Proteomic Signatures of Bacillus Subtilis

Proteomic signatures of Bacillus subtilis

Dissertation in fulfilment of the academic grade doctor rerum naturalium (Dr. rer. nat.)

at the Faculty of Mathematics and Natural Sciences Ernst-Moritz-Arndt-University Greifswald

Le Thi Tam born on 08.01.1979 in Bacninh, Vietnam

Greifswald, Germany, 2006

Dekan:

1. Gutachter 1: 2. Gutachter 2: 3. Gutachter 3:

Tag der Promotion: 3 Contents

Contents 3 Abbreviations 5 Summary of thesis 7 Chapter 1: Introduction 9 1. Proteomic approachs and definition of proteomic signatures 10 2. B. subtilis as model organism for functional genomics 12 3. Proteome maps in Gram-positive bacteria 13 4. Regulation and function of stress responses 14 4.1. Heat shock response 14 4.2. Salt stress response 17 4.3. Oxidative stress response 19 4.4. Antibiotic response 21 5. Regulation and function of the starvation responses in B. subtilis 23 5.1. Glucose starvation response 24 5.2. Phosphate starvation response 26 5.3. Nitrogen starvation response 27 5.4. Tryptophan starvation response 29 5.5. The RelA-dependent stringent response 31 5.6. The CodY-dependent starvation response 32 5.7. The σH-dependent general starvation response 32 6. Degradation of aromatic compounds in microorganism 33 7. Scopes of thesis 36 Chapter 2: A comprehensive proteome map of growing Bacillus subtilis cells 39 Chapter 3: Proteome signatures for stress and starvation in Bacillus subtilis 69 as revealed by a 2D gel image color coding approach Chapter 4: Global gene expression profiling of Bacillus subtilis in response to 91 ammonium and tryptophan starvation as revealed by transcriptome and proteome analysis Chapter 5: Differential gene expression in response to phenol and catechol 131 reveal different metabolic activities for the degradation of aromatic compounds in Bacillus subtilis Chapter 6: Proteomic signature catalog of B. subtilis in response to stress, 161 aromatic substances and nutrient starvation Chapter 7: General discussion 221 1. The vegetative proteome map of B. subtilis 222 2. Proteome signatures of B. subtilis in response to stress, starvation and 223 xenobiotics 2.1. The catalog of proteome signatures of B. subtilis 223 4

2.2. Proteome signatures of B. subtilis in response to stress and xenobiotics 224 2.3. Proteome signatures of B. subtilis in response to starvation 225 3. The response of B. subtilis to ammonium and tryptophan starvation 226 4. The response of B. subtilis to the aromatic compounds phenol and 227 catechol References 230 List of publications 252 Curriculum vitae 253 Acknowledgements 254

ABBREVIATIONS FULL NAMES

2D two-dimensional 2DE two-dimensional electrophoresis 2D-PAGE two-dimensional polyacrylamide gel electrophoresis ACN acetonitril ATP adenosine-5’-triphosphate B. subtilis Bacillus subtilis BMM Belitsky minimal medium BOC Belitsky minimal medium without citrate CBB Coomassie Brilliant Blue cDNA complementary deoxyribonucleic acid CFU colony forming unit CHAPS 3-[(3-cholamidopropyl)dimethyl ammonio]-1-propane sulfonate DNA deoxyribonucleic acid DTT dithiolthreitol E. coli Escherichia coli EDTA ethylenediamine tetra acetic acid Emr erythromycine resistance g gravity GTP guanosine triphosphate h hour IEF isoelectric focusing incl. including IPG non-linear immobilized pH gradients IPTG isopropyl-β-D-thiogalactoside kb kilo bases kDa kilo Daltons L liter LB Luria Bertani broth medium MIC minimal inhibitory concentration min minute

Mr molecular weight MS mass spectrometry nm nanometer OD optical density ORF open reading frame PCR polymerase chain reaction 6 pI isoelectric point PMSF phenylmethylsulphonylfluoride RNA ribonucleic acid rpm rounds per minute s second SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis TFA trifluoroacetic acid U unit V voltage v/v volume per volume w/v weight per volume

Summary of thesis

The proteome obtained by the high resolution 2D protein electrophoresis reflects the physiological state of a cell. From a physiological point of view, there are two main proteomes in microorganisms- the proteomes of growing and non-growing cells. The goals of this PhD thesis were (1) to establish the vegetative proteome map of B. subtilis; (2) to define the proteome signatures of B. subtilis in response to stress and starvation and aromatic substances towards the comprehensive proteome map of non-growing B. subtilis cells; (3) to study the response of B. subtilis to ammonium and tryptophan starvation using transcriptomics; (4) to investigate and characterize the global response of B. subtilis to phenol and catechol stress.

In the vegetative proteome of B. subtilis, 745 proteins were identified using the 2D gel-base approach. These include more than 40% of the predicted vegetative proteome in the standard pH range 4-7 and most of the proteins involved in the central metabolic pathways. This vegetative proteome map was complemented by the proteome map of B. subtilis in response to heat, salt, hydrogen peroxide and paraquat stress, after ammonium, tryptophan, glucose and phosphate starvation as well as in response to the aromatic compounds phenol, catechol, salicylic acid, 2-methylhydroquinone, 6-brom-2-vinyl-chroman- 4-on. In total, 224 induced marker proteins have been identified using the 2D gel-based approach including 122 stress-induced and 155 starvation-induced marker proteins. Of these, 89 marker proteins are not expressed in the vegetative proteome map. Fused proteome map and a color coding approach have been used to define stress-specific regulons that are involved in specific adaptation functions (HrcA for heat, PerR and Fur for oxidative stress, RecA for peroxide, CymR and S-box for superoxide stress). In addition, starvation-specific regulons are defined involved in the uptake or utilization of alternative nutrient sources (TnrA, σL/BkdR for ammonium; TRAP for tryptophan; CcpA, CcpN, σL/AcoR for glucose; PhoPR for phosphate starvation). The general stress or starvation proteome signatures include the CtsR, Spx, σL/RocR, σB, σH, CodY, σF and σE regulons. Among these, the Spx-dependent oxidase NfrA was induced by all stress conditions indicating stress- induced protein damages. Finally, a subset of σH-dependent proteins (Spo0A, YvyD, YtxH, YisK, YuxI, YpiB) and the CodY-dependent aspartyl phosphatase RapA were defined as general starvation proteins that indicate the transition to stationary phase caused by starvation.

The global gene expression profile of B. subtilis was monitored in response to ammonium and tryptophan starvation using the transcriptome approach. The results 8 demonstrated that both starvation conditions induced specific, overlapping and general responses. The TnrA and GlnR regulons as well as σL-dependent bkd- and roc- operons are most strongly and specifically induced after ammonium starvation which are involved in the uptake and utilization of ammonium and alternative nitrogen sources such as arginine, proline and branched chain amino acids. In addition, the induction of several carbon catabolite controlled genes (e.g. acsA, citB) as well as α-acetolactate synthase/ decarboxylase (alsSD) involved in acetoin biosynthesis and rather specific for ammonium starvation. The specific response to tryptophan starvation includes the TRAP-regulated tryptophan biosynthesis genes, a few RelA-dependent genes (e.g. adeC, ald) as well as spo0E. Furthermore, we recognized overlapping responses between ammonium and tryptophan starvation (e.g. dat, maeN) as well as the common induction of the CodY and σH general starvation regulons and the RelA-dependent stringent response. Several genes encoding proteins of so far unknown functions are induced in response to ammonium and/or tryptophan starvation which gained novel insights into the ammonium and tryptophan starvation responses of B. subtilis.

Finally, the global expression profile of B. subtilis was investigated in response to phenol and catechol using transcriptome analyses. Phenol induced the HrcA, σB and CtsR heat shock regulons as well as the Spx disulfide stress regulon. Catechol caused the activation of the HrcA and CtsR heat shock regulons and a thiol- specific oxidative stress response involving the Spx, PerR and Fur regulons but no induction of the σB regulon. The most surprising result was that several catabolite controlled genes are derepressed by catechol, even if glucose is taken up under these conditions. This derepression of the carbon catabolite control was dependent on the glucose concentration in the medium, since glucose excess increased the derepression of the CcpA-dependent lichenin utilization licBCAH operon and the ribose metabolism rbsRKDACB operon by catechol. Growth and viability experiments with catechol as a sole carbon source suggested that B. subtilis 168 is not able to utilize catechol as a carbon-energy source. In addition, the microarray results revealed the very strong induction of the yfiDE operon by catechol of which the yfiE gene shares similarities to glyoxalases/bleomycin resistance proteins/extradiol dioxygenases. Using recombinant His6-YfiEBs, we demonstrate that YfiE shows catechol-2,3-dioxygenase activity in the presence of catechol since the metabolite 2-hydroxymuconic semialdehyde was measured . Furthermore, both genes of the yfiDE operon are essential for the growth and viability of B. subtilis in the presence of catechol. Thus, our studies revealed that the catechol-2,3-dioxygenase YfiE is the key enzyme of a meta cleavage pathway in B. subtilis involved in the catabolism of catechol. 9

Chapter 1

Introduction

1. Proteomic approaches and definition of proteomic signatures

The genome sequence of an organism predicts the number of coding sequences and represents only the “blue-print of life”, not “life itself”. The proteome consisting of all expressed proteins at a certain time and under a certain condition brings the genetic information of the DNA sequence to the life. In contrast to the DNA sequence, the proteome provides informations about the expression levels, stabilization, localization, interaction and post-translational modifications of the proteins (e.g. phosphorylation, glycosylation). Therefore, the proteome analysis is an essential approach for the study of functional genomics and the regulation in biological systems.

Transcriptomic and proteomic approaches in response to changes in the environment including mutants in central regulatory genes are the major tools for functional genomics. The transcriptome is defined as the transcriptional expression profile in the cell under a certain condition [Velculescu et al., 1997] and the proteome refers to the complete protein set expressed in the cell under a certain condition. In 1975, O’Farrell and Klose introduced the two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) technique [O’Farrell 1975; Klose 1975]. Using this technique, a complex mixture of proteins can be separated because each single protein will migrate to it’s unique position in the 2D-gel determined by its charge and molecular mass. Later, this technique was introduced into bacterial physiology by Neidhardt and VanBogelen [Neidhardt and VanBogelen, 2000] who addressed crucial physiological questions by proteomics such as the heat stress response or the phosphate starvation response of E. coli. This new approach was extremely attractive for studies on cell physiology because proteomics could visualize cellular events not seen before by more conventional techniques.

However, the standard 2D gel-based proteome analysis has also certain limitations. For example, only a restricted protein amount can be separated in a 2D gel. Additionally, there are problems to separate hydrophobic transmembrane or alkaline proteins using the 2D gel-based approach [Choe and Lee, 2003]. Many new gel-based and alternative gel-free proteomic techniques have been developed to address these limitations. For example, for proteome analysis of membrane bound proteins in B. subtilis, Bunai and coworker have developed a membrane-protein-enrichment protocol using stepwise extraction of membrane proteins with mixtures of detergents [Bunai et al., 2004]. This purified membrane fraction was separated by three 2D gel-based techniques (IPGs, 16-BAC-PAGE and blue native PAGE). The 2D gel-based approach combined with the fluorescence thiol modification assay is a further proteome approach that allows to monitor the thiol state of cytoplasmic proteins and the oxidized state of sulfhydryl groups [Hochgräfe et al., 2005]. In addition, the ProQ Diamond Phosphoprotein Stain provides an excellent tool to study protein phosphorylation in a 2D gel. These advances in the proteome analysis improved significantly the study of post-

11 translational modifications in proteins [Hecker and Völker, 2004]. Moreover, to improve visualization of the proteome changes, the dual-channel imaging analysis technique was introduced by the Decodon Delta 2D software [Bernhardt et al., 1999].

In addition, gel-free proteomic approaches have been developed for proteome analysis of complex protein extracts including two-dimensional liquid chromatography coupled with tandem mass spectrometry (2D-LC-MS/MS) [Link et al., 1999; Lee et al., 2002], isotope-coded affinity tag (ICAT) methods coupled with 2D-LC-MS/MS [Gygi et al., 2002] or MALDI-QTOF (Matrix Assisted Laser Desorption/ Ionisation quadrupole time-of-flight) mass spectrometry methods. These gel-free proteome approaches allow high throughput proteome analyses or direct analysis of protein complexes [Griffin et al., 2001]. In addition, Righetti and coworkers have developed electrophoretic pre-fractionation techniques [Righetti et al., 2005], attempted to diminish previous disadvantages of 2D gel-based proteome techniques.

The definition of comprehensive proteome maps is the basis for the study of changes in the protein expression profile in response to changes in cellular physiology, such in response to stress and starvation. Fred Neidhardt and Ruth VanBogelen are pioneers in the field of the physiological proteome analysis, who concluded 17 steps in proteome analysis, allowing the diagnosis of the cellular state of microbial organisms using proteomics [VanBogelen et al. 1999]. They studied physiological proteomics in response to different stress and starvation conditions in Escherichia coli, the model organism for Gram-negative bacteria to elucidate cellular adaptation to inconvenient situations [VanBogelen, 2003]. In general, three different groups of expressed proteins can be distinguished, including induced, repressed and unchanged proteins. Induced proteins are proteins with an increased protein synthesis or amount in response to the specific stimulus which are often involved in the protection against or adaptation to the specific environmental change. The repressed proteins are those proteins with decreased protein syntheses or amounts in response to the specific stimulus. These are switched off because (i) these are not required for the cell in response to the stimulus (by transcriptional repression, proteolysis or post-translation modification) or (ii) the cell is no longer able to maintain the protein (by proteolysis or release of the protein from the cell) [VanBogelen, 2003]. All proteins that are induced and repressed in response to a single stimulus constitute a stimulon which in turn can be classified in different induced and repressed regulons. A regulon includes all proteins which are controlled by a common regulatory protein. Regulons reflect the genetic points in the adaptation to the stimulus [Hecker, 2003]. The stimulons can be classified in the specific regulons using comparative proteome and transcriptome analyses of wild-type and mutant strains in central regulatory genes.

The term of ‘proteomic signature’ was defined as the subset of proteins that is induced in response to a defined condition including specifically induced proteins that

12 respond to one specific stimulus and generally induced proteins that are induced by a different set of stimuli [VanBogelen et al., 1999]. For example the chaperones DnaK and GroEL are heat specific proteins and the σB-dependent stress proteins overlap between heat, salt, ethanol stress and starvation for glucose, phosphate in B. subtilis. Proteomic signatures were first defined in E. coli to study bacterial physiology in the presence of external stress factors or different nutrient sources. Ruth VanBogelen and Fred Neidhardt have shown a clear correlation between the proteomic signatures of E. coli after heat and cold shock and in response to different classes of antibiotics that target the prokaryotic ribosome [VanBogelen and Neidhardt., 1990]. For example, the protein expression profiles in response to puromycin, streptomycin and kanamycin indicate a heat shock response as revealed by the induction of heat shock proteins (HSPs) that are induced also by a temperature up-shift. In contrast, chloramphenicol, tetracycline, erythromycin, spiramycin and fusidic acid cause an induction of cold shock proteins (CSPs), repress the HSPs and increase slightly the synthesis of ribosomal proteins and translation factors. However, HSPs and CSPs were induced at 30, 45 or 75 min after the addition of antibiotics. Thus, these proteins are suggested to be induced in response to a change in the translational capacity of the cell. The proteome comparison after phosphorous limitation and in the presence of phosphonate revealed proteins that are likely involved in the adaptation to new phosphorous sources or stationary phase survival of the cells [VanBogelen et al., 1996].

2. B. subtilis as model organism for functional genomics

B. subtilis is a rod-shaped, flagellated and spore-forming Gram-positive soil bacterium. B. subtilis is widely regarded as model organism for functional genomics of Gram- positive bacteria since (i) there is a long standing interest in bacilli as host for biotechnological production processes, (ii) it is a simple model for cellular differentiation, (iii) it is highly amenable for genetic manipulation and (iv) there is an excellent genetic and biochemical characterization (e.g. by mutant collection in a joint Japanese European functional analyses program). B. subtilis consists of a limited number of sub-cellular compartments: the cytoplasm is surrounded by a single cytoplasmic membrane which in turn is separated from the extracellular space by a thick Gram-positive cell wall consisting of peptidoglycan and covalently attached anionic polymers such as teichoic acids [Archibald et al., 1993]. In contrast to Gram-negative bacteria, B. subtilis is lacking an outer membrane. Thus, the thick cell wall is thought to perform some roles of the periplasm of Gram-positive bacteria [Pooley et al., 1992]. The lack of an outer membrane simplifies the secretion pathway: B. subtilis is able to secrete large amounts of proteins directly into the surrounding growth medium. Thus, B. subtilis is also used as an industrial host for the large-scale production of enzymes like proteases, amylases or lipases.

As soil-living bacterium, B. subtilis is exposed to several stress and starvation conditions which require a complex regulatory network to adapt to changes in the environment. Changes in the environment lead to global changes in the cellular metabolism which are reflected by changes in the global gene expression pattern as visualized by proteome and transcriptome approaches. To grow under stress conditions, cells adapt by either induction of new stimulons including stress specific regulons or an increase of systems expressed in growing cells. If cells are faced to starvation conditions, they have to adapt by the induction of stimulons including starvation specific regulons that are involved in the uptake and metabolism of alternative nutrient sources. These highly sophisticated networks for adaptation to stress or starvation conditions reveal new insights into the B. subtilis physiology and provide major leads for the research on physiology of other microorganisms.

3. Proteome maps in Gram-positive bacteria

The first goal of the 2D gel-based proteome analysis is the definition of master 2D gels or reference proteome maps for the different subproteomes of the specific organism. In Gram-positive bacteria such as B. subtilis, four different subproteomes can be defined: the cytoplasmic, membrane, cell wall and extracellular proteome. The vegetative proteome of growing B. subtilis cells includes 745 proteins that can be separated using 2D gel-based proteome approaches in the standard pH range 4-7 [chapter 2, Eymann et al., 2004]. The identified cytoplasmic proteins are involved in the central metabolism of carbohydrates, amino acids, nucleotides, fatty acids as well as in replication, transcription, translation, motility, secretion and cell wall synthesis. The 4100 different open reading frames that are predicted from the sequence for B. subtilis include 2515 genes that are actively transcribed in growing cells according to previous array data [chapter 2; Kunst et al. 1997]. The identified proteins cover more than 40% of all theoretically in growing cells expressed proteins according to transcriptome data. 2D gel-free proteome approaches such as 2D-LC-MS/MS resulted in the additional identification of 475 new proteins in the vegetative cytoplasmic and membrane proteome not detected using the gel-based proteome analysis [Wolff et al., 2006]. This vegetative proteome map was the basis for physiological applications by the definition of the proteome map after stress and starvation including a catalog of proteome signatures as presented in chapter 3.

Since members of the genus Bacillus are lacking an outer membrane, extracellular proteins are directly secreted into the surrounding growth medium. B. subtilis is known to secrete large amounts of degradative enzymes such as amylases, proteases, lipases and nucleotidases that are used in industrial applications [Ferrari et al., 1993]. In the extracellular proteome of B. subtilis, 113 proteins were identified including 50% predicted secretory

14 proteins with signal peptides and no retention signals. The remaining unpredicted secretory proteins are cytoplasmic, flagella-related and prophage-related proteins that lack signal peptides or lipoproteins and cell wall proteins with retention signals in addition to the signal peptides [Antelmann et al., 2001; Tjalsma et al., 2004]. The comparative extracellular proteome analysis with mutants lacking different components of the B. subtilis secretion machinery gained novel insights into the protein secretion mechanisms of B. subtilis. The majority of predicted secretory proteins was shown to be translocated via the SRP-Sec pathway and requires the PrsA foldase for proper folding [Zanen et al., 2006]. Only the alkaline phosphodiesterase PhoD was shown to be specifically transported via the TatAdCd pathway [Jongbloed et al., 2000; 2002]. Lipoproteins and cell wall proteins were shown to be secreted due to proteolysis and cytoplasmic proteins leave the cell via cell lysis [Tjalsma et al., 2004]. The LiCl-extracted cell wall proteome of B. subtilis consists of 12 abundant non- covalently linked cell wall proteins including the WapA processing products (CWBP105 and CWBP62), the processing products of the major cell wall protease WprA (CWBP52 and CWBP23) and the autolysins LytC and LytB [Antelmann et al., 2002].

The cytoplasmic proteome of S. aureus includes 473 proteins which were identified in the standard pH range 4-7 by 2D gel-based proteome techniques and 650 additional proteins only detected by gel-free proteome analyses (2D-LC-MS/MS). In the extracellular proteome of different S. aureus strains, at least 178 secreted proteins have been identified including 53 predicted secretory proteins with N-terminal signal peptides and 70% unpredicted secretory proteins (cytoplasmic proteins, cell wall proteins and membrane proteins) [Ziebandt et al., 2001; Ziebandt et al., 2004; A.-K. Ziebandt, K. Rogasch and S. Engelmann, personal communication]. Reference proteome maps for cytoplasmic and extracellular proteins have been defined also for Bacillus licheniformis [Voigt et al., 2004; 2006]. In addition, the subproteomes for cytoplasmic, cell wall and extracellular proteins have been defined for many pathogen Gram-positive bacteria including for example Bacillus anthracis [Antelmann et al., 2005; Gohar et al., 2005], Bacillus cereus, Bacillus thuringensis [Gohar et al., 2005], Listeria [Folio et al., 2004], C. difficile [Wright et al., 2005] and Streptococcus [Lee et al., 2006].

4. Regulation and function of stress responses

4.1. Heat shock response

The heat shock response has been studied in many cellular systems such as bacteria, yeast, insects [Hecker, 2003; Neidhardt and VanBogelen., 2000; Michaud et al., 1997; Morano et al., 1998; Bukau, 1993]. The highly conserved set of so-called heat shock proteins (HSPs) includes molecular chaperones and ATP-dependent proteases. The

15 chaperones prevent misfolding and aggregation of partially denatured proteins and assist in proper protein folding. The proteases are involved in the degradation of mal-folded or aggregated proteins. In addition, these HSPs are shown to be involved in the cross- protection against other stresses in B. subtilis [Hecker and Völker., 1998]. Even though the HSPs are conserved, the regulatory mechanisms are different among microorganisms. In the Gram-negative bacterium E. coli, the HSPs are regulated by the alternative heat shock sigma factor σ32. The σ32 regulon includes the chaperones and proteases (DnaK, DnaJ, HtpG, GroES, GroEL, ClpB, IbpB, IbpA, HslO, ClpP, ClpX, ClpY, ClpQ and Lon), the peptidyl-prolyl cis/trans isomerase (PpiD), the dehydrogenase (GapA), the phosphatase (PrpA), the metalloprotease (HflB), the nucleotide exchange factor (GrpE), the sigma factor (σ70), the epimerase (HtrM), the homoserine transsuccinylase (MetA) and many proteins with unknown E 32 functions. Other heat shock proteins including the sigma factors (σ , σ ), protease (DegP) and peptidyl prolyl cis/trans isomerase (FkpA) are regulated by the heat shock sigma factor σE in E. coli [Yura et al., 2000].

In B. subtilis, HSPs can be divided into three classes. The class I heat shock proteins including the DnaK-DnaJ-GrpE and GroESL chaperone machineries are regulated by the HrcA repressor. The class II heat shock proteins are under control of the general stress and starvation sigma factor σB, and the class III heat shock proteins such as the Clp proteases are controlled by the CtsR repressor [Schumann et al., 2002]

The HrcA-dependent class I heat shock proteins DnaK, GroEL, GroES, GrpE were identified in B. subtilis in the 2D gel after heat shock more than 10 years ago [Hecker and Völker., 1990]. The HrcA regulon consists of the dnaK and groE operons that are preceded by a σA type promoter and a CIRCE element (controlling IR of chaperone expression) (TTAGCACTC-N9-GAGTGCTAA) which was shown to be involved in the regulation of the heat shock response [Zuber U and Schumann W, 1993]. The dnaK operon includes the genes hrcA, grpE, dnaK and dnaJ of which hrcA gene encodes a transcriptional repressor of the dnaK and groE operons [Wetzstein et al., 1992; Schulz and Schumann, 1996]. In the absence of heat shock, the binding of activated HrcA to the CIRCE element is modulated by the GroE molecular chaperone amount which allows a basal level of transcription of the downstream operon [Mogk et al., 1997]. After heat shock, HrcA is inactivated and not able to recognize the CIRCE sequence. Therefore, a high expression level of the whole operon was observed [Schumann, 2003; Hecker et al., 1996]. The heat shock induces also the formation of non-native proteins arising the GroE chaperonin system. However, after removal of the non-native proteins from the cytoplasm, the GroE chaperonins are free to convert inactive HrcA into its active form, resulting in a turn-off of the HrcA regulon until the default state has been reached [Schumann, 2003].

The class II heat shock σB regulon was found to be induced by heat, salt, ethanol or acid stress as well as by starvation for glucose, phosphate and oxygen [Bernhardt et al. 1997; Hecker and Völker, 1998, 2001; Hecker, 2003]. In unstressed cells, the anti-σ factor RsbW sequesters σB in an inactivate complex, preventing its association with the RNA polymerase core enzyme. RsbW is a serine kinase which phosphorylates RsbV under non- stress conditions, preventing RsbV from RsbW binding. In stressed cells, the regulation to activate σB depends on two classes of stress. The first class consists of energy-stress signals caused by carbon, phosphorus, oxygen starvation or the addition of uncouplers. The second class includes environmental-stress signals such as acid, ethanol, heat or salt stress [Price, 2002]. The energy-stress signaling pathway (first group) terminates with the RsbP phosphatase (PP2C), which contains a PAS (an amino-terminal Per-Arnt-Sim) domain important for energy stress sensing [Vijay et al., 2000]. RsbP was shown to interact with RsbQ, a positive regulator essential for energy stress activation of σB [Brody et al., 2001]. In contrast, the environmental-stress signaling pathway (second group) terminates with RsbU phosphatase (PP2C). RsbU is activated by upstream regulators which rely on a partner switching mechanism between the RsbS-RsbT complex and RsbT-RsbU complex [Kang et al., 1998; Yang et al., 1996]. When activated by stress, either the RsbP or the RsbU phosphatase removes the serine phosphate from RsbV-P. Dephosphorylated RsbV then binds the RsbW anti-σ factor, release σB which can then activate the transcription of its target genes [Alper et al., 1996; Dufour and Haldenwang, 1994]

Using transcriptome analysis, 125 σB-dependent genes were identified that are induced after ethanol, heat and salt stresses in the wild-type but not in the σB mutant [Petersohn et al., 2001]. Of these, 101 genes contain σB-dependent promoter sequences. The physiological role of the proteins belonging to the σB regulon in the complex of general stress response is only partly understood. The σB-dependent proteins are shown to confer a multiple, non-specific and preventive stress resistance to non-growing B. subtilis cells in anticipation of future stress possibly encountered during long-term stationary growth stages [Hecker and Völker, 2004; Price, 2002]. It was further demonstrated that σB is required for growth and stationary-phase survival at low temperatures [Mendez et al., 2004]. Induction of the general stress response by one stress affords significant cross-protection against other stresses [Hecker and Völker, 2004; Price, 2002]. Some σB-dependent gene products were known with clear protective functions. For instance, the Clp proteases are shown to participate directly in overall proteolysis of misfolded proteins [Kruger et al., 2000; Kim et al., 2000]. The Dps protein resembles the Escherichia coli Dps/PexB protein that binds and shields the chromosome against multiple stresses including acid, heat and oxidative stresses [Martinez and Kolter, 1997; Antelmann et al., 1997]. OpuE transports proline and provides a potentially broad but as yet uncharacterized stress resistance [von Blohn et al., 1997]. The

σB-dependent proteins including the catalases KatE and KatX, the manganese-containing catalase YdbD and thioredoxin TrxA are thought to specifically prevent or repair the damage caused by oxidative stress. YdbD can destroy peroxides and related damaging compounds, and the TrxA is involved in the maintainance of the thiol-disulfide balance [Price et al., 2001; Scharf et al., 1998]. Other σB-dependent proteins such as YdfO, YkzA an YqgZ may fulfil a detoxification role that contributes to general stress protection. YdfO is similar to hydroquinone dioxygenase from Sphingomonas species [Price et al., 2001; Miyauchi et al., 1999]. YkzA is an OsmC homolog which closely resembles the Ohr organic hydroperoxide resistance protein from Xanthamonas campestris [Mongkolsuk et al., 1998]. YqgZ resembles arsenate reductase and may therefore provide resistance to toxic metals [Price et al., 2001]. Some σB-dependent proteins appear to directly affect cell metabolism including solute influx and efflux, carbon metabolism, envelope synthesis and macromolecular turnover [Price et al., 2001].

The class III heat shock proteins include proteins involved in protein renaturation, protein repair, or ATP-dependent proteolysis such as the ATP-dependent Clp proteases (ClpC, E, P, X) and the Lon protease (LonA and LonB) [Rotanova et al., 2004] that are controlled by the CtsR repressor. The ClpC ATPase of B. subtilis was shown to be involved in competence, degradative enzymes synthesis, sporulation, cell division and survival under stress conditions. The clpC operon (ctsR-mcsA-mcsB-clpC) as well as the clpP gene are both preceeded by overlapping σB and σA-dependent promoters [Schumann et al., 2002]. ClpP is essential for growth at high temperature and stress tolerance [Gerth et al., 1998; Msadek et al., 1998]. In combination with ClpC and/or ClpX, ClpP appears to be involved in the degradation of misfolded proteins or regulation of the signal peptide cleavage of secretory preproteins in protein secretion [Pummi et al., 2002; Kock et al., 2004]. ClpE and ClpX are rapidly degraded in the wild-type cells during permanent heat stress by ClpP [Gerth et al., 2004]. In B. subtilis, ClpX is necessary for the induction of σH-dependent genes [Nakano et al., 2000]. It is proposed to function indirectly in the displacement of σA from RNA polymerase core enzyme and directly in the transcription of σH-dependent genes during sporulation [Liu and Zuber, 2000]. LonA is induced in response to heat, osmotic and oxidative stress and prevents σG activity under non-sporulation conditions. In contrast, LonB is expressed under σF control during sporulation conditions [Serrano et al., 2001]. However, the roles of the Lon proteases in stress management remain to be elucidated.

4.2. Salt stress response

A rise in the external salinity and osmolality triggers the outflow of water from the cell, results in a reduction in turgor and dehydration of the cytoplasm. To cope with these

18 unfavorable osmotic conditions, B. subtilis initiates a two-step adaptation response [Bremer and Kramer, 2000; Kempf and Bremer, 1998]. Initially, K+ is rapidly taken up [Whatmore and Reed, 1990] and subsequently replaced in part by proline [Whatmore et al., 1990], a member of the so-called compatible solutes [Galinski and Truper, 1994]. These osmolytes can be accumulated to high levels through either de novo synthesis or uptake of osmoprotectants from the environment without interfering with central cellular functions. For B. subtilis, proline serves as the primary endogenously synthesized compatible solute [Whatmore et al., 1990] and large quantities are produced via a dedicated osmostress-responsive synthesis pathway [Belitsky et al., 2001]. In addition, B. subtilis can efficiently scavenge a wide variety of compatible solutes from environmental sources by means of five osmoregulated transport systems (OpuA to OpuE) [Kappes et al., 1996; Kappes et al., 1999; Kempf and Bremer, 1995; von Blohn et al., 1997] and can aquire choline for the production of the osmoprotectant glycine betaine [Kappes et al., 1999]. The accumulation of compatible solutes offsets the detrimental effects of high osmolality on cell physiology and permits growth over a wide range of osmotic conditions [Boch et al., 1994]. It has been shown that the increases in salinity affect the phospholipid composition of the cytoplasmic membrane [Lopez et al., 2000], the properties of the cell wall [Lopez et al., 1998], and the synthesis of the cell wall- associated protein WapA [Dartois et al., 1998]. In addition, the production of several extracellular degradative enzymes is regulated in a DegS/DegU-dependent manner at high salinity [Kunst and Rapoport, 1995]. Under such growth conditions, the structural gene for membrane-associated protease FtsH is transiently induced [Deuerling et al., 1995].

Proteomic and transcriptomic approaches have shown that salt stress triggers generally the induction of σB regulon [Petersohn et al., 2001; Steil et al., 2003; Höper et al., 2006]. This non-specific stress protection also includes protection against osmotic stress. For instance, YceE, YdbD, YfkM, and YhdN might be involved in the osmotic protection since mutants are more salt-sensitive than the wild-type [Höper et al., 2005]. Membrane proteins such as OpuD and OpuE are involved in the uptake of osmoprotectants. The immediate response to salt stress is followed by the induction of the σW regulon [Höper et al., 2006]. The σW-dependent proteins seem to be involved in the maintenance of cell integrity during cell surface or alkaline stress [Cao et al., 2002b; Cao et al., 2002a]. Salt shock induced the fatty acid biosynthesis enzymes such as the beta-ketoacyl-acyl carrier protein synthase II and III (FabF, FabHB). Furthermore, salt stress seems to cause oxidative stress in the cell as indicated by the induction of the PerR-dependent catalase KatA, the alkyl hydroperoxide reductase subunits AhpC and AhpF, the glutamyl tRNA reductase HemA as well as enzymes involved in cysteine biosynthesis and the formation of [4Fe-4S] clusters (CysC, YurU) [Höper et al., 2006] and those induced also by iron limitation [Hoffmann et al., 2002]. Transcriptomic analysis revealed the most strongly induction of the proJH genes which are involved in the

19 osmoregulatory synthesis of the compatible solutes proline [Belitsky et al., 2001] and mntR that encodes a transcriptional regulator of the manganese uptake system [Steil et al., 2003].

4.3. Oxidative stress response

Cells encounter oxidative stress by the exposure to reactive oxygen species (ROS) that result in protein or DNA damage. ROS include hydroxyl radical (OH•), hydrogen peroxide

(H2O2), or superoxide anions (O2¯) that are generated by the incomplete reduction of dioxygen or the autoxidation of respiratory enzymes. ROS are also induced by the exposure of cells to ionizing radiation, redox-active compounds (paraquat, plumbagin, ubiquinones, menadione) or transition metals. The destructive power of ROS can be argued by free intracellular iron. As long as the ROS amount increases to the levels that exceed the capacity of the cellular defence systems, it causes toxic effects, damages nucleic acids, proteins and membrane lipids [Storz and Zheng, 2000; Imlay, 2003]

The O2¯ attacks enzymes with exposed [4Fe-4S] clusters, resulting in the release of iron and loss of enzyme activity [Brown et al., 1995]. It has shown that the O2¯ inhibits the synthesis of branched-chain and aromatic amino acids by inactivating the [4Fe-4S] cluster of dehydratases or transketolases [Benov et al., 1996; Benov and Fridovich, 1999; Benov,

2000; Imlay, 2006]. H2O2 can be produced by spontaneous dismutation of superoxide O2¯.

H2O2 is able to oxidize free iron (Fenton chemistry), generating hydroxyl radicals that react with any biomolecule of the cell [Imlay et al., 1988; Imlay, 2003]. In addition, H2O2 can also react with cysteinyl-thiol, create disulfide bonds or sulfenic acid derivatives [Imlay, 2003].

H2O2 is further able to form carbonyl groups in lysine, arginine, threonine, proline residues and to oxidize methionine to methionine sulfoxides [Requena et al., 2001; Stadtman and Levine, 2003]

The cellular responses to oxidative stress were studied firstly in E. coli [Demple and

Halbrook, 1983]. The adaptive responses to H2O2 and O2¯ in E. coli are regulated by OxyR and SoxRS, respectively. After exposure to superoxide-generating agents, SoxR is recovered with [2Fe-2S] centers in the oxidized (Fe3+-Fe3+) state which is specific for the soxS promoter at a site between the -10 and -35 elements. The activation of OxyR in response to H2O2 depends on two cysteine residues (Cys199 and Cys208). The oxidized form of OxyR binds to the promoter region of the target genes and activates transcription by protein-protein contact with RNA polymerase. The SoxRS regulon includes sodA (superoxide dismutase), zwf (glucose-6-phosphate dehydrogenase), fldA and fldB (flavodoxins), fpr (NADPH-ferredoxinreductase), fur (regulator of iron metabolism), nfo (DNA repair endonuclease IV), acrAB (efflux pump) and micF (untranslated small RNA that downregulates the porin OmpF). The OxyR regulon includes dps (a DNA- binding protein),

20 gorA (GSH reductase), grxA (glutaredoxin), katG (peroxidase), ahpCF (alkyl hydroperoxide reductase) and fur. The SoxRS system was shown to be involved in the resistance of the cell to organic solvents, macrophage-generated nitric oxide (NO), and antibiotics [Pomposiello and Demple, 2001].

