system, the fast- replicating tachyzoite converts to slow-replicating bradyzoites, which reside, predominantly in the brain, in the form of tissue cysts for the life of the host (Bohne et al., 1994; Gazzinelli et al., 1993; Gazzinelli et al., 1994). This chronic infection is

37 relatively asymptomatic and is maintained by the continuous presence of immune cells, most importantly, IFN-γ producing T cells in the CNS (Gazzinelli et al., 1992; Gazzinelli et al., 1994). The requirement for T cells was highlighted in the 1980s during the AIDS crisis, when infected patients presented with Toxoplasmic encephalitis, a fatal condition resulting from the reactivation of tachyzoites in the brain (Luft et al., 1984; Luft and

Remington, 1992). Thus, the ability of T cells to migrate to sites of infection in the brain is paramount in controlling the replication of the parasite. Currently, little is known about the mechanisms of immune cell migration within the brain parenchyma. A recent study using multiphoton imaging and SHG revealed the presence of a reticular fibrous network in the brains of mice infected with T. gondii and absent in the naïve brain

(Wilson et al., 2009). Live imaging shows the migration of CD8+ T cells along these structures in a directional manner. The composition and source of this network is unknown, however, it is hypothesized that this is a mechanism for effector cells to migrate to sites of infection within the brain.

Here we show that SPARC is upregulated in the brain following infection with T. gondii. Importantly, this upregulation is observed in the frontal cortex of the brain, an area associated with parasite infection and replication. Analysis of SPARC in situ reveals the presence of fibrous strands that are associated with migrating cells and parasite cysts.

Interestingly, these fibers are absent in the brains of naïve mice and are similar in nature to the migratory network previously observed through intravital imaging. SPARC-null mice are more susceptible to chronic T. gondii infection, with increased parasite burden in the brain, despite no defect in cell recruitment or activation. However, we did observe

38 increased perivascular and meningeal accumulation of cells, suggesting a defect in cell migration within the parenchyma possibly due to a compromised migratory network.

Multiphoton analysis of live tissue reveals a significant decrease in the volume and length of extracellular fibers in the brains of SPARC-null mice as compared to wild-type.

Taken together, these data point to an important role for the glycoprotein, SPARC, in matrix remodeling of the migratory network in the CNS.

39 2.3 Results

2.3.1 SPARC is upregulated in the frontal cortex of the brain during T. gondii infection.

During chronic T. gondii infection, a migratory network of fibers is established to aid in the migration of immune cells to the sites of infection within the CNS (Wilson et al., 2009). This network is not present in naïve mice and therefore requires a substantial amount of tissue remodeling prior to or during chronic infection. Since SPARC is a molecule that is consistently associated with such events, we examined its expression profile in the CNS following infection. Infected mice were sacrificed at various time points and frontal cortex and cerebellum were analyzed for SPARC expression using rt- qPCR. Our results show a substantial increase in SPARC mRNA in the frontal cortex, an area of the brain associated with parasite infection, beginning at day 7 and peaking at day

14 post-infection (Figure 2-1 A). In contrast, SPARC expression was relatively stable in the cerebellum following infection. SPARC is known to be expressed in the cerebellum in the adult brain, but is normally absent from the cortex (Mendis and Brown, 1994). To confirm these results, we examined in situ hybridization for SPARC mRNA (performed by Whitney Carter, laboratory of Dr. Monica Carson) on brain slices taken from naïve and infected mice (Figure 2-1 B). Here, our results confirm heavy SPARC expression in the hindbrain of both naïve and 14 day infected mice. However, a substantial upregulation of SPARC is noted in the frontal cortex of infected mice at day 14 over naïve. Together, these data demonstrate SPARC upregulation in the CNS as a result of

40 parasite infection. Furthermore, this increase in SPARC mRNA is limited to areas of the brain that are associated with parasite replication and infection.

Next, we examined the localization of SPARC protein in the frontal cortex of the infected brain by immunofluorescence. Brains were taken from infected mice at various time points and slices were incubated with specific antibodies against SPARC and

CXCR3. CXCR3 is a chemokine receptor known for its role in immune cell migration in the CNS following infection (Liu et al., 2005; Stiles et al., 2006). Fluorescent staining revealed SPARC associated with long reticular fibrous strands, similar in nature to those previously revealed in the brain using SHG (Wilson et al., 2009) (Figure 2-1 C).

Additionally, these strands were associated with both parasite cysts as shown with DAPI staining, and migrating CXCR3+ cells. Thus, SPARC is upregulated in the frontal cortex of the brain following infection and associated with a reticular fibrous network, parasite cysts and migrating immune cells.

2.3.2 SPARC deficiency leads to a delayed immune response during acute infection.

SPARC deficiency has been associated with alterations in the immune response such as impaired cell migration, antigen presentation and germinal center formation

(Piconese et al., 2011; Rempel et al., 2007; Rotta et al., 2008). To determine the role of

SPARC during the early stages of infection, WT and SPARC-null mice were infected with T. gondii and serum levels of proinflammatory cytokines were evaluated using a

41 cytokine bead assay (CBA) (Figure 2-2 A). At day 7, the peak of the systemic immune response, there were no significant differences in concentrations of proinflammatory cytokines IL-6, MCP-1, IL-12p70, TNF-α or IFN-γ. IL-10, an anti-inflammatory cytokine required to prevent immunopathology during infection, was also equivalent between WT and KO mice. At day 14 when the infection is moving into the chronic stage, concentrations of these cytokines were decreased but remained equivalent between

WT and SPARC-null mice.

SPARC-null mice have been shown to have a delay in the adaptive immune response resulting from defective dendritic cell networking and germinal center formation (Piconese et al., 2011). To determine if there is a defect in immune cell recruitment of activation during acute infection with T. gondii, cell populations from cervical lymph node and peritoneal exudate cells (PECS) were analyzed using flow cytometry. At day 7 post-infection, there was a significantly larger proportion of CD4+

T cells in the lymph nodes of SPARC-null mice (Figure 2-2 B, left). This proportion remained elevated at day 14, but was not statistically significant. In contrast, proportions of CD4+ T cells taken from the site of infection (PECS) were significantly lower in

SPARC-null mice at day 7 p.i. and showed no differences at day 14 p.i. (Figure 2-2 B, right). SPARC deficiency did not result in any differences in proportions of CD8+ T cells in lymph node or PECS at day 7 p.i., however there was a significant increase in the proportion of CD8+ cells in the PECS of SPARC-null mice at day 14 (Figure 2-2 C).

Proportions of CD11b+ cells were equivalent in the lymph nodes of WT and SPARC-null mice at day 7 and 14 p.i., however there was a significantly decreased proportion of this

42 population in the PECS of SPARC-null mice at day 7 (Figure 2-2 D). Thus, in the absence of SPARC, there is a delay in the migration of CD4+ T cells and CD11b+ macrophages to the site of infection in the peritoneal cavity.

To determine if there was any difference in activation of immune cells during acute infection, we examined CD4+, CD8+, and CD11b+ cells for surface markers indicative of activation status. At day 7 p.i. there was a significant decrease in the percentage CD4+ T cells displaying the activated phenotype CD44hi and CD62Llo in the lymph nodes and PECS of SPARC-null mice (Figure 2-2 E). This defect was not present at day 14, in fact there was a significant increase of activated CD4+ T cell proportions in the lymph nodes of SPARC-null mice at this time point. There were no differences in the percentage of activated CD8+ T cells in either the lymph nodes or PECS at day 7, however there was a significant increase in this population in the lymph nodes of

SPARC-null mice at day 14 (Figure 2-2 F). Proportions of CD11b+ cells expressing

MHC II were equivalent in the lymph node at day 7, but increased in SPARC-null mice at day 14 (Figure 2-2 G, left). However, there was a significant decrease in this population in the PECS of SPARC-null mice at day 7 p.i. and this difference was resolved by day 14 (Figure 2-2 G, right). Overall, these data suggest that in the absence of SPARC, there is a delay in the migration and activation of CD4+ T cells and macrophages during the early acute immune response, however this defect appears to be resolved by 14 days post infection.

To determine if delayed CD4+ and CD11b+ cell activation results in a decreased ability to control parasite replication during acute infection, parasite burden in peripheral

43 tissues was evaluated using qPCR (Figure 2-2 H). At day 7 following infection, parasite

DNA in both the lungs and liver was detectable at high levels and decreased by day 14 in both WT and SPARC-null mice. There were no significant differences in parasite burden at either timepoint, suggesting no defect in parasite control during acute infection. Thus, despite delayed activation and recruitment of CD4+ T cells and CD11b+ macrophages, there is no defect in cytokine production and the immune response is sufficient to control parasite replication in the absence of SPARC during the acute stage of infection.

2.3.3 SPARC deficiency does not impair the ability of immune cells to migrate to the brain during chronic infection

During chronic T. gondii infection, there is a continuous need for the presence of immune cells in the brain to prevent reactivation of the parasite, most importantly IFN-γ producing T cells (Denkers and Gazzinelli, 1998). These cells must be able to cross the blood-brain barrier (BBB) and then migrate into the parenchyma of the brain to the sites of infection. Defective or inefficient cell migration results in a compromised ability to control the parasite in the CNS as shown by multiple studies (Khan et al., 2000; Norose et al., 2010; Ploix et al., 2011). SPARC is well known for its role in modulating cell migration in multiple models of disease including cancer, fibrosis, and EAE (Girotti et al., 2011; Piconese et al., 2011; Rotta et al., 2008; Sangaletti et al., 2005; Sangaletti et al.,

2011; Shi et al., 2007). To examine a possible role for SPARC in cell migration to the brain during chronic infection, WT and SPARC-null mice were infected with the Pru-

OVA strain of T. gondii. Brains were harvested at days 21, 28, and 42 post-infection, and

44 brain mononuclear cell (BMNC) suspensions were prepared and analyzed for cellular composition using flow cytometry. At 21 days p.i., chronicity of infection is well- established and significant populations of T cells and macrophages are present in the brain (Carruthers and Suzuki, 2007). At this timepoint, our data show no significant differences in proportions of CD4+ or CD8+ T cells in the brains of SPARC-null mice

(Figure 2-3 A). Infiltrating macrophages can be distinguished from resident microglia as they express higher levels of CD45 (CD11bhi/CD45hi). At 21 days p.i. we observed no significant differences in the populations of either infiltrating macrophages or resident microglia (Figure 2-3 B). Inflammatory monocytes (IM) and neutrophils have both shown to play important roles in controlling T. gondii infection (Bliss et al., 2001; Dunay et al., 2010). These populations can be distinguished from each other by differential expression of the myeloid differentiation antigens Ly6c and Ly6g, with IMs

Ly6gint/Ly6chi and neutrophils Ly6ghi/Ly6cint. Analysis of these populations at day 21 p.i. reveal no differences in the proportions of either IMs or neutrophils in the brain

(Figure 2-2 C). Similarly, we observed no significant differences in any of these proportions of infiltrating cells at days 28 and 42 p.i. (data not shown).

Absolute cell numbers were also calculated for these cell types. There were no significant differences in the numbers of total BMNCs at day 21, 28 or 42 p.i. (Figure 2-3

D). Furthermore, we observed no difference in populations of CD4, CD8, macrophage,

IM, or neutrophil populations in the brain during any of these timepoints, suggesting that immune cell migration to the CNS in the absence of SPARC is unaffected. To evaluate the ability of antigen-specific T cells to migrate to the brain, we used MHC class I and II

45 tetramers specific to OVA and Toxoplasma antigens, respectively. There were no appreciable differences in the populations of either OVA-specific CD8 cells or Toxo- specific CD4 cells at days 21, 28, or 42 p.i. (Figures 2-3 E,F). Furthermore, we observed no differences in macrophage activation in the brain at any time point as demonstrated by similar expression levels of MHC II and CD40 (Figure 2-3 G, H). Taken together, these data suggest that SPARC is not required for efficient migration of activated leukocytes to the CNS during chronic infection.

2.3.4 SPARC-null show delayed control of parasite burden in the brain during chronic infection.

Unpublished data from this lab have shown that SPARC-null mice on a B129s background display hind-limb paralysis accompanied by a significant increase in parasite burden in the brain during chronic Toxoplasma infection. Paralysis of the hind legs is not a phenotype usually associated with high levels of parasite burden in the brain. This is more typical of inflammation in the spinal cord as seen in experimental autoimmune encephalitis (EAE) (Miller and Karpus, 2007). Toxoplasmic myelitis, an extremely rare condition resulting from dissemination of the parasite into the spinal cord, has been observed in AIDS patients (Vyas and Ebright, 1996). In these cases, parasite-induced lesions were present in the spinal cord resulting in symptoms such as motor loss in the lower extremities. The hind-limb paralysis and increased parasite burden in the brain observed in SPARC-null mice is suggestive of a compromised ability to control not only the replication, but also the dissemination of the parasite across biological barriers.

46 Although this phenotype has not been observed in SPARC-deficient B6 mice, it is possible that SPARC plays an important role in controlling parasite replication and dissemination.

To examine this, WT and SPARC-null mice were sacrificed at various time points prior to, and during the chronic stage of infection. Brains and spinal cords were harvested and DNA was isolated for analysis of parasite burden by qPCR. At day 14 p.i. parasite DNA was significantly elevated in the brains of SPARC-null mice compared to

WT (Figure 2-4 A). Parasite burden for WT and SPARC-null mice peaked at day 21, a timepoint considered to be the apex of chronic infection, and was decreased and remained level at day 28 and day 42. A significant increase in pDNA in the brains of SPARC-null mice was also observed at days 21 and 28 p.i., but not at day 42. These data suggest that

SPARC deficiency leads to an earlier dissemination of the parasite into the brain resulting in increased parasite burden during the peak of infection, which is resolved within 42 days.

To examine parasite burden in the spinal cord, spinal cords were removed and bisected into upper and lower sections. In the upper spinal cord, parasite DNA levels were detectable starting at 21 days p.i., increasing at days 28 and 42 (Figure 2-4 B).

These levels were slightly elevated at days 21 and 28 p.i. in SPARC-null mice, although this did not reach statistical significance. Parasite DNA was also detected in the lower spinal cord at day 21, peaking at day 28 and then slightly decreased at day 42 p.i. (Figure

2-4 C). There were no significant differences between WT and SPARC-null mice at any

47 timepoint, however, there was a moderate increase in the lower spinal cords of SPARC- null mice at day 21. Thus, despite an increase in parasite burden in the brain, there is no appreciable difference in parasite dissemination into the spinal cord in the absence of

SPARC.

Although no defects were observed in immune cell migration to the brains of

SPARC-null mice, these cells must also have the ability to migrate from perivascular spaces into the parenchyma to control the parasite. Recent studies have suggested that this process involves chemokine-dependent migration along a network of extracellular fibers (Ploix et al., 2011; Wilson et al., 2009; Wilson et al., 2010). The composition and source of these fibers is currently unknown, but they are similar in structure to those visualized through immunofluorescent staining of the chemokine CCL21 as well as

SPARC (Figure 2-1 C) (Wilson et al., 2009). Moreover, it has been hypothesized that

CCL21 regulates T cell entry into the parenchyma and is associated with these fibers, providing a substrate and stimulus for directed migration. CCL21 deficiency during chronic T. gondii infection results in the inability of T cells to enter the parenchymal space and is characterized by accumulation of cells in the meningeal and perivascular spaces (Ploix et al., 2011). To examine a possible role for SPARC in cell migration within the parenchyma, H&E stains were prepared from the brains of 21 day infected WT and SPARC-null mice (Figure 2-4 D). In contrast to WT, brain slices from SPARC-null mice showed greater cellular accumulation in the meninges as well as increased perivascular cuffing (Figure 2-4 D, bottom). These data suggest that SPARC may be

48 involved in facilitating immune cell migration within the parenchyma, providing a possible explanation for the increased parasite burden in the brains of these mice.