In B. subtilis, the PerR, Fur, OhrR, CtsR, SOS, σB, CymR and S-box regulons are shown to be involved in the response to oxidative stress provoked by paraquat, H2O2, and organic hydroperoxides [Helmann et al., 2003; Mostertz et al., 2004; Even et al., 2006]. The PerR regulon includes the vegetative catalase KatA, the alkyl hydroperoxide reductase AhpCF, the metalloregulatory DNA binding protein MrgA, the heme biosynthesis enzymes HemAXCDBL, the iron-uptake regulator Fur, the zinc-uptake system ZosA and PerR itself [Herbig and Helmann, 2001]. Fur is the ferric uptake repressor that controls genes involved in iron uptake and siderophore biosynthesis [Baichoo et al., 2002; Ollinger et al., 2006]. Regulation of iron uptake is necessary to prevent oxidative damage that can be exacerbated by excessive iron in the cell. It has also shown that the production of low molecular weight Fe(III) chelators (siderophores) enables microorganisms to efficiently scavenge iron [Wandersman and Delepelaire, 2004]. The Fur regulon includes the bacillibactin siderophore biosynthesis operon (dhbACEBF); ABC transporters involved in the uptake of siderophores such as enterobactin, bacillibactin (feuABCybbAB), ferric hydroxamates (yxeB, fhuBCG), schizokinin, arthrobactin (yusV,yfjYZ yfhA) or unknown siderophores (yclNOPQ, yhfQ, ywjAB), elemental Fe (ywbLMN), Fe-citrate (yfmCDEF); the predicted esterase (yuiI); the endoglucanase (yoaJ) and the thioredoxin reductase (ycgT) [Baichoo et al., 2002; Ollinger et al., 2006]. Sulfur-limitation regulated genes are involved in the synthesis of the sulfur- containing amino acids cysteine and methionine [Mostertz et al., 2004, Even et al., 2006]. In response to methionine availability the S-box transcription termination system controls the expression of genes participating in the uptake, biosynthesis and recycling of methionine [Grundy and Henkin, 1998]. In B. subtilis, at least 11 transcriptional units contain S-box elements in the leader region including cysH/ylnABCDEF (sulfur assimilation), yjcIJ (cystathionine gamma synthase/beta lyase), yusCBA (ABC transporter), yoaDCB (phosphoglycerate dehydrogenase transporter), ykrWXYZ (rubisco), ykrTS, metC (methionine synthase), yitJ (methionine synthase), yxjG, yxjH (methionine synthase, coenzyme B12-independent) and metE (S-adenosylmethionine synthetase) [Grundy and Henkin, 1998]. The S-box regulation mechanism is based on a direct interaction of available S-adenosilmethionine with the mRNA leader region [McDaniel et al., 2003]. Genes involved in cysteine metabolism are under global control of the repressor CymR (YrzC) [Even et al.,.2006]. The CymR regulon includes cysK (O-acetylserine thiol-lyase), tcyP and tcyJKLMN (L-cystine transporters), ytlI (positive regulator of sulfur metabolism), ydbM (putative butyryl CoA dehydrogenase), ssuACDN (sulfonate assimilation), yxeK operon (assimilation of

21 unknown sulfur compounds) and yrrT-mntN-yrhAB (methionine-to-cysteine conversion) [Even et al., 2006].

Proteomic and transcriptomic analyses have revealed that the PerR-regulated genes katA, mrgA, ahpCF, zosA and fur are most strongly induced after peroxide and superoxide stress [Mostertz et al., 2004; Helmann et al., 2003]. The Fur regulon was found to be induced due to PerR-dependent derepression. CymR- and S-box-regulated genes involved in sulfur assimilation are induced by superoxide challenge, and the SOS response that indicates DNA damage was induced by peroxide. The ohrA gene was specifically induced by organic hydroperoxides and regulated by the peroxide-sensing transcription factor, OhrR [Helmann et al., 2003; Fuangthong et al., 2001]. Moreover, the response of B. subtilis to superoxide stress also involved the extracytoplasmic sigma factor (ECF) σM [Cao et al., 2005]. Analysis of σM-regulated genes revealed that the putative hydrolase YqjL and the undecaprenyl pyrophosphate (UPP) phosphatase BcrC are involved in paraquat resistance.

Disulfide stress is a subcategory of oxidative stress provoked by the thiol-specific oxidant “diamide” that causes the oxidation of thiol groups, resulting in non-native disulfide bond formation and misfolded proteins [Leichert et al., 2003; Bardwell, 1994; Deneke, 2000]. Proteome and transcriptome analyses in response to diamide stress showed a relationship between disulfide, paraquat and heat stress. Diamide stress induced the class I and III heat shock regulons (HrcA, CtsR), the oxidative stress-specific PerR regulon and the CymR and S-box regulons involved in sulfur assimilation [Even et al., 2006; Leichert et al., 2003]. Most importantly, disulfide stress triggers the Spx regulon that functions in maintainance of thiol homeostasis (e.g. thioredoxin, methionine sulfoxide reductase, thiol peroxidase and several other oxidoreductases) [Nakano et al., 2003]. Spx bears a Cys-X-X-Cys (CXXC) motif resembling a redox active site commonly found in oxidoreductase which is a target for redox- dependent control [Zuber, 2004]. It was demonstrated that the transcriptional activation of trxA and trxB by Spx required formation of an intramolecular disulfide bond within the CXXC motif [Nakano et al., 2005]

4.4. Antibiotic response

Antibiotics are natural or synthetic compounds that inhibit the growth or kill microorganisms (bacteriostatic or bacteriolytic antibiotics). Antibiotics are classified according to the chemical structure. The β-lactam antibiotics are characterized by a four-membered cyclic amide (β-lactam) including penicillins, cephalosporins, carbapenems that inhibit the biosynthesis of peptidoglycan. Bacitracin and glycopeptides (vancomycin, teicoplanin) are also able to inhibit peptidoglycan biosynthesis. The cyclic peptide antibiotics polymicidin B, colistin, gramicidin and bacitracin are shown to affect membrane permeability.

Aminoglycoside antibiotics such as streptomycin, neomycin, kanamycin and tetracyclines are inhibitors of the 30S ribosomal subunit. Macrolides, lincosamides, streptogramins and chloramphenicol are inhibitors of the 50S ribosomal subunit. Mupirocin is an inhibitor of isoleucyl-tRNA synthetase. Even though antibiotics are successfully applied in the therapy of many otherwise lethal infectious diseases, bacteria are able to adapt to several antibiotics by the development of specific resistance mechanisms. The diversity of bacterial resistance mechanisms to antibiotics is the major problem caused by the use of antibiotics and is currently not fully understood. Thus, the study of the bacterial response to antibiotics by transcriptomic and proteomic approaches is required to understand the resistance mechanisms [Bandow et al., 2002; Brötz-Oesterhelt et al, 2005].

B. subtilis was used as model for the investigation of the antibiotic response in Gram- positive bacteria [Bandow et al., 2003; Brötz-Oesterhelt et al, 2004]. For these analyses, the concentration of antibiotics that resulted in a half-maximal growth rate was used for the analysis of proteomic signatures. The protein synthesis patterns are compared before and after the treatment with antibiotics and the antibiotic-induced proteins are defined as marker proteins [Evers et al., 2001; Bandow et al., 2003]. A catalog of proteomic signatures in response to the different major classes of antibiotics was established in B. subtilis showing the specific and overlapping marker proteins in combination with the known mode of actions [Bandow et al., 2003; Brötz-Oesterhelt et al, 2004]. Specifically, this catalog presents an overview about proteomic signatures in response to 30 different antibiotics with mostly known mode of action. This catalog might be helpful to predict the target and mode of action of new antibiotics or antimicrobials. This database gives a promise in regard to a perspective of proteomic application in drug discovery.

In total, 122 marker proteins were defined for 30 different antibiotics. For the known antibiotics, the proteomic signatures are consistent with pre-existing knowledge about the antibiotic mode of action. For example, antibiotics that inhibited protein biosynthesis by interfering with ribosomal translation accuracy or translation abortion such as gentamicin, kanamycin, streptomycin and puromycin, induced class I heat shock proteins (GroESL). This induction of heat shock proteins is caused by mistranslation resulting in the accumulation of misfolded proteins in the cell. The class of translation elongation inhibitors such as tetracycline, erythromycin, chloramphenicol and fusidic acid induced marker proteins that belong to the translation machinery such as ribosomal proteins and elongation factors. Mitomycin C and 4-nitroquinoline-1-oxide are known to disturb the DNA structure as revealed by the induction of the RecA-dependent prophage PBSX marker proteins. Cerulenin, an inhibitor of fatty acid synthesis induced proteins that are involved in fatty acid synthesis. The isoleucine/leucine tRNA synthetase inhibitors norvaline and mupirocin induced the classical stringent response in B. subtilis including the branched-chain amino acid biosynthesis ilv-leu

23 operon [Eymann et al., 2002]. The peptide deformylase inhibitor actinonin caused a shift to more acidic pH of proteins [Apfel et al., 2001; Bandow et al., 2003]. This effect is caused by the inhibition of the deformylation of newly synthesized protein fractions.

Antibiotics that share marker proteins might overlap in the modes of action. For example, nitrofurantoin and diamide share 12 marker proteins which led to a proposal that nitrofurantoin caused oxidative protein damage by non-native disulfide formation as shown for diamide. The marker proteins induced by Triton X-100 overlap with those of valinomycin and gramicidin A implying common disturbance effect of the membrane structure. The antibiotic cerulenin shared 5 marker proteins with monensin suggesting that its effect on inhibition of fatty acid biosynthesis eventually leads to a loss of membrane integrity. Interestingly, the marker protein overlapping concept was applied to a novel pyridiminone antibiotic BAY 50-2369. Protein pattern of cells treated with BAY 50-2369 closely resembled that of cells treated with other translation elongation inhibitors, such as chloramphenicol and tetracycline. This result leads to the suggestion that BAY 50-2369 acts by inhibition of the peptidyltransferase reaction. Later, this marker concept was also used for phenylalanyl-tRNA synthetase inhibitors, suggesting the potential value of phenylalanyl-tRNA synthetase as a target in antibacterial therapy [Beyer et al., 2004]

The treatment of the cells with antibiotics provides novel informations about regulatory mechanisms involved in antibiotic resistance mechanisms. The LiaRS two- component system was induced by cell wall active antibiotics, such as bacitracin, nisin, ramoplanin and vancomycin [Mascher et al., 2004]. In response to vancomycin or bacitracin, LiaRS autoregulates the liaIHGFSR operon. In addition to the lia operon, the σW and σM ECF sigma factor regulons are strongly induced by cell wall active antibiotics [Cao et al., 2002b]. The bcrC gene is regulated by σM and σX and involved in bacitracine resistance [Cao and Helmann, 2002]. BcrC acts as an undecaprenyl pyrophosphate (UPP) phosphatase that is able to compete with bacitracine for UPP [Bernard et al., 2005]. This supported the idea that the ECF sigma factors coordinate the antibiotic stress response. The induction of the σM and σW regulons as well as three two-component systems (YxdJK, YxdLM and BceAB) was shown for antimicrobial peptides [Pietiainen et al., 2005].

5. Regulation and function of the starvation responses in B. subtilis

24 and Ohja, 2001], the σB-dependent general stress response [Hecker and Völker, 1998; 2001] and the sporulation process [Hoch, 1993]. Bacteria are able to monitor the availability of essential nutrients (carbon, nitrogen, phosphorus) by measuring extracellular concentrations, intracellular pools, or fluxes in those pools and transmitting that information to regulatory proteins. Furthermore, bacteria preferentially utilize those carbon or nitrogen sources which can be metabolized most rapidly [Fisher and Sonenshein, 1991].

5.1. Glucose starvation response

B. subtilis uses glucose as the most preferred source of carbon and energy [Stülke and Hillen, 2000]. The presence of glucose inhibits the uptake and catabolism of less favourable carbon sources [Stülke and Hillen, 2000]. This inhibition process is controlled by a regulatory mechanism for carbon catabolite repression (CCR). CCR is a key mechanism that controls the expression of numerous genes in response to the availability of different carbon sources. CCR is mediated via CcpA [Henkin, 1996] and its co-repressor HPr and Crh [Deutscher et al., 2002]; CcpB or CcpC and CcpN. CcpA is a member of the LacI/GalR family of transcriptional regulators. In the presence of glucose, the HPr kinase/phosphatase phosphorylates its target proteins, the HPr protein of the phosphotransferase system (PTS) and its regulatory homolog, Crh, at a conserved seryl residue, Ser-46. HPr-Ser-P and Crh- Ser-P are cofactors of CcpA, which trigger the binding of catabolite-repression element (cre site) by CcpA (Fig. 1). cre binding by CcpA results in repression or activation of transcription [Stülke and Hillen, 2000]. Alternative CcpA-independent mechanisms involve the GalR-like transcriptional regulator CcpB, [Chauvaux et al., 1998] or the LysR-like regulator CcpC [Jourlin-Castelli et al., 2000]. CcpB mediates CCR of the B. subtilis gnt (gluconate utilization) and xyl (xylose metabolism) operons in parallel with CcpA and is apparently operative only under highly specific growth conditions [Chauvaux et al., 1998]. CcpC represses transcription of genes that encode enzymes of the tricarboxylic acid branch of the Krebs cycle [Jourlin- Castelli et al., 2000; Kim et al., 2002a] in response to citrate availability. CcpC also mediates CCR because its own transcription is under the control of CcpA and because CcpA indirectly controls the availability of citrate, the inducer for CcpC [Kim et al., 2002b]. CcpN is involved in the catabolite repression of the gluconeogenic glyceraldehyde-3-phosphate dehydrogenase (gapB) and the phosphoenolpyruvate carboxykinase (pckA) [Servant et al., 2005]. It has shown that two distinct signals are transduced by CcpN: (i) the presence of a glycolytic carbon source that activates the repressor activity of CcpN and (ii) an unknown signal, transmitted via YqfL that could inhibit the repressor activity of CcpN [Servant et al., 2005].

CARBON CATABOLITE REPRESSION

Fig 1. The mechanism of carbon catabolite repression mediated by CcpA in B. subtilis. When glucose is supplied in the medium, the glucose uptake leads to an increase in glycolytic intermediate FBP (fructose-1,6-bisphosphate) concentration which stimulates the ATP-dependent HprK/P-catalyzed phosphorylation of HPr and Crh at Ser-46. The seryl-phosphorylated form of HPr and Crh can bind to CcpA to create a P-Ser-Crh/CcpA complex. This complex, then, binds to the cre site, controls the expression of target genes (adapted from Deutscher at el, 2002)

Global gene expression analyses in B. subtilis combined with analyses of CRE sites suggested that 10% of the B. subtilis genes might be directly regulated by CcpA [Yoshida et al., 2001; Blencke et al., 2003]. Glucose starvation triggers the induction of the σB regulon and stringent response. Proteins involved in the usage of alternative carbon sources such as acetoine (acoR operon), malate (malA-yfiA-malP), acetate (acsA), β-glucoside (bglPH), lichenan (licBCAH), levan (levDEFG) are specifically induced in CcpA-dependent or CcpA- independent manner in response to glucose starvation [Bernhardt et al., 2003; Koburger et al., 2005].

5.2. Phosphate starvation response

In B. subtilis phosphate starvation-induced genes are regulated by at least two global regulatory systems, σB and PhoP-PhoR [Antelmann et al., 2000]. The σB regulon provides a nonspecific response under phosphate starvation conditions. In contrast, genes of the PhoPR regulon are induced specifically after phosphate starvation and involved in the uptake of inorganic phosphate and utilization of alternative phosphorous sources such as phosphonucleotides, phospholipids and phosphoproteins.

RR (−)

RR HK (−) (+)

(+) (+) (+) (−)

RR HK (+) ykoL

phoD-tatAdCd (+) (+) yttP (+) (+) (+) (+) (+) (+) phoB-ydhF pstSAC- (+) (+) glpQ (+) yfkN pstBA/BB phoA tuaABCDEGH vpr yurI yjdB (−) tagAB tagDEF

Fig. 2. Putative model showing the regulation of the expression of the Pho regulon genes in B. subtilis. The Pho regulon is under the control of three regulatory systems, PhoP–PhoR, ResD–ResE, and Spo0A. The PhoP and ResD proteins act as positive regulators. Spo0A functions as a negative regulator of the pho genes, represses the regulator proteins AbrB and ResD. Dashed lines show the interactions that could either be direct or indirect. Solid lines indicate the interaction that has been demonstrated. Positive regulation is marked by the symbols (↑) and (+), and negative regulation is marked by the symbols (┴) and (–). HK and RR stand for histidine protein kinase and response regulator, respectively (adapted from Hulett, 2002)

The Pho regulon consists of 34 members including the phoA and phoB alkaline phosphatases which facilitate the recovery of inorganic phosphate (Pi) from organic phosphorous sources [Hulett et al., 1990]; the phoD phosphodiesterase/APase that is involved in cell wall teichoic acid turnover and exported via the twin arginine translocation pathway (tatAdCd) [Jongbloed et al., 2000]; the pstSACBA/BB high-affinity phosphate uptake sytem [Allenby et al., 2004]; the glpQ glycerophosphoryl diester phosphodiesterase that is involved in the hydrolysis of deacylated phospholipids [Antelmann et al., 2000]; the tuaABCDEFGH operon for teichuronic acid biosynthesis; the tagAB and tagDEF operons for

27 polyglycerolteichoic acid biosynthesis [Liu et al., 1998]; the ribonuclease (yurI), a protease (vpr) the 2’, 3’cyclic nucleotide phosphodiesterase and 5’ phosphonucleotidase (yfkN), the phoPR and resABCDE two-component systems [Hulett, 2002; Liu and Hulett, 1998; Geng et al., 2004], the lipoprotein ydhF and the genes with unknown functions ykoL, yjdB and yttP [Pragai and Harwood, 2002; Allenby et al., 2005].

There are at least three signal transduction systems that have role in the phosphate deficiency response of B. subtilis (i) the PhoRR system [Hulett, 1996] (ii) the phosphorelay required for the initiation of sporulation [Burbulys et al., 1991] and (iii) the ResDE system [Nakano and Zhu, 2001]. Under phosphorus starvation, PhoP~P enhances the expression of the resABCDE operon and raises the concentration of the ResD protein, promoting a full induction of the Pho response which provides a high-affinity Pi transport system, alkaline phosphatases and regulates the switch from phosphate-containing teichoic acids to phosphate-less teichuronic acids. The resABCDE operon provides components essential for electron transport such as hemeA biosynthesis and cytochrome c biogenesis, needed for assimilation of the transported Pi into ATP. When faced with over-decreasing concentrations of Pi, the Pho system is repressed by Spo0A~P which inhibits transcription of the PhoPR operon by repressing the synthesis of a positive regulator AbrB as well as through ResD- ResE. This leads the cell to initiate sporulation [Hulett, 2002; Vershinina and Znamenskaya, 2002] (Fig. 2).

5.3. Nitrogen starvation response

1996; Belitsky et al., 2000]. In contrast, GlnR acts as repressor of glnRA (glutamine synthetase), ureABC (urease) and tnrA in cells grown with nitrogen excess [Schreier et al., 1989; Brown and Sonenshein, 1996; Wray et al., 1997; Fisher and Débarbouillé, 2002]. The glutamine synthetase protein (GlnA) is required for the transduction of a nitrogen signal to GlnR and TnrA since glnA mutants show constitutive expression of GlnR- and TnrA- regulated genes [Schreier and Sonenshein, 1986; Wray et al., 1996]. It has been shown that the feedback inhibited GlnA protein forms a protein-protein complex with TnrA preventing TnrA from DNA binding [Wray et al., 2001].

Isoleucine Valine

bcd

α-keto β-methylvalerate α-keto isovalerate lpdV, bkdAA, bkdAB, bkdB

Acyl ~ CoA + CO2 ptb

Acyl −C−O−P buk

Branched-chain carboxylic acids

Fig 3. Isoleucine and valine degradative pathway. The enzyme of this pathway in B. subtilis are as follows: leucine dehydrogenase (bcd), branched-chain α-keto acid dehydrogenase (bkdAA/AB, bkdB, lpd), phosphate butyryl-CoA transferase (ptb) and butyrate kinase (buk) (adapted from Fisher and Débarbouillé, 2002)

Some amino acids can be used as nitrogen or carbon source such as branched-chain amino acids (valine, leucine and isoleucine), arginine, proline, ornithine, glutamate. [Commichau et al., 2006] (Fig 3, 4). It has been shown that the σ54 family sigma factor σL is involved in the regulation of the BkdR-dependent catabolism for the branched chain amino acids isoleucine and valine (bkd operon), the RocR-dependent catabolism for arginine and ornithine (roc operon), the LevR-dependent levan degradation (lev operon) and the AcoR- dependent acetoin utilization (aco operon) [Beckering et al., 2002]. Since arginine and ornithine provide also alternative carbon sources, the RocR operon is also under CcpA- dependent carbon repression [Wray et al., 1994; Yoshida et al., 2001]. Interestingly, CRE sites have been detected in the σL–dependent lev operon, rocDEF operon, rocG, acoABCL

29 operon, acoR and sigL. This indicates a link between carbon and nitrogen catabolism via the CcpA-dependent control of the σL regulon [Choi and Saier, 2005].

Arginine

ureABC rocF NH3 + CO2

Prolin rocD ycgM?

Pyrroline 5- Carboxylase

rocA ycgN

rocG Glutamate

TCA

Fig 4. Proline and arginine degradative pathway in B. subtilis. rocF encodes for arginase; rocD encodes for ornithine transaminase; Glutamic semialdehyde is spontaneously converted to pyrroline 5-carboxylase. Either rocA or ycgN can function in the degradation of proline and arginine dehydrogenase isozymes, ycgM is similar to proline oxidase that converts proline to pyrroline 5-carboxylase (adapted from Fisher and Débarbouillé, 2002)..

5.4. Tryptophan starvation response

Tryptophan metabolism in B. subtilis is regulated in response to L-tryptophan availability by a RNA-binding protein TRAP (for trp RNA-binding attenuation protein). Tryptophan is synthesized from chorismate, the common aromatic amino acid precursor [Henner and Yanofsky, 1993] (Fig. 5).The TRAP regulon includes the genes for the tryptophan biosynthesis enzymes such as the trp operon (trpEDCFBA), a suboperon within the aromatic supraoperon and the trpG gene (pabA), located in the unlinked folate operon. TRAP is encoded by mtrB, the second gene of the mtr operon that is involved in folate biosynthesis. When cells are growing with an excess of tryptophan, TRAP binds to a segment of the trp leader transcript containing 11 closely spaced (G/U)AG repeats and to a segment of the trpG message containing 8 of such repeats. Thus, a TRAP multisubunit complex is composed of 11 identical subunits. This multisubunit TRAP prevents the

30 formation of the antiterminator. This leads to the formation of the transcription terminator and stops the transcription process at the leader region. In contrast, TRAP does not bind to RNA leader, allows the expression of the TRAP operon in response to tryptophan starvation. TRAP also regulates TrpG synthesis by binding to a segment of trpG that contains the trpG ribosome-binding site [Babitzke and Yanofsky, 1995] (Fig 6).

chorismate anthranilate synthase trpE, trpG

anthranilate

anthranilate phosphoribosyl trpD transferase N-(5’-phosphoribosyl)-anthranilate

phosphoribosyl anthranilate trpF isomerase 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate indole-3-glycerol phosphate trpC synthase Indole-3-glycerol phosphate tryptophan synthase alpha subunit indole-3-glycerol trpA phosphate aldolase indole tryptophan synthase beta trpB subunit L-serine hydro-lyase tryptophan

Fig. 5. Enzymes, genes of the tryptophan synthesis pathway from chorismate (adapted from Gollnick et al. 2002)

In addition to the attenuation mechanism by TRAP, a stem-loop structure at the 5’ end of the trp leader transcript and the uncharged tRNATrp was shown to be involved in trp operon regulation. The stem-loop structure may facilitate the binding of TRAP to the trp operon leader region. The uncharged tRNATrp also regulates the expression of yczA-ycbK operon which contains a potential TRAP binding site. The high expression level of the yczA- ycbK operon affects the reduced availability of the TRAP regulatory protein and increases the transcription of the trp operon [Sarsero et al., 2000].

pab trpG pabC sul Folate operon Translation control mtrA mtrB mtr TRAP

operon Transcription attenuation and translation control

trp operon aroF aroB aroH trpE trpD trpC trpF trpB trpA hisH tyrA aroE

Fig. 6. Folate, mtr and trp operons. trpG located within folate operon, while the rest of trp genes is clustered in trpEDCFBA operon. mtrB encodes trp-RNA attenuation protein (TRAP). TRAP controls the expression of trpG by translation control mechanism. And TRAP controls trp operon by transcription attenuation and translation control mechanism (adapted from Babitzke, 1997)

5.5. The RelA-dependent stringent response

The general response for different kinds of nutrient limitation is mediated by the RelA, CodY, σB and σH transition phase regulons. These general starvation regulons are required for the adaptation of the cell to post-exponential stationary phase processes such as survival under non-growing conditions, competence or sporulation. The stringent response is induced during the transition to stationary phase provoked by different kinds of nutrient depletion and depends on the (p)ppGpp pool in the cell. In E. coli, the stringent response is regulated by relA and spoT [Cashel et al., 1996]. In B. subtilis, the stringent response is controlled only by relA [Wendrich and Marahiel, 1997]. RelA encodes a ribosome-bound (p)ppGpp (guanosine tetra-and pentaphosphate) synthetase. This enzyme catalyzes the transfer of a pyrophosphoryl group from ATP to the 3’-hydroxyl group of GTP. The RelA protein is activated by the arrival of an uncharged tRNA at the ribosome, thus this protein also acts as a sensor of amino acid starvation.

Transcriptomic and proteomic analyses were performed with norvaline that triggers RelA activation and the stringent response. Positively RelA-dependent genes are involved in the biosynthesis of branched chain amino acids Ilv-leu operon (Isoleucine, Valine, Leucine), transport processes, sporulation, motility, chemotaxis and protein secretion. Genes encoding ribosomal proteins and translation factors that are involved in protein synthesis are under negative stringent control [Eymann et al., 2002].

5.6. The CodY-dependent starvation response

CodY, a GTP-binding protein, represses the transcription of genes involved in nitrogen and carbon metabolism as well as in competence, sporulation and motility during the fast growth in the presence of nutrient excess [Serror and Sonenshein, 1996; Ratnayake- Lecamwasan et al., 2001; Molle et al., 2003]. Specifically, CodY regulates the expression of the histidine degradative operon (hut), the dipeptide transport operon (dpp), the isoleucine and valine degradative operon (bkd), the urease operon (ureABC) and gabP [Fisher, 1999], the acetyl-CoA synthetase (acsA), aconitase (citB), motility genes (hag, fla/che operon), competence genes (comK, rapC and srfA operon) and phosphorelay phosphatase (rapA) [Lazazzera et al., 1999]. These CodY-dependent proteins allow broader adaptation to nutrient depletion [Guedon et al., 2001a,b; Molle et al., 2003]. The induction of the CodY regulon in response to starvation is reflective for the reduced growth rate resulting in the drop of the GTP level and consequently CodY derepression [Lopez et al., 1981]. It was shown that the repressor function of CodY is mediated by interaction with two different effectors, GTP and isoleucine, which independently and additively increase the affinity of CodY for its target sites [Sonenshein, 2005; Levdikov et al., 2006]

5.7. The σH-dependent general starvation response

σH directs the transcription of several genes that function in the transition from exponential growth to stationary phase, including the initiation of spore formation and genetic competence. σH activates transcription of several sporulation genes including the two- component response regulators spo0A, spo0F [Bai et al., 1990], the sensor histidine kinases kinA, kinE [Predich et al., 1992], the sporulation control gene spo0M, gene required for assembly of the spore coat spoVS [Resnekov et al., 1995], the spoIIA operon for stage II sporulation [Wu et al., 1991] and the sporulation regulator sigF [Britton et al., 2002]. In addition, σH controls many genes that are required for general adaptation to nutrient depletion. These genes are involved in transport, generation of potential nutrient sources, cell wall metabolism, proteolysis and cytochrome biogenesis. These include extracellular proteases vpr, aprE and nprE, a putative secreted nuclease yhcR, the glutamate transporter gltP, the ABC transporter yhaQ, the ccdA and qcr operon that encode proteins involved in the synthesis of cytochrome c and cytochrome bc complex, respectively. σH controls a group of genes involved in cell wall binding proteins/autolysins such as ftsA, ftsB which required for septum formation, yojL (similar to major autolysins lytE and lytF), yrvJ (similar to N- acetylmuramoyl-L-alanine amidase), yuxL (similar to acylaminoacyl-peptidase), dacC and spoVG that are involved in cell wall modification. Finally, four genes are predicted to be involved in adaptation to environmental changes including yoeA (similar to multidrug efflux),

33 yojM (similar to superoxide dismutase), ywfF (similar to efflux protein) and bsaA (a putative glutathione peroxidase). Many σH–dependent genes are under control of additional sigma factors such as YvyD and YtxH that are controlled by σH and σB. It has been shown that both σB and σH contribute to stationary phase survival under acidic and alkaline conditions and this effect was independent from the simple loss of sporulation ability [Gaidenko and Price, 1998].

6. Degradation of aromatic compounds in microorganism

The extensively use of hydrocarbons and their derivatives in industrial processes over the past decades has led to a widespread pollution of the environment by these toxic compounds. Aromatic hydrocarbons are used in the chemical and pharmaceutical industry as fuels, solvents (benzene, toluene), xenobiotics or as starting materials for chemical syntheses [Chaudhry et al., 1991; Sikkema et al., 1995; Rieger et al., 2002]. In addition, aromatic compounds are applied as herbicides or pesticides in agriculture. The catabolism of natural and xenobiotic aromatic compounds was studied in variety of soil bacteria including also Bacillus species that are able to use these compounds as sole carbon and energy source [Timmis et al., 1994; van der Meer et al., 1992]. For example, phenol degrading thermophilic strains of B. staerothermophilus, B. thermoleovorans and B. thermoglucosidasius have been isolated and the corresponding genes involved in phenol degradation were cloned and characterized [Dong et al., 1992; Kim and Oriel, 1995; Duffner and Muller, 1998; Duffner et al., 2000; Milo et al., 1999]. Specifically, it was shown that both enzymes responsible for the primary attack of phenol, the phenol hydroxylase and the catechol 2,3-dioxygenase are expressed in these thermophilic Bacillus species. In contrast, B. subtilis ATCC 7003 was regarded as a “secondary degrader” in phenol degrading microbial consortia [DuTeau et al., 1998]. Secondary degraders do not grow on the primary substrate (e.g. phenol), but rather utilize secondary metabolites produced by primary degraders which are able to grow on the primary substrate [Senior et al., 1976].

The biodegradations of aromatic compounds are refered to the microbial respiration in the presence and absence of oxygen. The aerobic and anaerobic biodegradation pathways contain several common features. The original compounds are degraded to intermediates through many different peripheral pathways. Aerobic bacteria initially hydroxylate the aromatic ring of phenolic compounds, producing catecholic metabolites with hydroxyl groups at adjacent carbon atoms which are channeled into the ortho cleavage pathway (also termed as β-ketoadipate pathway) or the meta cleavage pathway [Harayama et al., 1992; Eltis et al., 1996]. In the ortho cleavage pathway the carbon ring is opened between two adjacent hydroxyl groups by intradiol dioxygenases. Extradiol dioxygenase

34 enzymes are involved in the meta cleavage of the carbon ring proximal to one of the two hydroxyl groups [Fig 7) [Diaz, 2004]. In the anaerobic degradation of aromatic compounds, the peripheral pathways mostly converge at benzoyl-CoA which in turn is cleaved by a specific multicomponent reductase in the presence of ATP [Gibson and Harwood 2002]. These CoA derivatives are converted to further metabolites by aromatic ring oxygenation reactions that are chanelled into the central metabolic pathways.

Fig 7: The catabolic pathway for the aerobic degradation of aromatics. White arrows show peripheral pathways; black arrows show the ring cleavage steps; gray arrows show the central pathways (adapted from Diaz,2004)

The cells recognize pollution signals from the environment through specific intermediate sensors such as the (p)ppGpp, the DNA-bending protein IHF, the transport systems or σ-factors. These mediators activate transcriptional regulators, drive the cell to either activation of specifically suitable enzymes for a catabolic degradation or detoxification and other general adaptation to maintain cell viability [Shingler, 2003]. The regulation of degradation pathways is mediated by specific transcriptional regulator families such as LysR,

IclR, AraC/XylS, GntR, TetR, MarR, FNR, XylR/NtrC-type regulators and two component regulatory systems [Tropel and van der Meer, 2004].

LysR-type transcriptional regulators (LTTRs) are involved in the metabolism of aromatic compounds such as catechol (CatR in Pseudomonas; CatM and BenM in Acinetobacter), chlorocatechol (ClcR in Pseudomonas; CbnR in Ralstonia; TfdT in Burkholderia), naphthalene, salicylate (NahR in Pseudomonas), dichlorocatechol (TcbR in Pseudomonas), dichlorophenol (TfdR/S in Ralstonia), protocatechuate (PcaQ in Agrobacterium), nitrotoluene (NtdR in Acidovorax) and chlorohydroquinone (LinR in Sphingomonas). In general, LTTRs act as transcriptional activator in the presence of a chemical inducer except for BenM. The IclR-type regulators are similar to LysR-regulators, but functions as repressor as revealed in Streptomyces or E. coli [Hindle and Smith, 1994; Maloy and Nunn, 1982]. However, PcaU and PcaR act as activators in the degradation of protocatechuate in Acinetobacter and Pseudomonas. XylS/AraC-type activators are involved in the regulation of the meta-cleavage pathway in Pseudomonas (e.g. meta-toluate). PobC and PobR regulate the degradation of p-hydroxy benzoate in Pseudomonas and Azotobacter. GntR-type regulators such as PaaX, Orf0, AphS act as repressors in the degradation of phenylacetic acid, biphenyl or phenol in E. coli, Pseudomonas and Comamonas, respectively. TetR-type regulators repress genes for p-cymene and p-cumate degradation [Eaton, 1997]. The MarR family member NbzR functions as repressor in the degradation of aminophenol in Pseudomonas. The two-component systems such as TodST and StyRS activate toluene and styrene degradation in Pseudomonas. The XylR/NtrC-type regulators are shown to be involved in the degradation of many aromatic compounds such as xylene and toluene [Tropel and Roelof van der Meer, 2004]. In conclusion, bacteria are able to express many different regulators to regulate the degradation of aromatic compounds. Detailed studies on these regulators will provide new insights in the response, metabolism and adaptation to aromatic compounds in bacteria.

Proteomic techniques have been used to study the adaptation and induction of metabolic enzymes in different bacteria in response to aromatic compounds. For example aromatic substances like benzoate, aniline, phenol and catechol have been shown to induce biodegradation- related enzymes as well as other heat or oxidative stress specific proteins in soil bacteria [Giuffrida et al., 2001]. These stress proteins confer resistance mechanisms against the aromatic compounds to protect the cell against the deleterious effects of these toxic compounds. The induction of stress responses caused by aromatic phenolic compounds has been shown in Pseudomonas putida [Lupi et al., 1995], Methylocystis sp. [Uchiyama et al., 1999], Burkholderia sp. [Cho et al., 2000], Acinetobacter radioresistens [Giuffrida et al., 2001], Acinetobacter calcoaceticus [Benndorf et al., 2001], Acinetobacter lwoffii [Kim et al., 2004], Stenotrophomonas sp. [Ho et al., 2004] or Pseudomonas putida

[Santos et al., 2004 ; Segura et al., 2005]. Specifically, a heat shock response was found to be induced by phenol in A. calcoaceticus whereas catechol predominantly induced oxidative stress proteins as revealed by proteome analyses [Benndorf et al., 2001]. It has been shown that phenol and other chaotropic solutes that do not affect turgor reduce water activity, perturb macromolecule-water interactions and destabilize cellular macromolecules, inhibit the growth and are powerful mediators of water stress in Pseudomonas putida. In addition, the chaotropic solute-induced water stress resulted in the induction of proteins involved in stabilization of protein structures, in lipid metabolism and membrane composition in P. putida [Hallsworth et al., 2003].

Currently, there is only little information about the response of B. subtilis 168 to aromatic phenolic compounds which are often found in contaminated soils. Furthermore, it is not known if B. subtilis 168 is able to degrade and detoxify these toxic compounds. Thus, it was one goal of this thesis to study the response of B. subtilis to aromatic compounds such as phenol and catechol.

7. Scopes of thesis

The goals of this thesis are (1) to complete the vegetative proteome of B. subtilis by the identification of proteins expressed during the exponential growth; (2) to define the proteome signatures of B. subtilis in response to different stress and starvation conditions towards the comprehensive proteome map of non-growing cells; (3) to study the proteome and transcriptome of B. subtilis in response to xenobiotic substances (phenol and catechol) and (4) to characterize the functions of unknown proteins that are involved in the specific degradation of aromatic compounds by the use of mutants. These studies are comprised in 4 papers that are included as different chapters in this thesis. The vegetative proteome is published in Proteomics in 2004 (chapter 2), the catalog of proteome signatures is in revision in Proteomics (chapter 3), the transcriptome and proteome analyses after ammonium and tryptophan starvation is submitted to Journal of Molecular Microbiology and Biotechnology (chapter 4) and the response of B. subtilis to phenol and catechol is online-early published in Environmental Microbiology (chapter 5).

Chapter 2: The proteome map of exponentially growing cells was established under the supervision of C. Eymann in collaboration with A. Dreisbach, D. Albrecht, J. Bernhardt, D. Becher, S. Gentner, L.T. Tam, K. Buttner, G. Buurman, C. Scharf, S. Venz, U. Völker, and M. Hecker that were involved in protein identification of 745 vegetative proteins. These proteins were separated using the standard 2D gel-based approach in the standard pH range 4-7 as well as in the alkaline region. My part of the description of the vegetative proteome includes

37 the preparation of cytoplasmic proteins, the separation using 2D gel electrophoresis and the spot cutting for protein identification by MALDI-TOF-MS of the pH range 4-7 region.

Chapter 3: The stress and starvation proteome maps of B. subtilis in response to 4 different stress conditions (heat, salt, hydrogen peroxide and paraquat stress) and 4 different starvation conditions (glucose, phosphate, ammonium and tryptophan starvation) were established using the 2D gel image color coding approach. Proteome signatures were defined for these different conditions in B. subtilis. The stress and starvation induced marker proteins could be classified into specifically induced regulons that are induced by one stimulus only and more generally induced regulons that are induced by multiple stimuli.

Chapter 4: Since the response of B. subtilis to ammonium and tryptophan starvation has not yet been studied in Belitsky minimal medium, we performed detailed proteome and transcriptome analyses and compared the resulting data with previous publications about nitrogen starvation in B. subtilis. Several genes with previously unknown functions seem to be involved in the response to tryptophan and ammonium starvation that should be subject to future studies.

Chapter 5: To investigate the global response of B. subtilis to the aromatic compounds phenol and catechol, proteome and transcriptome analyses are performed. Phenol induced a classical heat shock response and catechol induced a thiol-specific oxidative stress response. The most surprising result was the derepression of CcpA- dependent genes by catechol, which was increased with glucose excess. The microarray results revealed the very strong induction of the yfiDE operon by catechol of which the yfiE gene shares similarities to glyoxalases/bleomycin resistance proteins/extradiol dioxygenases. Our studies revealed that the catechol-2,3-dioxygenase YfiE is the key enzyme of a meta cleavage pathway in B. subtilis involved in the catabolism of catechol. Furthermore, both genes of the yfiDE operon are essential for the growth and viability of B. subtilis in the presence of catechol.

Taken together, this work provides a global view and detailed results about the adaptation of B. subtilis to different stress and starvation conditions. This work can be regarded as the second generation in proteomic research by the identification and functional analyses of new genes and pathways. These should provide important leads for future research on functions and regulation of interesting stress and starvation-induced proteins in B. subtilis.

Chapter 2

A comprehensive proteome map of growing Bacillus subtilis cells

Christine Eymann1, Annette Dreisbach2, Dirk Albrecht1, Jörg Bernhardt1, Dörte Becher1,

Sandy Gentner1, Le Thi Tam1, Knut Büttner1, Gerrit Buurman2,3, Christian Scharf1,2, Simone

Venz2, Uwe Völker2,3,4 and Michael Hecker1

1Institute for Microbiology, Ernst-Moritz-Arndt-University Greifswald, D-17487 Greifswald,

Germany

2Laboratory for Functional Genomics, Medical Faculty, Ernst-Moritz-Arndt-University, D-

17487 Greifswald, Germany

3Max-Planck-Institute for terrestrial Microbiology, D-35043 Marburg, Germany

4Philipps-University Marburg, Department of Biology, Laboratory for Microbiology, D-35032

Marburg, Germany

running title: Proteome reference map of growing Bacillus subtilis cells

Keywords: Bacillus subtilis / Master gel / Physiological proteomics / Membrane proteins /

Protein modifications

Corresponding author: Michael Hecker, Institute for Microbiology, Ernst-Moritz-Arndt-

University Greifswald, Friedrich-Ludwig-Jahn-Str. 15, 17487 Greifswald, Germany; Phone:

+49-3834-864200; Fax: +49-3834-864202; E-mail: [email protected]

This chapter is published in Proteomics, 4, 2849-2876.

40 Proteomics 2004, 4, 2849–2876 DOI 10.1002/pmic.200400907 2849 A comprehensive proteome map of growing Bacillus subtilis cells

Christine Eymann1, Annette Dreisbach2, Dirk Albrecht1, Jörg Bernhardt1, Dörte Becher1, Sandy Gentner1, Le Thi Tam1, Knut Büttner1, Gerrit Buurman2, 3, Christian Scharf1, 2, Simone Venz2, Uwe Völker2, 3, 4 and Michael Hecker1

1Institute for Microbiology, Ernst-Moritz-Arndt-University, Greifswald, Germany 2Laboratory for Functional Genomics, Medical Faculty, Ernst-Moritz-Arndt-University, Greifswald, Germany 3Max-Planck-Institute for Terrestrial Microbiology, Marburg, Germany 4Philipps-University Marburg, Department of Biology, Laboratory for Microbiology, Marburg, Germany

The proteome of growing cells of Bacillus subtilis was analyzed in order to provide the basis for its application in microbial physiology. DNA arrays were used to calculate the number of genes transcribed in growing cells. From the 4100 B. subtilis genes, 2515 were actively transcribed in cells grown under standard conditions. From these genes 1544 proteins should be covered by our standard gel system pI 4–7. Using this standard gel system and supplementary zoom gels (pI 5.5–6.7, 5–6, 4.5–5.5, and 4–5) 693 proteins which are expressed in growing cells were detected that cover more than 40% of the vegetative proteome predicted for this region. Particularly broad coverage and thus comprehensive monitoring will be possible for central carbohydrate metabolism (glycolysis, pentose phosphate shunt, and citric acid cycle), amino acid synthesis pathways, purine and pyrimidine metabolism, fatty acid metabolism, and main cellular functions like replication, transcription, translation, and cell wall synthesis. Comparing the theoretical pI and Mr values with those experimentally determined a reasonable correlation was found for the majority of protein spots. By a color code outliers with dramatic deviations in charge or mass were visualized that may indicate post- translational modifications. In addition to the cytosolic neutral and alkaline proteins, 130 membrane proteins were found relying on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) separation in combination with electrospray ionization-tandem mass spectrometry (ESI-MS/MS) techniques. The vegetative proteome containing 876 proteins in total is now ready for physiological applications. Two main proteome fractions (pI 4–7 and zoom gel pI 4.5–5.5) should be sufficient for such high-throughput physiological proteomics. Received 17/3/04 Revised 25/5/04 Keywords: Bacillus subtilis / Master gel / Membrane proteins / Physiological proteomics / Protein modifi- Accepted 5/6/04 cations

1 Introduction nificantly stimulated the proteome research since it provided the basis for the identification of protein spots by The Bacillus subtilis genome encodes about 4100 diffe- mass spectrometric techniques at a genome-wide scale. rent open reading frames (ORFs) as predicted from the We have been interested in the application of proteomics DNA sequence published seven years ago [1]. Even if the to address physiological problems for almost 20 years first proteome studies were published more than 10 years [4–6]. The high resolution power of the 2-DE provides earlier [2, 3], the availability of the genome sequence sig- the basis for this physiological proteomics. However, only the combination of high-resolution 2-DE, computer-based Correspondence: Michael Hecker, Institute for Microbiology, analysis of the complex protein patterns and high-sensi- Ernst-Moritz-Arndt-University Greifswald, Friedrich-Ludwig- Jahn-Str. 15, D-17487 Greifswald, Germany tivity, high-throughput MS analysis unleashes the full E-mail: [email protected] potential of physiological proteomics. Fax: +49-3834-864202 Abbreviations: GRAVY, grand average of hydropathicity; MSD, Supporting information for this article is available on the WWW membrane spanning domain; TE, Tris-EDTA buffer under www.proteomics-journal.de or from the author.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 41 2850 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Unfortunately, not all cellular proteins can be visualized on This study of B. subtilis was mainly focused on the pro- one single gel. This complication is the result of two differ- teome of growing cells. For this visualization of the vege- ent main reasons: (i) In contrast to DNA arrays that may tative proteome, DNA arrays were used to determine how cover the entire genome currently only parts of the cellu- many genes are actively transcribed in exponentially lar protein population are accessible to proteome ap- growing cells. This approach provided an estimate of the proaches. To cover the majority of proteins synthesized number of different proteins that can be expected on the in a cell population, subproteomic fractions have to be an- 2-D gels. Physiological proteomics essentially depends alyzed including neutral/weakly acidic and alkaline cytoso- on quantitative comparative protein expression profiling. lic proteins, cell wall-associated and extracellular proteins. Obviously, such an approach requires the analysis of a The routine 2-DE proteome techniques available so far maximal number of identified proteins on a minimal num- do not cover proteins with multiple membrane-spanning ber of subfractions/gels because only a small number of domains. Special procedures, such as SDS-PAGE com- standard gels can be routinely managed in time-resolved bined with multidimensional chromatography and MS/MS studies. Thus, we already adopted our comprehensive techniques, are necessary to visualize at least a portion of description of the proteome of exponentially growing cells this membrane subproteomic fraction. Furthermore, low- to this central requirement and avoided the use of exten- abundance proteins and very alkaline or acidic proteins, sive prefractionation techniques such as free flow electro- extremely large or small proteins are not covered by the phoresis that produce large numbers of fractions that can standard experimental separation protocols. (ii) Also from currently not be routinely handled in studies involving a physiological point of view only a subfraction of the entire multiple samples. In this paper we now show that 40% proteome is available because only a portion of the ge- of the vegetative proteome of the Gram-positive soil nome is active at any time, which is dependent on the bacterium B. subtilis can be identified within the main pI environmental conditions that dictate the gene expression window pH 4–7. pattern. Based on their different physiological states two major classes of proteomes may be defined: proteomes of growing cells (vegetative proteomes) and proteomes of 2 Materials and methods nongrowing cells. The first group related to cell growth/cell 2.1 Growth conditions and preparation of division may provide a stable “vegetative core proteome” protein extracts with a variable portion that is determined by the definite growth conditions (e.g., growth rate, nitrogen/carbon The B. subtilis wild-type strain 168 was grown aerobically source and concentration, oxygen concentration, mineral in 1 L minimal medium [16] supplemented with 0.5% w/v salts, growth temperature, etc.). These proteomic signa- glucose and 0.078 mM tryptophan in 5 L Erlenmeyer tures of growing cells reflect the growth conditions [7]. flasks at 180 rpm and 377C. Growth was monitored by For nongrowing cells the proteomic signatures for vari- measurement of the OD at 500 nm. Cells were harvested ous stress or starvation stimuli will indicate if the non- during exponential growth phase at an OD500 of about growing cells suffered from oxidative or heat stress or 0.4–0.5 by centrifugation (18 3006g,47C, 10 min) and from phosphate starvation, etc. [6, 8]. The assembly of dif- washed twice with TE buffer (10 mM Tris, 1 mM EDTA, pH ferent specific proteomes of growing and nongrowing cells 7.5). Bacteria were resuspended in TE buffer with 1 mM (incl. sporulation) is an essential contribution of microbial PMSF and disrupted by passage through a french press physiology towards the entire proteome of B. subtilis. (minicell; SLM, Rochester, NY, USA) at 6.2 MPa. After cell disruption, the cell lysate was cleared by centrifugation at The main goal of this study has been to increase substan- 18 3006g and 47C for 30 min. The protein concentration tially the number of identified proteins on standard 2-D gels was determined by RotiNanoquant and after removing an [9] in order to provide the basis for a new level of compre- aliquot of 10 mg the crude protein extract was subjected hensive physiological proteomics. A similar goal has been to an ultracentrifugation at 100 0006g for 1 h at 47C. An in the focus of proteome studies of various bacteria. Most aliquot of the supernatant was used for an additional progress has been made for Mycoplasma pneumoniae, determination of the protein concentration and the Haemophilus influenzae, Escherichia coli, Mycobacterium remainder was stored at 2207C. tuberculosis, and Helicobacter pylori [10–15]. The proteome map of H. influenzae, a bacterial species with 1742 2.2 Two-dimensional protein gel genes, covers about 30% of the predicted ORFs [12]. In electrophoresis a recent paper by Jaffe et al. [10], more than 80% of the genomically predicted ORFs of Mycoplasma were accessi- IEF was done with commercially available 18 cm IPG ble to proteomics, a high coverage that was also achiev- strips in the pH ranges 4–7, 4–5, 4.5–5.5, 5–6 and 5.5– able due to the low complexity of its genome. 6.7 (Amersham Biosciences, Freiburg, Germany). IPG

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 42 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2851 strips were loaded with 200 mg (in the case of pH 4–7) was subjected to ultracentrifugation (100 0006g, or 400 mg (in the case of ultrazoom gels) of crude protein 60 min, 47C). The resulting supernatant was designated extract by rehydration for 24 h in a solution containing 8 M cytosolic fraction and stored at 2807C. The remaining urea (ICN Biomedicals, Aurora, OH, USA), 2 M thiourea pellet was homogenized in 8 mL high-salt buffer (20 mM (Sigma, St. Louis, MO, USA), 1% w/v CHAPS (Roth, Tris-HCl, pH 7.5, 10 mM EDTA, 1 M NaCl, 1 mM Pefabloc) Karlsruhe, Germany), 20 mM DTT (ICN-Biomedicals) and and incubated for 30 min at 47C on a rotary shaker and 0.5% v/v Pharmalyte 3–10 (Amersham Biosciences, Pis- again subjected to ultracentrifugation as described cataway, NJ, USA). IPG strips of the pH range 5.5–6.7 above. The remaining pellet was homogenized in and 6–11 were incubated for 24 h in a rehydration solu- 100 mM Na2CO3-HCl, pH 11, 10 mM EDTA, 100 mM tion published by Görg et al. [17] and the protein extract NaCl [21]. After a final washing step with 8 mL TE buffer was loaded with sample cups. Additionally a paper strip the resulting pellet was homogenized in 200 mLTE buffer. soaked with rehydration solution containing 3.5% w/v The protein concentration was determined according to DTT was applied near the cathode [18]. IEF using the Bradford. Protein extraction from the membrane was Multiphor II unit (Amersham Biosciences) and SDS- carried out by solubilizing the pellet with 15 mM n-dode- PAGE using the Investigator 2-D electrophoresis system cyl-b-D-maltoside. The solubilized membrane proteins (Perkin Elmer, Norwalk, CT, USA) were performed as pre- were subjected to centrifugation (20 0006g, 10 min, viously described [9]. For IPG strips of the pH ranges 5.5– 47C). The resulting supernatant was designated mem- 6.7 and 6–11 the focusing protocol included an additional brane fraction. initial phase of 30 min at 150 V. The resulting 2-D gels were fixed with 40% v/v ethanol and 10% v/v acidic acid for 1–2 h and subsequently stained with colloidal CBB 2.4 SDS-PAGE and Western blotting (Amersham Biosciences), SYPRO Ruby (Molecular A fraction of the membrane protein preparation (100 mg) Probes, Eugene, OR, USA) or silver nitrate [19]. Gels was separated by 1-D SDS-PAGE (10% acrylamide, stained with SYPRO Ruby were scanned on a STORM 25 cm separation gel). The gel was stained with a colloidal 840 fluorescence scanner (Amersham Biosciences) and Coomassie staining procedure (Amersham Biosciences, those stained with CBB or silver nitrate were scanned Freiburg, Germany). For identification of proteins by MS, with a HP Scanjet Scanner. the lanes from the 10% SDS-PAGE were cut into 25 1 pieces of equal length from which /4 was used for identification by nano-LC MS/MS (see Section 2.6.2). For West- 2.3 Preparation of the membrane protein ern blotting 30 mg protein of the crude extract and the fraction corresponding aliquots of the cytosolic and the membrane fraction were separated using minigels (12.5% B. subtilis 168 (trpC2) cells were grown aerobically in acrylamide). Proteins were transferred onto a nitrocellu- 261 L Luria Broth (LB) and harvested during the expo- lose membrane and then incubated with monoclonal anti- nential growth phase (OD 1.0). The cells were washed 540 bodies raised against RsbU, RsbS, and SigB [22, 23] or twice with TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) a polyclonal antibody raised against FtsH [24]. Specific at 47C. Protoplasts were prepared as described pre- signals were detected as previously described [23, 25] viously [20] by incubation with sucrose buffer (0.5 M with alkaline phosphatase-conjugated secondary goat sucrose, 20 mM maleic acid/KOH, pH 6.5, 20 mM anti-mouse or anti-rabbit antibodies from Bio-Rad (Her- MgCl ) containing 0.4% w/v lysozyme, 0.01% w/v 2 cules, CA, USA) utilizing the ECF substrate from Amers- DNase I and 1 mM Pefabloc at 377C for 2 h. Afterwards, ham Biosciences. the suspension was centrifuged (30006g, 10 min, 47C). The pellet was resuspended in 6 mL Lichrosolv water containing 1 mM Pefabloc and incubated on a rotary 2.5 Preparation of peptide mixtures for shaker (500 rpm, 30 min, 47C) to lyse the cells by osmo- MALDI-MS tic shock. Cell debris and unbroken cells were removed by centrifugation (60006g, 10 min, 47C). The superna- Proteins were excised from colloidal CBB-stained 2-D tant was removed and stored on ice. The pellet was gels using a spot cutter (Proteome Works, Bio-Rad) resuspended in 2 mL TE buffer with 1 mM Pefabloc and with a picker head of 2 mm diameter and transferred into cell disruption was completed by sonication (4630 s, 96-well microplates loaded with 100 mL Lichrosolv water 30 W). After centrifugation (60006g, 10 min, 47C) the per well. Digestion with trypsin and subsequent spotting supernatant was combined with the supernatant from of peptide solutions onto the MALDI targets were per- the first centrifugation and a 300 mL aliquot was removed formed automatically in the Ettan Spot Handling Work- for Western blot analysis. The remaining crude extract station (Amersham Biosciences) using a modified stand-

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 43 2852 C. Eymann et al. Proteomics 2004, 4, 2849–2876 ard protocol. Briefly, gel pieces were washed twice with that failed to exceed the 30% sequence coverage cutoff 100 mL50mM ammoniumbicarbonate/ 50% v/v methanol level were subject to MALDI-MS/MS. MALDI-TOF-TOF for 30 min and once with 100 mL 75% v/v ACN for 10 min. analysis was performed for the three strongest peaks of After 17 min drying 10 mL trypsin solution containing the TOF spectrum. For one main spectrum 20 subspec- 20 ng/mL trypsin (Promega, Madison, WI, USA) in 20 mM tra with 125 shots per subspectrum were accumulated ammoniumbicarbonate was added and incubated at using a random search pattern. The internal calibration 377C for 120 min. For peptide extraction gel pieces were was automatically performed as one-point calibration if covered with 60 mL 50% v/v ACN/0.1% w/v TFA and the mono-isotopic arginine (M+H)1 m/z at 175.119 or incubated for 30 min at 377C. The peptide-containing lysine (M+H)1 m/z at 147.107 reached an S/N of at least supernatant was transferred into a new microplate and 5. The peak lists were created using the “peak to mas- the extraction was repeated with 40 mL of the same solu- cot” script of the 4700 Explorer Software with the fol- tion. The supernatants were dried at 407C for 220 min lowing settings: mass range from 60 Da to a mass that completely. Peptides were dissolved in 2.2 mL of 0.5% was 20 Da lower than the precursor mass; peak density w/v TFA/50% v/v ACN and 0.7 mL of this solution were of 5 peaks per 200 Da; minimal area of 100 and maximal directly spotted on the MALDI target. Then, 0.4 mLof 20 peaks per precursor and a minimal S/N ratio of 5. matrix solution (50% v/v ACN/0.5% w/v TFA) saturated Database searches employed the B. subtilis-specific with a-cyano-4-hydroxycinnamic acid (CHCA) was added database and the MASCOT search engine (Matrix and mixed with the sample solution by aspirating the mix- Science) mentioned above. Proteins with a mowse score ture five times. Prior to the measurement in the MALDI- of at least 49 in the reflector mode that were confirmed by TOF instrument the samples were allowed to dry on the subsequent measurement of the strongest peaks (MS/ target for 10–15 min. MS) were regarded as positive identification. MS/MS analysis was particularly useful for the identification of spots containing more than one component. 2.6 Analysis of peptides and identification of proteins 2.6.1 MALDI-TOF-MS 2.6.2 NanoLC-MS/MS

The MALDI-TOF measurement of spotted peptide solu- Gel pieces of proteins smaller than 15 kDa or isolated tions was carried out on a Proteome-Analyzer 4700 (Ap- from SDS-PAGE gels of the membrane protein fraction plied Biosystems, Foster City, CA, USA). The spectra were cut and washed with 200 mL20mM NH4HCO3/50% were recorded in reflector mode in a mass range from v/v ACN for 30 min at 377C and dried in a vacuum centri- 900 to 3700 Da with a focus mass of 2000 Da. For one fuge for 30 min. Trypsin solution containing 20 ng/mL tryp- main spectrum 25 subspectra with 100 shots per sub- sin (Promega) in 20 mM ammonium bicarbonate was spectrum were accumulated using a random search added until the gel pieces stopped swelling and digestion pattern. If the autolytical fragment of trypsin with the was allowed to proceed for 16–18 h at 377C. For peptide mono-isotopic (M+H)1 m/z at 2211.104 reached a sig- extraction, gel pieces were subsequently covered with nal-to-noise ratio (S/N) of at least 10, an internal calibra- 15 mL 5% v/v formic acid and incubated in an ultrasonic tion was automatically performed using this peak for bath for 20 min. The peptide containing supernatant was one-point-calibration. The peptide search tolerance transferred into microvials for mass spectrometric analy- was 50 ppm but the actual standard deviation was be- sis. High-pressure liquid chromatography separation tween 10 and 20 ppm. Calibration was performed manu- was performed on an Ultimate system (LC Packings, ally for the less than 1% samples for which the auto- Amsterdam, Netherlands). The system was coupled via matic calibration failed. After calibration the peak lists a nanoLC inlet (New Objective, Woburn, MA, USA) to were created using the “peak to mascot” script of the the Q-TOF mass spectrometer (Q-Star Pulsar; Applied 4700 Explorer Software with the following settings: Biosystems, Foster City, CA, USA) equipped with a mass range from 900 to 3700 Da; peak density of 50 nano-electrospray source (Protana, Odense, Denmark). peaks per range of 200 Da; minimal area of 100 and Peptides were loaded and desalted on a reversed-phase maximal 200 peaks per protein spot and minimal S/N precolumn (m-Precolumn, PepMap, C18, 300 mm i.d.6 ratio of 6. Peak lists were compared with a specific B. 5 mm; LC Packings) with a flow rate of 30 mL/min using subtilis sequence database using the mascot search 0.1% v/v formic acid as solvent. The separation was per- engine (Matrix Science, London, UK). Peptide mixtures formed via a reversed-phase nanocolumn (PepMap, that yielded at least twice a mowse score of at least 49 C18, 75 mm i.d.615 cm; LC Packings). As solvents and a sequence coverage of at least 30% were regarded 0.05% v/v acetic acid (solvent A) and 90% v/v ACN/ as positive identifications. Proteins/peptide mixtures 0.05% v/v acetic acid (solvent B) were used with a linear

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 44 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2853 gradient from 5 to 50% of solvent B over 70 min. The tion of the theoretical proteome of an organism can be eluted peptides were analyzed by MS/MS. The instru- displayed in proteome studies. In this study, we primarily ment was running in automatic mode, allowing switching focused on exponentially growing cells because the from MS to MS/MS mode. All peptides in a mass range corresponding reference map will likely cover most main from 300 to 1700 with an intensity of at least 10 counts routes of cellular metabolism to which stress- and starva- were fragmented and an MS/MS spectrum was recorded tion-specific adaptations reactions will subsequently be in positive detection mode. The collision energy was added. adjusted by the instrument automatically. The resulting MS/MS data were analyzed with the Bioanalyst Soft- The cellular mRNA levels do not display such a wide dy- ware (Applied Biosystems) and the integrated mascot namic range as the encoded proteins. Therefore, whole script. For database searches the mascot search engine genome arrays are believed to provide a much more com- (Matrix Science) was used with a specific B. subtilis prehensive overview of the actual gene expression pat- sequence database. Proteins with a mowse score corre- tern than proteome studies. We wanted to exploit this sponding at least to a p-value of 0.05 were regarded as advantage of DNA-array technology to gain an overview positively identified when the calculated mass matched of the genes expressed in exponentially growing cells and the mass expected from the SDS-PAGE. thus an estimate of the number of proteins to be expected in the proteome study. The DNA-macroarray analysis revealed that 2515 genes can be regarded as significantly 2.7 Transcriptional profiling of exponentially expressed in cells growing exponentially in defined syn- growing cells thetic medium (data not shown; for details see Section 2).

Ten different data sets obtained from previously published Whereas whole genome arrays cover all genes of an DNA macroarray experiments [26–28] were analyzed in organism per definition, particular 2-DE gels can only dis- order to screen for expressed genes. This evaluation was play a selection of the cellular protein profile. Thus, it is a restricted to samples of cells of the B. subtilis wild-type major challenge of physiological proteomics to cover as strain 168 that were grown in minimal medium [16] and many proteins as possible in a minimum number of gels. harvested during the exponential growth phase (OD500 = The theoretical proteome map of all B. subtilis proteins 0.5). After quantification of the intensity of the hybridiza- compiled by Büttner et al. [9] already indicated that most tion signals with ArrayVision 6.0, genes were screened for proteins of this organism can be allocated to two main pI signals with a quality factor (quality factor = (ARVol [signal regions, an alkaline as well as a neutral/weak acidic one. intensity] – standard deviation)/background value) of at Based on these theoretical calculations, separation of least 1.2 for both replicates. 2515 genes exceeding this proteins in one single 2-DE gel with a pH range of 4–7 quality factor for at least 6 of the 10 data sets were 2 would cover /3 of all B. subtilis proteins. The data of the regarded as significantly expressed during the exponen- transcriptome studies indicate that 1658 mRNAs encod- tial phase in minimal medium. ing proteins with a pI of 4–7 are probably present in exponentially growing cells. If all these mRNAs are translated 2.8 Software and bioinformatic approaches 1544 proteins should be covered by our standard gel system pI 4–7 if proteins with a molecular mass below The Genespring software Version 6.0 from Silicon Genet- 10 kDa and above 150 kDa and a gramd average of ics was used for the analysis and comparison of protein/ hydropathicity (GRAVY) index of more than 0.3 are gene lists. 2-D gel image analysis was performed with excluded (114 of the 1658 proteins). From these expected the Delta2D Software (Decodon, Greifswald, Germany). 1544 proteins which mainly perform house-keeping func- The association of protein labels to the corresponding tions (see supplementary Table 4) 271 proteins were SubtiList Data [29] was supported by Decodon Scout already identified by Büttner et al. [9]. Technology. The Mr and pI outliers were calculated with MS Excel using a linear (pI) and a third-order polynomial For the current study 200 mg of protein from exponentially

(lnMr) function. growing cells were separated by 2-DE (pI 4–7) and stained with colloidal CBB (Fig. 1). About 700 protein spots were cut, digested, and analyzed by mass spectrometric 3 Results and discussion techniques. The 602 protein spots identified were encoded by 449 different genes. After thorough analysis 3.1 Proteome of growing cells (pI region 4–7) of the densely covered regions by narrow pH gradients The value of physiological proteomics very much de- (see below), annotation of 48 additional protein spots pends on the degree of coverage of the cellular proteome. was transferred to the image covering the pI-range 4–7 For technical as well as physiological reasons only a frac- finally raising the number of labelled spots to 650 en-

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 45 2854 C. Eymann et al. Proteomics 2004, 4, 2849–2876

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 46 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2855

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 47 2856 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Figure 1. Reference 2-DE map of cytosolic proteins of B. subtilis grown exponentially in minimal medium (pI range 4–7). The 2-D map was divided into four sections: (A) the upper left part (high Mr and pI 7–5.5); (B) the upper right part (high Mr and pI 5.5–4); (C) the lower left part (low Mr and pI 7–5.5); (D) the lower right part (low Mr and pI 5.5–4). Protein spots are

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 48 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2857

labelled with protein names according to the SubtiList database [29]. Protein extracts were separated on 18 cm IPG strips and 2-DE gels were stained with colloidal CBB. Theoretical Mr and pI scales are indicated. Detailed information onto each individual protein identified is available in supplemental Table 4.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 49 2858 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Figure 2. Reference image of low-molecular-weight proteins (lower than 15 kDa) of the pI range 4–7. Cytosolic proteins of B. subtilis grown exponentially in minimal medium were separated by 2-DE and gels were stained with SYPRO Ruby. Labelled proteins were manually cut, pooled, and identified by MS/MS as described in Section 2. Proteins spots are labelled as indicated in the legend for Fig. 1. Theoretical Mr and pI scales are indicated.

coded by 497 different genes (Fig. 1). Of those spots 24 ent proteins in 120 protein spots in the pI range 5.5–6.7. were found to contain two proteins of similar pI value Transfer from the pI range 4–7 increased the number of and Mr. labels to 125, corresponding to 114 different proteins (see supplementary Fig. 9). Whereas identification by peptide mass fingerprinting (PMF) was readily accomplished for larger proteins, iden- The separation of the pI range 5–6 allowed assignment of tification more frequently failed for low-molecular-weight 235 different proteins in 318 protein spots. In this case, proteins due to the small number of peptides observed. transfer of annotations from other gels significantly raised To increase the coverage of proteins with low molecular the number of labelled spots to 377 and the number of weight, spots of the corresponding gel region were cut different protein species to 293 (see supplementary manually, pooled from several gels stained with SYPRO Fig. 10). In the pI region 4.5–5.5 we identified and labelled Ruby, subjected to tryptic digestion and then analyzed 385 different proteins in 569 protein spots. Annotations of by ESI-MS/MS after separation of digested peptides by 35 protein spots could be transferred to this region raising reverse phase nano-HPLC. This ESI-MS/MS analysis of the number of labels to 604 that correspond to 417 differ- 75 protein spots allowed the identification of 62 protein ent proteins (Fig. 3). spots encoded by 51 different genes (Fig. 2). Twenty-two Ultrazoom gels covering the pI range 4–5 facilitated the proteins were exclusively identified from these SYPRO identification of 219 protein spots encoded by 130 differ- Ruby-stained gels. Altogether 519 different proteins were ent genes. Thirty-three protein labels could be transferred identified and labelled on the standard pI range 4–7 (Figs. 1 to this region raising the number of labelled spots to 252 and 2 and supplementary Table 4). that correspond to 162 different proteins (see supplementary Fig. 11). Comparing the protein patterns and identifi- 3.2 Analysis of the ultrazoom gels cations with the standard pH 4–7 gel, it was obvious that (pH 5.5–6.7, 5–6, 4.5–5.5, and 4–5) analysis of the protein extract with ultrazoom gels would not significantly improve the reference map of the stand- The protein profile displayed in Fig. 1 clearly contains ard gel itself by facilitating transfer of annotations. Only regions of spot crowding in which separation and thus 48 proteins newly identified on zoom gels could be used unequivocal spot identification is compromised. Ultra- for transfer of annotations to the main pI 4–7 window zoom gels of four different pI ranges were used (pH 5.5– increasing the number of identified proteins (pI 4–7) to 6.7, 5–6, 4.5–5.5, 4–5) to increase resolution and spot 519 (see above). However, 174 proteins previously not identification in these overcrowded regions. Furthermore, recognized in the standard gel were identified on the we wanted to evaluate if such ultrazoom gels would sig- ultrazoom gels. The four different zoom gels contributed nificantly improve coverage and thus justify inclusion in to these de novo identifications to a different extend routine physiological studies in addition to the standard (35 proteins pI 5.5–6.7; 46 proteins pI 5–6; 117 proteins pH 4–7 gel. In this set of experiments, 400 mg protein pI 4.5–5.5, and 27 proteins pI 4–5). Some of the proteins were separated and visualized with colloidal CBB stain- were detected on more than one zoom gel. Of the four ing. These studies allowed the identification of 109 differ- narrow pI-range systems the pI range 4.5–5.5 had the

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 50 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2859

Figure 3. Reference 2-DE map of ultracentrifuged cytosolic proteins of B. subtilis separated in an ultrazoom gel of pH gradient 4.5–5.5. Proteins were separated with 18 cm IPG strips and 2-DE gels were stained with colloidal CBB. Proteins 3 spots are labelled as indicated in the legend for Fig. 1. Theoretical Mr (610 ) and pI scales are indicated.

largest impact (Fig. 3). It provided access to 117 addition- In total we identified 693 different proteins on gels span- al proteins not noticed in the standard gel system (pI 4–7). ning the pI range from 4 to 7, 668 of which also have their Therefore, it should subsequently be included in the rou- predicted pI in this region. 618 of these 668 proteins were tine physiological studies. expected to be expressed based on transcriptional profil-

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 51 2860 C. Eymann et al. Proteomics 2004, 4, 2849–2876 ing data. Thus, future routine proteome analysis of grow- tify all homologs predicted from the genome (53% of all ing cells will now include 40% of the expected proteome potential citric acid cycle proteins predicted), because of this pI range (618 proteins of 1544 genes of the tran- many are very likely only expressed under particular con- scriptome study). Furthermore, the proteome analysis ditions. identified 50 additional proteins for most of which the transcriptional data just failed the cutoff criteria also In a second approach, the available data set was ana- indicating the limits of transcriptional profiling experi- lyzed for a correlation between relative quantitative levels ments. of the proteins and their physiological function in exponentially growing cells (Fig. 5). The quantification of the protein amount in the corresponding spots by the Delta2D 3.3 Protein abundance during exponential software revealed that about 40% of the proteins de- growth: Correlation with functional groups tectable in the pI range from 4 to 7 is involved in amino acid supply (18%), protein production (tRNA loading 2%, This study is mainly confined to cells exponentially grow- translation 12%), and protein maintenance (6%). About ing in a defined minimal medium. Thus, most of the cellu- 18% of the protein level detected is required for degrada- lar components (i.e., amino acids) need to be synthe- tion of glucose (8% glycolysis) and supply of the central sized, because they are not available for uptake in the metabolism with carbon skeletons and energy (PP-shunt, culture medium. The proteins identified in this study citric acid cycle, and pyruvat metabolism at least 9.5%). were assigned to metabolic pathways and compared 5% of the protein amount fulfils functions in purine and to the enzymes encoded by the genome in order to pyrimidine metabolism (Fig. 5). evaluate to which extent the available proteome data reflect the different branches of B. subtilis’ metabolism (Table 1 and Fig. 4). We were able to detect nearly all 3.4 Alkaline proteins (pI 6–11) members of the central carbohydrate metabolism (glycolysis, pentose phosphate shunt, and citric acid cycle), Approximately one-half of the B. subtilis proteins should almost all amino acid synthesis pathways (except tryp- be localized to the pI region 6–11. However, experimental tophan synthesis because the B. subtilis strain 168 is analysis of this group of proteins is more challenging and auxotrophic for this amino acid and thus tryptophan thus often not included in standard proteome studies. A is supplied in the medium), purine and pyrimidine me- large fraction of these proteins (644 of 2375) also contain tabolism, fatty acid metabolism, and main cellular func- multiple membrane spanning domains (MSDs; at least 4) tions like replication, transcription, translation, and cell and as a result of their high hydrophobicity those mem- wall synthesis (see Fig. 4, Table 1, and supplementary brane proteins are almost inaccessible by standard Table 4). Therefore, the set of proteins covered by the 2-DE. We now continued the analysis of the alkaline pro- current version of the reference map will allow for a com- tein fraction of B. subtilis initiated by Ohlmeier et al. [30]. prehensive monitoring of B. subtilis’ cellular physiology Thus, the protein list also includes 59 alkaline proteins (Fig. 4). of growing B. subtilis cells that were identified and/or labelled on alkaline gels (pI 6–11), 40 of them already According to the functional groups of the SubtiList data- identified by Ohlmeier et al. [30] and additional 19 proteins base [29] the greatest recovery rate of expected proteins identified in this study (Fig. 6). Fifty-two proteins were by number was found for: (i) the translational apparatus exclusively identified on alkaline gels. One of these pro- (e.g., 89% of the aminoacyl-tRNA synthetases, 83% of teins (LytC) contains five MSDs, four proteins contain the translation elongation factors); (ii) enzymes of main two or three MSDs (MurG, YmfA, YwbD, PhoD) and addi- glycolytic pathways (81%); (iii) the citric acid cycle tional 16 proteins contain just one MSD. Clearly, these (53%); (iv) metabolism of nucleotides and nucleic acids proteome studies of the alkaline pI-range provide only a (51%); (v) transcription elongation proteins (50%); (vi) core set of proteins and need significant expansion. In- enzymes involved in metabolism of amino acids and clusion of these 52 alkaline proteins increases the total related molecules (45%) (for details see Table 1). number of identifications in growing cells to 745 cytosolic proteins. Not all proteins encoded by the B. subtilis genome are actually expected to be expressed in growing cells. Therefore, the practical coverage is even more compre- 3.5 Putative protein modifications hensive than indicated by the numbers given above. This is particularly obvious for the citric acid cycle were the 183 proteins were found as multiple spots (in total 483 proteome analysis assigned enzymes to all individual spots), in most cases in two or three forms (157 proteins) steps of this pathway (100% coverage) but did not iden- but also up to eight or nine spots (TufA and MetE) (Figs. 1,

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 52 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2861

Table 1. Coverage of the theoretical proteome by standard 2-D gel image analysis sorted by the SubtiList functional categories

Functional groups according to SubtiList Genome- Proteins Proteins identified database encoded expected in 2-D gels proteinsa) in 2-D gels (pI 4–7) (pI 4–7)b) No. (%)c)

1.1 Cell wall 89 35 18 (20) 1.2 Transport/binding proteins; lipoproteins 400 74 18 (5) 1.3 Sensors 39 20 1 (3) 1.4 Membrane bioenergetics 80 42 21 (26) 1.5 Motility and chemotaxis 55 37 11 (20) 1.6 Protein secretion 36 8 2 (6) 1.7 Cell division 22 11 7 (32) 1.8 Sporulation 164 49 9 (5) 1.9 Germination 26 3 0 (0) 1.10 Transformation/competence 25 12 3 (12) 2.1.1 Specific pathways 226 110 40 (18) 2.1.2 Main glycolytic pathways 26 23 21 (81) 2.1.3 Citric acid cycle 19 14 10 (53) 2.2 Amino acids and related molecules 201 140 90 (45) 2.3 Nucleotides and nucleic acids 92 69 47 (51) 2.4 Metabolism of lipids 89 40 23 (26) 2.5 Coenzymes and prosthetic groups 103 71 30 (29) 2.6 Metabolism of phosphate 10 2 2 (20) 2.7 Metabolism of sulfur 8 4 3 (38) 3.1 DNA replication 26 18 6 (23) 3.2 DNA restriction/modification and repair 42 15 3 (7) 3.3 DNA recombination 19 12 2 (11) 3.4 DNA packaging and segragation 11 5 1 (9) 3.5.1 Transcription initiation 20 7 5 (25) 3.5.2 Transcription regulation 224 83 22 (10) 3.5.3 Transcription elongation 6 4 3 (50) 3.5.4 Transcription termination 4 4 2 (50) 3.6 RNA modification 28 15 8 (29) 3.7.1 Ribosomal proteins 58 4 4 (7) 3.7.2 Aminoacyl-tRNA synthetases 28 25 25 (89) 3.7.3 Translation initiation 6 3 3 (50) 3.7.4 Translation elongation 6 6 5 (83) 3.7.5 Translation termination 3 3 2 (67) 3.8 Protein modification 35 21 13 (37) 3.9 Protein folding 12 5 4 (33) 4.1 Adaptation to atypical conditions 81 39 20 (25) 4.2 Detoxification 89 48 18 (20) 4.3 Antibiotic production 35 12 3 (9) 4.4 Phage-related function 87 15 0 (0) 4.5 Transposon and IS 10 2 0 (0) 4.6 Miscellaneous 30 15 5 (17) 5.1 Similar to unknown B. subtilis proteins 540 163 33 (6) 5.2 Similar to other unknown proteins 381 155 62 (16) 6 No similarity 623 100 13 (2) a) Amount of protein complements of all predicted ORFs from SubtiList b) Amount of proteins which are known to be expressed (array analysis) and can be expected to be visualized in the standard pI range 4–7 gel c) Percent values correspond to the recovery rate of proteins in the standard 2-D gel image compared to the genome encoded amount of genes

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 53 2862 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Figure 4. Assignment of proteins identified to the different branches of cellular metabolism. Proteins that have not been identified in the 2-D gel images thus far are shaded light grey. Proteins exclusively identified from the membrane protein fraction are indicated with asterisks. Components of the carbohydrate metabolism such as glycolysis (right side of the left page), pentose phosphate shunt (left side of the right page), and aminosugar synthesis for murein synthesis (center of the left page) are indicated in dark cyan. Citric acid cycle (lower right side of the left page), biotin and fatty acid metabolism (upper center of the right page) are indicated by dark gray. Amino acid metabolism is colored red. The

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 54 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2863

essential amino acids are highlighted in yellow. Purin (upper left corner) and pyrimidine (lower right) metabolism are encoded in purple and the nicotinate metabolism (upper left page) in brown. Compo- nents not directly involved in metabolic pathways but in essential cell structures are presented in boxes. DNA related functions in yellowish green (bottom left page), flagellum and chemotaxis related components in azure (bottom left page), and ATPase components in pink (bottom left page). Trans- porters are highlighted in dark blue, components of the transcriptional machinery in green, and the ribosome and other components of the translational apparatus are encoded in ochre.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 55 2864 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Figure 5. Relative quantitative distribution of the 500 most abundant proteins to the various branches of cellular physiology. The total protein content observed on a standard gel (pH range 4–7) was quantified (100%) and then relative contri- butions of individual proteins were calculated. The 500 most abundant proteins were assigned to the different branches of cellular metabolism and then the sum of the relative quantities of each protein class was calculated and displayed in the pie-chart with the aid of the Delta2D software package (Decodon GmbH, Greifswald, Germany). For details of individual proteins see supplemental Table 3.