2.3.5 Reticular fiber network in the CNS is compromised in SPARC-null mice following infection.

Reticular fiber networks that facilitate cell migration have been observed in the tumor microenvironment as well as in inflamed tissue following infection or insult

(Condeelis and Segall, 2003; Herz et al., 2011; Wilson et al., 2009). The extent to which

SPARC regulates the assembly of these networks is currently unknown, however several studies have drawn a correlation between SPARC deficiency and disregulation of reticular networks (Chlenski et al., 2006; Sangaletti et al., 2008; Sangaletti et al., 2005).

The network observed in the CNS following T. gondii infection is strikingly similar to the fibrous strands revealed by SPARC immunostaining. Furthermore, SPARC is known for its ability to bind to and regulate the deposition of fibrillar ECM molecules such as collagen (Bradshaw, 2009). To examine the role of SPARC in the creation or maintenance of the migratory network in the CNS following infection, wild-type (WT) and SPARC-null mice were infected with T. gondii. At 4 weeks following infection, whole brains were harvested and examined using multiphoton microscopy, for SHG signal. 30µm z-stacks were collected from different areas of the cerebral cortex and 3D images were compiled and analyzed for volume and structure (Figure 2-5 A-D).

Visualization of SHG signal in WT mice reveals a dense, organized fibrous network, similar to those previously observed following infection (Figure 2-5 A, top). In contrast,

49 the observed network in the brains of SPARC-null mice appears to be much more sparse and tangled. Volume measurements of these fibers confirm this observation, demonstrating a significant decrease in the brains of SPARC-null mice as compared to

WT (Figure 3-5 B). Skeletal length is defined here as the total combined length of all the fibers in each 3D image. Our data show a significant decrease in skeletal length of fibers in the brains of SPARC-null mice (Figure 2-5 C). There was no difference in the average skeletal diameter of these fibers (Figure 2-5 D). Taken together, these results reveal a novel role for SPARC in the proper formation of ECM networks in the CNS following infection. Furthermore, the increased parasite burden and accumulation of cells in the meninges and perivascular spaces observed in the absence of SPARC may be attributed to this insufficient migratory network.

50 2.4 Discussion

Chronic T. gondii infection represents a somewhat harmonious balance between parasite and host with limited pathology from either the pathogen or immune response.

This delicate balance is maintained through the controlled activation and migration of immune cells from the bloodstream to sites of infection within the CNS. Until recently, very little was known about the mechanisms of cell migration within the brain parenchyma. However, with the relatively recent advancement of live imaging techniques, we now have the ability to directly observe these events in live tissues.

Multiple studies using multiphoton microscopy and second harmonic generation (SHG) have highlighted a new and important role for the ECM in facilitating cell migration through tissues (Condeelis and Segall, 2003; Egen et al., 2008; Okada and Cyster, 2007;

Wilson et al., 2009). From these studies, it is now understood that ECM networks acts as a malleable substrates providing bioavailability of chemokines, arrangement of cellular interactions, and a directional path from point A to point B. The migratory network observed in the brain during chronic T. gondii infection is absent in uninfected mice, suggesting that a substantial tissue remodeling event occurs in the CNS following infection (Wilson et al., 2009). Remodeling of the ECM involves the deposition and uptake of collagen and other matrix proteins by tissue remodeling cells such as fibroblasts and macrophages (Bosman and Stamenkovic, 2003). Matricellular proteins play an important role in regulating these processes by modulating cell function as well as cell-matrix interactions (Bornstein and Sage, 2002).

51 SPARC is a matricellular that plays an important role in the creation and maintenance of the ECM (Bradshaw, 2009). In addition to direct interactions with matrix components such as collagen, SPARC can also bind and signal through cell surface integrins, thus affecting a multitude of cellular processes including migration, adhesion, and activation (Brekken and Sage, 2001). Here, we identify a novel role for SPARC in providing protective immunity during chronic T. gondii infection through regulation of the infection-induced migratory network in the CNS.

SPARC is highly expressed in all types of tissue during development and then limited to tissues with high ECM turnover after maturation (Nomura et al., 1988).

Expression of SPARC is induced in tissues following tissue injury and also in cases of infection, disease or stress (Bradshaw and Sage, 2001). In the adult brain, SPARC expression is normally limited to the cerebellum and brainstem and is thought to play a role in synaptic plasiticity and neurogenesis (Vincent et al., 2008). Following infection with T. gondii, we observed an upregulation of SPARC mRNA in the front cortex of the brain, an area associated with parasite infection. Our observation that SPARC expression remains constant in the cerebellum suggests that this induction is a result of infection.

Induction of SPARC in the brain occurs as early as day 7, peaking day 14 p.i., which is prior to the major influx of immune cells that is observed around day 21. Upregulation of matrix metalloproteases (MMP), key mediators of tissue remodeling, have been observed in the brain as early as 3 days following infection, suggesting that matrix remodeling in the CNS occurs during acute infection (Clark et al., 2010). The network of reticular fibers induced in the brain following infection is characterized by long, linear strands,

52 distinct from the “wavy” appearance of collagen fibrils (Cox and Kable, 2006). These strands are strikingly similar to the fiber-like structures revealed by SPARC immunostaining. Although SPARC is not a structural component of the ECM, it has been shown to bind and interact with multiple structural proteins. Thus, we propose that the function of SPARC in the brain following infection is to regulate the assembly and maintenance of this network of fibers.

SPARC deficiency has been associated with decreased deposition of collagen and compromised ECM networks (Bradshaw et al., 2003; Chlenski et al., 2006; Yunker et al.,

2008). In the lymph node of SPARC-null mice, poor organization of collagen networks and an impaired ability to form germinal centers leads to a delayed adaptive immune response (Piconese et al., 2011). Our data confirm this delayed immune response as

CD4+ T cell and macrophage populations displayed fewer activated cells and an impaired ability to migrate to the site of infection. This was only observed at day 7 p.i. and did not result in defective cytokine production or increased parasite burden. Furthermore,

SPARC-null mice showed no impairment in immune cell migration to the brain during chronic infection. In apparent contrast to these findings, we observed significantly elevated levels of parasite DNA in the brains of SPARC-null mice at days 14, 21, and 28 post-infection. However, by day 42 parasite burden was equivalent to WT suggesting the presence of compensatory mechanisms in the absence of SPARC. Although we had previously observed hind-limb paralysis in B129s SPARC-null mice during chronic infection, we have yet to observe this phenotype in backcrossed B6 mice. Evaluation of parasite burden in the spinal cord revealed a slight increase in parasite burden in the

53 upper spinal cord of SPARC-null mice, however this difference was not statistically significant. The absence of this phenotype in B6 mice could be attributed to differences in susceptibility between the two strains. Interestingly, despite no apparent defects in immune cell activation and migration to the brain, SPARC-null mice showed significantly elevated parasite burden.

The inability to initially control the parasite in the brain may be attributed to impaired cell migration within the parenchyma. In line with this, histology taken from the brains of chronically infected mice show increased accumulation of cells in the meninges and perivascular space of SPARC-null mice. Entry of T cells into the parenchyma from meningeal and perivascular spaces is thought to be facilitated, in part, by the chemokine CCL21 (Ploix et al., 2011). In the lymph node, CCL21 is associated with a constitutive network of collagen conduits that act to facilitate T cell migration and arrange antigen presentation between T cells and dendritic cells (Okada and Cyster, 2007;

Worbs et al., 2007). A similar process is thought to occur in the brain following T. gondii infection, where CCL21 would facilitate migration into the parenchyma through association with the network of reticular fibers and engagement of its receptor CCR7

(Noor et al., 2010; Wilson et al., 2009). Indeed, the absence of CCL21 results in accumulation of immune cells in the meninges and perivascular spaces of the brain (Ploix et al., 2011). Similarly, any compromise in the migratory network associated with

CCL21 would also result in impaired cell migration within the parenchyma. Our data reveal that SPARC deficiency leads to reduced volume and length of reticular fibers in the brain during chronic infection. These results are consistent with previous studies that

54 identify SPARC as a modulator of stromal networks in tumors (Brekken et al., 2003;

Chlenski et al., 2006; Yunker et al., 2008).

In summary, we have identified a novel role for the matricellular protein, SPARC, in the regulation of an infection-induced migratory network in the CNS. We hypothesize that the reduced volume and integrity of these reticular fibers result in an impairment of parenchymal migration of immune cells and increased susceptibility to the replicating parasite in the brain during chronic infection.

55 2.5 FIGURES AND LEGENDS

Figure 2-1. Expression of SPARC in the CNS during chronic T. gondii infection.

(A-E) C57Bl/6 mice were infected with the Pruigniund strain of T. gondii and sacrificed at various timepoints. (A) Front cortex and cerebellum of infected brains were removed at days 7, 14, 21, and 50 post-infection. RNA was isolated and reverse transcribed and cDNA was analyzed for levels of SPARC transcript using qRT-PCR. Results are shown as fold change over naïve normalized to HPRT. (B) Brains were removed from naïve and 14 day infected mice. In-situ hybridization was performed on brain slices with probes specific to SPARC mRNA. (C) Confocal fluorescence microscopy of 20µm brain slices taken from mice at 3 weeks post infection. (C) Panels from left to right show parasite cyst identified by punctate DAPI (blue) stain in association with SPARC (green), close up image of cyst in association with SPARC, and SPARC (green) fibers associated with cell expressing CXCR3 (red). Data are represented as mean ± SEM, * p < 0.05.

56 A B

30 frontal cortex cerebellum

20 Naive

0 7 14 21 50

-10 Days post infection Day 14

SPARC SPARC SPARC CXCR3

57 Figure 2-2. SPARC-null mice have no defect in cytokine production during acute

T. gondii infection. C57Bl/6 (WT) and SPARC -/- mice were infected with the

Pruigniund strain of T. gondii and sacrificed at 7 and 14 days following infection. (A)

Serum was isolated from whole blood samples and analyzed for IL-10, IL-6, MCP-1,

IFNγ, TNFα, and IL-12 using a cytometric bead assay (CBA). (B-G) Cervical lymph nodes (LN) and peritoneal exudate cells (PECS) were harvested and prepared for analysis by flow cytometry. Cell suspension were stained and analyzed for expression of (B) CD4

T cells, (C) CD8 T cells, (D) macrophages (CD45hi/CD11b+), (E, F) activation

(CD44hi/CD62lo) of (E) CD4+T cells, (F) CD8+ T cells and (G) MHC II expression by macrophages. (H) DNA was isolated from the lungs and analyzed for parasite burden using qPCR. Results are displayed as parasites per mg tissue. Data are representative of at least 2 individual experiments with a minimum of n=4 and are represented as mean ±

SEM, * p < 0.05, ** p< 0.01.

59 Figure 2-3 SPARC-null mice have no defect in immune cell migration to the brain during chronic infection. C57Bl/6 (WT) and SPARC -/- mice were infected with the Ova expressing Pruigniund strain of T. gondii and sacrificed at 21, 28, and 42 days following infection. (A-G) Brains were harvested and BMNCs prepared for analysis by flow cytometry. (A-B) Cell suspensions were stained and analyzed for expression of

CD4 T cells, CD8 T cells, macrophages (CD45hi/CD11b+), microglia (CD45int/CD11b+), inflammatory monocytes (IM) (Ly6gint/Ly6chi) and neutrophils (Ly6ghi/Ly6cint). (A)

Percentages of (left) CD4 and CD8 T cells, (center) macrophages and microglia, and

(right) IM and neutrophils in WT and SPARC-/- at 21 days p.i.. (B top) Absolute cell counts of total cells CD4, CD8, macrophages, IM, and neutrophils at days 21, 28, and 42 p.i.. (C-F) Histograms of cell populations from day 21 infected brains (C) MHC II tetramer staining of toxo-specific CD4 cells, (D) MHC I dextramer staining of Ova- specific CD8 cells, (E) MHC II expression on CD11b+ cells, (F) CD40 expression on

CD11b+ cells. Data are representative of at least 2 individual experiments with a minimum of n=4 and are represented as mean ± SEM.

60 A 14.2±3.1 24.3±0.4 31.1±2.4

20.4±4.2 WT

14.2±2.1 3.8±0.3

15.5±1.9 21.6±3.8 28.6±5.3 SPARC-/- 14.8±3.5

4.6±1.2 16.5±1.6 Ly6c CD8 CD45 CD4 CD11b Ly6g

C D E F isotype WT SPARC-/- % of Max

Toxo Ova MHC II CD40

61 Figure 2-4 SPARC-null mice have higher parasite burden in the brain and increased cellular accumulation in perivascular spaces. C57Bl/6 (WT) and SPARC -

/- mice were infected with the Pruigniund strain of T. gondii and sacrificed at 14, 21, 28, and 42 days following infection. (A-C) DNA was isolated from (A) brain, (B) upper spinal cord and (C) lower spinal cord and analyzed for parasite burden using qPCR.

Results are displayed as parasites per mg tissue. (D) Whole brains were fixed, frozen and stained for H&E to examine cellular infiltrates and pathology. Data are representative of at least 2 individual experiments with a minimum of n=4 and are represented as mean ±

SEM, * p < 0.05.

63 Figure 2-5. SPARC-null mice have compromised reticular fiber network in the brain during chronic T. gondii infection. C57Bl/6 (WT) and SPARC -/- mice were infected with the Pruigniund strain of T. gondii and sacrificed at 21 days following infection. (A-D) Whole brains were removed and imaged on a Zeiss 710 LSM multiphoton microscope for second harmonic generation (SHG) signal. (A) 30µm z- stacks were obtained at various locations of the cortex. 3D images were compiled using

Volocity software and reticular fibers were analyzed for (B) volume, (C) skeletal length, and (D) skeletal diameter. Data are representative of at least 2 individual experiments with a minimum of n=4 and are represented as mean ± SEM, ** p< 0.01.

65 CHAPTER THREE

Macrophage-derived Acidic Mammalian Chitinase is required to Control Cyst Burden in the Brain during Chronic T. gondii Infection

66 3.1 Abstract

Chronic infections represent a continuous battle between the host’s immune system and pathogen replication. Many protozoan parasites have evolved a cyst lifecycle stage that provides it with increased protection from environmental degradation as well as endogenous host mechanisms of attack. In the case of Toxoplasma gondii, these cysts are predominantly found in the immune protected brain making clearance of the parasite more difficult and resulting in a lifelong infection.

Currently, little is known about the nature of the immune response stimulated by the presence of these cysts or how they are able to propagate. Here we establish a novel chitinase-dependent mechanism of cyst control in the infected brain. Despite a dominant Th1 immune response during Toxoplasma infection, there exists a population of alternatively activated macrophages (AAMΦ) in the infected CNS.

These cells are capable of cyst lysis via the production of AMCase as revealed by live imaging, and this chitinase is necessary for protective immunity within the CNS.

These data demonstrate chitinase activity in the brain in response to a protozoan pathogen and provide a novel mechanism to facilitate cyst clearance during chronic infections.

67 3.2 Introduction

The brain has unique structures in place to limit access of immune cells and molecules.