3; supplementary Figs. 9–11). We found protein chains atypical position includes the ribosomal proteins RpsD of high-molecular-weight proteins (e.g., MetE), double and RplD that are detected in the acidic range although spots (pI variations), multimerizations or fragmentations these proteins display very basic theoretical pI’s of 10.2

(Mr variations), which might be attributed either to biologi- and 10.5, respectively. This unexpected migration proper- cally important post-translational modifications or to arti- ties of selected ribosomal proteins are currently investi- ficial chemical modifications imposed during the experi- gated. Forty-one protein spots encoded by 29 genes mental processing of the protein sample. 136 proteins show dramatic differences from the expected Mr values show only charge variations, 17 proteins only mass varia- ( 10 kDa shifts) indicated by a color that does not fit to tions and 30 proteins both. For a few double spots the the typical color code of the selected region (Fig. 7B). For shift from an acidic to a more basic pI is caused by defor- 21 of these 41 proteins with a large Mr (e.g., ClpC, GltA, mylation of the start methionine by peptide deformylase OdhB) this deviation is very likely the result of the limited [31]. resolution of the gel system for proteins with large molecular mass. Furthermore, we also found possible frag- An approach for the intuitive visualization of dramatic ments of TufA, FusA, and an isoform of LysC (LysCb) deviations in protein migration is presented in Figs. 7A which is known to be encoded by lysC but to contain and B for our standard pI range 4–7. When the theoretical only the amino acids 246–408 of the b-subunit of asparto- pI and M values were compared with those experimen- r kinase [9, 29]. Additionally we found four proteins with tally determined, in general a reasonable correlation was dramatic deviations in both the pI and M values. These found for the majority of spots in the gel figures (Figs. 7A, r are AlaT, ArgJ, OdhB, and YcgM. Observed deviations B). Color codes significantly different from the main color in M were also supported by a third order polynomial of the particular region visualize outliers with a clear r regression analysis of the ln M vs. the observed migra- deviation of the experimentally measured pI or M from r r tion position (data not shown). the expected theoretical values. Proteins showing such deviations are candidates for dramatic post-translational modifications like fragmentations. Nineteen protein spots 3.6 Analysis of membrane proteins show dramatic differences (D pI . 0.5) from the expected pI values indicated by clear-cut color deviations (Fig. 7A). 2-DE-based proteome studies have long been shown to This visual identification gained additional support using be well-suited for the analysis of cytosolic [2, 4, 8], cell linear regression of the theoretical pI values vs. migration wall-associated [32] as well as secreted proteins [33] of position (data not shown). The reason for these unex- B. subtilis. Despite their functional relevance membrane pected spot positions has to be individually analyzed for proteins have only very recently been subjected to pro- the most interesting proteins. The list of proteins with teome analysis [34]. This delay in the analysis of the mem-

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 56 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2865

Figure 6. Reference 2-DE map of alkaline proteins of B. subtilis separated in the pH gradient 6–11. Crude protein extracts of exponentially growing cells were separated on 18 cm IPG strips and after 2-DE gels were stained with silver nitrate [19]. For experimental details see Section and supplemental Table 4.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 57 2866 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Figure 7. Color-coded representation of mass and pI deviations. The Delta2D software (Decodon GmbH) was utilized to visualize the observed physicochemical properties (pI and Mr) of the proteins identified on the 2-D gel image in the standard pH range 4–7 in comparison with the corresponding values in the SubtiList database (http://genolist.pasteur.fr/SubtiList/).

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 58 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2867

The color code is presented in the bottom left corner in (A) for pI and in (B) for Mr. Rectangles indicate a more acidic pI (A) or smaller Mr (B) of a protein on the gel image than predicted, ellipses highlight regions of interest, where proteins show a more alkaline pI (A) or a higher Mr (B) on the gel image. Only deviations greater than 10 kDa or 0.5 pI units were considered.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 59 2868 C. Eymann et al. Proteomics 2004, 4, 2849–2876 brane proteins is mainly the result of their unfavorable These proteins were examined for the presence of MSDs physical properties, such as high hydrophobicity and the and signal peptides using the ALOM2/TMHMM and Sig- associated limited solubility in solutions compatible with nalP [35] algorithms, respectively. Based on this predic- 2-DE. Yamane and co-workers [34] recently presented a tion and the functional annotation the proteins listed in profiling of ABC-transporter solute-binding proteins thus Table 2 could be assigned to the following groups: 46 pro- starting the proteome analysis of B. subtilis’s membrane teins containing more than 3 MSDs; 65 proteins with 1–3 protein fraction. This study involved various 2-D sepa- MSDs, including 25 lipoproteins and 15 proteins secreted ration systems as well as SDS-PAGE and used MALDI- by the Sec-system; 17 membrane-associated proteins MS to identify in total 637 proteins including 256 mem- and 39 soluble proteins; 37 of the 168 proteins were also brane proteins, 101 lipo- or secretory proteins and 280 identified in the cytosolic protein fraction on 2-D gels. soluble proteins. Due to their importance in maintaining cell integrity, signal sensing, transport processes, and A considerable fraction of soluble proteins (44%) has also energy conservation, membrane proteins constitute an been observed in the membrane proteome study by important facet for physiological proteomics. Therefore, Bunai et al. [34]. The stringent high-salt and alkaline we intended to complement our proteome analysis of the washing procedures employed during the membrane cytosolic proteins by the description of the membrane preparation presented here apparently reduced (23%) protein fraction. Starting from high-salt and alkaline- but did not avoid the fraction of soluble proteins. Impor- washed membrane protein preparations that were solubi- tantly, using a combination of SDS-PAGE and ESI-MS/ lized with the detergent n-dodecyl-b-D-maltoside it was MS analysis we can now make proteins of the membrane first necessary to prove the quality of the membrane prep- fraction including those with multiple MSDs (46 pro- aration. We used a set of monoclonal antibodies directed teins with more then 3 MDSs) accessible to physiologi- against the transcription factor SigB and two of its regula- cal studies. tory proteins RsbS and RsbU that should all be localized to the cytosolic fraction as well as a polyclonal antibody directed against the membrane-associated protease 4 Concluding remarks FtsH to test the specificity of the membrane preparations. The results of this Western blot analysis are displayed in The vegetative core proteome of growing cells contain- Fig. 8A. The cytosolic proteins SigB, RsbU, and RsbS are ing 693 identified proteins in the pI 4–7 region, 52 alkaline quantitatively recovered in the cytosolic fraction and proteins that were exclusively identified on alkaline gels could not be detected in the membrane protein fraction. (pH 6–11) and 130 intrinsic membrane proteins or sur- In contrast the full-length protease FtsH was exclusively face-associated proteins (in total 876) is now ready for located in the membrane fraction. A second, truncated physiological application. Because only a very low form of FtsH that probably lacks the N-terminal MSDs amount of extracellular proteins were produced in grow- was allocated to the cytosolic protein fraction. Thus, this ing cells [33], two main proteome fractions (pI 4–7 and pI Western blot analysis proves the purity of the membrane 6–11) should be sufficient to capture the most essential protein preparation that was subsequently used for the changes of the proteome in growing cells. The coverage separation by 2-DE and SDS-PAGE/ESI-MS/MS. The in the standard gel region of pI 4–7 can be substantially quality of the preparation gains further support by the increased if a zoom gel of the pI range 4.5–5.5 is included low levels of contaminating ribosomal proteins (see in the routine analysis. This data set can now be explored below). to compare physiologically different growth conditions and to reveal the proteomics signatures of particular envi- Initially, 2-DE was tested for its ability to separate mem- ronmental conditions, such as those for glucose or amino brane proteins. In spite of the fact that the protein pat- acid excess [7, 28]. terns of the cytosolic and membrane protein fraction dif- fered significantly, analysis by MALDI-MS mainly revealed The evaluation of the proteome of growing cells (vegeta- cytosolic and membrane associated proteins in the mem- tive proteome) presented here has to be succeeded by brane fraction but failed to identify true membrane pro- the analysis of proteomes of stationary phase cells in teins with multiple MSDs (data not shown). Since this order to gain a comprehensive experimental validation/ absence of membrane proteins likely reflects loss of this description of the entire theoretical proteome. These sin- protein class during the first dimension (IPG), separation gle proteomes of nongrowing cells will probably show by SDS-PAGE in combination with a thorough analysis by more differences than proteomes of cells grown under dif- ESI-MS/MS was utilized for the characterization of the ferent conditions, because the stress or starvation stimuli membrane protein fraction. Using this approach we iden- that trigger the nongrowing state normally induce a huge tified 168 different proteins (Fig. 8B; Table 2 Addendum). number of stress or starvation-specific genes [36–41].

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 60 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2869

Figure 8. Analysis of membrane proteins of B. subtilis. The membrane protein fraction of exponentially growing B. subtilis cells was prepared as described in Section 2. (A) Immunoblot analysis of the sub- cellular localization of cytosolic and membrane proteins. After separation of the crude protein extract by the differential centrifugation procedure described in Section 2, aliquots of the crude protein extract (lanes 1 and 4), the cytosolic protein fraction (lanes 2 and 5) and the n-dodecyl-b-D-maltoside-solubilized membrane protein fraction (lanes 3 and 6) were separated by SDS-PAGE and either stained with a colloidal CBB staining procedure (Amersham Biosciences) (lanes 1–3) or subjected to immunoblot analysis with antibodies directed against the cytosolic proteins RsbS, RsbU, and SigB or the membrane- bound protease FtsH. The molecular masses of the proteins and those of Mr standards are given. (B) Identification of proteins by a combined SDS-PAGE LC-MS/MS approach. Proteins of the membrane protein fraction were separated by SDS-PAGE, the gel was divided into sections as indicated by the black-white bar adjacent to the gel lane, and identification was accomplished by ESI-MS/MS after tryptic in-gel digestion of the proteins and separation of the resulting peptides by reverse-phase chromatography. The proteins identified and the Mr of standard proteins are indicated.

The vegetative proteins that are involved in the metabo- in B. subtilis. These studies initiated by a proteomic ap- lism of growing cells were inserted into a comprehensive proach [7] led to a new understanding of the regulation of metabolic map (Fig. 4). This comprehensive proteomic basal carbon/energy metabolism in B. subtilis. Glycolysis information of growing cells enables us to analyze the reg- is strongly stimulated by glucose and the citric acid cycle ulation of entire metabolic pathways, which was already is repressed if glutamate is available even in the presence done for the regulation of glycolysis and citric acid cycle of oxygen. The excess glucose intermediates can not

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 61 2870 C. Eymann et al. Proteomics 2004, 4, 2849–2876 enter the citric acid cycle because it is repressed but have [13] Jungblut, P. R., Schaible, U. E., Mollenkopf, H. J., Zimny- to be secreted into the extracellular medium (overflow Arndt, U. et al., Mol. Microbiol. 1999, 33, 1103–1117. metabolism). This phenomenon known as Crabtree effect [14] Jungblut, P.R., Bumann, D., Haas, G., Zimny-Arndt, U. et al., Mol. Microbiol. 2000, 36, 710–725. depends on CcpA, the global regulator of carbon catabo- [15] Kolker, E., Purvine, S., Galperin, M. Y., Stolyar, S. et al., lite repression. Later it turned out that this CcpA depend- J. Bacteriol. 2003, 185, 4593–4602. ency is indirect because in the ccpA mutant HPr is highly [16] Stülke, J., Hanschke, R., Hecker, M., J. Gen. Microbiol. phosphorylated at the Serin residue 46 with the result that 1993, 139, 2041–2045. the glucose uptake rate is reduced in the mutant [7, 42, [17] Görg, A., Obermaier, C., Boguth, G., Csordas, A. et al., Elec- trophoresis 1997, 18, 328–337. 43]. This example shows that proteomics is an attractive [18] Görg, A., Boguth, G., Obermaier, C., Posch, A., Weiss, W., approach to initiate new physiological studies because of Electrophoresis 1995, 16, 1079–1086. its global view of the processes. Proteomics is, however, [19] Blum, H., Beier, H., Gross, H., Electrophoresis 1987, 8, 93– only the first step which has to be accompanied by fol- 99. low-up studies relying on molecular genetics techniques. [20] Chang, S., Cohen, S. N., Mol. Gen. Genet. 1979, 168, 111– The vegetative proteome map with 876 entries (including 115. the membrane protein fraction) covering many metabolic [21] Fujiki, Y., Hubbard, A. L., Fowler, S., Lazarow, P. B., J. Cell. Biol. 1982, 93, 97–102. pathways should promote related studies to gain a more [22] Dufour, A., Völker, U., Völker, A., Haldenwang, W. G., J. Bac- comprehensive picture of metabolism and its regulation in teriol. 1996, 178, 3701–3709. B. subtilis showing that even in the best-studied model [23] Benson, A. K., Haldenwang, W. G., J. Bacteriol. 1993, 175, system of Gram-positive bacteria many interesting phe- 2347–2356. nomena still wait for their elucidation. [24] Deuerling, E., Mogk, A., Richter, C., Purucker, M., Schu- mann, W., Mol. Microbiol. 1997, 23, 921–933. We are grateful to W. G. Haldenwang and W. Schumann [25] Völker, U., Völker, A., Maul, B., Hecker, M. et al., J. Bacteriol. for providing the antibodies directed against SigB, RsbS, 1995, 177, 3771–3780. RsbU, and FtsH, respectively. We are indebted to DECO- [26] Mostertz, J., Scharf, C., Hecker, M., Homuth, G., Microbiol- ogy 2004, 150, 497–512. DON GmbH for the close cooperation and the pre-release [27] Leichert, L. I., Scharf, C., Hecker, M., J. Bacteriol. 2003, 185, access to new software tools. Financial support for this 1967–1975. study was provided by the Bundesministerium für Bil- [28] Mäder, U., Homuth, G., Scharf, C., Büttner, K. et al., J. Bac- dung und Forschung through the proteome initiative teriol. 2002, 184, 4288–4295. “Neue Methoden zur Erfassung des Gesamtproteoms [29] Moszer, I., Jones, L. M., Moreira, S., Fabry, C., Danchin, A., von Bakterien”, the Max-Planck-Society, and the Fonds Nucleic Acids Res. 2002, 30, 62–65. [30] Ohlmeier, S., Scharf, C., Hecker, M., Electrophoresis 2000, der Chemischen Industrie (to M.H. und U.V.). 21, 3701–3709. [31] Bandow, J. E., Becher, D., Büttner, K., Hochgrafe, F. et al., Proteomics 2003, 3, 299–306. 5 References [32] Antelmann, H., Yamamoto, H., Sekiguchi, J., Hecker, M., Proteomics 2002, 2, 591–602. [1] Kunst, F., Ogasawara, N., Moszer, I., Albertini, A. M. et al., [33] Antelmann, H., Tjalsma, H., Voigt, B., Ohlmeier, S. et al., Ge- Nature 1997, 390, 249–256. nome Res. 2001, 11, 1484–1502. [2] Wachlin, G., Hecker, M., Z. Allg. Mikrobiol. 1984, 24, 397– [34] Bunai, K., Nozaki, M., Hamano, M., Ogane, S. et al., Prote- 401. omics 2003, 3, 1738–1749. [3] Streips, U. N., Polio, F. W., J. Bacteriol. 1985, 162, 434–437. [35] Tjalsma, H., Bolhuis, A., Jongbloed, J. D., Bron, S., van Dijl, [4] Richter, A., Hecker, M., FEMS Microbiol. Lett. 1986, 36, 69– J. M., Microbiol. Mol. Biol. Rev. 2000, 64, 515–547. 71. [36] Bernhardt, J., Weibezahn, J., Scharf, C., Hecker, M., Ge- [5] Hecker, M., Völker, U., FEMS Microbiol. Ecol. 1990, 74, 197– nome Res. 2003, 13, 224–237. 213. [37] Sonenshein, A. L., in: Storz, G., Hengge-Aronis, R. (Eds.), [6] Hecker, M., Adv. Biochem. Eng. Biotechnol. 2003, 83, 57– Bacterial Stress Responses, ASM, Washington DC 2000, 92. pp. 199–215. [7] Tobisch, S., Zühlke, D., Bernhardt, J., Stülke, J., Hecker, M., [38] Hecker, M., Völker, U., Adv. Microbial. Physiol. 2001, 44, J. Bacteriol. 1999, 181, 6996–7004. 35–91. [8] Antelmann, H., Bernhardt, J., Schmid, R., Mach, H. et al., [39] Kobayashi, K., Ogura, M., Yamaguchi, H., Yoshida, K. et al., Electrophoresis 1997, 18, 1451–1463. J. Bacteriol. 2001, 183, 7365–7370. [9] Büttner, K., Bernhardt, J., Scharf, C., Schmid, R. et al., Elec- [40] Eichenberger, P.,Jensen, S. T., Conlon, E. M., van Ooij, C. et trophoresis 2001, 22, 2908–2935. al., J. Mol. Biol. 2003, 327, 945–972. [10] Jaffe, J. D., Berg, H. C., Church, G. M., Proteomics 2004, 4, [41] Fawcett, P., Eichenberger, P., Losick, R., Youngman, P., 59–77. Proc. Natl. Acad. Sci. USA 2000, 97, 8063–8068. [11] Tonella, L., Hoogland, C., Binz, P.A., Appel, R. D. et al., Pro- [42] Ludwig, H., Rebhan, N., Blencke, H. M., Merzbacher, M., teomics 2001, 1, 409–423. Stulke, J., Mol. Microbiol. 2002, 45, 543–553. [12] Langen, H., Takacs, B., Evers, S., Berndt, P. et al., Electro- [43] Ludwig, H., Homuth, G., Schmalisch, M., Dyka, F. M. et al., phoresis 2000, 21, 411–429. Mol. Microbiol. 2001, 41, 409–422.

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 62 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2871

6 Addendum

Table 2. Analysis of membrane proteins of B. subtilis

Protein Accession pI Theo- Ob- MSDs GRAVY Function and homology name number retical served Mr (kDa) Mr (kDa)

AckAa) BG10813 8.0 43.0 49.9 0 20.022 Acetate kinase AlaSa) BG12563 5.7 97.1 93.6 0 20.347 Alanyl-tRNA synthetase AlsT BG11798 4.2 50.1 41.7 9 0.715 Amino acid carrier protein a) AroA BG10375 10.0 39.4 45.6 0 20.204 3-Deoxy-D-arabino-heptulosonate 7-phosphate synthase/chorismate mutase-isozyme 3 AroEa) BG10294 9.6 45.1 49.9 0 20.018 5-Enolpyruvoylshikimate-3-phosphate synthase AtpAa) BG10819 5.4 54.4 54.6 0 20.101 ATP synthase (subunit a) 59.8 AtpB BG10815 8.0 26.9 20.3 4 0.733 ATP synthase (subunit a) AtpDa) BG10821 5.5 51.3 54.6 0 20.103 ATP synthase (subunit b) 59.8 AtpFa) BG10817 4.9 19.1 18.6 1 20.394 ATP synthase (subunit b) AtpGa) BG10820 8.8 31.5 34.9 0 20.232 ATP synthase (subunit g) 38.1 AtpHa) BG10818 9.0 19.8 20.3 0 20.139 ATP synthase (subunit d) Bcda) BG11723 5.1 39.8 31.9 0 20.369 Leucine dehydrogenase BdbDb BG14104 5.2 24.8 26.6 1 20.443 Thiol-disulfide oxidoreductase CitB BG10478 9.5 99.1 102.4 0 20.200 Aconitate hydratase ComERa) BG10479 4.7 30.1 31.9 0 0.068 Nonessential gene for competence CsbB BG11834 4.8 37.6 34.9 2 20.036 Stress response protein CtpA BG11794 5.7 51.0 59.8 1 20.436 Carboxy-terminal processing protease CydD BG11928 8.3 64.3 59.8 6 0.156 ABC transporter required for expression of cytochrome bd (ATP-binding protein) a) c) DacA BG10074 6.3 48.5 54.6 1 20.318 Penicillin-binding protein 5 (D-alanyl- D-alanine carboxypeptidase) DctP BG12075 6.4 45.3 31.9 7 0.763 C4-dicarboxylate transport protein DltB BG10550 8.7 46.6 31.9 6 0.440 D-Alanine transfer from Dcp to undecaprenol-phosphate b) DltD BG10548 9.2 44.6 45.6 1 20.507 D-Alanine transfer from undecaprenol- phosphate to the poly(glycerophosphate) chain EcsAa) BG11516 5.2 27.6 29.1 0 20.160 ABC transporter (ATP-binding protein) FbaAa) BG10412 8.9 30.2 34.9 0 20.139 Fructose-1,6-bisphosphate aldolase FeuAc) BG10835 7.3 35.0 38.1 1 20.438 Iron-uptake system (binding protein) FhuC BG11390 10.5 29.8 34.9 0 20.159 Ferrichrome ABC transporter (ATP-binding protein) FhuDc) BG10828 4.9 34.3 34.9 1 20.319 Ferrichrome ABC transporter (ferrichrome- binding protein) FlgEa) BG10249 4.9 27.3 29.1 0 20.248 Flagellar hook protein FlgL BG11936 9.3 32.6 45.6 0 20.504 Flagellar hook-associated protein 3 (HAP3)

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 63 2872 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Table 2. Continued

Protein Accession pI Theo- Ob- MSDs GRAVY Function and homology name number retical served Mr (kDa) Mr (kDa)

FlhF BG10544 6.5 41.0 41.7 0 20.273 Flagella-associated protein FliLb) BG10250 4.6 15.5 17.3 1 20.213 Flagellar protein required for flagellar formation FruA BG11938 5.3 67.0 65.4 6 0.276 PTS fructose-specific enzyme IIABC component FtsH BG10132 6.2 70.8 78.2 2 20.308 Cell-division protein/general stress protein (class III heat-shock) FtsX BG12591 9.1 32.9 29.1 4 0.374 Cell-division protein 31.9 GapAa) BG10827 8.0 35.7 45.6 0 20.147 Glyceraldehyde-3-phosphate dehydrogenase GatBa) BG12840 4.4 53.2 59.8 0 20.551 Glutamyl-tRNA(Gln) amidotransferase (subunit B) GlpDa) BG10188 9.4 62.4 65.4 0 20.479 Glycerol-3-phosphate dehydrogenase GlpKa) BG10187 4.9 54.9 45.6 0 20.272 Glycerol kinase 59.8 GltT BG12595 5.8 45.8 31.9 7 0.875 H1/Na1-glutamate symport protein 34.9 38.1 Haga) BG10655 5.0 32.5 38.1 0 20.414 Flagellin protein 41.7 HemATa) BG13066 9.6 48.6 54.6 0 20.419 Haem-based aerotactic transducer HemBa) BG10344 8.7 36.1 38.1 0 20.184 d-Aminolevulinic acid dehydratase b) LytC BG10407 6.3 52.5 54.6 1 20.137 N-Acetylmuramoyl-L-alanine amidase (major autolysin) LytRa) b) BG10404 5.8 34.4 34.9 1 20.535 Attenuator role for lytABC and lytR expression ManP BG13176 9.1 61.8 65.4 6 0.409 Putative PTS mannose-specific enzyme 71.5 IIBCA component McpB BG10859 5.1 71.7 78.2 2 20.274 Methyl-accepting chemotaxis protein MleN BG11763 9.5 50.0 31.9 11 0.970 Malate-H1/Na1-lactate antiporter 34.9 38.1 MreCb) BG10327 6.6 32.0 38.1 1 20.461 Cell-shape-determining protein MtlA BG11215 9.3 65.3 45.6 5 0.184 PTS mannitol-specific enzyme IICBA component NagP BG12941 4.6 48.4 45.6 6 0.641 Putative PTS N-acetylglucosamine- specific enzyme IICB component NupC BG10984 5.7 42.4 34.9 8 0.916 Pyrimidine-nucleoside transport protein Obga) BG10337 9.5 47.5 41.7 0 20.434 GTP-binding protein involved in initiation of sporulation (Spo0A activation) OppAa) c) BG10771 5.0 61.3 65.4 1 20.660 Oligopeptide ABC transporter (binding protein) OpuACc) BG11372 6.3 32.1 31.9 1 20.340 Glycine betaine ABC transporter (glycine betaine-binding protein)

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 64 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2873

Table 2. Continued

Protein Accession pI Theo- Ob- MSDs GRAVY Function and homology name number retical served Mr (kDa) Mr (kDa)

PbpA BG11678 5.2 80.0 85.6 1 20.615 Penicillin-binding protein 2A (spore outgrowth) PbpCc) BG11234 6.2 74.2 71.5 1 20.624 Penicillin-binding protein 3 78.2 PbpDb) BG10977 9.3 70.4 71.5 1 20.438 Penicillin-binding protein 4 PbpXd) BG12642 6.4 43.7 45.6 1 20.534 Penicillin-binding protein PbuG BG12811 9.1 46.0 29.1 12 1.125 Hypoxanthine/guanine permease PonA BG10954 6.2 99.4 93.6 1 20.809 Penicillin-binding proteins 1A/1B 102.4 PrsAc) BG10464 5.0 32.4 29.1 1 20.822 Protein secretion (post-translocation 31.9 molecular chaperone) PspAa) BG12797 5.8 25.0 29.1 0 20.646 Phage shock protein A homolog 31.9 PtsG BG10198 9.4 75.3 49.9 7 0.380 PTS glucose-specific enzyme IICBA 71.5 component 78.2 PyrP BG10992 4.8 45.4 31.9 9 0.859 Uracil permease 34.9 QoxAc) BG10583 4.4 36.1 34.9 3 20.115 Cytochrome aa3 quinol oxidase 45.6 (subunit II) QoxB BG10584 5.2 73.7 49.9 12 0.560 Cytochrome aa3 quinol oxidase 54.6 (subunit I) RbsAa) BG10879 10.1 54.4 59.8 0 20.190 Ribose ABC transporter (ATP-binding protein) RbsBa) c) BG10881 5.7 32.1 34.9 1 20.147 Ribose ABC transporter (ribose-binding 38.1 protein) RbsC BG10880 6.2 33.6 24.3 7 0.937 Ribose ABC transporter (permease) RecU BG10953 9.6 23.8 31.9 0 20.748 DNA repair, homologous recombination and chromosome segregation RpsBa) BG19004 9.5 27.8 34.9 0 20.492 Ribosomal protein S2 RpsEa) BG10442 9.9 17.5 18.6 0 20.001 Ribosomal protein S5 SdhAa) BG10352 8.9 65.2 71.5 1 20.378 Succinate dehydrogenase (flavoprotein subunit) SdhBa) BG10353 9.4 28.3 29.1 0 20.435 Succinate dehydrogenase (iron-sulfur protein) SecDF BG12672 6.6 81.5 78.2 12 0.248 Protein-export membrane protein SecY BG10445 9.9 47.1 34.9 7 0.599 Preprotein translocase subunit 38.1 54.6 SodAa) BG11676 8.0 22.4 31.9 0 20.411 Superoxide dismutase SpoIIB BG10912 9.7 35.8 34.9 1 20.723 Spatial and temporal regulation of the dissolution of septal peptidoglycan during engulfment SpoIIIJc) BG10062 5.3 29.4 20.3 4 0.297 Essential for sigma-G activity at stage III 22.2 SpsE BG10613 4.8 40.7 34.9 0 20.109 Spore coat polysaccharide synthesis

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 65 2874 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Table 2. Continued

Protein Accession pI Theo- Ob- MSDs GRAVY Function and homology name number retical served Mr (kDa) Mr (kDa)

SspA BG10786 5.0 6.9 34.9 0 20.261 Small acid-soluble spore protein (major a-type SASP) TagF BG10725 4.9 87.9 85.6 0 20.563 CDP-glycerol:polyglycerol phosphate glycero-phosphotransferase TagH BG11191 7.1 59.1 65.4 1 20.413 Teichoic acid translocation (ATP-binding protein) TreP BG11009 5.8 49.8 41.7 5 0.625 PTS trehalose-specific enzyme IIBC 45.6 component TrpC BG11038 10.2 27.7 24.3 0 20.135 Indol-3-glycerol phosphate synthase TufAa) BG11056 9.5 43.4 49.9 0 20.318 Elongation factor Tu 54.6 YabG BG10106 5.6 33.2 38.1 0 20.412 Similar to unknown proteins YacA BG10151 4.9 40.7 38.1 4 0.397 Similar to unknown proteins YacDc) BG10135 5.2 33.9 38.1 1 20.599 Similar to protein secretion PrsA 41.7 homolog YbeC BG12730 7.9 59.0 41.7 11 0.660 Similar to amino acid transporter YbfG BG12736 9.7 79.0 71.5 2 20.139 Similar to unknown proteins YcbN BG11169 5.4 31.5 29.1 0 20.145 Similar to ABC transporter (ATP-binding protein) YckBc) BG11178 8.8 31.6 31.9 1 20.378 Similar to amino acid ABC transporter (binding protein) YckI BG11185 8.6 27.6 31.9 0 20.212 Similar to glutamine ABC transporter (ATP-binding protein) YckKc) BG11187 6.7 29.3 29.1 1 20.561 Similar to glutamine ABC transporter 26.6 (glutamine-binding protein) YclQa) BG12037 8.5 34.6 38.1 1 20.344 Similar to ferrichrome ABC transporter 41.7 (binding protein) YdbM BG12080 6.3 42.0 34.9 0 20.341 Similar to butyryl-CoA dehydrogenase YdbT BG12087 7.3 56.7 49.9 5 0.138 Similar to unknown proteins YdcQ BG12104 6.5 54.6 54.6 2 20.079 Similar to transposon protein YdjIa) BG12800 7.2 35.9 146.7 0 20.337 Similar to unknown proteins YebC BG12812 6.4 30.5 26.6 5 0.009 Function unknown YerHc) BG12836 10.2 44.4 54.6 1 20.585 Similar to unknown proteins YerP BG12842 5.1 114.8 93.6 11 0.033 Similar to acriflavin resistance protein 112.1 YetK BG12867 7.2 35.6 41.7 8 0.999 Similar to unknown proteins from B. subtilis YfiYa) c) BG12901 9.3 36.1 38.1 1 20.413 Similar to iron(III) dicitrate transport 41.7 permease YfmCc) BG12954 8.4 34.9 31.9 1 20.475 Similar to ferrichrome ABC transporter (binding protein) YfnI BG12980 9.5 73.1 71.5 5 20.292 Similar to anion-binding protein YhaP BG12992 6.3 45.3 41.7 7 0.543 Similar to unknown proteins YhaRc) BG12994 5.2 27.5 34.9 1 0.107 Similar to enoyl CoA hydratase

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 66 Proteomics 2004, 4, 2849–2876 Proteome reference map of growing Bacillus subtilis cells 2875

Table 2. Continued

Protein Accession pI Theo- Ob- MSDs GRAVY Function and homology name number retical served Mr (kDa) Mr (kDa)

YhcH BG11586 9.2 34.3 38.1 0 20.188 Similar to ABC transporter (ATP-binding protein) YhdP BG13022 5.0 49.7 59.8 2 0.209 Similar to hemolysin YheB BG13034 9.9 42.7 38.1 2 20.046 Similar to unknown proteins YheI BG13041 5.0 64.9 65.4 3 0.122 Similar to ABC transporter (ATP-binding protein) YhfQc) BG13061 7.8 38.4 34.9 2 20.392 Similar to iron(III) dicitrate-binding protein YhgE BG10433 4.8 83.9 78.2 6 20.181 Similar to phage infection protein YjeA BG13184 9.6 53.7 59.8 1 20.600 Similar to chitooligosaccharide deacetylase YjlDa) BG13203 9.3 41.8 41.7 1 20.009 Similar to NADH dehydrogenase 45.6 YkaAa) BG13225 9.1 23.7 24.3 0 20.416 Function unknown YknW BG13243 5.0 24.0 20.3 5 0.810 Similar to unknown proteins YknXb) BG13244 4.7 41.5 54.6 1 20.622 Similar to unknown proteins from B. subtilis YknZ BG13246 9.5 42.0 49.9 4 0.291 Similar to unknown proteins YkoK BG13256 4.9 50.7 54.6 5 0.326 Similar to Mg2+ transporter YkrL BG13274 4.9 32.7 24.3 4 0.300 Similar to heat-shock protein YkuR BG13302 5.3 41.4 49.9 0 20.130 Similar to hippurate hydrolase YlbLb) BG13364 9.3 38.6 38.1 1 20.358 Similar to unknown proteins YluC BG13410 6.9 46.6 45.6 4 0.209 Similar to unknown proteins 54.6 YlxFb) BG10246 5.0 22.8 24.3 1 20.410 Similar to unknown proteins YneF BG11249 10.3 8.2 18.6 1 0.217 Similar to unknown proteins YobJ BG13502 4.7 33.6 26.6 2 20.289 Function unknown YocB BG13515 5.9 30.0 31.9 0 20.627 Function unknown YocR BG13528 5.1 48.2 31.9 10 1.033 Similar to sodium-dependent transporter c) YodJ BG13538 9.7 30.7 31.9 1 20.762 Similar to D-alanyl-D-alanine carboxypeptidase YokFc) BG13573 11.0 32.8 31.9 1 21.006 Similar to micrococcal nuclease YonSc) BG13629 4.5 22.1 24.3 1 20.279 Function unknown YorG BG13691 4.9 36.5 41.7 0 20.420 Function unknown YoxDa) BG11048 9.1 25.2 31.9 0 0.032 Similar to 3-oxoacyl- acyl-carrier protein reductase YpuAb) BG10511 10.0 31.1 31.9 1 20.098 Similar to unknown proteins 38.1 YqfA BG11651 5.7 35.5 34.9 2 0.139 Similar to unknown proteins YqiK BG11719 9.5 26.8 29.1 0 20.325 Similar to glycerophosphodiester phosphodiesterase YqiXa) BG11727 9.6 28.2 26.6 1 20.481 Similar to amino acid ABC transporter (binding protein) YqjPc) BG11745 4.9 35.6 41.7 0 20.219 Similar to unknown proteins

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 67 2876 C. Eymann et al. Proteomics 2004, 4, 2849–2876

Table 2. Continued

Protein Accession pI Theo- Ob- MSDs GRAVY Function and homology name number retical served Mr (kDa) Mr (kDa)

YqzCb) BG13769 5.3 16.9 17.3 1 20.471 Similar to unknown proteins from B. subtilis YraH BG12272 6.1 15.0 24.3 0 20.662 Similar to unknown proteins YraM BG12277 5.5 39.4 41.7 0 20.114 Similar to unknown proteins YrrLb) BG13793 5.0 40.3 41.7 1 20.418 Similar to folate metabolism YtmJc) BG13884 5.7 30.0 34.9 1 20.549 Similar to amino acid ABC transporter (binding protein) YtnA BG13891 8.3 50.2 34.9 9 0.704 Similar to proline permease YtrF BG13916 9.8 48.3 54.6 4 20.043 Similar to unknown proteins YubA BG13950 5.9 43.5 31.9 8 0.851 Similar to unknown proteins YugJa) BG12364 4.8 42.6 54.6 0 20.202 Similar to NADH-dependent butanol dehydrogenase YuiF BG13971 8.5 45.8 38.1 12 1.014 Similar to unknown proteins YusAc) BG14013 6.6 30.2 29.1 1 20.338 Similar to unknown proteins YusB BG14014 4.7 23.6 18.6 4 1.050 Similar to unknown proteins YusCa) BG14015 9.5 37.7 41.7 0 20.253 Similar to ABC transporter (ATP-binding protein) YutK BG14047 5.6 42.1 38.1 5 0.912 Similar to Na1/nucleoside cotransporter YvbJ BG14083 9.5 67.1 71.5 1 20.676 Function unknown YvcC BG12395 8.5 64.3 59.8 6 0.191 Similar to ABC transporter (ATP-binding protein) YvhJd) BG12449 5.1 43.0 54.6 1 20.673 Similar to transcriptional regulator YvpBb) BG14130 9.0 27.4 31.9 1 20.277 Function unknown YwbMc) BG10574 4.7 42.6 45.6 1 20.671 Similar to unknown proteins YwjA BG11306 6.1 64.4 41.7 4 0.107 Similar to ABC transporter (ATP-binding 59.8 protein) YwsBb) BG12530 9.6 19.0 29.1 0 20.273 Similar to unknown proteins YwtFb) BG12537 9.8 35.7 41.7 1 20.370 Similar to transcriptional regulator YxeBc) BG11878 4.9 35.1 34.9 1 20.336 Similar to ABC transporter (binding protein) YxjA BG11150 5.2 43.6 38.1 6 0.895 Similar to pyrimidine nucleoside transport YxkC BG12541 6.0 22.8 22.2 1 20.257 Function unknown 24.3 26.6 YycH BG11462 4.7 52.0 45.6 1 20.454 Similar to unknown proteins YycR BG11471 4.8 42.8 38.1 0 20.026 Similar to formaldehyde dehydrogenase a) Proteins which were also identified via the 2-DE approach b) Proteins which are probably secreted via Sec-system c) Proteins with a putative lipoprotein motive d) Proteins with a putative twin arginine motive for secretion

 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de 68

Chapter 3

Proteome signatures for stress and starvation in Bacillus subtilis

as revealed by a 2D gel image color coding approach

Le Thi Tam1, Haike Antelmann1#, Christine Eymann1, Dirk Albrecht1, Jörg Bernhardt1 and

Michael Hecker1

#corresponding author

1Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität Greifswald, F.-L.-Jahn-Str. 15, D-

17487 Greifswald, Germany

# To whom correspondence should be addressed: Tel. +49-3834-864237, Fax. +49-

3834-864202, e-mail: [email protected]

Key words: Bacillus subtilis/ proteome signatures/ stress/ starvation/ color coding

This chapter is in press in Proteomics 6.