Although this can provide protection against an overambitious inflammatory response, it may also lead to the high prevalence of latent and chronic infections that can persist at this site. Removal of such pathogens has its own particular problems in an organ dense with sensitive neurons and stringent gateways for immune cell infiltration. Toxoplasma gondii is a common intracellular protozoan parasite that forms a chronic infection in the brain for the lifetime of the host. The infection is controlled, in part, through the effector mechanisms of macrophages that result in the conversion of fast replicating tachyzoites to the slow replicating, cyst forming bradyzoites (Bohne et al., 1994; Gazzinelli et al., 1993;

Gazzinelli et al., 1994; Kim and Boothroyd, 2005; Li et al., 2006). Cysts can form in all tissues but exist predominantly in the brain for the lifetime of the host requiring a continuous immune response to prevent cyst reactivation and Toxoplasmic encephalitis, a common cause of AIDS related fatalities (Luft et al., 1984; Luft and Remington, 1992).

The infection-induced immune response in the brain consists of activated CNS resident cells including astrocytes and microglia, infiltrating CD4+ and CD8+ T cells, peripheral macrophages and substantial tissue remodeling (Drogemuller et al., 2008; Gazzinelli et al., 1996; Wilson et al., 2009; Wilson et al., 2005). Such immune activity in the brain is often associated with a pathological outcome yet despite the high prevalence of infection

Toxoplasma is seemingly controlled without adverse neurological damage. The mechanisms that are involved in the trafficking and control of such a potentially

68 pathological immune response within the CNS are only beginning to be understood

(Drogemuller et al., 2008; Ploix et al., 2011; Wilson et al., 2009; Wilson et al., 2010;

Wilson et al., 2005). The cyst and cyst-forming bradyzoites are poorly immunogenic

(Kim and Boothroyd, 2005; Radke et al., 2003) and although we have known for sometime that T cells are required to prevent cyst reactivation (Gazzinelli et al., 1992;

Luft et al., 1984; Luft and Remington, 1992), very little is understood about the biology of this structure in the brain. Although anti-Toxoplasma drugs are available that efficiently control the tachyzoite, there are no therapies available that can effectively remove the cyst form of the parasite. Thus, the continuous presence of Toxoplasma cysts in the brain presents a critical and constant danger for the immune compromised patient.

It is widely believed that cysts remain intracellular within neurons possibly minimizing their contact with host defense systems (Ferguson and Hutchison, 1987). However it has been known for some time that cyst burden reaches a peak, declines and becomes stable over time pointing to some form of effector mechanism that can target this stage of the parasite (Burke et al., 1994). Studies have implicated CD8+ T cell production of perforin in cyst clearance with perforin deficient mice exhibiting higher cyst burden and susceptibility at the chronic stage of infection (Denkers et al., 1997; Suzuki et al., 2010).

Nevertheless, histological analysis from these studies as well as recent live imaging of cell interactions in the CNS (John et al., 2011) demonstrates monocyte accumulation and contact with cysts.

In recent years, our understanding of macrophages has expanded and we now appreciate these cells’ remarkable plasticity. Thus, although whole populations of macrophages can

69 become polarized to classical or alternative phenotypes associated with protection against protozoan and helminth pathogens respectively, the ability to respond and adapt to local stimuli in the environment is paramount (Redente et al., 2010; Stout et al., 2005; Stout and Suttles, 2004). The role of classically activated macrophages in the control of T. gondii infection is well documented. These cells are a source of IL-12, reactive oxygen and nitrogen species, and GTPases that enable the direct killing of the parasite (Deckert-

Schluter et al., 1999; Drogemuller et al., 2008; Gazzinelli et al., 1994; Melzer et al.,

2008; Nathan and Shiloh, 2000; Scharton-Kersten et al., 1997). However, here we describe a population of CXCR3+ macrophages in the brain following T. gondii infection. These cells express the scavenger receptors MMR and stabilin-1 and produce arginase in response to the presence of Toxoplasma cysts. In addition to these traditional signs of alternative activation, these studies demonstrate that macrophages respond to chitin present in the cyst wall and produce the true mammalian chitinase, AMCase.

Finally, we show that this chitinase activity destroys cysts and is essential for the control of cyst burden within the chronically infected brain.

70 3.3 Results

3.3.1 CXCR3 and ligands are up regulated in the CNS during chronic T. gondii infection.

CXCR3 is required for protective immune responses to T. gondii primarily due to its role in Th1 cell recruitment and most recently for T cell search strategies in the brain (Dufour et al., 2002; Harris et al., 2012; Khan et al., 2000; Norose et al., 2010). To examine the kinetics of CXCR3 expression in the CNS during the chronic stage of infection, we performed RT-PCR on whole brains from mice infected with the Pruigniund strain of T. gondii at various time points following infection up to day 42 post-infection. As expected CXCR3 and its ligands CXCL9 and CXCL10 are upregulated as indicated by both copy number (Figure 3-1 A) and fold induction (Figure 3-1 B). Expression of

CXCR3 transcript is markedly increased in the brains of infected mice beginning at day

21 post infection compared to naïve controls. This time point coincides with the start of chronic infection when tachyzoites in the periphery have been controlled and the parasite remains in the brain in cyst form requiring recruitment of immune cells into the CNS

(Saeij et al., 2005b). Transcript levels for CXCR3 subsequently decrease after day 21, but remain elevated over naïve through 6 weeks post infection. Expression of the ligands

CXCL9 and CXCL10 increases earlier at day 14 but also peaks at day 21 with CXCL9 showing almost a 300-fold increase over naïve (Figure 3-1 B). Although expression levels of these ligands have greater copy number at all time points than their receptor,

71 they follow a similar pattern and remain elevated throughout the chronic stage of infection (Figure 1A, B).

During infection, there are multiple cell types in the brain that may be a source of

CXCR3. This includes CNS resident microglia as well as cells infiltrating from the periphery: T cells and macrophages (Liu et al., 2005). To determine the cells responsible for the increase in CXCR3 in the brain following Toxoplasma infection, brain mononuclear cells were isolated from infected animals and analyzed for expression of

CXCR3. In the absence of infection or ongoing inflammation, no T cells or macrophages are found within the CNS (Mrass and Weninger, 2006). However, during T. gondii infection large numbers of T cells and macrophages continually cross into the brain parenchyma to control the parasite. Analysis of these populations revealed a significant proportion of CD3+ T cells in the infected brain that expressed CXCR3 (Figure 3-1 C),

This is consistent with the known requirement for CXCR3 in the trafficking of Th1 cells and studies using a model of retinal toxoplasmosis (Dufour et al., 2002; Khan et al.,

2000; Norose et al., 2010; Stiles et al., 2006; Yamamoto et al., 2000). However, in addition to T cells, approximately 8% of macrophages isolated from the brain expressed

CXCR3 during the chronic stage of infection (Figure 3-1 D). Infiltrating macrophages can be distinguished from resident microglia by their increased expression of CD45 and

CD11b (Langrish et al., 2005; Wilson et al., 2005). Flow cytometry data revealed

CXCR3 expression on both macrophages and microglia (Figure 3-1 D, E). Although the

CXCR3+ population was not as distinct as that of T cells or macrophages, intrinsic expression by microglia was apparent in cells from naïve brains. Following infection,

72 unlike macrophages, there was no development of a distinct population of CXCR3hi macrophages. Together, these data demonstrate that CXCR3 and its ligands are up regulated during the chronic stages of T. gondii infection and that CXCR3 is expressed by not only infiltrating T cells, but also CNS resident microglia and infiltrating macrophages.

3.3.2 CXCR3 is required for efficient macrophage migration to the CNS.

CXCR3 is required on T cells for efficient migration to the CNS during viral infection and during Toxoplasma infection for control of the parasite during the acute stage of infection (Khan et al., 2000; Norose et al., 2010; Stiles et al., 2006). To assess the role of

CXCR3 for macrophage trafficking into the brain, blocking antibodies for CXCR3 and

CXCL10 were used. Mice were allowed to develop a chronic infection (3 weeks post infection) and then treated with or without blocking antibodies for a further week.

Depletion using antibodies to CXCR3 and its ligand CXCL10 led to a significant decrease in T cell recruitment and a reciprocal increase in parasite burden (Figure 3-2 A -

C). However, in addition, the proportion of macrophages in the brain was significantly reduced (Figure 3-2 D, E), confirming a role for CXCR3 in the maintenance of this cell population. Thus, despite the increased parasite burden macrophage infiltration is significantly decreased by the blockade of CXCR3 signaling. Infiltration of monocytes into the CNS has been shown to occur prior to T cell infiltration (Kim et al., 2009;

Savarin et al., 2010), however depletion of T cells via CXCR3 may indirectly affect the recruitment of macrophages be reducing the expression of necessary chemotactic

73 molecules. Therefore, to determine if the decrease in macrophages was due to a lack of a migratory signal, we performed qPCR for the macrophage chemoattractants CCL2 and

CCL5 (Glass et al., 2004; Held et al., 2004) (Figure 3-2 F). No defect in production of either of these chemokines was apparent; indeed a significant increase in CCL2 and

CCL5 was noted during blockade of CXCR3. These results demonstrate that CXCR3 is required for the migration of not only T cells, but also a proportion of macrophages to the

CNS during the chronic stage of Toxoplasma infection.

3.3.3 A population of AAMΦ in the T. gondii infected brain

Recent studies have identified a substantial increase in tissue remodeling in the brain during chronic T. gondii infection (Wilson et al., 2009). Additionally, there is a continuous need for the clearance of debris from ruptured cysts and dead cells in the brain (Ferguson et al., 1989). To investigate if AAMΦ, known for their role in tissue remodeling and homeostatic clearance, are present during such an event in the CNS, macrophage populations from the infected brain were phenotypically analyzed for the expression of known markers of alternative activation. One of the key molecules that has been associated with a tissue remodeling macrophage phenotype in the CNS is the expression of CXCR3 on microglia (Li et al., 2006; Rappert et al., 2004). To confirm that expression of CXCR3 is associated with alternative activation of macrophages the expression of the scavenger receptor ‘macrophage mannose receptor’ (MMR; also known as Mrc1 and CD206), a key indicator of the AAMΦ phenotype (Stein et al., 1992) was analyzed. Here we show that MMR expression is limited to macrophages and microglia

74 that express CXCR3 (Figure 3-3 A). To quantify MMR expression by macrophages and microglia in the infected brain, qRT-PCR was performed on magnetically isolated

CD11b+ cells from the brains of naive and infected animals. Our results show an approximate 3-fold increase in MMR expression in macrophage populations from infected mice over naïve (Figure 3-3 B). Confirmation of this population in the brain was revealed by immunohistochemical analysis. In situ analysis of MMR+ macrophages revealed small and discrete populations of MMR+ cells (Figure 3-3 C). A further functional marker of alternative activation is the scavenger receptor stabilin-1

(Kzhyshkowska et al., 2006a). Stabilin-1 is involved in the clearance of cell corpses as well as the uptake of extracellular matrix components (Kzhyshkowska et al., 2006c; Park et al., 2009). Expression of MMR co-localized with stabilin-1 as well as the microglia/macrophage marker Iba-1, confirming that these cells display an alternatively activated phenotype (Figure 3-3 C, D). Furthermore, we observed stabilin1 expression on macrophages in close proximity with intact T. gondii cysts in the CNS (Figure 3-3 E).

An important feature of AAMΦ is the cell’s ability to produce arginase-1, which acts on its substrate, L-arginine to produce L-ornithine, a precursor to collagen (Kreider et al.,

2007). L-arginine is also the substrate for NO synthase and the two enzymes compete for substrate availability and are regulated by Th1 and Th2 type cytokines (Hesse et al.,

2001; Rutschman et al., 2001). Previous studies have demonstrated that direct infection of macrophages by T. gondii tachyzoites can induce arginase expression via STAT-6 dependent and independent pathways (Butcher et al., 2011; El Kasmi et al., 2008; Jensen et al., 2011). Furthermore, these studies imply that such an induction is a survival strategy

75 enlisted by the parasite to inhibit killing via NO. To assess whether or not macrophages and microglia in the infected brain produce arginase, CD11b+ BMNCs from infected mice were isolated and analyzed for arginase-1 expression by qRT-PCR. Our results show almost a 2-fold increase in arginase-1 expression in cells from infected brains over naïve (Figure 3-3 F). In contrast, these cells did not express IL-10 ruling out an anti- inflammatory phenotype (Figure 3-3 G) (Verreck et al., 2004). Thus, during chronic T. gondii infection there is a population of AAMΦ in the CNS characterized by expression of CXCR3, MMR, stabilin-1 and the production of arginase-1.

3.3.4 Alternatively activated macrophages secrete an active chitinase in the CNS in response to the presence of chitin in the cyst wall

During chronic infection, there are several forms of the parasite that could be the source of the infection-associated stimulus for alternative activation of macrophages in the CNS. Since latent cysts are the most prevalent form of infection in the brain, an attractive candidate for the source of this stimulus is the presence of chitin in the cyst wall (Boothroyd et al., 1997; Coppin et al., 2003). Indeed, it has been shown that the presence of chitin induces the recruitment of macrophages that have an alternatively activated phenotype (Da Silva et al., 2008; Reese et al., 2007). It is therefore possible that the presence of cysts may be the stimulus for this population of cells. To determine if sources of T. gondii can induce alternative activation, tachyzoites, bradyzoites, and cysts were added to bone marrow derived macrophage (BMDM) cultures and the production of urea, a downstream product of arginase activity, was measured (Munder et al., 1998). In addition, soluble antigen derived from freeze-thawed tachyzoites (sTAg) and whole cysts

76 (cystAg) was assessed for their ability to induce urea (Figure 3-4 A). Our results show a baseline production of urea in unstimulated (media) macrophage cultures, possibly due to the presence of M-CSF (Lari et al., 2007). This significantly increased (p<0.001) during AAMΦ polarization with IL-4. Despite the known ability of tachyzoites to induce arginase production (El Kasmi et al., 2008), tachyzoite infection of macrophages did not lead to significant production of urea (Figure 3-4 A). This can be attributed to the use of a type II strain a weak inducer of arginase-1 (Butcher et al., 2011; Jensen et al., 2011). However, addition of cysts or cyst antigen but not “naked” bradyzoites, did lead to a significant increase in urea production although not as great as induction of alternative activation by IL-4 (Loke et al., 2002; Stein et al., 1992). This points to components of the cyst wall as the stimulus for AAMΦ. Taken together, these data demonstrate that macrophages can be alternatively activated by the presence of T. gondii cysts, but not free replicating parasites.