70 Proteomics 2006, 6, 4565–4585 DOI 10.1002/pmic.200600100 4565

RESEARCH ARTICLE Proteome signatures for stress and starvation in Bacillus subtilis as revealed by a 2-D gel image color coding approach

Le Thi Tam, Haike Antelmann, Christine Eymann, Dirk Albrecht, Jörg Bernhardt and Michael Hecker

Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität Greifswald, Greifswald, Germany

In this paper we have defined proteome signatures of Bacillus subtilis in response to heat, salt, Received: February 8, 2006 peroxide, and superoxide stress as well as after starvation for ammonium, tryptophan, glucose, Revised: April 26, 2006 and phosphate using the 2-D gel-based approach. In total, 79 stress-induced and 155 starvation- Accepted: May 11, 2006 induced marker proteins were identified including 50% that are not expressed in the vegetative proteome. Fused proteome maps and a color coding approach have been used to define stress- specific regulons that are involved in specific adaptative functions (HrcA for heat, PerR and Fur for oxidative stress, RecA for peroxide, CymR and S-box for superoxide stress). In addition, starvation-specific regulons are defined that are involved in the uptake or utilization of alternative nutrient sources (TnrA, sL/BkdR for ammonium; tryptophan-activated RNA-binding attenuation protein for tryptophan; CcpA, CcpN, sL/AcoR for glucose; PhoPR for phosphate starvation). The general stress or starvation proteome signatures include the CtsR, Spx, sL/RocR, sB, sH, CodY, sF, and sE regulons. Among these, the Spx-dependent oxidase NfrA was induced by all stress conditions indicating stress-induced protein damages. Finally, a subset of sH-dependent proteins (sporulation response regulator, YvyD, YtxH, YisK, YuxI, YpiB) and the CodY-dependent aspartyl phosphatase RapA were defined as general starvation proteins that indicate the transition to stationary phase caused by starvation.

Keywords: Bacillus subtilis / Color coding / Proteome signatures / Starvation / Stress

1 Introduction nongrowing cells. The proteome of growing cells provides a stable “vegetative core proteome” with a variable portion that The proteome obtained by the high resolution 2-D protein is determined by definite growth conditions. In the vegeta- electrophoresis reflects the physiological state of a cell [1, 2]. tive proteome of Bacillus subtilis 745 proteins were identified From a physiological point of view there are two main pro- using the 2-D gel-based approach. These include more than teomes in microorganisms – the proteomes of growing and 40% of the predicted vegetative proteomes in the standard pH range 4–7 and most of the proteins involved in the central metabolic pathways [3]. Gel-free proteome approaches Correspondence: Dr. Haike Antelmann, Institut für Mikrobiologie, such as 2-D-LC and MS/MS (2-D LC-MS/MS) resulted in the Ernst-Moritz-Arndt-Universität Greifswald, F.-L.-Jahn-Str. 15, D- identification of 814 proteins in the vegetative proteome of 17487 Greifswald, Germany B. subtilis including 473 new proteins not detected using the E-mail: [email protected] 2-D gel-based approach [4]. Fax: 149-3834-864202 In contrast, “proteome signatures” reflect changes of the proteome in response to physiological changes of B. subtilis, Abbreviations: AcsA, acetyl-CoA synthetase; BMM, Belitsky minimal medium; Spo0A, sporulation response regulator; TRAP, such as after exposure to different stress or starvation condi- tryptophan-activated RNA-binding attenuation protein tions [1, 2]. Proteome signatures include all specifically and

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 71 4566 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 generally induced marker proteins that are representative for one stress or starvation condition. Specific marker proteins are induced by one specific stimulus only whereas general marker proteins are induced by multiple stimuli. These proteome signatures are useful for the prediction of the physiological state of the cell. In several studies proteome signatures were established in B. subtilis for heat, cold, salt, oxidative, and disulfide stress as well as in response to glucose, phosphate, and amino acid starvation [5–12]. Proteome signatures include for example the PerR-dependent oxidative stress-specific proteins KatA, AhpC, and AhpF [12]; the Spx- dependent proteins NfrA, TrxA, and Tpx for disulfide stress [11]; the HrcA-dependent chaperones DnaK and GroEL for heat shock [2]; the carbon catabolite-controlled proteins MalA and AcoB for glucose starvation [6]; and the PhoPR-dependent proteins PstS and TuaD for phosphate starvation [5, 7]. In addition, proteome signatures were defined in response to different antibiotics which are useful to predict the mode of action and the target of new antibiotics or antimicrobial substances [13, 14]. In this paper, we have complemented the vegetative proteome map of B. subtilis by the proteome map of B. subtilis in response to stress and starvation using the 2-D gel- based approach. For that purpose we have analyzed the cytoplasmic proteome of 35S-methionine-labeled B. subtilis cells in response to heat, salt, hydrogen peroxide, and paraquat stress as well as after ammonium, tryptophan, glucose and phosphate starvation. The resulting proteome maps of B. subtilis after stress and starvation comprises 201 marker proteins identified in the standard pH range 4–7 that include 83 stress- and starvation-specific marker proteins which are absent in the vegetative proteome map and 118 proteins which exhibit a basal expression level in growing cells [3]. The 2-D gel images from different time points of all stress or starvation experiments were combined by an Figure 1. (a) Growth curves of B. subtilis 168 in response to heat, salt, hydrogen peroxide, and paraquat stress. B. subtilis was image fusion approach in a stress-or starvation-fused pro- grown in minimal medium to an OD500 of 0.4, and labeled before teome map reflecting specific and general proteome sig- and at different times after heat shock (5, 10, and 20 min) or natures. exposure to salt, hydrogen peroxide, and paraquat stress (10, 20, and 30 min) as indicated by arrows (1, 2, 3). (b) Growth curves of B. subtilis 168 in response to ammonium, tryptophan, glucose 2 Materials and methods and phosphate starvation. B. subtilis was grown under different starvation conditions and labeled during the exponential growth phase for control (co), at the transition phase (1) and 10, 30, and 2.1 Bacterial strains and culture conditions 60 min after transition to stationary phase (2, 3, and 4) as indicated by arrows. Cells of B. subtilis 168 (trpC2) [15] were cultivated under vigorous agitation at 377C in Belitsky minimal medium (BMM) as described previously [16]. The stress experiments were respectively. In each starvation experiment the stationary performed by the exposure of exponentially growing cells at phase was reached at an OD at 500 nm (OD500) of about 1 an OD500 of 0.4 to 487C (for heat shock), 6% NaCl (for salt (Fig. 1b). stress), 116 mMH2O2, or 100 mM paraquat (for oxidative stress) (Fig. 1a). Glucose starvation was provoked by cultiva- 2.2 Preparation of the cytoplasmic 35 tion in BMM without citrate (BOC) and 0.05% w/v instead of L-[ S]methionine-labeled protein fraction 0.2% glucose. For the ammonium, tryptophan, or phosphate starvation experiments, cells were grown in BMM containing Cells grown in minimal medium were pulse-labeled for 35 0.7 mM instead of 15 mM (NH4)2SO4,4mM instead of 5 min each with 10 mCi/mL of L-[ S]methionine at an OD500 80 mM tryptophan, or 0.2 mM instead of 1 mM KH2PO4, of 0.4 (for control), at different times (5, 10, 20, and 30 min)

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 72 Proteomics 2006, 6, 4565–4585 Microbiology 4567 after stress exposure or during transition phase and 10, 30, to the total spot quantity per gel. Proteins showing an induc- and 60 min after transition to stationary phase caused by tion of at least two-fold compared to the control during the 35 ammonium, tryptophan, glucose, or phosphate starvation. L-[ S]methionine pulse in any time point of the two inde- 35 L-[ S]methionine incorporation was stopped after 5 min by pendent stress or starvation experiments were designated as addition of 1 mg/mL of chloramphenicol and an excess of stress-or starvation-induced marker proteins that are listed cold L-methionine (10 mM) on ice. Two independent experi- and classified in Table, at the end of this article.. ments were performed for each stress or starvation condition. The cells were disrupted by ultrasonication, and the 2.5 Color coding soluble protein fraction was separated from the cell debris by 35 centrifugation. Incorporation of L-[ S]methionine was The fused images including either the different stress pro- measured by precipitation of aliquots of protein extracts with teome maps (for all time points after heat, salt, hydrogen 10% TCA on filter papers, as described previously [17]. peroxide, and paraquat stress) or the different starvation proteome maps (for all times during the transition to sta- 2.3 2-D PAGE tionary phase after ammonium, tryptophan, glucose and phosphate starvation) and the corresponding controls were The protein content was determined using the Bradford combined using the union fusion approach of the Delta2D 35 assay [18], and 80 mg of the L-[ S]methionine-labeled protein software to generate fused proteome maps for all stress or extract was separated by 2-D PAGE using the nonlinear IPG starvation conditions (Figs. 2, 4). The induced marker pro- in the pH range 4–7 (Amersham Biosciences) and a Multi- teins were color coded according to their expression profiles phor II apparatus (Amersham Pharmacia Biotech) as descri- by the Delta2D software as indicated in the figure legends. bed previously [17]. The gels were stained with Sypro Ruby, dried on filter paper and exposed to phosphor screens (Mo- 2.6 Protein identification by MALDI-TOF-TOF MS lecular Dynamics, Sunnyvale, California) which were read out with a Phosphor Imager SI instrument (Molecular Spot cutting from Colloidal Coomassie-stained 2-D gels, Dynamics) [17]. For identification of the proteins by MS, tryptic digestion of the proteins and spotting of the resulting nonradioactive protein samples of 200 mg were separated by peptides onto MALDI-targets (Voyager DE-STR, PerSeptive preparative 2-D PAGE. The resulting 2-D gels were fixed in Biosystems) were performed using the Ettan Spot Handling 40% v/v ethanol, 10% v/v acetic acid and stained with Col- Workstation (Amersham Biosciences, Uppsala, Sweden), loidal CBB (Amersham Biosciences). according to the standard protocol described previously [3]. The MALDI-TOF-TOF measurement of spotted peptide 2.4 Quantitative image analysis solutions was carried out on a Proteome-Analyzer 4700 (Applied Biosystems, Foster City, CA, USA) and protein iden- Quantitative image analysis was performed with the DECO- tification was performed using the MASCOT search engine DON Delta2D software (http://www.decodon.com) which is (Matrix Science, London, UK) as described previously [3]. based on the dual channel image analysis technique pioneered in 1999 [17]. Using this software, the 2-D gel images from stress and starvation experiments were aligned to a 3 Results reference image (control) by using a warp transformation. To avoid incomplete groups of matching spots a fused 2-D gel 3.1 Fused proteome maps for stress and starvation was created for spot detection. For preparing such a fusion and color codes gel, all 2-D gel images from each single stress or starvation experiments were combined using the spot preserving Growing B. subtilis cells were exposed for 5–30 min to differ- “union fusion” algorithm of Delta2D [19]. Spot detection was ent stress conditions (heat, salt, hydrogen peroxide, and performed in the fusion gel containing all spots present in paraquat stress) that except for heat shock result in a any gel of one stress or starvation experiment according to decreased growth rate (Fig. 1a). The different starvation the automatically suggested parameters for background responses were provoked by growing the cells with limiting subtraction, average spot size, and spot sensitivity. The amounts of ammonium, tryptophan, glucose, or phosphate, resulting spot shapes were reviewed and manually edited in respectively, that result in the transition to stationary phase at the fusion gel if necessary. This reviewed spot mask serves as an OD500 of 1.0 (Fig. 1b). Starved cells were labeled at the a spot detection consensus for all gel images of the stress or transition phase and 10–60 min after transition to stationary starvation experiment, and was applied to the individual gels phase. The fused images combining either the different to guide the spot detection and quantitation. This enables times of all particular stress proteome maps or the different spot quantitation in all gels at the same locations resulting in time points of all particular starvation proteome maps were 100% matching and in a reliable analysis of complete generated using the union fusion approach of Delta2D. All expression profiles. Normalization was performed by calcu- marker proteins induced specifically by one stimulus or lating the quantity of each single spot in percentage related generally by multiple stimuli are labeled in these fused pro-

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 73 4568 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 teome maps for stress and starvation by a defined color code codes for different stress or starvation conditions can be used of 15 different colors that indicates the induction profile. In as a tool to define stress/starvation-specific proteins induced Fig. 2 we show the fused proteome map combining four by one single stimulus or more general stress/starvation stress conditions: heat, salt, hydrogen peroxide, and paraquat proteins induced by multiple stimuli. According to their stress. In Fig. 4 we show the fused proteome map combining specific color codes, the proteins can be classified into speci- four starvation conditions: ammonium, tryptophan, phos- fically or generally induced regulons (Figs. 3, 5 and Table 1). phate, and glucose starvation. These fused images and color

Figure 2. Color-coded fused proteome map of B. subtilis exposed to heat, salt, hydrogen peroxide, and paraquat stress. The protein synthesis patterns (autoradiograms) of B. subtilis exposed to heat, salt, hydrogen peroxide, and paraquat stress were combined to generate a fused stress proteome map of B. subtilis using the union image fusion approach of the Delta2D software. The induced marker proteins were color coded according to their expression profiles. All spots induced specifically after one stress or generally also by other stresses are labeled in the fused proteome map by a defined color code that indicates the induction profile.

3.2.2 Proteome signature for salt stress (6% NaCl)

The response to salt stress provoked by the addition of 6% NaCl is reflected by the induction of 33 marker proteins of which ClpE, GspA, YocK, and YdaD are not present in the vegetative proteome map (Fig. 2, Table 1). These marker proteins can be classified according to the sB, CtsR, and Spx regulons (Fig. 3) [10, 21, 22]. Two magenta-labeled marker proteins are specifically induced by salt stress, namely the sB-dependent tellurium resistance protein (YceC) and the fatty acid biosynthesis enzyme (FabF). The general proteome signature for salt and heat stress includes the 16 above-mentioned sB-dependent marker proteins. Other sB-dependent marker proteins YdaP, YdaD, KatE, YocK, and YfhM are induced generally by salt stress, phosphate, and glucose starvation [22]. The CtsR regulon members ClpC, ClpE, and ClpP and the Spx-dependent proteins NfrA and YuaE are general marker proteins for salt and heat or oxidative stress. Finally, YurU involved in Fe-S- Figure 3. The specific and general stress regulons in B. subtilis. cluster assembly and the ABC-transporter ATP-binding pro- Commonly shared (generally induced) and unique (specifically tein YurY belong to general marker proteins for salt stress, induced) stress regulons and proteins in the proteome of B. sub- ammonium, or tryptophan starvation [10, 21, 22]. tilis exposed to heat, salt, hydrogen peroxide, and paraquat stress according to the fused stress proteome map in Fig. 2. The specific and general stress regulons are underlined, and the 3.2.3 Proteome signature for oxidative stress encoded specific or general stress proteins are listed in paren- (116 mMH2O2 and 100 mM paraquat) theses.

The exposure of cells to 116 mMH2O2 or 100 mM paraquat resulted in the induction of 28 peroxide marker proteins or 3.2 Stress proteome signatures 31 superoxide marker proteins including 14 proteins that are absent in the vegetative proteome map (Fig. 2, Table 1). 3.2.1 Proteome signature for heat shock (487C) These marker proteins can be classified into the oxidative stress regulons PerR, Fur, and Spx as well as the oxygen In total, 36 marker proteins are induced in the proteome radical specific SOS regulon and the sulfur limitation re- map after the temperature up-shift to 487C of which ClpE sponse (Fig. 3) [11, 21, 23, 24]. and GspA are not present in the vegetative proteome map Marker proteins for peroxide and superoxide stress are (Fig. 2, Table 1). The heat shock response involves mainly the the light-orange labeled oxidative stress-specific PerR-de- HrcA, sB, and CtsR regulons (Fig. 3) [20]. Since heat shock pendent proteins KatA, AhpC, AhpF, and MrgA and seven causes protein damages, such as non-native disulfide bond Fur-dependent proteins including the siderophore bacilli- formation, the Spx regulon that is required for thiol home- bactin biosynthesis enzymes (DhbA, DhbB, DhbC, and ostasis is induced [21]. DhbE), the ferrioxamine ABC-transporter binding protein The HrcA-dependent chaperones DnaK, GroEL, GroES, (YxeB), the Fe-transporter (YwbM), the thioredoxin reductase and GrpE are heat-specific marker proteins that are red- (YcgT), and three proteins belonging to Spx regulon (HemH, labeled in the fused stress proteome map (Fig. 2). Surpris- YfjR, YugJ) [21, 23]. These light-orange labeled oxidative ingly, two proteins of the sB regulon (YceD and YvaA) are stress-specific marker proteins are most strongly induced by also heat-specific marker proteins. both reactive oxygen species and involved in specific adapta- General marker proteins for heat and salt stress as well as tive functions to oxidative stress (Fig. 2). Surprisingly, three starvation for glucose and phosphate are 16 sB-dependent orange-labeled ABC-transporter binding proteins of the Fur proteins (Ctc, Dps, GsiB, GspA, GtaB, NadE, RsbW, SigB, regulon that are involved in the uptake of the siderophores SodA, YcdF, YceH, YdaG, YfkM, YhdN, YkzA, YsnF) [22]. In bacillibactin, enterobactin (FeuA), schizokinin, arthrobac- addition, the CtsR-dependent chaperones and proteases tin (YfiY), or unknown siderophores (YclQ) are specifically ClpC, ClpP, and ClpE are general marker proteins for heat induced only after peroxides [23, 24]. and salt stress. General Spx-dependent marker proteins for The orange-labeled proteins UvrB and RecA of the DNA heat and oxidative stress include NfrA, IolS, YhfK, YjbG, and damage inducible SOS regulon are induced specifically after YqiG [21]. Finally, the class IV heat shock protein HtpG is a peroxide stress (Figs. 2, 3) [25]. In contrast, four yellow- general marker protein for heat shock and phosphate starva- labeled proteins involved in sulfur assimilation (YxeK, YxeP) tion. and cysteine biosynthesis (CysK, YrhB) represent superoxide

Figure 4. Color-coded fused proteome map of B. subtilis after ammonium, tryptophan, glucose and phosphate starvation. The protein synthesis patterns (autoradiograms) of B. subtilis in response to starvation for ammonium, tryptophan, glucose, and phosphate were combined to generate a fused starvation proteome map of B. subtilis using the union image fusion approach of the Delta2D software. The induced marker proteins were color coded according to their expression profiles. All spots induced specifically after one starvation condition or generally also by other starvation conditions are labeled in the fused proteome map by a defined color code that indicates the induction profile.

specific marker proteins that are regulated by the cysteine General marker proteins for oxidative, heat or salt stress metabolism repressor CymR (YrzC). The superoxide specific belong to the Spx regulon including IolS, NfrA, Tpx, YhfK, marker proteins MetE and YitJ are involved in methionine YjbG, YqiG, and YuaE [21]. Of these the flavin mononucleo- biosynthesis and regulated by the S-box transcription anti- tide-dependent NADPH oxidase NfrA was identified as termination system (Figs. 2, 3) [11, 26]. Further superoxide global Spx-dependent protein induced by all four stress con- specific marker proteins are YbaL and YpsC. ditions.

3.3 Starvation proteome signatures The general proteome signature for ammonium and tryptophan or phosphate starvation is represented by 3.3.1 Proteome signature for ammonium starvation 11 CodY-dependent proteins including the dipeptide- and

(0.7 mM (NH4)2SO4) oligopeptide-transporters (AppD, DppA), the urease (UreC), the acetyl-CoA synthetase (AcsA), the aminohy- The ammonium starvation proteome showed 84 induced drolase (AmhX), the sugar metabolism system (YurJ, YurO, marker proteins including 31 proteins that are not present in YurP), the Spo0F,P aspartyl phosphatase (RapA), and the the vegetative proteome map (Fig. 4, Table 1). These can be proteins of unknown functions (YxbB and YxbC) [33, 34]. In classified according to the TnrA, sL/BkdR, sL/RocR, CodY, addition to AcsA, the sL/RocR-dependent arginine and orni- sB, sH, sF, and sE regulons (Fig. 5). Of major importance thine catabolic proteins (RocA, RocD, RocF), the citrate syn- are the red-labeled specific marker proteins of the TnrA and thase (CitZ), and the 3-hydroxbutyryl-CoA dehydratase (YsiB) sL/BkdR regulons, which are known to be induced by nitro- are also under CcpA-dependent glucose repression con- gen starvation and involved in the utilization of alternative sistent with their general induction in response to ammo- nitrogen sources such as proteins, peptides, purines, nium and glucose starvation [5, 35–37]. Further general branched chain amino acids, and asparagine [27–30]. marker proteins for ammonium and glucose starvation The specific proteome signature for ammonium starva- include four sB-dependent proteins (Dps, SigB, YdaE, YfhM) tion is reflected by seven red-labeled TnrA-regulated proteins [22] and six sE-dependent sporulation proteins (YuaE, KamA, including the asparaginase (AsnZ), the glutamine syntheta- PrkA, SafA, SpoIVA, YjbX) [31, 32]. se (GlnA), the uricase (PucL), the oligopeptide-transporters In addition, 11 marker proteins of the transition phase (OppA and OppD), the extracellular serine protease (Vpr), sH regulon are generally induced by ammonium and tryp- and the translocation-dependent antimicrobial spore com- tophan starvation including proteins involved in cell divi- ponent (TasA) (Figs. 4, 5 and Table 1) [28, 29]. In addition, sion (MinD), the sporulation response regulator (Spo0A), the red-labeled sL/BkdR-dependent proteins (Bcd, LpdV, and the response regulator aspartyl phosphatase (RapG), the BkdAA) represent specific marker proteins for ammonium sporulation protein (SpoVG), the sB- and sH-controlled pro- starvation that are involved in the catabolism of branched teins (YvyD and YtxH), the 5-oxo-1,2,5-tricarboxilic-3-penten chain amino acids (isoleucine and valine) (Fig. 5) [30]. Other acid decarboxylase (YisK), the sF transcription factor, and the specific marker proteins are AroD, CitB, GcvT, IspA, YqeH, proteins of unknown functions (YpiB, YuxI, and YwfC) [38– YvaB, and LiaH; the sF-dependent sporulation proteins 40]. Interestingly, a subset of six sH-dependent proteins KatX, SpoIIQ, and SpoVT; and the sE-dependent sporulation (Spo0A, YvyD, YtxH, YpiB, YisK, YuxI) and the CodY-de- proteins AsnO, SpoVR, SpoVID, YaaH, and YhbH [31, 32]. pendent RapA are induced by all four starvation conditions and these proteins are defined as general starvation proteins.

3.3.2 Proteome signature for tryptophan starvation (4 mM tryptophan)

In response to tryptophan starvation we identified 47 marker proteins including 20 proteins that are not present in the vegetative proteome map (Fig. 4, Table 1). These marker proteins can be classified according to the tryptophan-activated RNA-binding attenuation protein (TRAP), CodY, sB, sE, and sH regulons (Fig. 5). Specifically and most strongly induced are five magenta-labeled tryptophan biosynthetic enzymes TrpA, TrpB, TrpD, TrpE, and PabA (TrpG) that are regulated by the TRAP (Fig. 5) [41, 42]. Further tryptophan starvation- specific marker proteins include two CodY-dependent proteins (the dihydroxy-acid dehydratase IlvD and the ribokinase YurL), the sE-dependent sporulation protei- n(YybI), and two sH-dependent proteins (FtsA and Figure 5. The specific and general starvation regulons in B. sub- SpoVS); the homoserine dehydrogenase (Hom), the ade- tilis. Commonly shared (generally induced) and unique (specifi- nine deaminase (AdeC), and the two component system cally induced) starvation regulons and proteins in the proteome regulating extracellular enzyme synthesis, competence, of B. subtilis after ammonium, tryptophan, phosphate, and glucose starvation according to the fused starvation proteome map and motility (DegS and DegU). in Fig. 4. The specific and general starvation regulons are under- General marker proteins for tryptophan and ammonium H lined and the encoded specific or general starvation proteins are starvation belong to the CodY- and s -regulons as written in listed in parentheses. Section 3.3.1. In addition, the sB-dependent proteins GsiB

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 77 4572 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 and YdaE as well as the sE-dependent catalase KatA are gen- Eight yellow-labeled PhoPR-dependent proteins are eral marker proteins for tryptophan and other starvation specifically and most strongly induced in response to phos- conditions. phate starvation including the alkaline phosphatase (PhoB), the phosphodiesterase (PhoD), the response regulator (PhoP), the phosphate-specific ABC-transporter binding protein (PstS), the ATP binding protein of the phosphate- 3.3.3 Proteome signatures for glucose starvation transporter (PstBB/BA), the lipoprotein YdhF, and the tei- (0.05% glucose) churonic acid biosynthesis proteins TuaD and TuaH (Fig. 5) [5, 7, 45, 46]. In addition, PksC involved in polyketide syn- The glucose starvation proteome signature revealed the thesis, the putative regulator YhjL, the glucanase YhfE, the induction of 65 marker proteins of which 26 proteins are not transaldolase YwjH, the sH-dependent glycogen synthase present in the vegetative proteome map (Fig. 4, Table 1). GlgA, the sD-dependent flagellin Hag, YaaQ and the sB-de- These include the most strongly induced 22 carbon catabo- pendent proteins YdaT and YdbD can be regarded as phos- lite-controlled proteins and members of the sB, sF, and sE phate starvation-specific marker proteins [5]. regulons (Fig. 5) [6, 36, 37, 43, 44]. General CodY-dependent marker proteins for phosphate Specifically induced in response to glucose starvation are and ammonium starvation include AcsA, YxbB, YxbC, and nine orange-labeled CcpA-dependent carbon catabolite-con- RapA [33, 34]. In addition, 17 sB-dependent proteins are trolled proteins involved in utilization of alternative carbon general marker proteins for phosphate and glucose starva- sources such as aryl-b-glucosides (BglH), lichenan (LicH), tion (GsiB, GspA, GtaB, Dps, RsbW, YfkM, YsnF, Ctc, KatE, glycerol (GlpK), ribose (RbsA and RbsK), maltose (MalA, YdaG, YflT, YocK, YkzA, YfhM, YdaE) or phosphate starva- MalL, and YvdG), and glutamate (RocG). In addition, the tion and salt stress (YdaD, YdaP) [22]. Four sH-dependent orange-labeled sL/AcoR-dependent proteins for utilization of proteins are induced by phosphate and ammonium starva- acetoin (AcoA, AcoB, AcoC, and AcoL) are glucose starvation- tion (MinD, RapG, SpoVG, SigF) in addition to the six sH- specific marker proteins (Fig. 5) [6, 36, 37]. The CcpN-regu- dependent general starvation proteins (Spo0A, YisK, YpiB, lated proteins involved in gluconeogenesis including the YuxI, YvyD, and YtxH) [38–40]. The sE-dependent YjbX and glyceraldehyde-3-phosphate dehydrogenase (GapB) and the the sF-dependent RsfA are general marker proteins for phosphoenolpyruvate carboxykinase (PckA) are also specifi- phosphate, glucose, and ammonium starvation and HtpG cally induced in response to glucose starvation (Fig. 5) [44]. overlaps between heat shock and phosphate starvation. Finally, the acetate kinase (AckA), the 2-amino-3-ketobutyrate CoA ligase (Kbl), and the electron transfer flavoprotein subunits (EtfA and EtfB) were identified as glucose starva- 4 Discussion tion-specific marker proteins [6, 37]. The general proteome signature for glucose and ammo- 4.1 The proteome of B. subtilis in response to stress nium or tryptophan starvation includes six further CcpA- and starvation controlled proteins (AcsA, CitZ, RocA, RocD, RocF, and YsiB). In addition, 17 sB-dependent proteins (GsiB, GspA, Soil-dwelling bacteria, such as B. subtilis have developed a GtaB, Dps, RsbW, SigB, YfkM, YsnF, Ctc, KatE, YdaE, YdaG, very complex adaptational network to overcome changes in YflT, NadE, YfhM, YocK, YkzA) are induced in response to their environment provoked by different stress and starva- glucose and phosphate starvation as well as by heat and salt tion conditions. Based on previous genome-wide expression stress [22]. The six sH-dependent general starvation proteins profiling with mutants in the central regulatory genes (e.g., (Spo0A, YisK, YpiB, YuxI, YvyD, and YtxH) and RapA are alternative sigma factors, transcriptional activators, and general marker proteins for all starvation conditions [38–40]. repressors) the stimulons that are induced by the specific Finally, the sF-dependent RsfA and six sE-dependent spor- stress or starvation conditions are classified in their respec- ulation proteins are general marker proteins for glucose and tive regulons. However, these analyses have not only defined ammonium starvation as referred in Section 3.3.1 [31, 32]. specifically induced regulons, but also enabled the global analysis to define generally induced regulons that respond to different stimuli. The proteome analysis is a powerful tool to 3.3.4 Proteome signature for phosphate starvation visualize the panorama view of the physiological state of the

(0.2 mM KH2PO4) cell. A set of marker proteins is induced in response to changes in the environment that was defined as proteome The proteome signature in response to phosphate starvation signature indicative for specific stress or starvation condi- revealed the induction of 62 marker proteins of which 27 are tions [1, 2]. absent in the vegetative proteome map (Fig. 4, Table 1). In this study, the proteome signatures of B. subtilis for These marker proteins can be classified according to the different stress and starvation conditions could be completed phosphate starvation-specific PhoPR regulon as well as the by 45 new marker proteins not detected in the previous generally induced sB, CodY, and sH regulons (Fig. 5). separate proteome analyses for heat, salt, oxidative stress, or

Figure 6. The vegetative proteome map of B. subtilis including all newly induced marker proteins after stress and starvation The protein synthesis pattern (autoradiogram) of B. subtilis during vegetative growth conditions. All 83 red-labeled proteins are induced by stress or starvation only and not present in the vegetative proteome map.

starvation for glucose and phosphate (Figs. 6–8) [2, 5–7, 10, defined including 32 newly identified marker proteins. 12]. In total, 201 stress- or starvation-induced proteins have There are 68 new starvation proteins compared to only been identified, including 83 proteins that are absent in the 18 new stress proteins. This indicates that the starvation vegetative proteome map (Figs. 6–8). Heat, salt, and oxidative proteins are not expressed during vegetative growth condi- stress caused the induction of 79 marker proteins including tions in contrast to the stress proteins that show a basal 18 new proteins not present in the vegetative proteome map. expression level in vegetative growing cells. The total num- In response to ammonium, tryptophan, glucose, and phos- ber of 83 new proteins seems probably low since in most phate starvation 155 marker proteins are induced including cases more than 100 genes are induced in response to one 68 new proteins not detected in the vegetative proteome map stress or starvation condition at the transcriptome level. (Figs. 6–8). As novel proteome signatures for B. subtilis, the However, we have to consider that some induced marker responses to ammonium and tryptophan starvation were proteins could not be identified in coomassie-stained 2-D

Figure 7. The fused proteome map of all stress and starvation conditions of B. subtilis including all induced marker proteins. The protein synthesis patterns (autoradiograms) of B. subtilis in response to heat, salt, hydrogen peroxide, and paraquat stress as well as after starvation for ammonium, tryptophan, glucose, and phosphate were combined to generate a fused global proteome map of B. subtilis cells after stress and starvation using an image fusion approach of the Delta2D software. All 201 labeled proteins are induced by stress or starvation. Among these the 83 proteins that are not present in the vegetative proteome map are marked with red labels. Some induced proteins which were identified in previous proteome analyses but not in the present study were marked with circles.

gels since these are synthesized at increased levels after 4.2 Functional characterization of stress proteins labelling with 35S-methionine but do not accumulate in the proteome. Furthermore, the gene products for many The catalog of stress and starvation proteome signatures may induced genes that have been identified in the tran- help to define the mode of action of unknown anti- scriptome analysis escape the 2-D gel based proteome microbials, antibiotics, and xenobiotics or to analyze the approach since these are hydrophobic transmembrane pro- physiological changes and kind of limitation in complex teins or alkaline proteins. nondefined media, for example, during an industrial

Interestingly, the flavin mononucleotide-dependent NADPH oxidase NfrA is one representative of the Spx regulon that is generally induced by all analyzed stresses indicating protein damage by non-native disulfide formation in response to heat, salt and oxidative stress (Fig. 3). In Staphy- lococcus aureus NfrA has been shown to be involved in the maintainance of the thiol-disulfide balance under oxidative stress conditions [51]. Since the color coding approach identified NfrA as a broader general stress protein it will be interesting to analyze the survival of a B. subtilis nfrA mutant under different stress conditions.

4.3 Functional characterization of starvation proteins Figure 8. The 2-D gel-based proteome of B. subtilis cells. Com- monly shared and unique proteins in the vegetative proteome map of B. subtilis (Fig. 6) as well as in the fused stress and star- For the first time, a fused proteome map for ammonium, vation proteome maps (Figs. 2, 4). tryptophan, glucose and phosphate starvation was created that provided the tool to define specifically induced starvation regulons and more generally induced transition phase fermentation process [13, 14, 47, 48]. Using the novel gel- regulons (Figs. 4, 5). The induction of the TnrA- and sL/ based approach of fused proteome maps and color codes for BkdR-dependent catabolic enzymes for alternative nitrogen all stress or starvation conditions it was possible to visualize sources indicates an ammonium starvation-specific pro- for the first time all specifically and generally induced regu- teome signature (Fig. 5) [27–30]. In contrast, the induction of lons in one single image for stress (Figs. 2, 3) and starvation the TRAP-regulated tryptophan biosynthesis enzymes is the (Figs. 4, 5), respectively. For example, the heat shock sig- specific proteome signature for tryptophan starvation (Fig. 5) nature is indicated by the induction of the heat-specific [41, 42]. In response to glucose starvation several carbon cata- HrcA-dependent chaperones and the general induction of bolite-controlled marker proteins are specifically activated in the sB, CtsR, and Spx regulons (Fig. 3) [20]. The treatment the absence of glucose and repressed in the presence of glu- with hydrogen peroxide and paraquat resulted in the oxida- cose by CcpA, CcpN, and AcoR (Fig. 5) [36, 37, 44]. Finally, tive stress-specific PerR and Fur regulons as well as in the the induction of the PhoPR regulon is the specific proteome Spx regulon as general indicator for protein damages by non- signature for phosphate starvation (Fig. 5) [5, 7, 45, 46]. native disulfide bond formation (Fig. 3) [12, 21, 24]. In con- These specific starvation regulons such as TnrA, TRAP, trast, the SOS regulon induction is specific for DNA dama- CcpA, or PhoPR were shown to be specifically involved in the ges caused by peroxides only. The CymR regulon that regu- uptake and utilization of alternative nutrient sources in re- lates cysteine metabolism and the S-box regulon involved in sponse to the specific nutrient limitation. Consequently, the methionine biosynthesis were induced in response to super- specific starvation response is strongly induced during the oxides only (Fig. 3) [12, 24–26]. These specific and general transition phase and remains constant until 60 min after stress regulons are strongly expressed after 10 min of stress transition to stationary phase (Table 1). exposure and this expression proceeds until the 20–30 min The general proteome signature for different kinds of time points (Table 1). One exception is the heat shock re- nutrient limitation is mediated by the CodY, sB, and sH sponse resulting in a rapid increase of protein synthesis after transition phase regulons (Fig. 5). These general starvation 5 min which drops after 10 min. regulons are required for the adaptation of the cell to post- The specific adaptative functions of the stress-specific exponential stationary phase processes such as survival regulons (e.g., HrcA, PerR) are to confer specific resistance under nongrowing conditions, competence, or sporulation. mechanisms against the stress and thereby enable the cell The induction of the CodY regulon after ammonium and (i) to neutralize the stressor, (ii) to adapt to the specific stres- tryptophan starvation is reflective for the reduced growth rate sor, or (iii) to repair damages caused by the stressor [2]. In resulting in the drop of the GTP level and consequently contrast, the sB-dependent general stress regulon encodes CodY derepression [33, 34]. The CodY regulon encodes pro- proteins with different functions conferring a multiple, teins that allow broader adaptation to nutrient depletion nonspecific and preventive stress resistance to nongrowing including extracellular degradative enzymes, transporter B. subtilis cells in anticipation of future stress possibly proteins, catabolic enzymes, factors involved in genetic encountered during long-term stationary growth stages [2, competence, antibiotic synthesis pathways, chemotaxis 49]. Induction of the general stress response by one stress proteins, and sporulation proteins [33]. In addition, the sB affords significant cross-protection against other stresses [2]. regulon is the general proteome signature for glucose and It was further demonstrated that sB is required for growth phosphate starvation and required for the stationary phase and stationary phase survival at low temperatures [50]. survival upon starvation [2, 49].

As a novel finding, the color-coded fused proteome map Spo0A and RapA proteins as general proteome signature for for starvation defined six sH-dependent proteins YvyD, YtxH, starvation indicates that sporulation is a process with a bi- YisK, YpiB, Spo0A, YuxI and the CodY-dependent RapA as stable outcome, some cells initiate sporulation while others general starvation proteins indicating the transition phase in do not [54, 55]. It was demonstrated that the main function of response to nutrient limitation (Fig. 5). SigmaH directs the RapA is to maintain the bistable sporulation gene expres- transcription of several genes that function in the transition sion, RapA is repressed in sporulating cells and still accu- from exponential growth to stationary phase, including the mulated in nonsporulating cells [55]. The induction of the sF initiation of spore formation and genetic competence [38]. In and sE early sporulation regulons during the stationary addition, sH controls many genes that are required for gen- phase in response to nitrogen and glucose starvation reflects eral adaptation to nutrient depletion. These genes are that some cells have initiated the sporulation process since involved in transport, generation of potential nutrient they could not overcome the nutrient limitation. sources, cell wall metabolism, proteolysis and cytochrome Another interesting general starvation protein is the YvyD biogenesis [38]. It has been shown that both sB and sH con- protein that is similar to s54 modulation factors. It has been tribute to stationary phase survival under acidic and alkaline shown in E. coli that the YvyD-homologous YfiAprotein binds to conditions and this effect was independent from the simple the 30S subunits of the ribosomes, inhibits the 100S ribosome loss of sporulation ability [49]. formation and reduces translation errors [56]. The B. subtilis YtxH protein shares some similarities to plant desiccation- 4.4 Regulatory mechanisms of specific and general related proteins [39]. The functions of the sB/sH-dependent stress/starvation proteins proteins YvyD and YtxH during the starvation response in B. subtilis remains to be elucidated [39, 40]. In addition, the Since most of the proteome signatures can be explained by general starvation proteins YvyD, YtxH, Spo0A, YpiB, and RapA known regulators, we have classified the stress- and starvation- proteins are under positive stringent control [8]. Thus, it might induced proteins into specific and general regulons. The spe- be that also YuxI and YisK are controlled by RelA in addition to cific stress or starvation proteins are controlled by one single sH. It is currently unknown whether these sH-dependent regulator (e.g., HrcA, PerR, TnrA, TRAP, CcpA, or PhoP). In general starvation proteins contribute to the stationary phase contrast, general starvation proteins can be controlled by sin- survival which has been demonstrated previously for sB and sH gle general regulators (sB, sH, or CodY), by multiple general [49]. Thus, the fused starvation proteome map and color code regulators (e.g., YvyD and YtxH by sB/sH) or by overlapping approach provide important leads for future research on protein specific and general regulators (e.g., DppA and YxbB by TnrA/ functions of the novel identified general starvation proteins CodY; UreC by TnrA/CodY/sH; AcsA by CcpA/CodY; RocADF during stationary phase survival in B. subtilis. by CcpA/sL/RocR/CodY). In addition, not all sB-dependent proteins are induced generally by the known conditions for sB 4.6 Outlook activation (e.g., heat, salt stress; phosphate and glucose starvation) (Table 1, Figs. 3, 5). Surprisingly, the sB-dependent pro- In summary, this study can be regarded as one step towards teins YceD and YvaA are induced specifically after heat shock, the description of the complete cytoplasmic proteome of YceC specifically after salt stress, and YdbD and YdaT specifi- B. subtilis, which includes a physiological approach by the cally after phosphate starvation (Fig. 3). These differences in description of proteome signatures in response to stress and the induction of individual sB regulon members might be starvation. In total, 1301 cytoplasmic proteins are currently explained by additional promoters (e.g., sW for YceC), different identified in the proteome of B. subtilis during the growth promoter strength, RNA or protein stability. In addition, some and in response to stress and starvation using gel-based and sB-dependent proteins might not be detected since these gel-free proteome approaches [3, 4]. In addition, protein overlap with other proteins in the 2-D gel. quantification in response to heat shock revealed that heat shock proteins were up-regulated at similar levels using the 4.5 Functional characterization of the sH-dependent gel-based approach and the gel-free ITRAQ™ labelling tech- general starvation proteins nology [4]. Future studies will be aimed on the definition of the complete proteome of B. subtilis cells after stress and Among the general starvation proteins Spo0A and RapA starvation using gel-free proteome approaches to identify counteract in the initiation of sporulation as last resort re- and quantify those stress- and starvation-induced proteins sponse to starvation. The process of sporulation is governed that escaped the gel-based proteome approach. by a multicomponent phosphorelay that results in phosphorylation of Spo0A [52, 53]. A certain threshold level of We thank the Decodon company for support with the Decodon Spo0A,P is necessary to initiate sporulation which is deter- Delta2D software. This work was supported by a scholarship of the mined by the phosphorelay [54]. The RapA phosphatase “Ministry of Education and Training of Viet Nam” (MOET) to dephosphorylates the phosphorelay response regulator L.T.T., and grants from the Deutsche Forschungsgemeinschaft, the Spo0F,P and consequently reduces the level of Spo0A,P Bundesministerium für Bildung und Forschung, the Fonds der [52, 53]. The coincidental induction of the counteracting Chemischen Industrie, the Bildungsministerium of the country

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 82 Proteomics 2006, 6, 4565–4585 Microbiology 4577 b) (ferrioxamine uptake) (siderophore uptake) cillibactin and enterobactin uptake) protein (schizokinin, arthrobactin uptake) homolog) ATPase proteolytic subunit subunit) subunit) Paraquat Function/similarity 2 O 2 1,2 1,0 0,7 ABC-transporter binding protein 5,1 2,6 0,6 ABC-transporter binding protein (ba- 1,5 1,1 0,8 ABC transporter binding protein 2,9 0,9 1,0 3,6 7,4 6,8 Elemental Fe transport (yeast FTS3 1,7 1,4 1,0 2,1 2,1 2,4 similar to thioredoxin reductase 4,0 2,1 0,6 2,8 4,2 2,8 Bacillibactin siderophore biosynthesis 5,9 6,5 4,9 Multifunctional SOS repair regulator 4,9 4,2 2,3 11,2 11,7 18,0 Alkyl hydroperoxide reductase (small 3,1 2,6 1,2 9,3 12,0 11,2 Alkyl hydroperoxide reductase (large 13,6 1,9 1,7 12,2 12,3 9,0 ABC transporter binding protein 13,6 3,915,4 0,3 107,4 2,1 147,7 139,7 1,6 Vegetative catalase 1 6,3 5,610,4 5,6 1,7 Metalloregulation DNA-binding stress 0,923,4 8,5 13,8 6,748,0 9,7 0,6 9,3 Bacillibactin 14,2 siderophore biosynthesis 20,2 2,2 19,6 14,2 Bacillibactin 33,1 siderophore biosynthesis 27,5 Bacillibactin siderophore biosynthesis 3,2 – – Class I heat-shock protein (chaperone) 4,2 3,64,9 1,0 3,3 1,6 Heat-shock protein (activation of DnaK) Class I heat-shock protein (chaperone) 6,6 7,6 1,7 2,4 5,9 6,8 ATP-dependent Clp protease 19,1 19,1 7,8 Class I heat-shock protein (chaperone) 23,4 16,8 1,5 19,2 22,2 36,5 Class III stress response-related 343,6 56,8 5,3 1,2 15,6 21,7 ATP-dependent Clp protease-like a) B. subtilis t0 10 30 60 t0 10 30 60 t0 10 30 60 t0 10 30 60 5 10 20 10 20 30 10 202,9 30 4,7 3,5 10 2,9 20 2,0 30 2,5 4,5 5,3 E B B s s s Fur * Fur * Fur * Fur lipo lipo lipo lipo YcgT* Fur, Spx YfiY GroES HrcA YclQ MrgA PerR DhbC*DhbE* Fur DhbB* Fur FeuA Fur DnaK HrcA ClpP CtsR, YxeB RecA RecA/LexA ClpC CtsR, AhpF PerR KatA PerR, Protein synthesis ratios of marker proteins for stress and starvation in C-radA-yacK Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H YwbLMN YwbM* Fur CtsR regulon ClpE* CtsR Fur regulon DhbACEBF DhbA* Fur GroESL GroEL HrcA Stress proteome signatures HrcA regulon HrcA-grpE-dnaKJ GrpE HrcA SOS regulon PerR regulon AhpCF AhpC PerR CtsR-mcsAB-clp

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 83 4578 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 b) protein) dehydrogenase 1 synthase s-methyltransferase (ATP-binding protein) flavin reductase oxidoreductase epimerase -alanyl-aminopeptidase Oligopeptide ABC transporter (binding Similar to asparaginase Oligopeptide ABC transporter Uricase Similar to carboxypeptidase D Glutamine synthetase Paraquat Function/similarity 4,7 0,72,8 2,3 1,9 Cysteine synthetase 3,2 A Cobalamin-independent methionine 3,2 1,3 3,45,6 Similar to homocysteine 1,56,2 2,7 1,92,0 Cystathionine gamma-lyase 3,4 1,7 Peptidase, M20/M25/M40 2,2 family Similar to monooxygenase 2,4 2,5 2,7 Thioredoxin 2 O 2 2,3 0,9 0,9 3,8 2,7 3,2 Probable NADH-dependent butanol 2,6 2,9 2,3 Excinuclease ABC (subunit B) 5,0 2,6 1,1 2,0 2,0 2,0 Ferrochelatase 3,0 1,1 1,1 1,8 2,5 2,5 Dehydrogenase precursor 3,2 0,8 1,3 0,6 1,2 3,2 2,3 0,7 0,7 3,9 5,9 4,2 FMN-containing NADPH-linked nitro/ 3,5 2,0 1,3 2,3 0,9 0,7 2,8 1,6 1,7 Probable NADH-dependent flavin 5,8 7,7 1,7 3,3 4,2 3,8 Superoxide dismutase 2,7 – – 1,5 3,0 3,2 Nucleoside-diphosphate-sugar 1,1 3,1 2,8 1,6 2,6 1,1 1,1 2,0 2,4 3,1 Thiol peroxidase 3,7 5,6 12,0 8,6 7,6 3,6 6,0 7,1 –––3,0 t0 10 30 60 t0 10 30 60 t0 10 30 60 t0 10 30 60 5 10 20 10 20 30 10 20 30 10 20 30 2,7 2,7 2,9 3,3 1,4 3,7 4,0 4,24,1 5,1 26,7 18,3 1,8 1,9 6,6 Similar to N-acetyltransferase 16,6 24,1 13,3 25,0 13,4 17,7 25,9 32,3 1,0 8,1 8,5 15,6 7,6 1,3 2,9 Cephalosporin C deacetylase B , PucR s E , , CodY 9,8 10,3 32,0 29,6 0,8 1,0 1,5 3,2 1,3 1,4 48,3 2,9 1,4 0,2 5,2 6,2 6,2 Unknown s , CodY 5,9 8,0 6,8 5,8 3,2 3,6 5,7 6,5 , GlnR 2,5 2,3 3,0 3,0 B B M E , s s s s 1 1 1 1 1 2 1 TnrA TnrA lipo OppD TnrA YugJ Spx Cah TnrA CysK CymR (YrzC) MetE S-box YxeK** CymR (YrzC) YitJ S-box YjbGYpwA Spx Spx 3,3 – 4,7 4,1 – 3,5 – 2,3 2,3 1,1 1,3 2,9 3,5 3,2 Oligoendopeptidase F homolog YqiG Spx SodA Spx, YuaE Spx, Tpx Spx TrxA Spx, YfjR Spx Continued Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H TnrA regulon AsnZ (yccC) AsnZ** TnrA DppABCDE DppA** TnrA UvrBA UvrB** RecA/LexA CymR and S-box regulons YrrT-mtn-yrhABYxeIJKLMNOPQ YrhB** YxeP** CymR (YrzC) Spx CymR regulon (YrzC) HemEHYIolABCDEFGHIJNfrA-ywcH IolS HemH IolR, Spx Spx NfrA Spx 2,8 2,5 0,5 3,0 2,9 3,6 1,8 2,1 0,9 0,9 Myo-inositol catabolism PucJKLM PucL** YhfIJK YhfK Spx GlnRAOppABCDEF OppA GlnA TnrA YjbCD YjbC Spx,

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 84 Proteomics 2006, 6, 4565–4585 Microbiology 4579 b) dehydrogenase E1 genase alpha subunit) dehydrogenase E3 dehydrogenase) (TPP-dep. a subunit) (TPP-dep. b subunit) (dihydrolipoamide acetyltransferase) (dihydrolipoamide dehydrogenase) spore component (subunit B) ferase Urease (alpha subunit) Ornithine aminotransferase Arginase Branched-chain alpha-keto acid Subunit (2-oxoisovalerate dehydro- Leucine dehydrogenase Branched-chain alpha-keto acid Subunit (dihydrolipoamide Glutamate dehydrogenase (major) Acetoin dehydrogenase E1 comp. Acetoin dehydrogenase E1 comp. Acetoin dehydrogenase E2 component Acetoin dehydrogenase E3 component Translocation-dependent antimicrobial Minor extracellular serine protease Para-aminobenzoate synthase Glutamine amidotransferase Anthranilate synthase Anthranilate phosphoribosyltrans- Paraquat Function/similarity 2 O 2 3,6 3,8 2,54,9 1,2 2,5 0,9 0,7 0,8 1,1 6,7 0,8 3,9 0,4 1,7 5,3 t0 10 302,1 3,6 60 2,8 t0 2,6 10 309,3 60 21,8 12,6 t0 7,7 10 30 60 t0 10 30 60 5 10 20 10 20 30 10 20 30 10 20 30 19,4 74,9 24,9 12,2 2,2 2,2 2,6 2,9 23,7 11,6 0,6 0,3 1,3 1,4 13,0 12,4 2,1 5,9 4,9 1,1 Pyrroline-5 carboxylate dehydrogenase 10,0 6,0 1,3 0,9 H H , BkdR 9,0 12,3, 14,4 7,9 , BkdR 5,8 4,6 1,0 1,2 , CcpA, AcoR, AcoR, AcoR, AcoR 1,0 1,6 0,7 2,5 0,6 12,7 1,1 16,8 0,7 0,5 0,3 14,0 0,6 0,7 5,4 264,8 1,0 0,8 1,0 22,7 , RocR, , RocR, , RocR, L L L L L L L L s s L L L , , CodY 9,5 11,2 10,7 12,4 6,2 6,8 8,6 10,0 2,3 4,8 3,1 7,8 Similar to methyltransferase , , CodY, s s s s s s s s , PucR s s s H 1 1 1 1 CcpA CcpA CcpA BkdR s * TnrA s RocG CodY, YxbB** TnrA LpdV CodY, AcoB* CodY, AcoC* CodY, AcoL* CodY, TrpD** TRAP 11,7 11,3 10,7 8,2 BkdR, RocR, AcoR) 1 Continued asnH-yxaM Regulon ( L Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H Vpr Vpr BkdR-ptb-bcd-buk- Bcd CodY, RocDEF RocF CodY, RocDEF RocD CodY, -lpdV-bkdAA/AB/B BkdAA CodY, AcoABCL AcoA* CodY, YxbB-A.yxnB- TasA TasAs TnrA RocABC RocA CodY, TRAP regulon PabBAC PabA** TRAP, RelA 38,4 35,7 32,5 22,8 UreABC UreC TnrA s TrpEDCFBA TrpE** TRAP 25,0 22,8 31,6 31,8

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 85 4580 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 b) dehydrogenase phosphatase protein (ATP-binding protein) (ATP-binding protein) dehydratase phosphate transaminase Maltose/maltodextrin-binding protein Glyceraldehyde-3-phosphate Phosphoenolpyruvate carboxykinase Similar to multiple sugar-binding Oligopeptide ABC transporter Tryptophan synthase (beta subunit) Tryptophan synthase (alpha subunit) Similar to ribokinase Beta-glucosidase Citrate synthase II (major) Aconitate hydratase Dihydroxy-acid dehydratase Multiple sugar ABC transporter Glycerol kinase 6-Phospho-beta-glucosidase 6-Phospho-alpha-glucosidase Maltose-inducible alpha-glucosidase Ribose ABC transporter Ribokinase Similar to 3-hydroxbutyryl-CoA Similar to glutamine-fructose-6- Paraquat Function/similarity 2 O 2 0,4 1,0 9,1 Amidohydrolase 22,0 19,4 17,6 12,8 Biosynthesis of teichuronic acid 0,8 7,0 2,8 11,9 8,2 7,4 8,6 3,9 4,3 6,7 6,7 2,2 9,8 10,1 10,9 6,1 3,7 3,1 4,5 6,7 4,4 4,2 4,9 3,2 t0 10 30 60 t0 10 30 60 t0 10 30 60 t0 10 30 60 5 10 20 10 20 30 10 20 30 10 20 30 8,0 6,9 8,8 13,5 5,2 5,4 10,8 17,9 1,5 1,8 3,6 7,0 1,7 9,8 8,3 4,2 Response regulator aspartate 2,6 3,2 1,1 0,4 19,3 19,3 13,3 9,3 2,4 4,3 2,6 3,9 3,8 4,3 3,4 1,4 1,7 2,3 2,1 1,3 2 2 2 2 F E s s CcpA CcpA CcpA ** CcpA 0,9 0,9 0,4 11,3 ** CodY, TnrA lipo lipo PckA CcpN 1,2 0,5 1,1 17,2 AcsA* CodY, CcpA 5,0 6,4 9,3 5,3 1,1 4,5 13,4 21,8 1,6 3,7 5,7 5,4 Acetyl-CoA synthetase TrpB** TRAP 8,5 8,3 11,8 11,1 TrpA** TRAP 15,0 14,5 16,2 14,5 YurJ** CodY, TnrA YurL CodY, TnrA HagIlvD CodY CodY 1,6 1,9 2,6 2,8 0,7 4,1 4,0 2,1 Flagellin protein CitB CodY, CcpC, RbsK CcpA 1,3 2,5 1,4 5,2 YurO Continued Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H CcpN regulon GapB GapB* CcpN 1,0 1,1 5,0 25,6 PhoPR regulon TuaABCDEFGH TuaD* PhoPR, CodY regulon AmhXAppDFA AmhX AppD** CodY CodY, RelA, 4,2 4,2 3,7 3,4 3,4 2,6 3,8 3,8 YxbCDCcpA regulon BglPH-yxiECitZ-icd-mdh YxbCGlpFK BglH* CodY, RelA, PerR6,5 CitZ 8,9 CcpA 9,5 11,0 CcpA, Spx GlpK 3,3 4,0 CcpA, 6,9 5,4 3,4 2,8 3,4 4,0 0,9 1,8 1,6 2,9 1,5 4,0 0,9 3,6 6,7 7,8 2,4 0,9 3,8 1,5 1,1 Similar to unknown proteins RapA-phrA RapA** CodY, RelA, LicBCAHMalAMalLRbsRKDACB LicH* CcpAYsiB MalA RbsA* MalL** CcpA, CcpA CodY CcpA YsiB CcpA 0,7 0,4 1,1 5,5 1,2 54,5 0,9 19,2 1,5 3,7 7,9 1,2 57,3 15,3 3,9 5,4 6,0 24,9 0,7 0,3 2,9 0,5 3,8 6,6 YurPONML YurP CodY, TnrA YvdGHI YvdG

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 86 Proteomics 2006, 6, 4565–4585 Microbiology 4581 b) B factor s s factor of s binding protein) phosphate regulation binding protein biosynthesis protein phodiesterases (ATP-binding protein) catalase Alkaline phosphatase/phos- Phosphate ABC transporter General stress protein Alkaline phosphatase III Similar to manganese-containing Paraquat Function/similarity 2 O 2 10,7 11,0 12,3 Similar to tellurium resistance protein 2,3 – –5,0 5,6 0,82,1 2,1 3,6 1,5 4,7 1,6 2,5 5,3 6,9 Similar to glucose 1-dehydrogenase Similar to toxic anion resistance protein Similar to tellurium resistance protein 1,0 7,9 0,9 1,0x 9,3 13,2 23,4 16,3 Biosynthesis of teichuronic acid Lipoprotein x1,9 3,41,5 4,1 1,6x 4,1 7,0 0,5 0,4 13,4 4,0 2,8 9,5 8,4 Oxidoreductase Similar to pyruvate oxidase Unknown 0,6 3,1 19,2 1,1 x0,5 1,10,7 9,1 0,90,8 1,7 11,8 0,5 1,5 4,70,9 7,9 4,1 2,1 1,0 4,20,6 2,7 3,5 2,4 4,1 – 1,7 x 3,4 4,2 0,9 19,4 3,7 – 1,4 15,4 1,0 19,2 8,7 2,5 11,9 22,2 1,0 0,5 36,5 7,0 1,4 5,7 5,5 1,4 2,0 6,2 2,0 4,1 1,8 1,2 0,5 2,2 13,2 13,6 1,9 12,9 1,6 3,7 6,1 0,4 4,8 4,40,8 7,5 1,0 General 4,6 stress protein 0,7 General x stress protein Glucosylation of teichoic acid 0,5 4,30,6 14,5 Anti- 4,0 3,4 18,1 1,8 2,2 2,9 9,1 x 3,4 5,8 NAD biosynthesis 2,5 3,2 Catalase 2 3,9 5,9 2,0 5,2 9,3 2,7 11,8 18,6 20,3 General stress protein General stress protein 1,5 3,1 2,8 2,4 0,5 0,2 57,8 5,5 1,2 1,6 3,9 2,3 50,4 43,8 21,2 1,1 23,6 37,6 General stress protein t0 10 30 60 t0 10 30 60 t0 10 30 60 t0 10 30 60 5 102,4 20 1,6 10 1,7 20 3,5 30 10 20 30 10 20 30 0,61,0 3,0 1,2 2,3 5,1 0,6 7,0 1,1 1,8 1,7 2,0 2,83,8 1,9 5,3 18,6 1,2 16,19,3 9,1 9,1 9,6 0,8 8,3 7,1 1,1 8,7 10,2 3,2 5,2 1,7 8,8 6,0 0,4 1,0 3,6 1,6 8,7 14,7 1,4 4,9 1,8 2,0 3,23,1 4,5 5,4 3,7 2,5 8,6 2,7 2,0 2,5 5,0 Stress- and starvation-induced DNA 1,2 4,1 12,8 13,3 10,8 2,5 3,9 10,2 General stress Similar to epoxide hydrolase Probable spore coat polysaccharide 6,4 5,0 2,0 3,8 4,8 3,0 Similar to aldo/keto reductase , CcpA 1,9 3,2 3,8 4,4 Two-component response regulator for F E E E s s s s B B B B s s s s , , , , B B B B B B B B B B W W W W B B B B B B B B B s s s s s s s s s s s s s s s s s s s s s s s * PhoPR, * PhoPR x * PhoPR, s s * PhoPR 53,2 66,2 119,1 152,9 Phosphate ABC transporter (phosphate s s Ctc SigB YdhF GsiB YdaG TuaH** PhoPR, GspA* PstBA/BB*PhoPR x RsbW Dps GtaB KatE NadE YhdN YdaE* YdbD* PhoD YceH YfhM YceD YfkM Continued sigB-rsbX Regulon B Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H PhoB-ydhF PhoB YdaDEFG YdaD* YcdFG YcdF RsbRSTUVW- YdaP YdaP YfmA-yflT YflT PhoPR PhoP PhoPR, ó YdaTS YdaT* PstSAC/BA/BB PstS YceCDEFGH YceC

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 87 4582 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 factor -de- s F s b) modulating factor 54 s -dependent genes G placement) phatase decarboxylase initiation of sporulation sporulation resistance protein protein bacA s spoVID core pendent genes Required for septum formation during Similar to bacilysin biosynthesis Major catalase in spores Required for completion of engulfment Positive and negative regulator of Asparagine synthetase lysine 2,3-aminomutase serine protein kinase Morphogenetic protein associated with Required for dehydratation of the spore Paraquat Function/similarity 2 O 2 5,1 4,4 2,6 Similar to oxidoreductase 2,2 3,1 5,3 6,4 Starch (bacterial glycogen) synthase 0,3 1,6 22,1 2,10,5 x 1,3 12,6 1,80,4 x 2,6 15,3 7,4 2,2 1,7 1,5 8,5 0,6 27,4 15,4 22,3 12,2 3,7 30,7 50,1 6,5 4,8 9,7 31,6 11,6 17,6 19,4 Similar to organic hydroperoxide Unknown Similar to general stress protein 0,8 17,1 24,1 16,6 t0 10 30 60 t0 10 30 60 t0 10 30 605,9 t0 8,0 10 6,8 306,5 5,8 5,2 60 3,2 5,3 3,6 5 6,6 5,7 10 3,7 6,5 20 4,23,0 8,7 10 4,5 10,9 20 9,9 30 10,8 10 203,5 30 2,8 1,0 10 1,4 2,9 0,7 20 3,0 4,7 2,15,5 30 5,3 4,8 8,7 4,9 0,8 4,5 7,9 4,3 2,2 3,3 4,4 4,9 2,3 0,7 6,44,8 3,1 1,2 7,4 2,9 0,5 4,6 6,4 2,6 17,3 3,0 5,6 2,7 1,8 6,2 0,7 1,8 4,2 6,0–––2,6 2,9 1,8 4,13,0 5,6 2,5 2,7 4,5 1,1 3,2 9,9 1,5 10,80,5 2,0 2,8 3,9coo 17,6 2,1 11,6 2,6 1,8 1,2coo 6,1 8,6 6,8coo 0,8 2,21,0 2,3 1,92,1 12,7 3,1 70,7 Cell-division 4,4 inhibitor 0,5 (septum 12,0 53,4 3,0 6,2 Response regulator aspartate phos- 6,0 Sporulation forespore-specific 1,0 Similar to general stress protein 2,8 5-Oxo-1,2,5-tricarboxilic-3-penten 0,8 acid 0,9 1,9 4,4 6,6 5,7 1,6 10,3 31,6 7,4 Regulator of transcription of 27,9 25,2 21,146,6 28,5 13,0 2,3 3,2 2,1 2,5 76,0 2,7 62,7 2,8 50,5 36,2 0,8 0,6 0,5 5,5 2,7 30,5 3,1 2,7 2,1 8,1 16,5 22,2 52,0 21,3 38,8 2,9 3,6 – – 16,8 1,1 4,0 2,2 6,5 9,0 Similar to Unknown B B s s H B s s , CcpA, RelA, CodY 6,7 6,2 4,8 7,4 4,5 6,3 4,0, RelA 3,6 3,9 2,5 10,3 4,0 8,0 3,0 3,2 0,9 2,6 1,0 6,4 0,9, RelA, Spx 12,1 2,0 13,1, 3,4 RelA, 1,7 3,1 3,0 2,9 6,5 3,0, RelA, 5,1 4,0 6,0 4,3 5,9 4,4 1,0 5,3 1,8 6,0 4,2 2,8 3,8 1,3 3,1 5,2 5,3 2,2 Two-component response regulator for Required for spore cortex synthesis Similar to unknown proteins , , B B B B H H H H H H H H H H H H H F F F F E E E E E s s s s s s s s s s s s s s s s s s s s s s s s s s KatX* AsnO** SpoVS** YvyD SpoVG Spo0A RsfA** SpoVT** PrkA SafA** YkzA YocK* YvaA KamA** YisK YsnF SpoIIQ** Continued Regulon Regulon Regulon H F E Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H FtsAZ FtsA YtxGHJ YtxH RapG-phrG RapG** YpiABF-qcrABC YpiB** GlgBCDAP GlgA** YuxI-yukJ YuxI** SpoIIAA/AB-sigF SigF** MinCD MinD ó ó YwfBCDEFG YwfC ó

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 88 Proteomics 2006, 6, 4565–4585 Microbiology 4583 b) -fructose-6-phosphate D -alanine aminotransferase D and coat assembly enzyme amidotransferase reductase degradative enzymes gradative enzymes subunit) subunit) synthase II genase / (chaperone) -alanine dehydrogenase -glutamine- Penicillin-binding protein 4 Required for spore cortex formation Involved in spore cortex synthesis Similar to cortical fragment-lytic Putative stress response protein Required for assembly of the spore coat Unknown Acetate kinase Adenine deaminase L L Shikimate 5-dehydrogenase Two-comp. sensor kinase for Homoserine dehydrogenase Major intracellular serine protease 2-Amino-3-ketobutyrate CoA ligase Dihydroxynapthoic acid synthetase Two-comp. response regulator for de- Electron transfer flavoprotein (alpha Electron transfer flavoprotein (beta Methylenetetrahydrofolate dehydro- Aminomethyltransferase Paraquat Function/similarity 2 O 2 2,6 2,1 1,5 Beta-ketoacyl-acyl carrier protein 3,3 5,1 3,9 0,5 8,4 5,9 6,6 Class III heat-shock protein 3,4 40,9 3,7 3,8 5,8 8,1 1,1 1,8 4,0 3,3 9,4 2,5 8,4 7,4 t0 10 301,2 0,8 60 19,4 128,4 t02,1 10 0,9 30 2,21,3 60 6,1 3,3 t0 26,5 104,9 100,9 1,1 300,8 3,8 0,7 60 0,7 20,4 3,3 1,4 t0 0,9 10,9 10 3,2 30 60 5 10 20 10 0,9 20 2,7 30 2,6 5,3 10 1,3 20 1,5 30 5,8 10 3,9 20 30 Glutamic acid-rich protein 0,3 0,6 0,6 14,2 34,5 17,2 14,2 9,8 2 1 B s , TnrA , E E E E E E E s s s s s s s wall YjbX** SpoIVA YybI** YaaH** SpoVR** YhbH** IspA**Kbl* Glu- – – – 7,3 0,3 0,7 5,8 14,8 DegU DegSU 4,8 4,9 6,0 4,6 EtfA** 0,6 2,1 10,1 18,9 EtfB** 0,8 4,0 1 FabF Continued Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H SpoVID-ysxE SpoVID** Other starvation or stress induced proteins AckAAdeCAld AckA AdeC Glu- RelA Ald RelA, TnrA 3,6 5,4 5,9 3,3 1,0 0,5 3,0 4,7 AroDDat AroD Dat 3,0 3,6 19,2 3,5 36,5 3,2 4,0 3,3 2,6 2,3 3,4 2,9 1,2 3,4 3,1 1,9 Probable DegSU DegS* DegSU 7,6 5,8 6,2 5,5 HomMenBMurB HomPbpE MenB MurB PbpE 0,8 0,9 5,0 1,8 13,0 6,1 5,4 7,5 4,3 3,1 9,1 2,7 3,4 2,1 5,4 3,9 1,0 1,2 2,5 4,2 10,6 3,6 1,4 4,8 0,9 1,1 4,4 2,5 UDP-N-acetylenolpyruvoylglucosamine DhaS DhaS 2,6 1,0 7,7 7,9 0,9 2,2 2,2 6,0 0,6 2,6 7,2 7,4 Aldehyde dehydrogenase FolD FolD 0,8 0,9 1,8 13,1 5,4 4,3 2,7 5,4 1,2 3,6 1,4 4,8 HtpGGcvT-gcvPABGlmS GcvT HtpG GlmS Glu- – – 6,6 – 7,8 6,4 8,0 10,4 0,7 0,9 0,4 11,1

© 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 89 4584 L. Thi Tam et al. Proteomics 2006, 6, 4565–4585 b) n the synthesis gels were protein) dehydrogenase regulatory protein N-acetyltransferase pyrophosphatase (ATP-binding protein) (quinone) phosphate) Similar to 1-pyrroline-5-carboxylate Similar to GTP-binding protein Similar to xanthosine triphosphate Similar to butyryl-CoA dehydrogenase Similar to NAD(P)H dehydrogenase Similar to phage shock protein e indicated by * [3]. All newly secreted are indicated by “s”, cated by ** [5–8, 10–14]. he array data of previously described 30 min) and in response to starvation Paraquat Function/similarity 5,6 1,5 2,7 Similar to ATP-binding Mrp-like protein 6,2 1,9 3,4 Similar to methyltransferase genetic and physiological studies reported ) [11, 12, 21–26, 29–33, 35–38, 41, 44, 45] and the 2 E O 2 s , F s , H s 2,2 7,1 6,6 2,5 2,3 2,1 Similar to FeS cluster assembly system 5,1 4,4 2,6 Similar to 6-phosphogluconolactonase 1,8 – – 2,0 1,1 1,1 Similar to chlorite dismutase 1,6 5,0 9,5 7,3 Involve in polyketide synthesis 1,4 1,0 2,7 0,2 Unknown 1,1 2,03,7 2,9 5,5 25,6 1,3 216,7 Similar to Sensory glucanase transduction pleiotropic 2,7 4,6 1,3 0,1 Similar to transaldolase (pentose , BkdR, RocR, AcoR, TRAP, CcpA, CcpN, PhoPR, CodY, L s t0 10 30 60 t0 10 30 60 t0 10 30 60 t0 10 30 60 5 10 20 10 20 30 10 20 30 10 20 30 0) and 10, 30, and 60 min after the transition to stationary phase in one representative experiment. The proteins not detected in these experiments but t , CtsR, PerR, Fur, Spx, RecA, CymR, S-box, TnrA, B s YbaL YaaQ YhjL** YhfE YkgB YpsC** YqeH 1,0 1,6 6,1 14,8 YvcTYwjH Glu- – – – 12,2 0,7 1,5 3,3 1,7 Similar to glycerate dehydrogenase YwfI Continued operon structure is indicated. The protein synthesis ratios correspond to the induction at different times after the exposure to stress (5, 10, 20, or during the transition phase ( marked with Coo. Proteins that arelipoproteins under are marked glucose with repression according “lipo”, to andidentified previous cell proteins array that wall data are proteins absent are are in indicated indicated vegetative with by proteome “glu-” “wall”. map [36, Proteins and 37, that also are 43]. notpreviously not detected Proteins [23]. in that expressed previous in are proteome the analyses vegetative for proteome stress map and ar starvation are indi identified in previous proteome analyses or in the alkaline pH range were marked by an x. Proteins only detected in coomassie-stained 2-D gels but not i regulons (HrcA, b) The function is derived from the SubtiList database (http://genolist.fr/SubtiList/). The functions of the Fur-regulated genes are derived from Table 1. Gene or operon Protein Regulon Ammonium Tryptophan Glucose Phosphate Heat Salt H a) All marker proteins with induction factors of at least two-fold in two independently repeated proteome experiments were classified according to t PtsGHI PtsH Glu- 0,5 2,0 9,1 1,0 3,6 – – Phosphocarrier protein of the PTs (HPr PksBCDE-acpK-pksF PksC** YcgN YcgN 3,2 19,8 15,7 9,6 5,3 5,9 4,3 8,1 0,7 1,6 28,2 4,0 YjcLK YjcK**YsnA YsnA 2,6 2,9 5,9 6,0 8,0 6,8 8,1 7,5 0,7 0,4 1,1 5,5 1,2 2,1 3,4 2,3 0,7 2,9 3,8 6,6 Similar to ribosomal-protein-alanine YurUYurYYusJYvaCB YurU YurY YusJ* YvaB 4,4 8,1 11,9 8,3 3,2 5,4 1,9 2,2 2,2 1,5 3,2 1,4 3,6 1,8 28,3 29,1 5,4 35,2 2,5 30,5 0,7 3,9 40,2 78,4 2,2 2,9 3,4 Similar to ABC transporter LiaIHGFSR LiaH* LiaRS – – – 4,6 YxiE YxiE 6,2 5,6 10,9 6,6 1,1 1,9 2,3 0,5 Similar to universal stress protein