Chitinase activity has been demonstrated in certain populations of AAMΦ in both mice and humans (Boot et al., 2001; Reese et al., 2007; van Eijk et al., 2005). Chitinolytic activity by macrophages has also been implicated in host defense against chitin- containing fungal pathogens (Boot et al., 2001; Renkema et al., 1995). To test whether or not chitinase activity is induced by Toxoplasma infection, a chitinase assay was performed on whole brain lysates from naïve and infected animals. Three chitin substrates labeled with 4-methylumbelliferone (4MU) were used to assess the type of chitinase activity present. Upon hydrolysis, 4MU is released and can be measured fluorometrically to determine chitolytic activity. Our data reveal that chitinase activity is significantly increased in the brains of infected mice as compared to the naïve group in

77 only one of the three substrates (Figure 3-4 B). 4MU N-acetyl-β-D-glucosaminide is a substrate suitable for detection of exochitinase activity where the enzyme degrades the non-reducing end of the chitin (McCreath and Gooday, 1992). Several studies have linked chitinases and chitinase-like proteins to inflammation (Kzhyshkowska et al.,

2006b; Nair et al., 2005; Sohn et al., 2010). This family of 18 glycosyl hydrolases is typically induced during Th2 type immune responses and plays a role in tissue remodeling, fibrosis, and the modulation of both the innate and adaptive immune response (Lee et al., 2011). Acidic mammalian chitinase (AMCase) and chitotriosidase

(CHIT1) are unique members of this family in that they possess an enzymatically active domain that hydrolyzes the β 1-4 linkages that exist in chitin (Boot et al., 2001; Renkema et al., 1995). qRT-PCR analysis of naïve and infected brains demonstrated a significant upregulation of AMCase but not CHIT1 (Figure 3-4 C: and data not shown). Since chitin as been shown to activate and recruit AAMΦ, the cyst wall may serve as the stimulus for chitinase activity in this population of cells. To test this further, BMDM were cocultured with different forms of the parasite (Figure 3-4 D). The addition of tachyzoites, bradyzoites or sTAg did not lead to chitinase production (Figure 3-4 D). In contrast, live cysts and cyst antigen led to a significant increase in chitinase production that was abolished following chitinase treatment of cysts (Figure 3-4 D, E). Furthermore, treatment with IL-4 to induce alternative activation in macrophages did not lead to increased chitinase activity. These data suggest that the presence of chitin in the cyst wall induces a phenotype of macrophage characterized by the production of chitinase and distinct from IL-4 induced activation.

Previous work has shown macrophages in close association with rupturing cysts

(Ferguson et al., 1989; Suzuki et al., 2010) and the presence of an active chitinase could point to a role for these cells in the breakdown of cysts within the brain. Recognition of chitin by macrophages is size dependent and likely contact dependent (Da Silva et al.,

2009; Da Silva et al., 2008; Shibata et al., 1997b). To test this, we cocultured cysts separated from macrophages using 5µm transwell inserts and assayed for urea and chitinase activity as previously described (Fig 3-4 A, D). Our results show no increase in either urea production or chitinase activity, confirming that the observed alternative activation is dependent on contact with cysts or cyst antigen.

Immunohistochemical analysis of the location of AMCase secreting macrophages in the infected brain shows them in close proximity with tissues cysts (Figures 3-5 A-C). As a proportion of macrophages and microglia in the brain, alternatively activated cells are in the minority and it was not possible to find such cells in the naïve brain. However, cysts are easily identifiable with a highly spherical distinct morphology, can stain non- specifically with antibodies and individual bradyzoites within the cyst are visible by

DAPI staining. Examination of chitinase localization in the infected brain revealed distinct cytoplasmic staining of several cells, nearly all of which were within 75mm of a cyst. Although there were cells that were AMCase positive yet did not stain positively for macrophage/microglial markers, there were clearly several macrophages in close association with cysts that displayed chitinase activity polarized to the cyst wall (Figure

3-5 A). Furthermore, images provided in Figure 3-5 B show an alternatively activated

79 macrophage as judged by its expression of stabilin-1, adhering closely to a large round cyst. Polarized, again to the site of macrophage ‘attachment’, bradyzoites are seen escaping in an organized fashion towards or into the AAMΦ (Figure 3-5 B, arrows).

Taken together, these data suggest that the induction of chitinase activity in macrophages occurs in close proximity with the cyst wall and that this distinct population of macrophages is responsible for attacking the long-term chronic cyst stage of Toxoplasma via chitinase activity.

3.3.5 Macrophage chitinase activity is required to lyse cysts in vitro

The prevailing view is that cysts in the brain remain intracellular within neurons and that

CD8+ T cell production of perforin is responsible for cyst clearance in the brain although the exact mechanism of cyst destruction has yet to be described (Denkers et al., 1997;

Suzuki et al., 2010). In order to determine whether macrophage chitinase activity could be responsible for the direct lysis of cysts, BMDM were co-cultured with cysts with and without the chitinase inhibitor allosamidin. Cultures were observed for 14 hours capturing images every 10 minutes. Cysts observed in the absence of macrophages remained intact for the entire time course suggesting no parasite intrinsic mechanism of cyst destruction (Figure 3-6 A). In contrast, the addition of 20ug/ml trichoderma chitinase to cyst cultures led to rapid rupture of the cysts within an average of 4hrs, releasing bradyzoites into the media (Figure 3-6 B). Strikingly, cysts that were cultured with macrophages came under vigorous attack. This involved efficient and rapid migration of macrophages toward the cyst creating clusters of macrophages that could be

80 seen pulling at the cyst wall (Figure 3-6 C). In these cultures, most of the cysts were destroyed during the observation period with the average survival time of 9.5 hours

(Figure 3-6 E). In contrast, cysts cultured in the presence of macrophages and the chitinase inhibitor allosamidin survived significantly longer than in untreated cultures.

Although there appeared to be no defect in the recruitment and activity of macrophages to cysts with similar clustering and ‘pulling’ of the cyst wall, the majority of cysts survived the entire 14 hour period when treated with either 100µM or 10µM allosamidin (Figure 3-

6 D). Decreasing concentrations of allosamidin led to a dose dependent decrease in cyst survival time (Figure 3-6 E). These results demonstrate that macrophages can induce cyst lysis in a chitinase dependent manner.

Although both AMCase and CHIT1 are upregulated in certain bacterial and nematode infections, (Cozzarini et al., 2009; Nair et al., 2005) only AMCase was significantly increased in the brain following Toxoplasma infection (Figure 3-4 C) . To confirm that

AMCase is responsible for the observed chitinase activity, we performed a chitinase assay similar to that in Figure 1D using BMDM from WT and AMCase null mice (Figure

3-7 A). Our results reveal a severe defect in chitinase production by AMCase null macrophages. Indeed, these cells showed a significantly lower baseline level of chitinase and were unresponsive to the addition of cysts. To test whether the ability to destroy cysts is dependent on this enzyme, BMDM from WT and AMCase -/- mice were stained with CellTracker green and cultured with cysts containing RFP-expressing parasites. WT non-polarized macrophages were able to lyse cysts in 10 hours as shown previously

(Figures 3-7 A, D). In contrast, cysts cultured with AMCase -/- macrophages had a

81 significantly increased survival time over WT macrophages consistent with AMCase being the source of chitinase activity (Figures 3-7 B, D). To determine the role of macrophage polarization, macrophages were treated with cytokines to polarize them to classical or alternative phenotypes prior to cyst addition. IL-4 priming had no effect on cyst survival time, suggesting that cytokine-induced alternative activation does not enhance the ability to destroy cysts. (Figures 3-7 D). In contrast, macrophages that were classically polarized with LPS and IFN-g showed a defect in chitinase activity and cyst destruction (Figures 3-7 D, E). Suggesting that polarization of macrophages is required but that chitin is the most likely source of alternative activation and not IL-4. Taken together, these data demonstrate that macrophages lyse cysts in an AMCase-dependent manner in vitro.

3.3.6 AMCase dependent control of parasite burden in vivo

The consequences of chitinase dependent cyst lysis in the CNS could potentially benefit either the host or the parasite. If the escaping bradyzoites were quickly killed by macrophages or associated immune cells, we would expect this mechanism to benefit the host and result in a lower parasite burden. Conversely, if bradyzoites are able to propagate and infect new cells, this could be a mechanism that promotes the persistence of the parasite in the CNS. To investigate the role of AMCase in the brain in vivo, we infected WT and AMCase deficient mice and analyzed the immune response and parasite burden in the absence of chitinase activity. To ensure than AMCase deficiency does not result in immune defects during the acute stage of infection, tissue samples from lungs

82 were taken at day 7 and analyzed for parasite burden by qPCR. No significant differences in lung parasite load were found and serum IL-12 and IFN-g concentrations were equivalent (Figure 3-8 A-C). At 5 weeks post infection, when systemic inflammation has been controlled and parasites are located solely in the brain predominantly as cysts containing bradyzoites (Saeij et al., 2005a; Saeij et al., 2005b) parasite burden was evaluated. In the absence of AMCase, there was a significant increase (p= 0.0014) of approximately 2-fold in the total number but not the size of cysts in the brain (Figures 3-8 D, E). In addition, total parasite burden in the CNS as measured by qPCR was significantly greater by more than 2-fold (p= 0.0055) (Figure 3-8 F) correlating with the appearance of more cysts histologically (Figure 3-8 H). In addition, parasite burden was evaluated using RT-qPCR with stage-specific primers identifying tachyzoite (SAG1), bradyzoite (SAG4), and cyst (MAG1) specific transcripts (Contini et al., 2002) (Figure 3-9). Our results show similar increases in parasite burden for all three transcripts, suggesting that the failure to lyse cysts leads not only to an inability to remove cysts, but that this results in an increase in bradyzoite and conversion to tachyzoite. Flow cytometric analysis revealed no differences in infiltrating CD4+, CD8+

T cells, or macrophage populations (Figure 3-8 G). Therefore, the increase in parasite burden is not due to a defect in infiltrating effector immune cells. Furthermore, AMCase-

/- mice failed to survive and succumbed to infection beginning at six weeks (p=0.0177)

(Figure 3-8 I). These results demonstrate that AMCase activity is required for the protective immune response to T. gondii during chronic infection in the brain and that

83 AMCase mediated cyst lysis in the CNS is a beneficial mechanism for the host to control parasite burden at non-lethal levels.

84 3.4 Discussion

Chronic infections represent a continuous battle between the host’s immune system and pathogen replication. Many protozoan parasites and fungal pathogens have evolved a cyst lifecycle stage that provides it with increased protection from environmental degradation as well as endogenous host mechanisms of attack (Aguilar-Diaz et al., 2011; Shapiro et al., 2009). In the case of Toxoplasma, these cysts are predominantly found in the immune protected brain making clearance of the parasite more difficult and resulting in a lifelong infection. Here we describe three novel findings 1) despite a dominant Th1 immune response during Toxoplasma infection there exists a population of macrophages in the infected brain which display a distinct alternatively activated phenotype ; 2) these cells are responsible for chitinase dependent lysis of Toxoplasma cysts and 3) this chitinase activity is through the production of AMCase which is required to maintain chronicity of infection and protective immune responses.

Multiple studies have demonstrated the role of CXCR3 and its ligands in the migration of activated T cells during Th1 immune responses including to sites of infection (Hsieh et al., 2006; Stiles et al., 2006). It is also known that the chemokines CXCL9 and CXCL10 are induced by the presence of the proinflammatory cytokine, IFN-g (Dufour et al., 2002;

Khan et al., 2000; Liu et al., 2001; Norose et al., 2010; Stiles et al., 2009). More recently, however, the function of this family of chemokines has expanded to include neural-glial signaling following brain lesion where injured neurons upregulate CXCL10 and recruit

CXCR3 expressing microglia to phagocytose denervated dendrites (Rappert et al., 2004).

85 Consistent with this, another recent study has implicated CXCR3 in the function of perivascular macrophages and their ability to remodel the vasculature during stress (Zhou et al., 2010). We noted upregulation of CXCR3, CXCL9 and CXCL10 in the brain during chronic Toxoplasma infection. Furthermore, CXCR3 was preferentially expressed on macrophages expressing the scavenger receptors MMR and stabilin-1, suggesting an alternatively activated phenotype for these cells. Previous studies have established important functions of AAMΦ in the context of helminth infections such as control of inflammation (Kreider et al., 2007), wound healing (Satoh et al., 2010), and parasite expulsion (Anthony et al., 2006). Competitive metabolism of l-arginine by arginase-1 leads to the production of proline and other ECM precursors (Hesse et al., 2001) and is a definitive marker of alternative activation in macrophages (Mosser and Edwards, 2008).

T. gondii can exploit the arginine metabolic pathway via STAT6 dependent and independent pathways, and induce arginase-1 expression in macrophages (Butcher et al.,

2011; El Kasmi et al., 2008; Jensen et al., 2011) suppressing nitric oxide production and promoting survival. This process is dependent on the Toxoplasma rhoptry kinase, ROP16 which is absent in type II strains such as the Pruigniund and Me49 strains. This would explain the lack of arginase activity we observed in macrophages infected with tachyzoites. We did, however, observe a significant increase in arginase activity following treatment with cysts and cystAg suggesting that this induction is not a result of infection by the replicating parasite, but rather by the presence of chitin in the cyst wall.

This weak induction of arginase activity also points to a limited role for arginase-1 in the chitin-induced phenotype.

Chitin is found in the exoskeletons of insects, fungal cell walls, sheaths of parasitic nematodes, and is a component of the T. gondii cyst wall (Boothroyd et al., 1997; Coppin et al., 2003). The presence of this exogenous molecule can induce the recruitment of

AAMΦ, basophils, neutrophils, and eosinophils (Reese et al., 2007; Shibata et al., 2000;

Zhu et al., 2004). Active chitinases such as AMCase and chitotriosidase are secreted by macrophages in response to chitin-containing pathogens and have been shown to inhibit hyphal growth of chitinous fungi such as Candida and Aspergillus (Boot et al., 2001;

Renkema et al., 1995). In this study, we demonstrate for the first time, macrophage chitinase activity in response to a protozoan pathogen. Chitin recognition is thought to be a size dependent process and involve a combination of TLR2 and scavenger receptors such as MMR and dectin-1 (Da Silva et al., 2009; Da Silva et al., 2008; Shibata et al.,

1997b). It will be of interest in future studies to determine the role of these molecules in cyst containment during Toxoplasma infection. However, the likelihood is that this is a contact-dependent process via pattern recognition receptors. Indeed, cysts were unable to induce urea production or chitinase activity in macrophages when separated by transwell membranes. Furthermore, analysis of the location of AMCase producing cells in the brain finds them reliably close to cysts and often in direct contact with reactivating cysts.

These images clearly show that despite the presence of many DAPI positive cells surrounding the cyst, the escape of parasites through the cyst wall occurs juxtaposed to the macrophage. Our data suggest that the presence of cyst antigens induces alternative activation of macrophages and that these antigens are required for macrophages to

87 produce chitinase even in the presence of IL-4. Thus, alternative activation of macrophages is not sufficient for AMCase production and chitinase activity.

Live imaging in vitro demonstrated AMCase dependent degradation of cysts as shown using both a chitinase inhibitor and AMCase-/- macrophages. Although there is no evidence of an active chitinase produced by T. gondii, the similar cyst survival times observed for AMCase-null macrophages and chitinase inhibited macrophages exclude this possibility. The chitin dependent induction of chitinase activity implies that macrophages have access to the chitin in the cyst wall prior to chitinase-mediated cyst destruction. The prevailing view from ultrastructure studies is that cysts remain intracellular within neurons yet analysis of cyst burden over time shows a reduction in cyst numbers implying a mechanism of control. Several studies have demonstrated perforin dependent control of cyst burden during chronic infection . We suggest that instead of a direct effect of perforin on cysts, it is most likely that perforin production by

CD8+ T cells may initiate this process by lysing the cyst infected cell, thus exposing the cyst wall to chitinase activity from macrophages. This model would explain the many observations of macrophages in close association with rupturing cysts (Ferguson et al.,

1989; John et al., 2011; Suzuki et al., 2010).

AMCase mediated immunity is required for protective immunity during the chronic stage of infection as its absence during the acute stage of infection had no significant effect on parasite burden or cytokine production. Our observation of a higher cyst count and parasite burden as well as decreased survival in AMCase-null mice points to a specific and important role for chitinase mediated cyst lysis in the brain during chronic infection.

88 Thus, within the brain, cyst containment seems as important as the killing of free parasites in the control of pathology. In addition, continuous chitin-mediated attack by macrophages and the release of parasites from latent cysts will provide a constant source of antigenic stimulation for the immune response. This latter discovery may provide an explanation for the continuous recruitment of T cells into the brain.

In these studies, we demonstrate the presence of a distinct population of macrophages in the brain during chronic Toxoplasma infection, which express CXCR3, MMR, stabilin-1 and arginase-1. Furthermore, these macrophages have chitinase activity, are localized to cysts and are observed in association with cyst degradation. The mechanism of this cyst degradation is dependent on AMCase and this enzyme is required for survival during chronic infection. The continuous presence of Toxoplasmic cysts in the brain and other tissues presents a constant threat of reactivation to the immune compromised patient.

Mechanisms that enhance cyst removal or prevent their reactivation would provide a novel line of anti-parasitic therapies.

89 3.5 FIGURES AND LEGENDS

Figure 3-1. Expression of CXCR3 and its ligands during chronic T. gondii infection. (A-E) C57Bl/6 mice were infected with the Me49 strain of T. gondii and sacrificed at days 7, 14, 21, 28, 35, and 42 post-infection (p.i.). (A-B) BMNCs were isolated from mice at and RNA was isolated and reverse transcribed. cDNA was analyzed for levels of CXCR3, CXCL9, and CXCL10 transcripts using qRT-PCR.

Results are shown as (A) absolute quantitation using a standard curve as a ratio to HPRT and (B) fold change over naive. (C-E) BMNC from 28 day infected mice and splenic were isolated and stained with fluorescent conjugated antibodies to identify % CXCR3 expression on T cell (CD3), macrophage (CD45hi/CD11b+), and microglial

(CD45hi/CD11b+) populations. Isotype controls for CXCR3 are shown in grey. Data are displayed as mean ± SEM and are representative of at least 4 individual experiments.

91 Figure 3-2. CXCR3 is required for efficient macrophage migration to the CNS.

C57Bl/6 mice were infected with the Me49 strain of T. gondii. Neutralizing antibodies for CXCR3 and CXCL10 were administered beginning at 21 days post infection and mice were sacrificed on day 28 after infection. (A-E) BMNCs were isolated from treated and untreated mice and (A) total cell counts were obtained using hemacytometer. (B, D-

E) BMNCs were stained and analyzed for cellular composition using flow cytometry.

The proportions of (B) T cells (CD3), (D-E) macrophages (CD41hi/CD11b+), (D, F) and microglia (CD45int/CD11b+) were multiplied by total BMNC count for absolute quantitation. (C) DNA was isolated from the brains of treated and untreated mice and parasite burden was determined by qPCR analysis. (F) RNA was extracted from the brains of treated and untreated mice and reverse transcribed. cDNA was analyzed by qPCR for expression of CCL2 and CCL5 transcript. Results are shown as absolute quantitation using a standard curve as a ratio to HPRT .Data are representative of at least

2 individual experiments with a minimum of n=3 and are represented as mean ± SEM, * p < 0.05, ** p< 0.01.

93 Fig 3-3 Alternatively activated macrophages in the brain during chronic T. gondii infection. (A-E) C57Bl/6 mice were infected with the Me49 strain of T. gondii and sacrificed on day 28 post-infection (p.i.). (A) Brain mononuclear cells (BMNC) were isolated and analyzed for surface expression of CXCR3 and MMR. Mean ± SEM percentage MMR positive cells from CXCR3- (left) and CXCR3+ (right)

CD45hi/CD11b+ macrophages. (B, F) BMNCs were isolated from mice at 4 weeks p.i. and CD11b+ cells were magnetically purified by positive selection. RNA was isolated and reverse transcribed and cDNA was analyzed for levels of (G) MMR transcript using qRT-PCR. Results are shown as absolute quantitation of MMR using a standard curve as a ratio to HPRT. (C-D) Confocal fluorescence microscopy of 20µm brain slices taken from mice at 4 weeks post infection. (C) Panels from left to right show MMR (green),

Iba-1+ macrophages (red), and merged images in the infected brain with DAPI (blue).

(D) Panels from left to right show MMR (green), stabilin1 (red), and merged images in the infected brain with DAPI (blue). (E) Panels from left to right show tomato lectin

(green), stabilin1 (red), and merged images in the infected brain with DAPI (blue). (F)

MMR transcript using qRT-PCR. (G) Brain mononuclear cells (BMNC) were isolated and analyzed by intracellular staining for IL-10 expression by macrophages

(CD45hi/CD11b+) expressing CXCR3 with isotype control (left panel). Results are shown as absolute quantitation of MMR using a standard curve as a ratio to HPRT. Data are represented as mean ± SEM, * p < 0.05.

95 Figure 3-4 Macrophages produce active chitinase in the CNS in response to the presence of cysts. (A) BMDM were analyzed for arginase activity by measuring urea.

BMDM were cultured overnight with bradyzoites, tachyzoites, sTAg, whole cysts, cysts separated by 5µm transwell membranes (cysts/TW), cystAg, IL-4, or media alone and urea measured colormetrically. (B) C57Bl/6 mice were infected with the Me49 strain of

T. gondii., sacrificed on day 28 p.i. and lysates from whole brains were analyzed for chitinase activity fluorometrically. (C) qRT-PCR analysis of AMCase expression from whole brain RNA normalized to GAPDH. (D) BMDM were analyzed for chitinase activity fluorometrically. Macrophages were cultured with tachyzoites, sTAg, bradyzoites, whole cysts, cysts separated by 5µm transwell membranes (cysts/TW), cystAg, IL-4 or media alone. (E) Bone marrow derived macrophages were analyzed for chitinase activity fluorometrically. Macrophages were cultured with whole cysts, cysts treated with trichoderma chitinase or media alone. Data are representative of at least 3 individual experiments with a minimum of n=3 and are represented as mean ± SEM, * p

< 0.05, ** p < 0.01, *** p < 0.001.

97 Figure 3-5 Chitinase expressing AAMΦ are in close association with cysts in the

CNS. (A-B) Confocal fluorescence microscopy of 20µm brain slices taken from mice at

4 weeks post infection. (A) Panels from left to right show tomato lectin staining for macrophages (green) and AMCase (red). Merged images in the infected brain with DAPI

(blue) identifying the cyst. (B) Panels from left to right show tomato lectin staining for macrophages (red), Toxoplasma gondii (purple) and AMCase (red). Merged images in the infected brain show disrupted cyst. (C) Panels show tomato lectin staining for macrophages (red), Toxoplasma gondii (purple), DAPI (blue) and AMCase (red).

Merged images in the infected brain show location of macrophages in relation to cysts, arrows identify colocalization of AMCase with tomato lectin. (D) Panels from left to right show Iba1+ macrophages (top, red), Stabilin1 (bottom, green), DAPI (blue) to identify cyst and escaping parasites (arrows), and merged images in the infected brain.

99 Figure 3-6 Macrophage chitinase is required to lyse cysts in vitro. (A-E) Cysts purified from the brains of Me49 infected mice were cultured with or without BMDM in a 96 well plate. Cultures were imaged using an HT pathway microscope for 14 hours.

Images were collected every 10 minutes and cyst survival time was calculated (A-D)

Time-lapse images were taken from (A) cysts alone without macrophages, (B) cysts treated with 10µg/ml trichoderma chitinase, (C) cysts with untreated macrophages, and

(D) cysts with macrophages treated 100µM allosamidin. (E) Graph of allosamidin concentration and cyst survival time. Data are representative of at least 3 individual experiments with a minimum of n=6 and are represented as mean ± SEM, * p < 0.05.

100

101 Figure 3-7 Acidic mammalian chitinase is required to lyse cysts in vitro. (A)

BMDM from WT and AMCase -/- mice were analyzed fluorometrically for chitinase activity. Chitinase activity from WT and AMCase -/- macrophages cultured with bradyzoites, tachyzoites, whole cysts, IL-4 or media alone. (B-D) Me49-RFP cysts purified from the brains of infected mice were cultured with or without CellTracker green labeled bone marrow derived macrophages from either WT and AMCase null mice in a

96 well plate. Cultures were imaged using an HT pathway microscope for 16 hours.

Images were collected every 10 minutes and cyst survival time was calculated (B-C)

Time-lapse images were taken from cyst cultures (B) WT macrophages or (C) AMCase -

/- macrophages. (D) Graphical representation of cyst survival time over 16 hours. (E)

Chitinase activity from WT bone marrow-derived macrophages cultured with whole cysts, whole cysts + LPS/IFN-γ, or media alone. Data are representative of at least 3 individual experiments with a minimum of n=6 and are represented as mean ± SEM, * p

< 0.05, ** p < 0.01 *** p < 0.001.

102

103 Figure 3-8 AMCase-/- mice have a higher parasite burden in the brain and succumb to infection during the chronic stage of infection. (A-C) C57Bl/6 (WT) and

AMCase -/- mice were infected with the Me49 strain of T. gondii and sacrificed at 7 days following infection. (A) DNA was isolated from the lungs and analyzed for parasite burden using qPCR. Results are displayed as parasites per mg tissue. (B-C) Serum was isolated from whole blood samples and analyzed for (B) IL-12 and (C) IFN-γ. (D-F)

C57Bl/6 (WT) and AMCase -/- mice were infected with the Me49 strain of T. gondii and sacrificed at 5 weeks following infection. Brains were harvested and analyzed for cyst burden, cellular composition and histology. (D) Cyst counts were obtained from homogenized whole brain samples. (E) 20 cysts from each mouse were photographed microscopically and cyst area was determined using ImageJ software. (F) DNA from brains of WT and AMCase-/- was isolated and analyzed for parasite burden using qPCR.

(G) BMNCs were isolated and analyzed for expression of CD4 T cells, CD8 T cells, macrophages (CD45hi/CD11b+) and microglia (CD45hi/CD11b+) by flow cytometry. (H)

Whole brains were fixed, frozen and stained for H&E to examine cyst burden and pathology. (I) Survival data from C57Bl/6 (squares, n=7) and AMCase -/- (triangles, n=7). Significance was determined using log rank test with p = 0.0177. Data are representative of at least 2 individual experiments with a minimum of n=4 and are represented as mean ± SEM, ns = not significant, * p < 0.05, ** p< 0.01.

104 105 Figure 3-9 Transcripts for tachyzoite, bradyzoite and cyst genes are increased in the brains of AMCase-null mice. C57Bl/6 (WT) and AMCase -/- mice were infected with the Me49 strain of T. gondii and sacrificed at 5 weeks following infection. RNA was isolated from infected brains, reverse transcribed, and the resulting cDNA was analyzed for SAG1, SAG4, and MAG1 transcript levels using qRT-PCR to measure gene expression from tachyzoites, bradyzoites and cysts, respectively. Results are shown as absolute quantitation of copy number using standard curve. Data are representative of at least 3 individual experiments with a minimum of n=3 and are represented as mean ±

SEM, ** p< 0.01, *** p < 0.001.

106

107 CHAPTER FOUR

Conclusions and Perspectives

108 The study of the protozoan parasite Toxoplasma gondii has yielded some wonderful insight into the pathogenicity of chronic infections and the immune response required for control. Despite all of this research, however, there are still no effective therapies able to completely clear this infection. The urgency of developing an effective cure for Toxoplasmosis was revealed in the 1980s during the AIDS crisis, when thousands of patients died from Toxoplasmic encephalitis (Luft and Remington, 1988).

Still today, immune compromised patients that are infected with the parasite must adhere to a regimen of sulfa drugs and live with the adverse side effects and the constant danger of relapse (Fung and Kirschenbaum, 1996). In recent years, however, new mechanisms of parasite control and clearance have been revealed that provide hope for new and effective therapies. The key to a cure for Toxoplasmosis may lie in the natural ability of the immune system to control and even clear the replicating parasite.

This dissertation explores two distinct mechanisms of controlling parasite burden in the CNS. First, a novel role for the matricellular protein SPARC, is described, in the proper assembly of a migratory network of reticular fibers during chronic infection. Data presented here demonstrated that SPARC is upregulated in infected regions of the brain following infection. Immunoreactivity of SPARC is localized to long tubular strands in the CNS that are associated with parasite cysts and migrating cells. These strands are similar in nature to a network of extracellular fibers that acts as a substrate for chemokines and migrating cells (Wilson et al., 2009). It is hypothesized that these fibers exist as a mechanism for cells to migrate from meningeal and perivascular spaces to the sites of infection within the parenchyma. Since SPARC is known to regulate the

109 assembly of similar migratory networks in the lymph node and tumor microenvironment

(Chlenski et al., 2006; Sangaletti et al., 2005; Yunker et al., 2008), I hypothesized that

SPARC is involved in the regulation of the migratory network in the CNS following infection. The in vivo studies using transgenic mice and advanced imaging techniques presented here, reveal that in the absence of SPARC, there is an inadequate induction of migratory fibers in the brain resulting in a reduced ability of immune cells to migrate into the parenchyma and an increased susceptibility to the parasite. Very little is currently known about cell migration within the parenchyma, and this study sheds light on a new mechanism that will require further investigation. The chemokine CCL21 has recently been identified as a requirement for CD4+ T cells to migrate into the parenchyma (Ploix et al., 2011). It is thought that this chemokine associates with the network of fibers in the brain to facilitate the migration of these cells. Further investigation will be needed to determine if CCL21 interacts with SPARC to facilitate this migration. Additionally, the behavior of migrating cells in the absence of SPARC is also unknown. Since SPARC has the ability to mediate interactions between migrating cells and the ECM, it is possible that the direction, velocity or displacement of these cells will be affected by the lack of

SPARC. Live imaging studies will be needed to determine any behavioral differences of migrating cells in the CNS between WT and SPARC-null mice.

Also described here is a novel mechanism of cyst clearance in the CNS during chronic infection. My data show the presence of a population of alternatively activated macrophages in the brain that secrete the active chitinase, AMCase, in response to chitin in the cyst wall. Using both chemical and genetic inhibition in vitro, I have

110 mechanistically shown that this enzyme is required for efficient degradation and destruction of the cyst. The necessity for AMCase was demonstrated in vivo, as the absence of the enzyme resulted in a significant increase in cyst burden and decrease in survival during chronic infection. Previous studies suggested a mechanism of cyst clearance in the brain that involves perforin dependent lysis of the host cell by CD8+ T cells (Denkers et al., 1997; Suzuki et al., 2010). My results here are congruent with these studies as host cell lysis would presumably be a requirement to expose the cyst wall to immune cells in the brain. Further study will be necessary to determine whether this process is dependent on CD8+ T cells. Additionally, the mechanisms behind the recognition of chitin are largely unexplored. Although this is thought to be a size dependent process possibly involving dectin-1, MMR and TLR2 (Da Silva et al., 2009;

Shibata et al., 1997b), it is unclear whether any of these receptors are involved in the recognition of chitin in the cyst wall. Although chitin is determined to be a component of the cyst wall, it is unknown whether other components are required for recognition or for the polarization of these macrophages. Further study will be needed to identify the receptors involved in the recognition of chitin in the cyst wall and the mechanisms behind the induction of this macrophage phenotype.

Together, these studies identify two important mechanisms of parasite control and cyst clearance in the CNS. It is my hope that further study in these areas will lead to new and effective therapies for treatment of Toxoplasmosis and other chronic infections.

111 REFERENCE

112 Aguilar-Diaz, H., Carrero, J.C., Arguello-Garcia, R., Laclette, J.P., and Morales-Montor, J. (2011). Cyst and encystment in protozoan parasites: optimal targets for new life-cycle interrupting strategies? Trends Parasitol 27, 450-458.