Mecklenburg-Vorpommern (EMAU 0202120), European Union [28] Wray, L. V., Jr., Ferson, A. E., Rohrer, K., Fisher, S. H., Proc. grants (LSHG-CT-2004-503468), and Genencor International Natl. Acad. Sci. USA 1996, 93, 8841–8845. (Palo Alto, California, USA) to M.H. [29] Yoshida, K., Yamaguchi, H., Kinehara, M., Ohki, Y. H. et al., Mol. Microbiol. 2003, 49, 157–165. [30] Debarbouille, M., Gardan, R., Arnaud, M., Rapoport, G., J. Bacteriol. 1999, 181, 2059–2066. 5 References [31] Eichenberger, P., Jensen, S. T., Conlon, E. M., Van Ooij, C. et al., J. Mol. Biol. 2003, 327, 945–972. [1] VanBogelen, R. A., Schiller, E. E., Thomas, J. D., Neidhardt, F. [32] Feucht, A., Evans, L., Errington, J., Microbiology 2003, 149, C., Electrophoresis 1999, 20, 2149–2159. 3023–3034. [2] Hecker, M., Völker, U., Proteomics 2004, 4, 3727–3750. [33] Molle, V., Nakaura, Y., Shivers, R. P., Yamaguchi, H. et al., J. [3] Eymann, C., Dreisbach, A., Albrecht, D., Bernhardt, J. et al., Bacteriol. 2003, 185, 1911–1922. Proteomics 2004, 4, 2849–2876. [34] Ratnayake-Lecamwasam, M., Serror, P., Wong, K. W., [4] Wolff, S., Otto, A., Albrecht, D., Stahl Zeng, J. et al., Mol. Cell. Sonenshein, A. L., Genes Dev. 2001, 15, 1093–103. Proteomics 2006 (in press). [35] Gardan, R., Rapoport, G., Debarbouille, M., Mol. Microbiol. [5] Antelmann, H., Scharf, C., Hecker, M., J. Bacteriol. 2000, 182, 1997, 24, 825–837. 4478–4490. [36] Yoshida, K., Kobayashi, K., Miwa, Y., Kang, C. M. et al., [6] Bernhardt, J., Weibezahn, J., Scharf, C., Hecker, M., Genome Nucleic Acids Res. 2001, 29, 683–692. Res. 2003, 13, 224–237. [37] Koburger, T., Weibezahn, J., Bernhardt, J., Homuth, G. et al., [7] Eymann, C., Mach, H., Harwood, C. R., Hecker, M., Micro- Mol. Genet Genomics. 2005, 274, 1–12. biology 1996, 142, 3163–3170. [38] Britton, R. A., Eichenberger, P., Gonzalez-Pastor, J. E., Faw- [8] Eymann, C., Homuth, G., Scharf, C., Hecker, M., J. Bacteriol. cett, P. et al., J. Bacteriol. 2002, 184, 4881–4890. 2002, 184, 2500–2520. [39] Varón, D., Brody, M. S., Price, C. W., Mol. Microbiol. 1996, 20, [9] Graumann, P. L., Marahiel, M. A., Arch. Microbiol. 1999, 171, 339–350. 135–138. [40] Drzewiecki, K., Eymann, C., Mittenhuber, G., Hecker, M., J. [10] Höper, D., Bernhardt, J., Hecker, M., Proteomics 2006, 6, Bacteriol. 1998, 180, 6674–6680. 1550–1562. [41] Babitzke, P., Gollnick, P., J. Bacteriol. 2001, 183, 5795–5802. [11] Leichert, L. I., Scharf, C., Hecker, M., J. Bacteriol. 2003, 185, [42] Gollnick, P., Babitzke, P., Antson, A., Yanofsky, C., Annu. Rev. 1967–1975. Genet. 2005, 39, 47–68. [12] Mostertz, J., Scharf, C., Hecker, M., Homuth, G., Micro- [43] Blencke, H. M., Homuth, G., Ludwig, H., Mäder, U. et al., biology 2004, 150, 497–512. Metab. Eng. 2003, 5, 133–149. [13] Bandow, J. E., Brötz, H., Leichert, L. I., Labischinski, H., [44] Servant, P., Le Coq, D., Aymerich, S., Mol. Microbiol. 2005, Hecker, M., Antimicrob. Agents Chemother. 2003, 47, 948– 55, 1435–1451. 955. [45] Allenby, N. E., O’Connor, N., Pragai, Z., Ward, A. C. et al., J. [14] Sender, U., Bandow, J., Engelmann, S., Lindequist, U., Bacteriol. 2005, 187, 8063–8080. Hecker, M., Pharmazie 2004, 59, 65–70. [46] Hulett, F. M., in: Sonenshein, A. L., Hoch, J. A., Losick, R. [15] Anagnostopoulos, C., Spizizen, J., J. Bacteriol. 1961, 81, (Eds.), Bacillus Subtilis and its Closest Relatives: From 741–746. Genes to Cells, ASM press, Washington DC 2002, pp. 193– 201. [16] Stülke, J., Hanschke, R., Hecker, M., J. Gen. Microbiol. 1993, 139, 2041–2045. [47] Antelmann, H., Sapolsky, R., Miller, B., Ferrari, E. et al., Pro- teomics 2004, 4, 2408–2424. [17] Bernhardt, J., Büttner, K., Scharf, C., Hecker, M., Electropho- resis 1999, 20, 2225–2240. [48] Voigt, B., Schweder, T., Becher, D., Ehrenreich, A. et al., Pro- teomics 2004, 4, 1465–90. [18] Bradford, M. M., Anal. Biochem. 1976, 72, 248–254. [49] Gaidenko, T. A., Price, C. W., J. Bacteriol. 1998, 180, 3730– [19] Luhn, S., Berth, M., Hecker, M., Bernhardt, J., Proteomics 3733. 2003, 3, 1117–1127. [50] Mendez, M. B., Orsaria, L. M., Philippe, V., Pedrido, M. E., [20] Hecker, M., Völker, U., Adv. Microb. Physiol. 2001, 44, 35–91. Grau, R. R., J. Bacteriol. 2004, 186, 989–1000. [21] Nakano, S., Kuster-Schock, E., Grossman, A. D., Zuber, P., [51] Streker, K., Freiberg, C., Labischinski, H., Hacker, J., Ohlsen, Proc. Natl. Acad. Sci. USA 2003, 100, 13603–13608. K., J. Bacteriol. 2005, 187, 2249–2256. [22] Petersohn, A., Brigulla, M., Haas, S., Hoheisel, J. D. et al., J. [52] Perego, M., Hoch, J. A., in: Sonenshein, A. L., Hoch, J. A., Bacteriol. 2001, 183, 5617–5631. Losick, R. (Eds.), Bacillus Subtilis and its Closest Relatives: [23] Ollinger, J., Song, K.-B., Antelmann, H., Hecker, M., Hel- From Genes to Cells, ASM press, Washington DC 2002, mann, J. D., J. Bacteriol. 2006, 188, 3664–3673. pp. 473–481. [24] Helmann, J. D., Wu, M. F., Gaballa, A., Kobel, P. A. et al., J. [53] Sonenshein, L., Curr. Opin. Microbiol. 2000, 3, 561–566. Bacteriol. 2003, 185, 243–253. [54] Fujita, M., Gonzalez-Pastor, J. E., Losick, R., J. Bacteriol. [25] Fernandez, S., Ayora, S., Alonso, J. C., Res. Microbiol. 2000, 2005, 187, 1357–1368. 151, 481–486. [55] Veening, J.-W., Harmon, L. W., Kuipers, O. P., Mol. Microbiol. [26] Even, S., Burguiere, P., Auger, S., Soutourina, O. et al., J. 2005, 56, 1481–1494. Bacteriol. 2006, 188, 2184–2197. [56] Ueta, M., Yoshida, H., Wada, C., Baba, T. et al., Genes Cells. [27] Fisher, S. H., Mol. Microbiol. 1999, 32, 223–232. 2005, 10, 1103–1112.

Chapter 4

Global gene expression profiling of Bacillus subtilis

in response to ammonium and tryptophan starvation

as revealed by transcriptome and proteome analysis

Le Thi Tam1, Christine Eymann1#, Haike Antelmann1, Dirk Albrecht1 and Michael Hecker1

#corresponding author

1Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität Greifswald, F.-L.-Jahn-Str. 15, D-

17487 Greifswald, Germany

# To whom correspondence should be addressed: Tel. +49-3834-864227, Fax. +49-

3834-864202, e-mail: [email protected]

Key words: Bacillus subtilis, proteome, transcriptome, ammonium starvation, tryptophan starvation

This chapter has been submitted for publication to the “Written Journal of Molecular

Microbiology and Biotechnology-Symposium on Carbon and Nitrogen Regulation in Gram- positive Bacteria”.

Abstract

In this study, the global gene expression profile of Bacillus subtilis in response to ammonium and tryptophan starvation was analyzed using transcriptomics and proteomics which gained novel insights into these starvation responses. The results demonstrate that both starvation conditions induce specific, overlapping and general starvation responses. The TnrA and GlnR regulons as well as σL-dependent bkd- and roc-operons are most strongly and specifically induced after ammonium starvation which are involved in the uptake and utilization of ammonium and alternative nitrogen sources such as amino acids (alanine, asparagine, arginine, branched chain amino acids), γ-aminobutyrate, nitrate/nitrite, uric acid/urea and oligopeptides. In addition, the induction of several carbon catabolite controlled genes (e.g. acsA, citB) as well as α-acetolactate synthase/ decarboxylase (alsSD) involved in acetoin biosynthesis and elevated transcription of aminotransferase genes are rather specific for ammonium starvation. Furthermore, the induction of σF- and σE-dependent sporulation proteins accompanied by an increased sporulation frequency during the stationary phase was observed only after ammonium starvation. The specific response to tryptophan starvation includes the TRAP-regulated tryptophan biosynthesis genes, a few RelA- dependent genes (e.g. adeC, ald) as well as spo0E. Furthermore, we recognized overlapping responses between ammonium and tryptophan starvation (e.g. dat, maeN) as well as the common induction of the CodY and σH general starvation regulons and the RelA-dependent stringent response. Many genes encoding proteins of so far unknown functions could be assigned to specifically or commonly induced genes.

Introduction

In natural ecosystems, bacteria are subjected to a variety of starvation conditions and have therefore developed a highly sophisticated network of adaptational responses to cope with these growth-restricting situations. Important strategies for the adaptation to nutrient depletion in Bacillus subtilis are the synthesis of degradative enzymes, the development of genetic competence [Sonenshein, 1989], the stringent response [Cashel et al., 1996; Chatterji and Ohja, 2001], the σB-dependent general stress response [Hecker and Völker, 1998, 2001; Price, 2002] and the sporulation process [Hoch, 1993]. Bacteria are able to monitor the availability of essential nutrients (carbon, nitrogen, phosphorus) and to transmit this information to regulatory proteins. Furthermore, bacteria preferentially utilize those carbon or nitrogen sources which can be metabolized most rapidly [Fisher and Sonenshein, 1991].

In B. subtilis glutamine is the preferred nitrogen source followed by arginine and ammonium [Hu et al., 1999; Fisher and Débarbouillé, 2002]. In contrast to enteric bacteria, B. 93 subtilis lacks an assimilatory glutamate dehydrogenase. Thus, ammonium assimilation occurs via the glutamine synthetase (GS) - glutamate synthase (GOGAT) pathway only [Dean and Aronson, 1980]. The expression of proteins involved in nitrogen metabolism is controlled by GlnR, TnrA and CodY in response to the availability of nitrogen sources [Fisher, 1999]. TnrA activates the transcription of several operons including nasA, nasBCDEF (nitrate and nitrite assimilation), gabP (γ-aminobutyrate transport), nrgAB (ammonium transport) and represses the transcription of glnRA (glutamine synthetase) and gltAB (glutamate synthase) under conditions of nitrogen limitation [Nakano et al., 1995, 1998; Ferson et al., 1996; Wray et al., 1994, 1996; Belitsky et al., 2000]. In contrast, GlnR acts as repressor of glnRA (glutamine synthetase), ureABC (urease) and tnrA in cells grown with nitrogen excess [Schreier et al., 1989; Brown and Sonenshein, 1996; Wray et al., 1997; Fisher and Débarbouillé, 2002]. The glutamine synthetase protein (GlnA) is required for the transduction of a nitrogen signal to GlnR and TnrA since glnA mutants show constitutive expression of GlnR- and TnrA-regulated genes [Schreier and Sonenshein, 1986; Wray et al., 1996]. It has been shown that the glutamine synthetase controls gene expression through a proteinprotein interaction with TnrA. Under nitrogen excess conditions the feedback-inhibited GlnA protein binds to TnrA and blocks the DNA binding activity of TnrA [Wray et al., 2001]. CodY, a third regulatory protein, represses the transcription of several genes involved in nitrogen and carbon metabolism as well as in competence, sporulation and motility during the fast growth in the presence of nutrient excess [Serror and Sonenshein, 1996; Ratnayake-Lecamwasan et al., 2001; Molle et al., 2003].

Amino acid starvation triggers the stringent response in B. subtilis – a more general response to amino acid or nitrogen starvation [Swanton and Edlin, 1972; Hecker et al., 1987, Wendrich and Marahiel, 1997; Eymann et al., 2002]. Tryptophan starvation leads to the transcriptional activation of the trp operon encoding tryptophan biosynthetic enzymes via a TRAP-, Anti-TRAP-dependent mechanism [Babitzke and Gollnick, 2001; Valbuzzi and Yanofsky, 2001; Yang and Yanofsky, 2005].

In this study, we have analyzed the global gene expression profile of B. subtilis in response to ammonium and tryptophan starvation using DNA microarray hybridization (transcriptomics) and 2D gel electrophoresis (proteomics). The results allowed the classification of starvation induced genes into ammonium or tryptophan starvation specifically induced genes, genes that are induced by both and generally starvation induced genes. Many induced genes encoding proteins of so far unknown functions could be classified and seem to be involved in coping with ammonium and/or tryptophan starvation.

Results and Discussion

1. Growth of B. subtilis 168 under ammonium and tryptophan starvation conditions.

The gene expression profile in response to ammonium and tryptophan starvation of B. subtilis wild-type was analyzed using transcriptome and proteome analyses. In the ammonium or tryptophan limited minimal medium, cells stopped growth at an OD500 of 1.0. (Fig. 1AB).

A B

10 10

1 Co 1 Co 500 500 3 4 3 4 12 OD OD 0.1 0.1

15 mM (NH4)2SO4 0.78 mM tryptophan

0.7 mM (NH4)2SO4 4 µM tryptophan 0.01 0.01 0 100 200 300 400 500 0 100 200 300 400 500 Time (min) Time (min)

Fig. 1. Growth of B. subtilis 168 under ammonium (A) and tryptophan starvation (B). B. subtilis 168 was grown in minimal medium with 15 mM and 0.7 mM (NH4)2SO4 or 0.78 mM and 4 µM tryptophan, respectively. Time points used for proteome analysis (co,1,2,3,4) and transcriptome analysis (1) are indicated by arrows. The time points co,1,2,3,4 are related to the exponential growth (co), transient phase (1) and 10, 30 and 60 minutes after transition to stationary phase (2,3,4).

Firstly, the RNA was checked for quality by Northern blots with ureC or oppA specific RNA probes for the ammonium starvation experiments and a trpB specific RNA probe for the tryptophan starvation experiments. As expected, these operons showed a strong transcriptional induction during the transition from exponential growth to stationary phase under the respective conditions (data not shown). The RNA samples taken during the growth

(OD500=0.4) and at the transition phase were used for the transcriptome experiments. The protein samples labelled during the exponential growth, at transition (1) and at 10, 30 and 60 min after the transition phase were used for the proteome analyses (Fig. 1AB)

2. Transcriptome and proteome analyses in response to ammonium and tryptophan starvation

The transcriptome analysis revealed the significant induction (≥3-fold) of 110 genes 95 and the repression (≤0.3-fold) of 47 genes after ammonium starvation. In response to tryptophan starvation, 136 genes were upregulated and 172 genes were downregulated during the transition phase (Table 1; Table 2 [supplemental material]). The accompanying proteome analysis revealed the definition of the proteome signature for ammonium starved cells including 76 induced proteins. The proteome signature in response to tryptophan starvation includes 47 induced proteins (Fig. 2AB). The expression data for upregulated genes and/or proteins are summarized in Table 1 and the results for the specific, overlapping and general responses to ammonium and tryptophan starvation are discussed below.

3. Classification of genes induced specifically in response to ammonium starvation

L 3.1 Specific induction of the TnrA, GlnR and σ (BkdR/RocR) regulons

TnrA: It has been shown that TnrA is involved in the induction of at least 25 transcriptional units under nitrogen restricted conditions. This positive control by TnrA can be a result of direct interaction with TnrA boxes or maybe indirect. Most of the positively regulated TnrA target genes might be involved in the utilization of ammonium (nrgAB), glutamine (glnQHMP) and alternate nitrogen sources, such as asparagine (asnZ), γ- aminobutyrate (gabP), nitrate and nitrite (nas), alanine (yrbD), uric acid (puc), urea (ureABC) and oligopeptides (ykfD, opp) [Wray et al., 2000; Brandenburg et al., 2002; Fisher and Débarbouillé, 2002; Yoshida et al., 2003].

In our analysis, the expression of twelve TnrA-dependent transcriptional units was found to be induced specifically by ammonium starvation since enhanced transcription of asnZ, comGC, comGG, gabP, nasA, nasBCDEF, nrgAB, tnrA, ykzB-ykoL, yrbD, ywrD and increased protein synthesis of AsnZ, PucL and TasA was only observed in ammonium but not in tryptophan starved cells. Among these the nrgAB-operon encoding an ammonium transporter and a nitrogen-regulated PII-like protein were most strongly induced [Wray et al., 1994; Detsch and Stühlke, 2003]. In contrast, the TnrA-dependent genes ureABC, oppA and cah showed significant inductions at the transcriptional and/or translational levels after both, ammonium and tryptophan starvation which indicate a more complex regulation (Table 1, TnrA-regulon, Fig. 2AB, see also 5.1).

In case of the ure-operon, the transcriptional induction was significantly higher after ammonium starvation (ureA: 25-30-fold) compared to tryptophan starvation (ureA: 4-fold) and hence more specific for ammonium starvation. This difference in expression was also reflected on the proteome level (Table 1). The transcription of the ure-operon is controlled by three different promoters which are regulated by additional factors. The significantly higher induction by ammonium starvation might be caused by the TnrA activation and GlnR 96

2A CitB SpoVID

PrkA Vpr GlmS AsnO YjbG UreC AcsA YusJ YurU KamA KatA PucL PbpE YaaH GlnA SpoIVA RocA YcgN OppA DhaS LpdV SafA AmhX SpoVR YhbH YurO Bcd RocD YjbX YurJ RapG AsnZ YxbC CitZ RapA AsnZ_F YhdN YqeH SpoIIQ YurP AppD BkdAA IolS Dat YxbB SpoIIQ SigB SigF/RsfA Cah YisK RocF FolD / MenB MinD / DppA MurB YfhM TasA YuxI

Spo0A YwfC YuxI YjbC

YvyD YsiB / YsnA YvaB YpiB SpoVT YuaE YdaE YtxH YjcK

Dps

YxiE SpoVG pI 7 4

Fig. 2. Dual-channel images of the protein synthesis patterns of B. subtilis during exponential growth (green images) and under ammonium (A) or tryptophan (B) starvation (red images). The protein synthesis pattern (autoradiograms) in response to different times of starvation (1,2,3,4 in Fig.1) were combined to generate fused proteome maps for ammonium or tryptophan starvation using the union image fusion approach of the Delta2D software. Proteins that are synthesized at increased levels (induction≥3-fold) in response to ammonium 97

AdeC YusJ UreC IlvD KatA TrpE

YcgN Hom AmhX YurO Ald FtsA RapG YurJ RapA TrpB CitZ DegS TrpD AppD YurP YxbB Dat

Cah

YisK MurB YurL YybI FolD / MenB MinD/ DppA TrpA YuxI DegU YwfC YurY

YvyD Spo0A PabA

YpiB

YdaE YjcK YtxH

GsiB

SpoVG pI 7 4

or tryptophan starvation in at least two independent experiments are indicated by white labels. Their respective induction ratios for the different time point (1,2,3,4) are listed in Table 1. Spot identification was performed using MALDI-TOF-TOF mass spectrometry from coomassie-stained 2D gels as described in the Methods section. Note, the proteins KamA, AsnO and SpoVT are induced in coomassie-stained 2D gels but could be not detected by L- [35S]methionine-labelling.

kb Nc N1 N2 N3 N4 N5 Tc T1 T2 T3 T4

6.95 _ 4.74 ~5kb (ureABC-ywnAB?) _ 3.2kb (P3 ureABC) 2.66 _ 2.4kb (P2 ureABC)/23S RNA _ 1.82 16 S RNA 1.52

1.05

P3: σA /TnrA/GlnR/CodY P2: σH / CodY/ ? ureA ureB ureC ywnA ywnB 2.4 (2.7)kb 3.2 kb ~5 kb

Fig. 3. Transcript analysis of the ureABC-operon in response to ammonium (N) and tryptophan starvation (T). For Northern blot experiments 5 µg RNA each were applied from exponentially growing cells (Nc and Tc) and ammonium or tryptophan starved cells (N1-N5 and T1-T4). N1,2,3,4,5 are related to the transient phase and 10,20,30 and 60 minutes after the transition to stationary phase caused by ammonium starvation. T1,2,3,4 are related to 20 and 10 minutes before transient point, transient point and 10 minutes after the transition to stationary phase caused by tryptophan starvation. The ladder of the RNA standard and the sizes of the different ure-transcripts are indicated. In addition, the transcriptional organization of the ure- operon is shown.

derepression of the ure P3 promoter. The TnrA activation seems to be indirect via PucR whose expression is activated by TnrA [Wray et al., 1997; Brandenburg et al., 2002]. To verify this, Northern blot hybridization with an ureA-RNA probe was performed showing a significantly induced transcript of 3.2 kb length after ammonium starvation only that probably initiates at the P3 promoter. Surprisingly, the bulk of the induced ureABC mRNA after ammonium starvation resulted from the σH-dependent P2 promoter that is controlled by CodY [Wray et al., 1997]. This promoter is exclusively used for transcription induced by tryptophan starvation (Fig. 3).

GlnR: The negatively TnrA-regulated glnRA operon was specifically induced by ammonium starvation as demonstrated by transcriptome and proteome analyses (Fig. 2A, Table 1) which is consistent with previous studies [Fisher, 1999; Jürgen et al., 2005]. An increased transcription of the gene for glutamine synthetase by low levels of ammonium was also found in Escherichia coli [Atkinson et al., 2002]. The induction of the glnRA operon is probably caused by derepression of GlnR that is inactive under nitrogen limited conditions [Brown and Sonenshein, 1996; Schreier et al., 1989]. The additional TnrA-repression of the glnRA operon might be responsible for the fine-tuning of transcription to prevent a futile high 99 induction [Wray et al., 1996]. Besides the glnRA operon, a putative aspartate aminotransferase (yurG) was specifically induced by ammonium starvation which is also under negative TnrA control [Yoshida et al., 2003]. It is unknown whether GlnR derepression or other regulators are responsible for yurG induction.

σL (BkdR/RocR): The bkd-operon involved in degradation of branched chain amino acids and the rocABC and rocDEF operons, required for the catabolism of arginine and ornithine were induced specifically by ammonium starvation at the transcriptome and proteome level. The σ54-type sigma factor σL and specific activators (BkdR, RocR) are required for the substrate-dependent induction of the bkd and roc operons in response to nitrogen starvation [Debarbouille et al., 1991, 1999; Gardan et al., 1995, 1997] (Table 1, σL [BkdR/RocR]). In contrast, the glutamate dehydrogenase encoding rocG gene that catalyses the final step in arginine degradation was not induced. It has been shown that a high activity of glutamate dehydrogenase is incompatible with activity of TnrA [Belitsky and Sonenshein, 2004]. While the degradation of branched chain amino acids was induced, its biosynthesis was repressed upon ammonium starvation as indicated by the significant repression of the ilv-leu-operon (Table 2 [supplemental material]). This repression seems to be mediated by an active TnrA protein and is therefore specific for ammonium starvation [Tojo et al., 2004].

3.2 Specific induction of carbon catabolite controlled genes

The expression of the roc-operons is also under CcpA-dependent glucose repression [Yoshida et al., 2001]. Further carbon catabolite repressed genes that were induced specifically by ammonium starvation, include the CcpA-dependent genes acsA (acetyl-CoA synthetase), citB (aconitase), dhaS (aldehyde dehydrogenase), ysiB, yvmB, yvnA, ywsA and yojL as well as the CcpA-independently glucose repressed genes glmS and iolS [Yoshida et al., 2001, Moreno et al., 2001; Blencke et al., 2003]. Interestingly, the TCA cycle enzyme CitB was specifically induced by ammonium starvation. It was shown recently that citB expression is activated in the absence of glutamine or one of both equivalent substances, glutamate or ammonium. This activation seems to depend at least partly on TnrA [Blencke et al., 2006]. The induction of carbon catabolite repressed genes by ammonium starvation might indicate a link between carbon and nitrogen metabolism (Table 1).

3.3 Specific induction of the alsSD operon

For the first time we could show that the alsSD operon as well as alsR encoding the operon specific regulator were induced specifically upon ammonium starvation. The α- acetolactate synthase AlsS condenses two molecules of pyruvate to α-acetolactate that is 100 converted to acetoin by the acetolactate decarboxylase AlsD. In B. subtilis, the acetohydroxy acid synthase (IlvBN) as well as AlsS are involved in the biosynthesis of acetolactate, a central metabolite, involved in both anabolism and catabolism. The induction of the alsSD operon in ammonium starved cells might direct the acetolactate flux towards catabolism [Goupil-Feuillerat et al., 1997; Monnet et al., 2003]. Together with the bkd and ilv-leu operons, the degradation of acetolactate to acetoin by the alsSD operon might control the concentration of branched chain amino acids in nitrogen starved cells. The mechanism for the specific transcriptional activation upon ammonium starvation is unknown as well as the fate of acetoin. It was shown previously that the alsSD operon is CcpA- and AlsR- dependently activated during the transition from growth to stationary phase in complete medium [Renna et al., 1993]. The activation by CcpA seems to be indirect via CcpA- dependent acetate production [Turinsky et al., 2000]. Furthermore, an induction by anaerobiosis that was further increased by the addition of pyruvate was observed [Ye et al., 2000]. It might be possible that the pyruvate pool is increased in ammonium starved cells caused by the degradation of certain amino acids (e.g. branched chain amino acids, cysteine and alanine).

3.4. Specific induction of sporulation genes (σF-, σE-regulons)

The proteome analysis revealed the strong induction of early sporulation proteins belonging to the prespore specific σF regulon (e.g. SpoIIQ [18-fold], SpoVT) and the mother cells specific σE regulon (e.g. AsnO, PrkA [71-fold], SafA [53-fold], SpoIVA [128-fold], YaaH [105fold]) at later time points (t3 and t4) in ammonium starved cells [Errington, 2003; Kroos and Yu, 2000].

A B 10 2 10 2

1 1 500 1 500 1 OD OD 0.1 0.1 Spore frequency (%) Spore frequency (%) Spore frequency 0.01 0 0.01 0 0123456789101112 0123456789101112 Time (hour) Time (hour)

Growth rate Spore frequency

Fig. 4. Determination of sporulation frequencies during ammonium (A) and tryptophan (B) starvation conditions. Cells of B. subtilis 168 were grown under ammonium and tryptophan starvation and the number of spores in comparison to the viable counts were determined at different time points as described in the Methods section. 101

In addition, the sporulation frequency was increased solely in ammonium starved cells after 6 hours of stationary phase (Fig. 4) indicating that ammonium starvation triggers the sporulation process to a very manifested degree.

The induction of the σE-dependent putative aminotransferase (patB) during the transition phase upon ammonium starvation might be caused by another regulator because σE is not yet active. PatB could be involved in the degradation of cysteine under nitrogen restricted conditions, since cystathione beta lyase and cysteine desulfhydrase activities were measured in vitro [Auger et al., 2005].

3.5 Specific induction of other genes in response to ammonium starvation

The alaR-T-yugI operon encoding a putative alanine transaminase (alaT) and the cypX gene encoding a cytochrome P450-like enzyme were induced specifically by ammonium starvation (Table 1). In addition, 18 genes of unknown functions were induced specifically by ammonium starvation which could perform specific functions to cope with ammonium starvation. For example, YjbC similars to N-acetyltransferases, YcbU is similar to aminotransferases, YjbG might function as oligopeptidase and YurU, YuxJ and YwoE share similarities to transporters.

4. Specific responses to tryptophan starvation

4.1 Specific induction of the TRAP regulon

The transcriptome and proteome analyses revealed the specific induction of about 60 genes in response to tryptophan starvation. These include the trp operon (trpEDCFBA), a suboperon within the aromatic supraoperon and the trpG gene (pabA), located in the unlinked folate operon. These 7 genes encode enzymes required for the biosynthesis of tryptophan from chorismic acid, the common aromatic amino acid precursor. The transcription of these genes is regulated by the trp RNA-binding attenuation protein (TRAP) in response to the accumulation of tryptophan. Starvation for tryptophan causes inactivation of TRAP which is not longer able to bind specific targets in the mRNA leader region allowing antiterminator formation and hence operon expression [Babitzke and Gollnick, 2001; Gollnick et al., 2002]. Furthermore, the TRAP-regulated yczA-ycbK-(at)-operon encoding the anti- TRAP protein (AT) and the TRAP-regulated tryptophan transporter encoded by yhaG were induced specifically by tryptophan starvation. The at-operon is also regulated by the T-box antitermination mechanism in response to changes in the charging of tRNATrp. Under tryptophan starvation conditions, low tRNATrp charging causes increased AT-protein which bind to activated TRAP, blocking TRAP’s RNA binding ability [Sarsero et al., 2000a,b; Valbuzzi and Yanofsky, 2001; Yang and Yanofsky, 2005]. In addition to the TRAP-regulated 102 genes, the hisC-tyrA-aroE-upstream region of the supraoperon involved in chorismic acid biosynthesis as well as the tryptophanyl-tRNA synthetase gene trpS represent tryptophan starvation specifically induced genes. It has been shown that the transcription of trpS is also regulated by the same T-box antitermination mechanism like the at-operon (Sarsero et al., 2001a; Valbuzzi and Yanofsky, 2001).

4.2 Specific induction of other genes in response to tryptophan starvation

The RelA-dependent genes adeC, ald, hpr and yetH, the degSU two component system for degradative enzyme production, the NADH dehydrogenase encoded by ndhF and the negative sporulation regulatory phosphatase spo0E were among the tryptophan starvation specifically induced genes (Table 1, Fig. 2B). In addition, the transcription of 25 y- genes encoding proteins of unknown function was enhanced after tryptophan starvation only including yodF and yusM that encode a putative proline permease and dehydrogenase, respectively. The proteome analysis revealed elevated protein synthesis of the putative ABC transporter ATP binding protein YurY as well as YybI (unknown) after tryptophan starvation only. It might be that these y-genes code for proteins that are necessary for the specific adaptation to tryptophan starvation.

5. Genes induced by both ammonium and tryptophan starvation

5.1 Overlapping responses that are different from CodY, RelA and σH

Ammonium starvation leads to amino acid depletion (e.g. glutamine), causing responses that are also typical for amino acid starvation. Furthermore, both conditions result in the transition to stationary phase. This might cause the common induction of genes by both ammonium and tryptophan starvation. These genes could be classified into (1) overlapping genes involved in rather specific functions and (2) more generally starvation induced genes that overlap also with other starvation conditions such as glucose or phosphate starvation. The second group includes the CodY and σH general starvation regulons as well as the RelAdependent stringent response (see 5.2).