Anthony, R.M., Urban, J.F., Alem, F., Hamed, H.A., Rozo, C.T., Boucher, J.-L., Van Rooijen, N., and Gause, W.C. (2006). Memory T(H)2 cells induce alternatively activated macrophages to mediate protection against nematode parasites. Nat Med 12, 955-960.

Arnold, S.A., and Brekken, R.A. (2009). SPARC: a matricellular regulator of tumorigenesis. J Cell Commun Signal 3, 255-273.

Asperti-Boursin, F., Real, E., Bismuth, G., Trautmann, A., and Donnadieu, E. (2007). CCR7 ligands control basal T cell motility within lymph node slices in a phosphoinositide 3-kinase-independent manner. J Exp Med 204, 1167-1179.

Bajenoff, M., Egen, J.G., Koo, L.Y., Laugier, J.P., Brau, F., Glaichenhaus, N., and Germain, R.N. (2006). Stromal cell networks regulate lymphocyte entry, migration, and territoriality in lymph nodes. Immunity 25, 989-1001.

Bajenoff, M., Egen, J.G., Qi, H., Huang, A.Y., Castellino, F., and Germain, R.N. (2007). Highways, byways and breadcrumbs: directing lymphocyte traffic in the lymph node. Trends Immunol 28, 346-352.

Bleau, G., Massicotte, F., Merlen, Y., and Boisvert, C. (1999). Mammalian chitinase-like proteins. EXS 87, 211-221.

Bliss, S.K., Gavrilescu, L.C., Alcaraz, A., and Denkers, E.Y. (2001). Neutrophil depletion during Toxoplasma gondii infection leads to impaired immunity and lethal systemic pathology. Infect Immun 69, 4898-4905.

Bohne, W., Heesemann, J., and Gross, U. (1994). Reduced replication of Toxoplasma gondii is necessary for induction of bradyzoite-specific antigens: a possible role for nitric oxide in triggering stage conversion. Infect Immun 62, 1761-1767.

Boot, R.G., Blommaart, E.F., Swart, E., Ghauharali-van der Vlugt, K., Bijl, N., Moe, C., Place, A., and Aerts, J.M. (2001). Identification of a novel acidic mammalian chitinase distinct from chitotriosidase. J Biol Chem 276, 6770-6778.

Boothroyd, J.C., Black, M., Bonnefoy, S., Hehl, A., Knoll, L.J., Manger, I.D., Ortega- Barria, E., and Tomavo, S. (1997). Genetic and biochemical analysis of development in Toxoplasma gondii. Philos Trans R Soc Lond B Biol Sci 352, 1347-1354.

Bornstein, P., and Sage, E.H. (2002). Matricellular proteins: extracellular modulators of cell function. Curr Opin Cell Biol 14, 608-616.

113 Bosman, F.T., and Stamenkovic, I. (2003). Functional structure and composition of the extracellular matrix. J Pathol 200, 423-428.

Bradshaw, A.D. (2009). The role of SPARC in extracellular matrix assembly. J Cell Commun Signal 3, 239-246.

Bradshaw, A.D., Francki, A., Motamed, K., Howe, C., and Sage, E.H. (1999). Primary mesenchymal cells isolated from SPARC-null mice exhibit altered morphology and rates of proliferation. Mol Biol Cell 10, 1569-1579.

Bradshaw, A.D., Puolakkainen, P., Dasgupta, J., Davidson, J.M., Wight, T.N., and Helene Sage, E. (2003). SPARC-null mice display abnormalities in the dermis characterized by decreased collagen fibril diameter and reduced tensile strength. J Invest Dermatol 120, 949-955.

Bradshaw, A.D., and Sage, E.H. (2001). SPARC, a matricellular protein that functions in cellular differentiation and tissue response to injury. J Clin Invest 107, 1049-1054.

Brekken, R.A., Puolakkainen, P., Graves, D.C., Workman, G., Lubkin, S.R., and Sage, E.H. (2003). Enhanced growth of tumors in SPARC null mice is associated with changes in the ECM. J Clin Invest 111, 487-495.

Brekken, R.A., and Sage, E.H. (2001). SPARC, a matricellular protein: at the crossroads of cell-matrix communication. Matrix Biol 19, 816-827.

Burke, J.M., Roberts, C.W., Hunter, C.A., Murray, M., and Alexander, J. (1994). Temporal differences in the expression of mRNA for IL-10 and IFN-gamma in the brains and spleens of C57BL/10 mice infected with Toxoplasma gondii. Parasite Immunol 16, 305-314.

Butcher, B.A., Fox, B.A., Rommereim, L.M., Kim, S.G., Maurer, K.J., Yarovinsky, F., Herbert, D.R., Bzik, D.J., and Denkers, E.Y. (2011). Toxoplasma gondii rhoptry kinase ROP16 activates STAT3 and STAT6 resulting in cytokine inhibition and arginase-1- dependent growth control. PLoS Pathog 7, e1002236.

Cahalan, M.D., and Gutman, G.A. (2006). The sense of place in the immune system. Nat Immunol 7, 329-332.

Carruthers, V.B., and Suzuki, Y. (2007). Effects of Toxoplasma gondii infection on the brain. Schizophr Bull 33, 745-751.

Chao, C.C., Gekker, G., Hu, S., and Peterson, P.K. (1994). Human microglial cell defense against Toxoplasma gondii. The role of cytokines. J Immunol 152, 1246-1252.

114 Chiodoni, C., Colombo, M.P., and Sangaletti, S. (2010). Matricellular proteins: from homeostasis to inflammation, cancer, and metastasis. Cancer Metastasis Rev 29, 295-307.

Chlenski, A., and Cohn, S.L. (2010). Modulation of matrix remodeling by SPARC in neoplastic progression. Semin Cell Dev Biol 21, 55-65.

Chlenski, A., Guerrero, L.J., Salwen, H.R., Yang, Q., Tian, Y., Morales La Madrid, A., Mirzoeva, S., Bouyer, P.G., Xu, D., Walker, M., et al. (2011). Secreted protein acidic and rich in cysteine is a matrix scavenger chaperone. PLoS One 6, e23880.

Chlenski, A., Liu, S., Guerrero, L.J., Yang, Q., Tian, Y., Salwen, H.R., Zage, P., and Cohn, S.L. (2006). SPARC expression is associated with impaired tumor growth, inhibited angiogenesis and changes in the extracellular matrix. Int J Cancer 118, 310-316.

Clark, R.T., Nance, J.P., Noor, S., and Wilson, E.H. (2010). T-cell production of matrix metalloproteinases and inhibition of parasite clearance by TIMP-1 during chronic Toxoplasma infection in the brain. ASN Neuro 3, e00049.

Condeelis, J., and Segall, J.E. (2003). Intravital imaging of cell movement in tumours. Nat Rev Cancer 3, 921-930.

Contini, C., Cultrera, R., Seraceni, S., Segala, D., Romani, R., Fainardi, E., Cinque, P., Lazzarin, A., and Delia, S. (2002). The role of stage-specific oligonucleotide primers in providing effective laboratory support for the molecular diagnosis of reactivated Toxoplasma gondii encephalitis in patients with AIDS. Journal of Medical Microbiology 51, 879-890.

Cook, G.C. (1990). Toxoplasma gondii infection: a potential danger to the unborn fetus and AIDS sufferer. Q J Med 74, 3-19.

Coppin, A., Dzierszinski, F., Legrand, S., Mortuaire, M., Ferguson, D., and Tomavo, S. (2003). Developmentally regulated biosynthesis of carbohydrate and storage polysaccharide during differentiation and tissue cyst formation in Toxoplasma gondii. Biochimie 85, 353-361.

Cox, G., and Kable, E. (2006). Second-harmonic imaging of collagen. Methods Mol Biol 319, 15-35.

Cozzarini, E., Bellin, M., Norberto, L., Polese, L., Musumeci, S., Lanfranchi, G., and Paoletti, M.G. (2009). CHIT1 and AMCase expression in human gastric mucosa: correlation with inflammation and Helicobacter pylori infection. Eur J Gastroenterol Hepatol 21, 1119-1126.

115 Da Silva, C.A., Chalouni, C.c., Williams, A., Hartl, D., Lee, C.G., and Elias, J.A. (2009). Chitin Is a Size-Dependent Regulator of Macrophage TNF and IL-10 Production. The Journal of Immunology 182, 3573-3582.

Da Silva, C.A., Hartl, D., Liu, W., Lee, C.G., and Elias, J.A. (2008). TLR-2 and IL-17A in chitin-induced macrophage activation and acute inflammation. J Immunol 181, 4279- 4286.

Dabritz, H.A., Miller, M.A., Atwill, E.R., Gardner, I.A., Leutenegger, C.M., Melli, A.C., and Conrad, P.A. (2007). Detection of Toxoplasma gondii-like oocysts in cat feces and estimates of the environmental oocyst burden. J Am Vet Med Assoc 231, 1676-1684.

Dalton, D.K., Pitts-Meek, S., Keshav, S., Figari, I.S., Bradley, A., and Stewart, T.A. (1993). Multiple defects of immune cell function in mice with disrupted interferon- gamma genes. Science 259, 1739-1742.

Deckert-Schluter, M., Bluethmann, H., Kaefer, N., Rang, A., and Schluter, D. (1999). Interferon-gamma receptor-mediated but not tumor necrosis factor receptor type 1- or type 2-mediated signaling is crucial for the activation of cerebral blood vessel endothelial cells and microglia in murine Toxoplasma encephalitis. Am J Pathol 154, 1549-1561.

Delany, A.M., Amling, M., Priemel, M., Howe, C., Baron, R., and Canalis, E. (2000). Osteopenia and decreased bone formation in osteonectin-deficient mice. J Clin Invest 105, 1325.

Denkers, E.Y., and Gazzinelli, R.T. (1998). Regulation and function of T-cell-mediated immunity during Toxoplasma gondii infection. Clin Microbiol Rev 11, 569-588.

Denkers, E.Y., Yap, G., Scharton-Kersten, T., Charest, H., Butcher, B.A., Caspar, P., Heiny, S., and Sher, A. (1997). Perforin-mediated cytolysis plays a limited role in host resistance to Toxoplasma gondii. J Immunol 159, 1903-1908.

Desjardins, A., Malo, J.L., L'Archeveque, J., Cartier, A., McCants, M., and Lehrer, S.B. (1995). Occupational IgE-mediated sensitization and asthma caused by clam and shrimp. J Allergy Clin Immunol 96, 608-617.

Drogemuller, K., Helmuth, U., Brunn, A., Sakowicz-Burkiewicz, M., Gutmann, D.H., Mueller, W., Deckert, M., and Schluter, D. (2008). Astrocyte gp130 expression is critical for the control of Toxoplasma encephalitis. J Immunol 181, 2683-2693.

Dubey, J.P. (1986). Toxoplasmosis. J Am Vet Med Assoc 189, 166-170.

Dufour, J.H., Dziejman, M., Liu, M.T., Leung, J.H., Lane, T.E., and Luster, A.D. (2002). IFN-gamma-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. J Immunol 168, 3195-3204.

116 Dunay, I.R., Fuchs, A., and Sibley, L.D. (2010). Inflammatory monocytes but not neutrophils are necessary to control infection with Toxoplasma gondii in mice. Infect Immun 78, 1564-1570.

Egen, J.G., Rothfuchs, A.G., Feng, C.G., Winter, N., Sher, A., and Germain, R.N. (2008). Macrophage and T cell dynamics during the development and disintegration of mycobacterial granulomas. Immunity 28, 271-284.

El Kasmi, K.C., Qualls, J.E., Pesce, J.T., Smith, A.M., Thompson, R.W., Henao-Tamayo, M., Basaraba, R.J., Konig, T., Schleicher, U., Koo, M.-S., et al. (2008). Toll-like receptor-induced arginase 1 in macrophages thwarts effective immunity against intracellular pathogens. Nat Immunol 9, 1399-1406.

Ferguson, D.J., and Hutchison, W.M. (1987). An ultrastructural study of the early development and tissue cyst formation of Toxoplasma gondii in the brains of mice. Parasitol Res 73, 483-491.

Ferguson, D.J., Hutchison, W.M., and Pettersen, E. (1989). Tissue cyst rupture in mice chronically infected with Toxoplasma gondii. An immunocytochemical and ultrastructural study. Parasitol Res 75, 599-603.

Fitz, L.J., Declercq, C., Brooks, J., Kuang, W., Bates, B., Demers, D., Winkler, A., Nocka, K., Jiao, A., Greco, R.M., et al. (2011). Acidic Mammalian Chitinase Is Not A Critical Target For Allergic Airway Disease. Am J Respir Cell Mol Biol.

Friedl, P., and Weigelin, B. (2008). Interstitial leukocyte migration and immune function. Nat Immunol 9, 960-969.

Fung, H.B., and Kirschenbaum, H.L. (1996). Treatment regimens for patients with toxoplasmic encephalitis. Clin Ther 18, 1037-1056; discussion 1036.

Funkhouser, J.D., and Aronson, N.N., Jr. (2007). Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family. BMC Evol Biol 7, 96.

Gazzinelli, R., Xu, Y., Hieny, S., Cheever, A., and Sher, A. (1992). Simultaneous depletion of CD4+ and CD8+ T lymphocytes is required to reactivate chronic infection with Toxoplasma gondii. J Immunol 149, 175-180.

Gazzinelli, R.T., Eltoum, I., Wynn, T.A., and Sher, A. (1993). Acute cerebral toxoplasmosis is induced by in vivo neutralization of TNF-alpha and correlates with the down-regulated expression of inducible nitric oxide synthase and other markers of macrophage activation. J Immunol 151, 3672-3681.

Gazzinelli, R.T., Wysocka, M., Hayashi, S., Denkers, E.Y., Hieny, S., Caspar, P., Trinchieri, G., and Sher, A. (1994). Parasite-induced IL-12 stimulates early IFN-gamma

117 synthesis and resistance during acute infection with Toxoplasma gondii. J Immunol 153, 2533-2543.

Gazzinelli, R.T., Wysocka, M., Hieny, S., Scharton-Kersten, T., Cheever, A., Kuhn, R., Muller, W., Trinchieri, G., and Sher, A. (1996). In the absence of endogenous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal immune response dependent on CD4+ T cells and accompanied by overproduction of IL-12, IFN-gamma and TNF-alpha. J Immunol 157, 798-805.

George, E.L., Georges-Labouesse, E.N., Patel-King, R.S., Rayburn, H., and Hynes, R.O. (1993). Defects in mesoderm, neural tube and vascular development in mouse embryos lacking fibronectin. Development 119, 1079-1091.

Gerber, J.S., and Mosser, D.M. (2001). Stimulatory and inhibitory signals originating from the macrophage Fcgamma receptors. Microbes Infect 3, 131-139.

Gilles, C., Bassuk, J.A., Pulyaeva, H., Sage, E.H., Foidart, J.M., and Thompson, E.W. (1998). SPARC/osteonectin induces matrix metalloproteinase 2 activation in human breast cancer cell lines. Cancer Res 58, 5529-5536.

Girotti, M.R., Fernandez, M., Lopez, J.A., Camafeita, E., Fernandez, E.A., Albar, J.P., Benedetti, L.G., Valacco, M.P., Brekken, R.A., Podhajcer, O.L., et al. (2011). SPARC promotes cathepsin B-mediated melanoma invasiveness through a collagen I/alpha2beta1 integrin axis. J Invest Dermatol 131, 2438-2447.

Glass, W.G., Hickey, M.J., Hardison, J.L., Liu, M.T., Manning, J.E., and Lane, T.E. (2004). Antibody targeting of the CC chemokine ligand 5 results in diminished leukocyte infiltration into the central nervous system and reduced neurologic disease in a viral model of multiple sclerosis. J Immunol 172, 4018-4025.

Golembieski, W.A., Thomas, S.L., Schultz, C.R., Yunker, C.K., McClung, H.M., Lemke, N., Cazacu, S., Barker, T., Sage, E.H., Brodie, C., et al. (2008). HSP27 mediates SPARC-induced changes in glioma morphology, migration, and invasion. Glia 56, 1061- 1075.

Harris, T.H., Banigan, E.J., Christian, D.A., Konradt, C., Tait Wojno, E.D., Norose, K., Wilson, E.H., John, B., Weninger, W., Luster, A.D., et al. (2012). Generalized Levy walks and the role of chemokines in migration of effector CD8+ T cells. Nature In Press.

Held, K.S., Chen, B.P., Kuziel, W.A., Rollins, B.J., and Lane, T.E. (2004). Differential roles of CCL2 and CCR2 in host defense to coronavirus infection. Virology 329, 251- 260.

Herz, J., Paterka, M., Niesner, R.A., Brandt, A.U., Siffrin, V., Leuenberger, T., Birkenstock, J., Mossakowski, A., Glumm, R., Zipp, F., et al. (2011). In vivo imaging of

118 lymphocytes in the CNS reveals different behaviour of naive T cells in health and autoimmunity. J Neuroinflammation 8, 131.

Hesse, M., Modolell, M., La Flamme, A.C., Schito, M., Fuentes, J.M., Cheever, A.W., Pearce, E.J., and Wynn, T.A. (2001). Differential regulation of nitric oxide synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo: granulomatous pathology is shaped by the pattern of L-arginine metabolism. J Immunol 167, 6533-6544.

Hsieh, M.-F., Lai, S.-L., Chen, J.-P., Sung, J.-M., Lin, Y.-L., Wu-Hsieh, B.A., Gerard, C., Luster, A., and Liao, F. (2006). Both CXCR3 and CXCL10/IFN-inducible protein 10 are required for resistance to primary infection by dengue virus. J Immunol 177, 1855-1863.

Hunter, C.A., Abrams, J.S., Beaman, M.H., and Remington, J.S. (1993). Cytokine mRNA in the central nervous system of SCID mice infected with Toxoplasma gondii: importance of T-cell-independent regulation of resistance to T. gondii. Infect Immun 61, 4038-4044.

Jensen, K.D., Wang, Y., Wojno, E.D., Shastri, A.J., Hu, K., Cornel, L., Boedec, E., Ong, Y.C., Chien, Y.H., Hunter, C.A., et al. (2011). Toxoplasma polymorphic effectors determine macrophage polarization and intestinal inflammation. Cell Host Microbe 9, 472-483.

John, B., Ricart, B., Tait Wojno, E.D., Harris, T.H., Randall, L.M., Christian, D.A., Gregg, B., De Almeida, D.M., Weninger, W., Hammer, D.A., et al. (2011). Analysis of behavior and trafficking of dendritic cells within the brain during toxoplasmic encephalitis. PLoS Pathog 7, e1002246.

Kang, H., and Suzuki, Y. (2001). Requirement of non-T cells that produce gamma interferon for prevention of reactivation of Toxoplasma gondii infection in the brain. Infect Immun 69, 2920-2927.

Khan, I.A., MacLean, J.A., Lee, F.S., Casciotti, L., DeHaan, E., Schwartzman, J.D., and Luster, A.D. (2000). IP-10 is critical for effector T cell trafficking and host survival in Toxoplasma gondii infection. Immunity 12, 483-494.

Kim, J.V., Kang, S.S., Dustin, M.L., and McGavern, D.B. (2009). Myelomonocytic cell recruitment causes fatal CNS vascular injury during acute viral meningitis. Nature 457, 191-195.

Kim, S.-K., and Boothroyd, J.C. (2005). Stage-specific expression of surface antigens by Toxoplasma gondii as a mechanism to facilitate parasite persistence. J Immunol 174, 8038-8048.

Kreider, T., Anthony, R.M., Urban, J.F., and Gause, W.C. (2007). Alternatively activated macrophages in helminth infections. Curr Opin Immunol 19, 448-453.

119 Kupprion, C., Motamed, K., and Sage, E.H. (1998). SPARC (BM-40, osteonectin) inhibits the mitogenic effect of vascular endothelial growth factor on microvascular endothelial cells. J Biol Chem 273, 29635-29640.

Kzhyshkowska, J., Gratchev, A., and Goerdt, S. (2006a). Stabilin-1, a homeostatic scavenger receptor with multiple functions. J Cell Mol Med 10, 635-649.

Kzhyshkowska, J., Mamidi, S., Gratchev, A., Kremmer, E., Schmuttermaier, C., Krusell, L., Haus, G., Utikal, J., Schledzewski, K., Scholtze, J., et al. (2006b). Novel stabilin-1 interacting chitinase-like protein (SI-CLP) is up-regulated in alternatively activated macrophages and secreted via lysosomal pathway. Blood 107, 3221-3228.

Kzhyshkowska, J., Workman, G., Cardo-Vila, M., Arap, W., Pasqualini, R., Gratchev, A., Krusell, L., Goerdt, S., and Sage, E.H. (2006c). Novel function of alternatively activated macrophages: stabilin-1-mediated clearance of SPARC. J Immunol 176, 5825- 5832.

Lane, T.F., and Sage, E.H. (1990). Functional mapping of SPARC: peptides from two distinct Ca+(+)-binding sites modulate cell shape. J Cell Biol 111, 3065-3076.

Lane, T.F., and Sage, E.H. (1994). The biology of SPARC, a protein that modulates cell- matrix interactions. FASEB J 8, 163-173.

Langrish, C.L., Chen, Y., Blumenschein, W.M., Mattson, J., Basham, B., Sedgwick, J.D., McClanahan, T., Kastelein, R.A., and Cua, D.J. (2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201, 233-240.

Lari, R., Fleetwood, A.J., Kitchener, P.D., Cook, A.D., Pavasovic, D., Hertzog, P.J., and Hamilton, J.A. (2007). Macrophage lineage phenotypes and osteoclastogenesis-- complexity in the control by GM-CSF and TGF-beta. Bone 40, 323-336.

Lee, C.G., Da Silva, C.A., Dela Cruz, C.S., Ahangari, F., Ma, B., Kang, M.J., He, C.H., Takyar, S., and Elias, J.A. (2011). Role of chitin and chitinase/chitinase-like proteins in inflammation, tissue remodeling, and injury. Annu Rev Physiol 73, 479-501.

Li, H., Gang, Z., Yuling, H., Luokun, X., Jie, X., Hao, L., Li, W., Chunsong, H., Junyan, L., Mingshen, J., et al. (2006). Different neurotropic pathogens elicit neurotoxic CCR9- or neurosupportive CXCR3-expressing microglia. J Immunol 177, 3644-3656.

Liu, L., Callahan, M.K., Huang, D., and Ransohoff, R.M. (2005). Chemokine receptor CXCR3: an unexpected enigma. Curr Top Dev Biol 68, 149-181.

Liu, M.T., Keirstead, H.S., and Lane, T.E. (2001). Neutralization of the chemokine CXCL10 reduces inflammatory cell invasion and demyelination and improves neurological function in a viral model of multiple sclerosis. J Immunol 167, 4091-4097.

120 Llera, A.S., Girotti, M.R., Benedetti, L.G., and Podhajcer, O.L. (2009). Matricellular proteins and inflammatory cells: a task force to promote or defeat cancer? Cytokine Growth Factor Rev 21, 67-76.

Loke, P., Nair, M.G., Parkinson, J., Guiliano, D., Blaxter, M., and Allen, J.E. (2002). IL- 4 dependent alternatively-activated macrophages have a distinctive in vivo gene expression phenotype. BMC Immunol 3, 7.

Luft, B.J., Brooks, R.G., Conley, F.K., McCabe, R.E., and Remington, J.S. (1984). Toxoplasmic encephalitis in patients with acquired immune deficiency syndrome. JAMA 252, 913-917.

Luft, B.J., and Remington, J.S. (1988). AIDS commentary. Toxoplasmic encephalitis. J Infect Dis 157, 1-6.

Luft, B.J., and Remington, J.S. (1992). Toxoplasmic encephalitis in AIDS. Clin Infect Dis 15, 211-222.

Mackay, C.R. (2008). Moving targets: cell migration inhibitors as new anti-inflammatory therapies. Nat Immunol 9, 988-998.

MacMicking, J., Xie, Q.W., and Nathan, C. (1997). Nitric oxide and macrophage function. Annu Rev Immunol 15, 323-350.

Magnusson, M.K., and Mosher, D.F. (1998). Fibronectin: structure, assembly, and cardiovascular implications. Arterioscler Thromb Vasc Biol 18, 1363-1370.

Martinek, N., Shahab, J., Sodek, J., and Ringuette, M. (2007). Is SPARC an Evolutionarily Conserved Collagen Chaperone? Journal of Dental Research 86, 296-305.

Martinez-Pomares, L., Wienke, D., Stillion, R., McKenzie, E.J., Arnold, J.N., Harris, J., McGreal, E., Sim, R.B., Isacke, C.M., and Gordon, S. (2006). Carbohydrate-independent recognition of collagens by the macrophage mannose receptor. Eur J Immunol 36, 1074- 1082.

Mason, I.J., Murphy, D., Munke, M., Francke, U., Elliott, R.W., and Hogan, B.L. (1986). Developmental and transformation-sensitive expression of the Sparc gene on mouse chromosome 11. EMBO J 5, 1831-1837.

McCreath, K.J., and Gooday, G.W. (1992). A rapid and sensitive microassay for determination of chitinolytic activity. Journal of Microbiological Methods 14, 229-237.

Melo, M.B., Jensen, K.D., and Saeij, J.P. (2011). Toxoplasma gondii effectors are master regulators of the inflammatory response. Trends Parasitol 27, 487-495.

121 Melzer, T., Duffy, A., Weiss, L.M., and Halonen, S.K. (2008). The gamma interferon (IFN-gamma)-inducible GTP-binding protein IGTP is necessary for toxoplasma vacuolar disruption and induces parasite egression in IFN-gamma-stimulated astrocytes. Infect Immun 76, 4883-4894.

Mendis, D.B., and Brown, I.R. (1994). Expression of the gene encoding the extracellular matrix glycoprotein SPARC in the developing and adult mouse brain. Brain Res Mol Brain Res 24, 11-19.

Miller, S.D., and Karpus, W.J. (2007). Experimental autoimmune encephalomyelitis in the mouse. Curr Protoc Immunol Chapter 15, Unit 15 11.

Mosser, D.M., and Edwards, J.P. (2008). Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8, 958-969.

Motamed, K., and Sage, E.H. (1998). SPARC inhibits endothelial cell adhesion but not proliferation through a tyrosine phosphorylation-dependent pathway. J Cell Biochem 70, 543-552.

Mrass, P., and Weninger, W. (2006). Immune cell migration as a means to control immune privilege: lessons from the CNS and tumors. Immunol Rev 213, 195-212.

Munder, M., Eichmann, K., and Modolell, M. (1998). Alternative metabolic states in murine macrophages reflected by the nitric oxide synthase/arginase balance: competitive regulation by CD4+ T cells correlates with Th1/Th2 phenotype. J Immunol 160, 5347- 5354.

Murphy-Ullrich, J.E., Lane, T.F., Pallero, M.A., and Sage, E.H. (1995). SPARC mediates focal adhesion disassembly in endothelial cells through a follistatin-like region and the Ca(2+)-binding EF-hand. J Cell Biochem 57, 341-350.

Muzzarelli, R.A. (1999). Native, industrial and fossil chitins. EXS 87, 1-6.

Nair, M.G., Gallagher, I.J., Taylor, M.D., Loke, P., Coulson, P.S., Wilson, R.A., Maizels, R.M., and Allen, J.E. (2005). Chitinase and Fizz family members are a generalized feature of nematode infection with selective upregulation of Ym1 and Fizz1 by antigen- presenting cells. Infect Immun 73, 385-394.

Nathan, C., and Shiloh, M.U. (2000). Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc Natl Acad Sci U S A 97, 8841-8848.

Nie, J., Chang, B., Traktuev, D.O., Sun, J., March, K., Chan, L., Sage, E.H., Pasqualini, R., Arap, W., and Kolonin, M.G. (2008). IFATS collection: Combinatorial peptides

122 identify alpha5beta1 integrin as a receptor for the matricellular protein SPARC on adipose stromal cells. Stem Cells 26, 2735-2745.

Nomura, S., Wills, A.J., Edwards, D.R., Heath, J.K., and Hogan, B.L. (1988). Developmental expression of 2ar (osteopontin) and SPARC (osteonectin) RNA as revealed by in situ hybridization. J Cell Biol 106, 441-450.

Noor, S., Habashy, A.S., Nance, J.P., Clark, R.T., Nemati, K., Carson, M.J., and Wilson, E.H. (2010). CCR7-dependent immunity during acute Toxoplasma gondii infection. Infect Immun 78, 2257-2263.

Norose, K., Clark, J.I., Syed, N.A., Basu, A., Heber-Katz, E., Sage, E.H., and Howe, C.C. (1998). SPARC deficiency leads to early-onset cataractogenesis. Invest Ophthalmol Vis Sci 39, 2674-2680.

Norose, K., Kikumura, A., Luster, A.D., Hunter, C.A., and Harris, T.H. (2010). CXCL10 is required to maintain T-cell populations and to control parasite replication during chronic ocular toxoplasmosis. Invest Ophthalmol Vis Sci 52, 389-398.

Nourshargh, S., Hordijk, P.L., and Sixt, M. (2010). Breaching multiple barriers: leukocyte motility through venular walls and the interstitium. Nat Rev Mol Cell Biol 11, 366-378.

Okada, T., and Cyster, J.G. (2007). CC chemokine receptor 7 contributes to Gi-dependent T cell motility in the lymph node. J Immunol 178, 2973-2978.

Pappas, G., Roussos, N., and Falagas, M.E. (2009). Toxoplasmosis snapshots: global status of Toxoplasma gondii seroprevalence and implications for pregnancy and congenital toxoplasmosis. Int J Parasitol 39, 1385-1394.

Park, S.Y., Jung, M.Y., Lee, S.J., Kang, K.B., Gratchev, A., Riabov, V., Kzhyshkowska, J., and Kim, I.S. (2009). Stabilin-1 mediates phosphatidylserine-dependent clearance of cell corpses in alternatively activated macrophages. J Cell Sci 122, 3365-3373.

Phan, T.G., and Bullen, A. (2010). Practical intravital two-photon microscopy for immunological research: faster, brighter, deeper. Immunol Cell Biol 88, 438-444.

Piconese, S., Costanza, M., Tripodo, C., Sangaletti, S., Musio, S., Pittoni, P., Poliani, P.L., Burocchi, A., Passafaro, A.L., Gorzanelli, A., et al. (2011). The matricellular protein SPARC supports follicular dendritic cell networking toward Th17 responses. J Autoimmun 37, 300-310.

Ploix, C.C., Noor, S., Crane, J., Masek, K., Carter, W., Lo, D.D., Wilson, E.H., and Carson, M.J. (2011). CNS-derived CCL21 is both sufficient to drive homeostatic CD4+ T

123 cell proliferation and necessary for efficient CD4+ T cell migration into the CNS parenchyma following Toxoplasma gondii infection. Brain Behav Immun 25, 883-896.

Radke, J.R., Guerini, M.N., Jerome, M., and White, M.W. (2003). A change in the premitotic period of the cell cycle is associated with bradyzoite differentiation in Toxoplasma gondii. Mol Biochem Parasitol 131, 119-127.

Raines, E.W., Lane, T.F., Iruela-Arispe, M.L., Ross, R., and Sage, E.H. (1992). The extracellular glycoprotein SPARC interacts with platelet-derived growth factor (PDGF)- AB and -BB and inhibits the binding of PDGF to its receptors. Proc Natl Acad Sci U S A 89, 1281-1285.

Rappert, A., Bechmann, I., Pivneva, T., Mahlo, J., Biber, K., Nolte, C., Kovac, A.D., Gerard, C., Boddeke, H.W.G.M., Nitsch, R., et al. (2004). CXCR3-dependent microglial recruitment is essential for dendrite loss after brain lesion. J Neurosci 24, 8500-8509.

Redente, E.F., Higgins, D.M., Dwyer-Nield, L.D., Orme, I.M., Gonzalez-Juarrero, M., and Malkinson, A.M. (2010). Differential polarization of alveolar macrophages and bone marrow-derived monocytes following chemically and pathogen-induced chronic lung inflammation. J Leukoc Biol 88, 159-168.

Reed, M.J., Puolakkainen, P., Lane, T.F., Dickerson, D., Bornstein, P., and Sage, E.H. (1993). Differential expression of SPARC and thrombospondin 1 in wound repair: immunolocalization and in situ hybridization. J Histochem Cytochem 41, 1467-1477.

Reese, T.A., Liang, H.-E., Tager, A.M., Luster, A.D., Van Rooijen, N., Voehringer, D., and Locksley, R.M. (2007). Chitin induces accumulation in tissue of innate immune cells associated with allergy. Nature 447, 92-96.

Rempel, S.A., Hawley, R.C., Gutierrez, J.A., Mouzon, E., Bobbitt, K.R., Lemke, N., Schultz, C.R., Schultz, L.R., Golembieski, W., Koblinski, J., et al. (2007). Splenic and immune alterations of the Sparc-null mouse accompany a lack of immune response. Genes Immun 8, 262-274.

Renkema, G.H., Boot, R.G., Muijsers, A.O., Donker-Koopman, W.E., and Aerts, J.M. (1995). Purification and characterization of human chitotriosidase, a novel member of the chitinase family of proteins. J Biol Chem 270, 2198-2202.

Rotta, G., Matteoli, G., Mazzini, E., Nuciforo, P., Colombo, M.P., and Rescigno, M. (2008). Contrasting roles of SPARC-related granuloma in bacterial containment and in the induction of anti-Salmonella typhimurium immunity. J Exp Med 205, 657-667.

Rutschman, R., Lang, R., Hesse, M., Ihle, J.N., Wynn, T.A., and Murray, P.J. (2001). Cutting edge: Stat6-dependent substrate depletion regulates nitric oxide production. J Immunol 166, 2173-2177.

124 Saeij, J.P.J., Boyle, J.P., and Boothroyd, J.C. (2005a). Differences among the three major strains of Toxoplasma gondii and their specific interactions with the infected host. Trends in Parasitology 21, 476-481.

Saeij, J.P.J., Boyle, J.P., Grigg, M.E., Arrizabalaga, G., and Boothroyd, J.C. (2005b). Bioluminescence imaging of Toxoplasma gondii infection in living mice reveals dramatic differences between strains. Infect Immun 73, 695-702.

Sage, H., Vernon, R.B., Funk, S.E., Everitt, E.A., and Angello, J. (1989). SPARC, a secreted protein associated with cellular proliferation, inhibits cell spreading in vitro and exhibits Ca+2-dependent binding to the extracellular matrix. J Cell Biol 109, 341-356.

Said, N.A., Elmarakby, A.A., Imig, J.D., Fulton, D.J., and Motamed, K. (2008). SPARC ameliorates ovarian cancer-associated inflammation. Neoplasia 10, 1092-1104.

Sangaletti, S., Di Carlo, E., Gariboldi, S., Miotti, S., Cappetti, B., Parenza, M., Rumio, C., Brekken, R.A., Chiodoni, C., and Colombo, M.P. (2008). Macrophage-derived SPARC bridges tumor cell-extracellular matrix interactions toward metastasis. Cancer Res 68, 9050-9059.

Sangaletti, S., Gioiosa, L., Guiducci, C., Rotta, G., Rescigno, M., Stoppacciaro, A., Chiodoni, C., and Colombo, M.P. (2005). Accelerated dendritic-cell migration and T-cell priming in SPARC-deficient mice. J Cell Sci 118, 3685-3694.

Sangaletti, S., Tripodo, C., Cappetti, B., Casalini, P., Chiodoni, C., Piconese, S., Santangelo, A., Parenza, M., Arioli, I., Miotti, S., et al. (2011). SPARC oppositely regulates inflammation and fibrosis in bleomycin-induced lung damage. Am J Pathol 179, 3000-3010.

Sasaki, T., Gohring, W., Mann, K., Maurer, P., Hohenester, E., Knauper, V., Murphy, G., and Timpl, R. (1997). Limited cleavage of extracellular matrix protein BM-40 by matrix metalloproteinases increases its affinity for collagens. J Biol Chem 272, 9237-9243.

Sasaki, T., Hohenester, E., Gohring, W., and Timpl, R. (1998). Crystal structure and mapping by site-directed mutagenesis of the collagen-binding epitope of an activated form of BM-40/SPARC/osteonectin. EMBO J 17, 1625-1634.

Satoh, T., Takeuchi, O., Vandenbon, A., Yasuda, K., Tanaka, Y., Kumagai, Y., Miyake, T., Matsushita, K., Okazaki, T., Saitoh, T., et al. (2010). The Jmjd3-Irf4 axis regulates M2 macrophage polarization and host responses against helminth infection. Nat Immunol 11, 936-944.

Savarin, C., Stohlman, S.A., Atkinson, R., Ransohoff, R.M., and Bergmann, C.C. (2010). Monocytes regulate T cell migration through the glia limitans during acute viral encephalitis. J Virol 84, 4878-4888.

125 Scharton-Kersten, T.M., Yap, G., Magram, J., and Sher, A. (1997). Inducible nitric oxide is essential for host control of persistent but not acute infection with the intracellular pathogen Toxoplasma gondii. J Exp Med 185, 1261-1273.

Schellings, M.W., Vanhoutte, D., Swinnen, M., Cleutjens, J.P., Debets, J., van Leeuwen, R.E., d'Hooge, J., Van de Werf, F., Carmeliet, P., Pinto, Y.M., et al. (2009). Absence of SPARC results in increased cardiac rupture and dysfunction after acute myocardial infarction. J Exp Med 206, 113-123.

Schenke-Layland, K. (2008). Non-invasive multiphoton imaging of extracellular matrix structures. J Biophotonics 1, 451-462.

Schwartz, M.A. (2001). Integrin signaling revisited. Trends Cell Biol 11, 466-470.

Shapiro, K., Largier, J., Mazet, J.A., Bernt, W., Ell, J.R., Melli, A.C., and Conrad, P.A. (2009). Surface properties of Toxoplasma gondii oocysts and surrogate microspheres. Appl Environ Microbiol 75, 1185-1191.

Sharma, S.D., Mullenax, J., Araujo, F.G., Erlich, H.A., and Remington, J.S. (1983). Western Blot analysis of the antigens of Toxoplasma gondii recognized by human IgM and IgG antibodies. J Immunol 131, 977-983.

Shi, Q., Bao, S., Song, L., Wu, Q., Bigner, D.D., Hjelmeland, A.B., and Rich, J.N. (2007). Targeting SPARC expression decreases glioma cellular survival and invasion associated with reduced activities of FAK and ILK kinases. Oncogene 26, 4084-4094.

Shibata, Y., Foster, L.A., Bradfield, J.F., and Myrvik, Q.N. (2000). Oral administration of chitin down-regulates serum IgE levels and lung eosinophilia in the allergic mouse. J Immunol 164, 1314-1321.

Shibata, Y., Foster, L.A., Metzger, W.J., and Myrvik, Q.N. (1997a). Alveolar macrophage priming by intravenous administration of chitin particles, polymers of N- acetyl-D-glucosamine, in mice. Infect Immun 65, 1734-1741.

Shibata, Y., Metzger, W.J., and Myrvik, Q.N. (1997b). Chitin particle-induced cell- mediated immunity is inhibited by soluble mannan: mannose receptor-mediated phagocytosis initiates IL-12 production. J Immunol 159, 2462-2467.

Sohn, M.H., Kang, M.J., Matsuura, H., Bhandari, V., Chen, N.Y., Lee, C.G., and Elias, J.A. (2010). The chitinase-like proteins breast regression protein-39 and YKL-40 regulate hyperoxia-induced acute lung injury. Am J Respir Crit Care Med 182, 918-928.

Sorokin, L. (2010). The impact of the extracellular matrix on inflammation. Nat Rev Immunol 10, 712-723.

126 Stein, M., Keshav, S., Harris, N., and Gordon, S. (1992). Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med 176, 287-292.

Stiles, L.N., Hosking, M.P., Edwards, R.A., Strieter, R.M., and Lane, T.E. (2006). Differential roles for CXCR3 in CD4+ and CD8+ T cell trafficking following viral infection of the CNS. Eur J Immunol 36, 613-622.

Stiles, L.N., Liu, M.T., Kane, J.A.C., and Lane, T.E. (2009). CXCL10 and trafficking of virus-specific T cells during coronavirus-induced demyelination. Autoimmunity 42, 484- 491.

Stout, R.D., Jiang, C., Matta, B., Tietzel, I., Watkins, S.K., and Suttles, J. (2005). Macrophages sequentially change their functional phenotype in response to changes in microenvironmental influences. J Immunol 175, 342-349.

Stout, R.D., and Suttles, J. (2004). Functional plasticity of macrophages: reversible adaptation to changing microenvironments. J Leukoc Biol 76, 509-513.

Suzuki, Y., Wang, X., Jortner, B.S., Payne, L., Ni, Y., Michie, S.A., Xu, B., Kudo, T., and Perkins, S. (2010). Removal of Toxoplasma gondii cysts from the brain by perforin- mediated activity of CD8+ T cells. Am J Pathol 176, 1607-1613.

Termine, J.D., Kleinman, H.K., Whitson, S.W., Conn, K.M., McGarvey, M.L., and Martin, G.R. (1981). Osteonectin, a bone-specific protein linking mineral to collagen. Cell 26, 99-105.

Tsang, K.Y., Cheung, M.C., Chan, D., and Cheah, K.S. (2009). The developmental roles of the extracellular matrix: beyond structure to regulation. Cell Tissue Res 339, 93-110. van Eijk, M., van Roomen, C.P.A.A., Renkema, G.H., Bussink, A.P., Andrews, L., Blommaart, E.F.C., Sugar, A., Verhoeven, A.J., Boot, R.G., and Aerts, J.M.F.G. (2005). Characterization of human phagocyte-derived chitotriosidase, a component of innate immunity. Int Immunol 17, 1505-1512.

Verreck, F.A.W., de Boer, T., Langenberg, D.M.L., Hoeve, M.A., Kramer, M., Vaisberg, E., Kastelein, R., Kolk, A., de Waal-Malefyt, R., and Ottenhoff, T.H.M. (2004). Human IL-23-producing type 1 macrophages promote but IL-10-producing type 2 macrophages subvert immunity to (myco)bacteria. Proc Natl Acad Sci U S A 101, 4560-4565.

Vestweber, D. (2007). Adhesion and signaling molecules controlling the transmigration of leukocytes through endothelium. Immunol Rev 218, 178-196.

Vincent, A.J., Lau, P.W., and Roskams, A.J. (2008). SPARC is expressed by macroglia and microglia in the developing and mature nervous system. Dev Dyn 237, 1449-1462.

127 Vyas, R., and Ebright, J.R. (1996). Toxoplasmosis of the spinal cord in a patient with AIDS: case report and review. Clin Infect Dis 23, 1061-1065.

Wang, H., Fertala, A., Ratner, B.D., Sage, E.H., and Jiang, S. (2005). Identifying the SPARC binding sites on collagen I and procollagen I by atomic force microscopy. Anal Chem 77, 6765-6771.

Wilson, E.H., Harris, T.H., Mrass, P., John, B., Tait, E.D., Wu, G.F., Pepper, M., Wherry, E.J., Dzierzinski, F., Roos, D., et al. (2009). Behavior of parasite-specific effector CD8+ T cells in the brain and visualization of a kinesis-associated system of reticular fibers. Immunity 30, 300-311.

Wilson, E.H., Weninger, W., and Hunter, C.A. (2010). Trafficking of immune cells in the central nervous system. J Clin Invest 120, 1368-1379.

Wilson, E.H., Wille-Reece, U., Dzierszinski, F., and Hunter, C.A. (2005). A critical role for IL-10 in limiting inflammation during toxoplasmic encephalitis. J Neuroimmunol 165, 63-74.

Wirth, J.J., Kierszenbaum, F., and Zlotnik, A. (1989). Effects of IL-4 on macrophage functions: increased uptake and killing of a protozoan parasite (Trypanosoma cruzi). Immunology 66, 296-301.

Worbs, T., Mempel, T.R., Bolter, J., von Andrian, U.H., and Forster, R. (2007). CCR7 ligands stimulate the intranodal motility of T lymphocytes in vivo. J Exp Med 204, 489- 495.

Yamamoto, J., Adachi, Y., Onoue, Y., Adachi, Y.S., Okabe, Y., Itazawa, T., Toyoda, M., Seki, T., Morohashi, M., Matsushima, K., et al. (2000). Differential expression of the chemokine receptors by the Th1- and Th2-type effector populations within circulating CD4+ T cells. J Leukoc Biol 68, 568-574.

Yan, Q., and Sage, E.H. (1999). SPARC, a matricellular glycoprotein with important biological functions. J Histochem Cytochem 47, 1495-1506.

Yap, G.S., and Sher, A. (1999a). Cell-mediated immunity to Toxoplasma gondii: initiation, regulation and effector function. Immunobiology 201, 240-247.

Yap, G.S., and Sher, A. (1999b). Effector cells of both nonhemopoietic and hemopoietic origin are required for interferon (IFN)-gamma- and tumor necrosis factor (TNF)-alpha- dependent host resistance to the intracellular pathogen, Toxoplasma gondii. J Exp Med 189, 1083-1092.

Yunker, C.K., Golembieski, W., Lemke, N., Schultz, C.R., Cazacu, S., Brodie, C., and Rempel, S.A. (2008). SPARC-induced increase in glioma matrix and decrease in

128 vascularity are associated with reduced VEGF expression and secretion. Int J Cancer 122, 2735-2743.

Zhou, J., Tang, P.C.Y., Qin, L., Gayed, P.M., Li, W., Skokos, E.A., Kyriakides, T.R., Pober, J.S., and Tellides, G. (2010). CXCR3-dependent accumulation and activation of perivascular macrophages is necessary for homeostatic arterial remodeling to hemodynamic stresses. J Exp Med 207, 1951-1966.

Zhu, Z., Zheng, T., Homer, R.J., Kim, Y.K., Chen, N.Y., Cohn, L., Hamid, Q., and Elias, J.A. (2004). Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 304, 1678-1682.

129