The first group consists of twenty five genes that were induced at similar levels in response to ammonium and tryptophan starvation. These genes include the cephalosporin C deacetylase (cah, TnrA-group), the CcpA-dependent citrate synthase CitZ [Kim et al., 2002], the putative D-alanine aminotransferase dat, the maeN gene encoding a Na+/malate symporter and the two component system YufLM involved in regulation of maeN [Tanaka et al., 2003]. In addition, twelve further y-genes including the putative 1-pyrroline-5-carboxylate dehydrogenase ycgN and the ribosomal-protein-alanine N-acetyltransferase yjcK were Table1: Genes induced by ammonium (N) or tryptophan (T) starvation as revealed by transcriptome and proteome analysis Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T Genes specifically induced by ammonium starvation TnrA regulon (positive control) asnZ (yccC) asnZ 13.7/ 36.5 0.8/ 0.7 8,4,6,7 N similar to asparaginase TnrA+ comGA-B-C-D-E-F-G comGC 5.2/ 3.4 1.2/ 1.4 N exogenous DNA-binding TnrA+ comGG 7.0/ 3.1 1.4/ 1.6 N DNA transport machinery gabP gabP 8.0/ 11.1 1.8/ 1.8 N gamma-aminobutyrate permease TnrA+,CodY,RelA nasA nasA 3.4/ 4.9 1.2/ 1.4 N nitrate transporter TnrA+ nasBCDEF nasB 4.5/ 4.5 1.4/ 1.5 N assimilatory nitrate reductase (electron transfer subunit) TnrA+ nasC 13.3/ 10.0 1.8/ 1.6 N assimilatory nitrate reductase (catalytic subunit) nasD 18.0/ 15.2 1.0/ 1.1 N assimilatory nitrite reductase (subunit) nasE 11.9/ 17.4 1.0/ 1.0 N assimilatory nitrite reductase (subunit) nasF 5.3/ 9.7 1.1/ 1.4 N uroporphyrin-III C-methyltransferase nrgAB nrgA 118/ 80.3 1.1/ 1.2 N ammonium transporter TnrA+ nrgB 68.4/ 69.8 2.1/ 1.9 N nitrogen-regulated PII-like protein tnrA tnrA 328/ 11.9 1.4/ 1.6 N transcriptional regulator invoved in global nitrogen regulation TnrA+,GlnR 103 ykzB-ykoL ykzB 150/ 8.0 1.2/ 0.9 N unknown TnrA+ yrbD yrbD 3.4/ 5.9 1.0/ 1.0 N similar to sodium/proton-dependent alanine carrier protein TnrA+ ywrD ywrD 3.1/ 7.5 0.9/ 1.3 N similar to gamma-glutamyltransferase TnrA+ E pucJKLM pucL 0.8/ 1.0 0.8/ 1.0 4,5,27,18 N uricase TnrA+,σ ,PucR H tasA tasA 2.4/ 1.7 1.9/ 2.1 2,4,3,3 N translocation-dependent antimicrobial spore component TnrA+,σ ureABC-ywnA-B ureA 24.8/ 32.2 3.7/ 3.9 NT urease (gamma subunit) TnrA+,GlnR,PucR,CodY,RelA,σH ureB 30.4/ 30.0 3.9/ 4.8 NT urease (beta subunit) ureC 16.3/ 43.1 2.5/ 3.0 19,75,25,12 2,2,3,3 NT urease (alpha subunit) ywnA 2.8/ 3.4 1.2/ 1.3 N putative transcriptional regulator ykfABCD ykfA 3.2/ 4.6 2.9/ 2.3 N(T) similar to immunity to bacteriotoxins TnrA+,? ykfD 3.3/ 2.9 1.5/ 2.0 N(T) similar to oligopeptide ABC transporter (permease) oppABCDEF oppA 2.7/ 6.1 6.8/ 5.9 4,6,12,9 NT oligopeptide ABC transporter (binding protein) TnrA+,Hpr cah cah 1.0/ 1.2 1.5/ 1.7 17,24,13,25 13,18,26,32 NT cephalosporin C deacetylase TnrA+,? TnrA regulon (negative control), GlnR derepression glnRA glnR 8.6/ 3.7 0.4/ 0.5 N transcriptional repressor of the glutamine synthetase gene TnrA-,GlnR glnA 5.6/ 8.9 0.4/ 0.3 2,2,3,3 N glutamine synthetase yurG yurG 2.7/ 9.3 1.5/ 1.8 N similar to aspartate aminotransferase TnrA-,GlnR? σL (BkdR/RocR) (1) L bkdR-ptb-bcd-buk- ptb 6.7/ 17.7 1.8/ 1.5 N probable phosphate butyryltransferase CodY,TnrA-,σ ,BkdR lpdV-bkdAA-bkdAB- bcd 5.5/ 23.4 1.3/ 1.6 9,12,14,8 N leucine dehydrogenase Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T σL (BkdR/RocR) (2) -bkdB buk 2.7/ 8.3 1.2/ 1.3 N probable branched-chain fatty-acid kinase (butyrate kinase) lpdV 2.3/ 8.6 0.9/ 0.9 6,5,1,1 N probable branched-chain alpha-keto acid dehydrogenase E3 bkdAA 0.7/ 2.8 0.4/ 0.4 10,6,1,1 N branched-chain alpha-keto acid dehydrogenase E1 subunit L rocABC rocA 2.4/ 3.3 2.1/ 2.0 24,12,-,- N pyrroline-5 carboxylate dehydrogenase CodY,σ ,RocR,AhrC,CcpA L rocDEF rocD 1.3/ 1.7 1.4/ 1.2 4,4,2,- N ornithine aminotransferase CodY,σ ,RocR,AhrC,CcpA rocF 0.8/ 1.4 0.9/ 1.0 5,2,-,- N arginase Carbon catabolite control: CcpA dependent repression by glucose B acsA acsA 1.5/ 1.7 0.9/ 1.2 5,6,9,5 N acetyl-CoA synthetase CcpA,CodY,σ ysiB ysiB 0.7/ 0.9 0.9/ 0.8 -,-,-,6 N similar to 3-hydroxbutyryl-CoA dehydratase CcpA yvmB yvmB 53.4/ 7.4 0.8/ 1.1 N similar to possible transcriptional regulator CcpA yvnA yvnA 5.2/ 3.7 1.4/ 1.5 N similar to possible transcriptional regulator CcpA H yojL yojL 3.3/ 3.1 1.8/ 1.6 N similar to cell wall-binding protein CcpA,σ citZ-icd-mdh citZ 1.3/ 1.5 1.1/ 0.9 3,4,7,5 3,3,3,4 NT citrate synthase II (major) CcpA yqxI yqxI 3.0/ 4.0 2.0/ 3.1 N(T) unknown CcpA 104 CcpA independent repression by glucose glmS glmS 0.7/ 1.9 0.7/ 0.6 7,11,10,16 N L-glutamine-D-fructose-6-phosphate amidotransferase glu- iolS iolS 2.1/ 1.8 1.4/ 1.7 3,3,-,3 N myo-inositol catabolism glu-,IolR ywsA ywsA 4.3/ 4.8 1.7/ 1.5 N unknown glu- positive control by CcpA alsR alsR 5.8/ 5.8 1.4/ 1.5 N transcriptional regulator of the alpha-acetolactate operon CcpA+ alsSD alsS 12.2/ 18.3 1.7/ 1.7 N alpha-acetolactate synthase CcpA+ alsD 5.5/ 14.2 1.6/ 1.4 N alpha-acetolactate decarboxylase σF regulon rsfA rsfA 1.0/ 1.6 1.0/ 1.3 3,4,10,11SigF N probable regulator of transcription of σF-dependent genes σF F spoIIQ spoIIQ 1.4/ 2.0 1.1/ 1.2 -,3,18,12 N required for completion of engulfment σ spoVT spoVT 3.1/ 1.1 0.7/ 1.0 Coom N transcriptional regulator of σG-dependent genes σF σE regulon (1) E asnO asnO 0.8/ 1.1 1.0/ 1.3 Coom N asparagine synthetase σ E kamA kamA 0.8/ 1.3 1.1/ 1.1 Coom N lysine 2,3-aminomutase σ patB patB 7.0/ 43.0 1.0/ 1.2 N aminotransferase, cystathione beta lyase/cysteine desulfhydrase σE, ? E prkA prkA 0.8/ 1.4 0.9/ 1.2 1,2,13,71 N serine protein kinase σ E safA safA 0.7/ 0.8 0.8/ 1.4 2,4,12,53 N morphogenetic protein associated with SpoVID σ spoIVA spoIVA 0.7/ 0.4 0.6/ 0.5 -,-,19,128 N required for proper spore cortex formation and coat assembly σE E spoVR spoVR 1.1/ 1.0 1.4/ 1.4 2,1,2,6 N involved in spore cortex synthesis σ Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T σE regulon (2) E spoVID-ysxE spoVID 0.9/ 1.1 1.0/ 0.8 -,-,-,14 N required for assembly of the spore coat σ E B yaaH yaaH 0.6/ 0.5 0.5/ 0.5 1,3,26,105 N similar to cortical fragment-lytic enzyme σ , σ E yhbH yhbH 0.9/ 1.4 0.9/ 1.0 1,1,4,20 N putative stress response protein σ E yjbX yjbX 0.8/ 1.3 0.6/ 0.7 1,1,1,11 N glutamic acid-rich protein σ E yuaE yuaE 2.1/ 1.4 2.0/ 1.9 10,10,32,30 N unknown σ sporulation and competence cotG cotG 5.8/ 4.6 1.2/ 1.2 N spore coat protein cotH cotH 3.5/ 5.1 1.2/ 1.2 N spore coat protein (inner) kapB kapB 4.4/ 26.3 1.5/ 1.5 N activator of KinB in the initiation of sporulation kapD kapD 3.5/ 18.4 1.3/ 1.7 N inhibitor of the KinA pathway to sporulation kinB kinB 3.0/ 17.7 0.8/ 0.7 N sensor histidine kinase involved in the initiation of sporulation CodY pbpD pbpD 3.2/ 6.3 1.4/ 2.2 N penicillin-binding protein 4* pbpE pbpE 1.6/ 1.3 0.7/ 0.9 34,17,14,10 N penicillin-binding protein 4 others alaR-T-yugI alaR 10.9/ 14.4 0.9/ 1.5 N transcriptional regulator of the alaRT operon AlaR 105 alaT 8.1/ 9.5 1.0/ 1.3 N putative alanine transaminase yugI 3.6/ 3.9 1.1/ 1.5 N similar to polyribonucleotide nucleotidyltransferase citB citB ------2,4,3,4 N aconitate hydratase CodY,CcpA,CcpC cypX cypX 12.3/ 9.9 0.9/ 1.0 N cytochrome P450-like enzyme dhaS dhaS 2.0/ 4.2 2.1/ 2.2 3,1,8,8 N aldehyde dehydrogenase flgL flgL 3.1/ 3.7 1.4/ 1.7 N flagellar hook-associated protein 3 (HAP3) RelA unknown function (1) ycbU ycbU 2.8/ 3.0 1.9/ 1.8 N similar to putative aminotransferase B yfhM yfhM 1.4/ 1.4 1.9/ 1.0 4,5,19,16 N similar to epoxide hydrolase σ yfjA yfjA 3.1/ 3.3 2.0/ 2.6 N unknown B yhdN yhdN 1.2/ 1.1 3.5/ 1.8 3,2,2,4 N(T) similar to aldo/keto reductase σ B yjbCD yjbC 1.3/ 1.6 1.8/ 1.5 3,3,3,3 N similar to N-acetyltransferase σ yjbG yjbG 1.2/ 1.3 1.1/ 1.7 3,5,4,4 N similar to oligoendopeptidase yqeH yqeH 0.4/ 0.6 0.6/ 0.6 1,2,6,15 N similar to GTP-binding protein ysnA ysnA 0.8/ 0.9 1.1/ 0.9 -,-,-,6 N similar to xanthosine triphosphate pyrophosphatase yugE yugE 5.0/ 12.1 1.2/ 1.3 N unknown yurU yurU 0.8/ 1.1 1.1/ 1.2 4,8,12,8 N similar to ABC transporter yuxJ yuxJ 5.2/ 39.0 1.3/ 1.6 N similar to multidrug-efflux transporter yvaB yvaB ------2,2,3,4 N similar to NAD(P)H dehydrogenase (quinone) yvmC yvmC 31.3/ 18.6 0.7/ 1.0 N similar to unknown proteins yvyG yvyG 4.5/ 3.5 1.7/ 1.8 N similar to flagellar protein RelA ywmF ywmF 3.6/ 2.9 1.4/ 1.5 N similar to unknown proteins RelA Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T unknown function (2) ywoEF ywoE 4.2/ 4.2 0.9/ 1.0 N similar to permease ywqHIJKL ywqH 3.4/ 3.5 2.0/ 3.0 N(T) unknown ywqI 2.8/ 3.0 1.9/ 1.8 N similar to unknown proteins from B. subtilis ywrE ywrE 4.4/ 4.5 1.6/ 1.4 N unknown ywrK ywrK 3.4/ 4.4 1.3/ 1.2 N similar to arsenical pump membrane protein yxiE yxiE 1.6/ 1.6 1.6/ 1.7 6,6,11,7 N similar to universal stress protein Genes specifically induced by tryptophan starvation TRAP regulon pabBAC pabB 1.2/ 0.9 3.0/ 3.3 T para-aminobenzoate synthase (subunit A) pabA/trpG 1.4/ 1.1 6.9/ 10.2 38,36,32,23 T para-aminobenzoate synthase glutamine amidotransferase (subunit TRAP (subunit B) / anthranilate synthase (subunit II)

pabC 0.6/ 0.7 3.6/ 2.6 T aminodeoxychorismate lyase trpEDCFBA trpE 0.5/ 0.6 12.5/ 21.5 25,23,32,32 T anthranilate synthase TRAP trpD 0.5/ 0.6 44.9/ 50.7 12,11,11,8 T anthranilate phosphoribosyltransferase trpC 0.5/ 0.7 13.4/ 12.7 T indol-3-glycerol phosphate synthase 106 trpF 0.6/ 0.7 22.9/ 35.1 T phosphoribosyl anthranilate isomerase trpB 0.4/ 0.5 50.0/ 68.8 8,8,12,11 T tryptophan synthase (beta subunit) trpA 0.5/ 0.4 7.8/ 10.1 15,14,16,14 T tryptophan synthase (alpha subunit) yczA-ycbK yczA 0.8/ 0.6 7.5/ 9.5 T inhibitor of TRAP, regulated by T-BOX (trp) sequence RtpA TRAP

ycbK 0.9/ 0.9 14.3/ 13.2 T similar to efflux system yhaG yhaG 1.2/ 1.4 2.9/ 3.1 T transmembrane protein involved in tryptophan transport TRAP hisC-tyrA-aroE hisC/aroJ 0.4/ 0.4 5.6/ 5.3 T histidinol-phosphate aminotransferase / tyrosine and phenylalanine aminotransferase

tyrA 0.6/ 0.4 3.3/ 4.2 T prephenate dehydrogenase aroE 0.5/ 0.4 3.6/ 3.5 T 5-enolpyruvoylshikimate-3-phosphate synthase trpS trpS 1.0/ 1.5 10.9/ 16.0 T tryptophanyl-tRNA synthetase other functions (1) adeC adeC 0.9/ 1.0 3.7/ 3.2 4,5,6,3 T adenine deaminase RelA ald ald 1.2/ 1.4 1.1/ 1.3 4,4,6,8 T L-alanine dehydrogenase RelA,TnrA- ctaBCDEF ctaB 1.2/ 1.0 2.9/ 4.2 T cytochrome caa3 oxidase (assembly factor) CcpA degSU degS 1.8/ 1.5 1.8/ 1.6 8,6,6,5 T histidine kinase involved in degradative enzyme and compet. degU 1.4/ 1.3 1.6/ 1.5 5,5,6,5 T regulator involved in degradative enzyme and competence gsiB gsiB 0.8/ 0.7 9.1/ 1.9 -,3,3,2 T general stress protein SigmaB hpr hpr 1.9/ 1.2 6.3/ 4.6 T repressor of sporulation and extracellular proteases genes RelA hisJ hisJ 1.0/ 1.3 3.0/ 3.4 T histidinol phosphate phosphatase hutPHUIGM hutP 1.3/ 2.5 6.6/ 7.1 T transcriptional activator of the histidine utilization operon CodY,CcpA Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T other functions (2) liaIHGFSR liaR 2.1/ 1.0 7.6/ 8.2 T reponse regulator induced by cell wall active antibiotics liaS 2.0/ 0.9 7.9/ 10.4 T sensor histidine kinase induced by cell wall active antibiotics ndhF-ybcCDFHI ndhF 0.2/ 0.3 6.1/ 4.7 T NADH dehydrogenase (subunit 5) ybcC 0.2/ 0.1 5.2/ 3.8 T unknown ybcF 0.5/ 0.1 6.3/ 5.3 T similar to carbonic anhydrase ybcH 0.5/ 0.1 6.5/ 3.3 T similar to Probable ATPase ybcI 0.6/ 0.1 6.9/ 6.4 T similar to unknown proteins spo0E spo0E 1.7/ 1.6 3.2/ 3.2 T negative sporulation regulatory phosphatase hom hom 5.3/ 1.0 3.2/ 2.3 3,4,4,3 T(N) homoserine dehydrogenase msrA-yppQ msrA 3.2/ 2.2 3.2/ 3.4 T(N) peptidyl methionine sulfoxide reductase yppQ 2.6/ 2.5 3.1/ 3.0 T(N) similar to peptide methionine sulfoxide reductase thrC thrC 3.1/ 1.0 4.2/ 3.1 T(N) threonine synthase unknown function (1) ybgA ybgA 0.8/ 0.9 3.8/ 2.8 T similar to transcriptional regulator (GntR family) ycgB ycgB 1.1/ 1.2 3.0/ 3.2 T unknown yczJ yczJ 1.0/ 2.2 2.8/ 3.3 T similar to antibiotic biosynthesis monooxygenase 107 yetH yetH 1.3/ 1.8 4.1/ 4.8 T similar to glyoxalase/bleomycin resistance protein/dioxygenase RelA yfmI-J yfmI 1.3/ 2.2 3.3/ 3.0 T similar to macrolide-efflux transporter yhaA yhaA 2.3/ 2.8 3.9/ 3.6 T similar to aminoacylase CodY yhdX yhdX 0.9/ 1.3 2.9/ 3.6 T unknown CodY yjzD yjzD 2.0/ 1.3 2.9/ 3.3 T similar to unknown proteins ylbA ylbA 2.1/ 1.5 3.2/ 3.2 T similar to unknown proteins ylmCDEFGH ylmC 1.4/ 1.4 3.6/ 3.5 T similar to unknown proteins ylmE 1.2/ 1.4 3.1/ 3.3 T similar to unknown proteins ynfC ynfC 2.0/ 1.6 4.2/ 4.9 T unknown yocS yocS 1.3/ 0.9 6.1/ 7.6 T similar to sodium-dependent transporter yodF yodF 0.4/ 0.4 3.3/ 3.2 T similar to proline permease TnrA- H yoeA yoeA 1.7/ 1.9 2.8/ 3.5 T similar to Na+ driven multidrug efflux pump σ E yozE yozE 1.2/ 1.0 3.4/ 3.4 T unknown σ ,? ypbH ypbH 2.2/ 1.6 3.7/ 4.5 T similar to negative regulation of competence MecA homolog yrpB yrpB 1.5/ 1.5 5.6/ 5.4 T similar to 2-nitropropane dioxygenase yurY yurY 1.2/ 1.3 1.6/ 1.6 28,29,35,30 T similar to ABC transporter (ATP-binding protein) yusM yusM 1.2/ 1.4 3.4/ 5.0 T similar to proline dehydrogenase yusT yusT 1.2/ 1.9 2.9/ 3.6 T similar to transcriptional regulator (LysR family) yutG yutG 4.0/ 0.9 3.8/ 3.1 T similar to low temperature requirement C protein yweA yweA 1.4/ 4.1 3.1/ 3.5 T similar to unknown proteins yyaK yyaK 0.8/ 1.2 3.8/ 3.9 T similar to unknown proteins Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T unknown function (2) yyaO yyaO 1.3/ 1.3 3.1/ 3.0 T similar to peptidase M14, carboxypeptidase A E yybI yybI 2.3/ 1.3 1.8/ 1.7 9,3,8,7 T unknown σ B yacKLMN yacL 3.1/ 2.2 3.1/ 3.2 T(N) similar to unknown proteins σ yfhJ yfhJ 3.5/ 1.6 3.5/ 3.8 T(N) similar to catalase F yjbA yjbA 1.7/ 2.8 4.1/ 4.8 T(N) similar to unknown proteins σ ,? yolF yolF 6.4/ 1.8 3.2/ 3.4 T(N) similar to unknown proteins yqgY yqgY 3.1/ 2.0 4.1/ 4.6 T(N) similar to unknown proteins yrzI yrzI 3.2/ 1.1 5.1/ 4.6 T(N) unknown ysdB ysdB 4.1/ 2.0 3.1/ 3.3 T(N) similar to unknown proteins yuxK yuxK 2.1/ 4.2 3.7/ 4.6 T(N) similar to unknown proteins yvdT yvdT 9.2/ 2.3 5.6/ 4.7 T(N) similar to transcriptional regulator (TetR/AcrR family) General starvation induced genes CodY regulon (1) amhX amhX 1.1/ 1.9 2.4/ 2.6 4,4,4,3 3,3,4,4 NT amidohydrolase CodY appBC appB 2.9/ 6.9 5.5/ 4.7 NT oligopeptide ABC transporter (permease) CodY,Hpr 108 appC 3.0/ 7.0 5.9/ 8.2 NT oligopeptide ABC transporter (permease) appDFA appD 5.5/ 8.9 7.0/ 10.3 4,3,5,7 4,4,5,3 NT oligopeptide ABC transporter (ATP-binding protein) CodY,RelA,CcpA,Hpr appF 5.4/ 7.6 8.5/ 8.4 NT oligopeptide ABC transporter (ATP-binding protein) appA 2.1/ 4.5 4.2/ 4.8 (N)T oligopeptide ABC transporter (oligopeptide-binding protein) dppABCDE dppA 6.5/ 7.4 6.7/ 6.5 6,8,7,6MinD 3,4,6,6 NT D-alanyl-aminopeptidase CodY,TnrA+,glu- dppB 3.5/ 4.5 4.0/ 2.8 NT dipeptide ABC transporter (permease) (sporulation) dppC 3.5/ 5.7 3.3/ 3.8 NT dipeptide ABC transporter (permease) (sporulation) dppE 3.7/ 7.3 4.4/ 3.5 NT dipeptide ABC transporter (dipeptide-binding protein) (sporulation) ilvD ilvD 0.8/ 3.2 3.7/ 4.7 2,2,3,3 (N)T dihydroxy-acid dehydratase CodY rapA-phrA rapA 10.2/ 15.1 5.9/ 6.0 8,7,9,14 5,5,11,18 NT response regulator aspartate phosphatase CodY,RelA,CcpA phrA 10.9/ 12.4 5.7/ 5.7 NT phosphatase (RapA) inhibitor CodY,RelA rapC-phrC rapC 3.4/ 4.5 3.7/ 3.9 NT response regulator aspartate phosphatase CodY,RelA phrC 4.1/ 3.6 2.8/ 4.2 NT phosphatase (RapC) regulator CodY,RelA,σH,CcpA spo0A spo0A 2.1/ 1.8 2.0/ 1.8 7,6,7,6 4,2,4,3 NT regulator central for the initiation of sporulation CodY,RelA,σH ybgE ybgE 2.7/ 4.5 3.3/ 3.9 NT similar to branched-chain amino acid aminotransferase CodY ycgA ycgA 1.2/ 3.1 8.6/ 8.4 (N)T unknown; similar to putative transporter CodY yhdG yhdG 3.9/ 4.2 5.5/ 5.8 NT similar to amino acid transporter CodY,TnrA+ yufN yufN 4.9/ 17.4 7.3/ 10.3 NT similar to lipoprotein CodY,TnrA+ yufOPQ yufO 5.6/ 8.1 7.3/ 9.2 NT similar to ABC transporter (ATP-binding protein) CodY,TnrA+ yufP 5.3/ 7.8 7.6/ 7.1 NT similar to sugar ABC transporter (permease) yufQ 3.6/ 5.1 4.4/ 4.4 NT similar to sugar ABC transporter (permease) yurJ yurJ 1.1/ 1.3 0.9/ 0.8 3,3,-,- 19,19,13,9 NT similar to multiple sugar ABC transporter (ATP-binding protein) CodY,TnrA- Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T CodY regulon (2) yurPONML yurP 1.4/ 1.4 1.4/ 1.5 4,4,3,1 2,2,2,1 NT similar to glutamine-fructose-6-phosphate transaminase CodY,RelA,TnrA- yurO ------4,7,7,2 10,10,11,6 NT similar to multiple sugar-binding protein yurL 2.3/ 4.7 2.3/ 2.8 8,7,9,4 (N)T similar to ribokinase H ywfBCDEFG ywfB 2.1/ 6.8 4.2/ 4.4 (N)T similar to bacilysin biosynthesis protein bacA CodY,RelA,σ ywfC 1.5/ 4.4 3.4/ 3.5 5,3,3,3 2,2,2,3 NT similar to bacilysin biosynthesis protein bacA ywfD 1.5/ 4.9 3.0/ 3.5 (N)T similar to glucose 1-dehydrogenase yxbB-A-yxnB-asnH-yxayxbB 8.8/ 12.7 13.0/ 13.9 10,11,11,12 6,7,9,10 NT similar to methyltransferase CodY,TnrA+,glu- yxbA 7.0/ 10.2 6.2/ 7.2 NT unknown yxnB 7.7/ 5.0 5.8/ 7.9 NT unknown asnH 4.5/ 7.7 2.9/ 4.7 NT asparagine synthetase yxaM 5.9/ 8.2 2.6/ 3.1 NT similar to antibiotic resistance protein yxbCD yxbC 13.9/ 24.8 6.9/ 8.6 6,9,10,11 NT similar to unknown proteins CodY,RelA yxbD 4.9/ 6.4 3.0/ 2.8 NT similar to N-acetyltransferase RelA regulon (positive stringent response)(1) epr epr 3.2/ 1.9 3.9/ 3.3 (N)T minor extracellular serine protease RelA H spo0F spo0F 2.7/ 5.3 3.4/ 2.8 NT regulator involved in the initiation of sporulation RelA,σ 109 H spoVG spoVG 5.2/ 9.8 2.8/ 7.5 10,8,3,3 6,12,13,3 NT required for spore cortex synthesis RelA,σ vpr vpr 3.7/ 10.4 6.6/ 6.6 9,22,13,8 NT minor extracellular serine protease RelA,σH,TnrA+ ydaF ydaF 1.4/ 3.7 5.1/ 5.4 (N)T similar to acetyltransferase RelA ypiB ypiB 4.9/ 3.5 3.5/ 6.6 3,3,6,5 6,-,-,- NT similar to unknown proteins RelA,σH H ytxGHJ ytxG 2.5/ 2.4 5.5/ 3.2 (N)T similar to general stress protein RelA,σ ytxH 1.6/ 3.0 4.9/ 3.7 6,5,4,5 6,7,6,6 NT similar to general stress protein ytzE ytzE 6.8/ 3.4 9.0/ 10.1 NT similar to transcriptional regulator (DeoR family) RelA yvyD yvyD 6.0/ 4.4 8.5/ 9.1 47,13,3,2 76,63,50,36 NT similar to σ54 modulating factor of gram-negative bacteria RelA,σH,σB ywpF ywpF 4.0/ 2.1 3.7/ 3.3 (N)T similar to unknown proteins RelA σH regulon (1) H bsaA-ypgQ-ypgR bsaA 2.6/ 2.5 4.5/ 3.9 (N)T putative glutathione peroxidase σ ypgQ 2.2/ 2.3 4.7/ 4.8 (N)T similar to phosphohydrolase ypgR 1.5/ 2.2 2.9/ 4.3 (N)T similar to unknown proteins H ftsAZ ftsA 2.5/ 1.9 2.0/ 2.1 5,4,4,4 (N)T required for septum formatio during sporulation σ ,CcpA minCD minD ------6,8,7,6DppA 3,4,6,6 NT cell-division inhibitor (septum placement) σH H rapE-phrE phrE 3.2/ 4.0 2.1/ 2.8 N(T) phosphatase (RapE) regulator σ ,CcpA H rapG-phrG rapG 2.4/ 3.0 2.5/ 2.9 6,5,5,7 4,4,9,11 NT response regulator aspartate phosphatase σ phrG 3.5/ 4.2 3.6/ 4.7 NT phosphatase (RapG) regulator σH,CcpA spoIIAA-AB-sigF spoIIAB 3.6/ 6.4 4.1/ 3.9 NT anti-sigma factor / serine kinase σH H sigF 3.9/ 7.0 3.5/ 4.4 3,4,10,11RsfA NT RNA polymerase sporulation forespore σ Transcriptome2) Proteome3) Operon1) Gene Function/Similarity4) Regulon5) N1/ 2 T1/ 2 N T σH regulon (2) H spoVS 3.1/ 2.0 4.4/ 4.6 1,27,24,17 (N)T required for dehydratation of the spore core and assembly σ yisK yisK 1.9/ 2.3 3.0/ 3.6 4,3,-,- 5,5,4,3 NT 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase σH ymaH ymaH 6.5/ 3.4 3.4/ 4.6 NT similar to host factor-1 protein σH H yoxA-dacC yoxA 2.4/ 2.6 3.5/ 4.3 (N)T similar to galactose mutarotase related enzyme σ H yuxI yuxI 0.9/ 0.8 1.0/ 0.9 28,25,21,28 2,2,3,3 NT unknown σ σB regulon B dps dps 1.8/ 1.1 6.1/ 2.7 2,2,2,4 NT stress- and starvation-induced gene σ B rsbV-W-sigB-rsbX sigB 1.2/ 0.8 2.5/ 1.4 1,1,5,7 N(T) RNA polymerase general stress sigma factor σ ydaE ydaE 1.0/ 1.1 2.0/ 1.1 9,9,8,9 10,5,9,6 NT probable spore coat polysaccharide biosynthesis protein σB yjbCD yjbD 6.0/ 3.5 3.8/ 3.9 NT similar to glutaredoxin family protein Spx σB other functions dat dat 2.2/ 3.9 3.0/ 3.2 3,3,4,3 3,2,3,3 NT probable D-alanine aminotransferase folD folD 0.7/ 0.6 0.3/ 0.3 1,1,2,13MenB 5,4,3,5 NT methylenetetrahydrofolate dehydrogenase / cyclohydrolase FolD menB menB 0.5/ 0.6 0.7/ 0.7 1,1,2,13 5,4,3,5 NT dihydroxynapthoic acid synthetase E katA katA 3.2/ 2.5 2.5/ 3.2 3,5,4,3 2,2,4,5 NT vegetative catalase 1 σ , PerR maeN maeN 5.0/ 12.4 6.8/ 10.4 NT Na+/malate symporter 110 murB murB 0.5/ 0.8 0.5/ 0.5 5,6,7,9 2,1,4,11 NT UDP-N-acetylenolpyruvoylglucosamine reductase mecA mecA 5.4/ 3.3 8.0/ 9.6 NT negative regulator of competence unknown function ycgN ycgN 1.1/ 1.2 1.2/ 1.1 3,20,16,10 5,6,4,8 NT similar to 1-pyrroline-5-carboxylate dehydrogenase yfmH yfmH 4.3/ 4.1 2.4/ 2.4 N(T) unknown yhfH yhfH 30.1/ 8.6 13.6/ 18.0 NT unknown yhzC yhzC 5.3/ 5.2 11.7/ 11.5 NT unknown yjcLK yjcL 1.0/ 1.8 3.6/ 3.8 (N)T similar to unknown proteins yjcK 1.3/ 1.2 5.1/ 5.1 3,3,6,6 8,7,8,8 NT similar to ribosomal-protein-alanine N-acetyltransferase yncM yncM 4.4/ 4.4 4.6/ 5.4 NT similar to unknown proteins yoeB yoeB 6.6/ 6.0 11.0/ 9.2 NT unknown σE yrhP yrhP 20.5/ 3.2 10.0/ 10.4 NT similar to efflux protein yufLM yufL 4.1/ 11.6 5.1/ 5.4 NT similar to two-component sensor histidine kinase [YufM] yufM 3.5/ 13.2 5.6/ 7.0 NT similar to two-component response regulator [YufL] yusJ yusJ 2.4/ 2.4 3.6/ 3.5 3,5,2,1 -,-,5,3 NT similar to butyryl-CoA dehydrogenase yusU yusU 5.0/ 6.2 7.6/ 8.9 NT similar to unknown proteins yusV yusV 6.1/ 6.5 7.0/ 10.3 NT similar to iron(III) dicitrate transport permease 1) Induced genes/proteins were assigned to known or potential operon structures. 2) The transcription level ratios (normalized intensity t0/normalized intensity control ) of two different experiments are indicated. Only genes with induction factors of at least threefold during the transition phase as revealed by transcriptome analyses were considered as significant. Missed genes on microarray are indi cated by “---“.

3) The protein synthesis ratios correspond to one representative proteome experiment after different times of starvation (1,2,3 ,4) that are related to the transient phase (1) and 10, 30 1,2,3,4 control and 60 minutes after transition to stationary phase (2,3,4). The ratios are calculated by [%] quantity / [%] quantity using the Decodon Delta 2D software. In case of identification of two mixed spots, only one ratio could be calculated. The ratios of mixed spots are flagged then by the protein name of the s econd protein. Proteins only detected in coomassie-stained 2D gels but not in the autoradiograms were marked with Coo . An induction ratio of <1 is indicated by “-“. 4) The function or similarity is derived from the SubtiList database ( http://genolist.fr/SubtiList/ ). 5) All listed genes were classified according to the previously described regulons: TnrA (Débarbouillé and Fisher, 2002; Yoshid a et al., 2003), TRAP (Babitzke and Gollnick, 2001; Sarsero et al., 2000a,b), carbon catabolite control [glu-: repressed by glucose; CcpA] (Renna et al., 1993; Blenke et al., 2003 ; Yoshida et al., 2001), CodY (Lazazzera et al., 1999; Molle et al., 2003), RelA (Eymann et al., 2002), σB (Petersohn et al., 2001), σH (Lee & Price, 1993; Stover & Driks, 1999; McQuade et al., 2001; Britton et al., 2002), σF (Steil et al., 2005), σE (Feucht et al., 2003; Eichenberger et al., 2003; Steil et al., 2005), σL (Débarbouillé et al., 1999, Gardan et al., 1995) using the Genespring software from Agilent Technologies (version 7.1). The genes/proteins were assigned to main regulons, that are given in bold. 111 112 induced after ammonium and tryptophan starvation (Table 1). The corresponding gene products could be required for the adaptation of the cell to ammonium and tryptophan starvation, e.g. by the generation of glutamate (ycgN, dat), modification of ribosomal proteins (yjcK) and uptake of malate (maeN).

5.2 General induction of the CodY, RelA and σH-regulons by ammonium and tryptophan starvation

The transcriptome and proteome analysis revealed the general induction of eighteen CodY-regulated transcriptional units in response to ammonium and tryptophan starvation, as well (Table 1, CodY regulon). This indicates a CodY derepression in response to both starvation conditions. CodY loses its repressing activity by the drop of intracellular GTP level that occurs during the transition from rapid exponential growth to stationary phase [Freese et al., 1979; Lopez et al., 1981; Ratnayake-Lecamwasan et al., 2001]. The decrease of GTP might be responsible for the CodY derepression under ammonium and tryptophan starvation conditions. In ammonium starved cells, the decrease of branched chain amino acids, caused by the induction of the bkd-operon and the repression of ilv-leu-operon might also be involved in CodY derepression. It was shown previously that CodY binds GTP and/or branched chain amino acids [Blagova et al., 2003; Shivers and Sonenshein, 2004]. Interestingly, the CodY-dependent ABC transporter YurJ was 6-fold higher induced in tryptophan starved cells than after ammonium starvation (Table 1) which might be caused by the absence of active TnrA in tryptophan limited cells. A negative influence of TnrA on the transcription of yurJ was found in nitrogen restricted cells [Yoshida et al., 2003].

The stringent response causes a decrease in the GTP pool and consequently a CodY derepression [Lopez et al., 1981, Ochi et al., 1981; Ratnayake-Lecamwasan et al., 2001, Inaoka and Ochi, 2002; Inaoka et al., 2003]. The induction of eleven positively RelA- controlled genes (e.g. spo0A, ytzE, yvyD) (Table 1, RelA regulon) and the repression of 70 negatively RelA-dependent genes (e.g. frr, rplA,C,D,W, rpsJ, tsf) in response to ammonium and tryptophan starvation are indicative for the stringent response (Table 2 [supplemental material]). The connection between CodY derepression and RelA-mediated stringent response is also reflected by the co-regulation of nine transcriptional units by CodY and RelA (e.g. appD-, yurP-operon). It has been shown previously that the σH-dependent genes yvyD, ytxH, spoVG and spo0A are positively stringent controlled [Drzewiecki et al., 1998; Eymann et al., 2001]. The combined transcriptome and proteome analyses of ammonium and tryptophan starved cells revealed the common induction of eleven σH-dependent transcriptional units (e.g. phrG-, spoIIA-operon, ymaH) in addition to the stringently controlled genes (Table 1, σH regulon). The corresponding gene products of CodY-, RelA- and σH– 113 regulated genes could perform functions necessary for coping with both, ammonium and tryptophan starvation, e.g. hydrolysis of amino acids (yhdG, amhX), transport of oligo- and dipeptides (app, dpp) and unknown substances (yufOPQ, yurJ), asparagine synthesis (asnH) and synthesis of Rap phosphatases (rapA,C,G) as well as their specific regulators (phrA,C,G) [Perego, 1997; Jiang et al., 2000]. Rap phosphatases can dephosphorylate Spo0F~P, a member of the phosphorelay signal transduction system that governs the initiation of sporulation [Hoch, 1993]. Thus, they provide access for negative signals to influence the cell’s decision of whether to initiate the sporulation or not [Lazazzera et al., 1999].

Conclusions

The responses of B. subtilis to ammonium or tryptophan starvation cause major changes in the global gene expression pattern. Both starvation conditions caused the common induction of the CodY, RelA and σH general starvation regulons and overlapping responses that are independent from CodY, RelA, σH. The CodY and σH general starvation regulons are required for the adaptation of the cell to nutrient depletion and to post- exponential stationary phase processes such as survival under non-growing conditions, competence or sporulation. The negative RelA-dependent stringent response consisting of the repression of components of the translational apparatus including ribosomal proteins and translation factors is characteristic for the non-growing state under all starvation conditions. In contrast, clearly ammonium or tryptophan starvation specific gene expression patterns were detected.

The specific response to ammonium starvation includes mainly the induction of TnrA- and σL/BkdR/RocR-dependent genes that are involved in the high-affinity uptake of ammonium and utilization of alternate nitrogen sources such as amino acids (e.g. asparagine, branched chain amino acids, arginine, alanine), γ-aminobutyrate, nitrate/nitrite, uric acid/urea and oligopeptides. Additionally, the GlnR-regulated glutamine synthetase (GlnA) is strongly induced. Furthermore, the transcriptome analysis provided evidence for the synthesis of glutamate as the second substrate for GlnA in addition to ammonium. This is demonstrated by the upregulation of glutamate generating enzymes such as aspartate aminotranferase (yurG), ornithine aminotransferase (rocD), alanine transaminase (alaT), other potential α-ketoglutarate utilizing aminotransferases (ycbU, patB), γ- glutamyltransferase (ywrD) as well as aconitase (citB) that is involved in the synthesis of α- ketoglutarate/glutamate. Alternate nitrogen sources such as γ-aminobutyrate (gabP) or their degradation products, e.g. aspartate (asnZ) might function as amino group donors for aminotransferases. Glutamate is also generated by degradation of arginine/ornithine as 114 indicated by the specific induction of the rocA,D,F genes. These reactions and the prevention of rocG expression indicate that the level of glutamate as substrate for glutamine synthetase and nitrogen donor for transaminations is critical and should be maintained. The asparagine synthetase AsnO was synthezised specifically in ammonium starved cells. In addition to GlnA, the asparagine synthetase AsnO might be involved in ammonium assimilation during ammonium starvation. In contrast, the CodY-dependent asnH gene encoding another asparagine synthetase was induced in response to both, ammonium and tryptophan starvation as well [Molle et al., 2003; Yoshida et al., 1999].

The specific response of B. subtilis to tryptophan starvation includes the TRAP regulon involved in tryptophan biosynthesis (e.g. trp operon) as well as genes involved in the generation of ammonia (adeC, ald) and glutamate (yodF, yusM) that are different from that induced by ammonium starvation. Moreover, the ald and yodF genes are negatively controlled by TnrA preventing an induction during ammonium starvation [Yoshida et al., 2003]. Induction of adeC and ald is rather specific for amino acid starvation since these are also induced by norvaline in a RelA-dependent manner [Eymann et al., 2002]. The gene products of the yodF and yusM genes as well as the gene product of ycgN could be involved in the uptake and utilization of proline thereby generating glutamate as nitrogen donor for transaminations in amino acid biosynthesis.

In summary, this paper present one further step towards the description of the responses of B. subtilis to ammonium and tryptophan starvation by the use of transcriptome and proteome analyses. Several genes with still unknown function were induced by ammonium and/or tryptophan starvation which might be required for the adaptation of the cell to these starvation conditions. Thus, it is subject to future studies to characterize the functions of these unknown genes during ammonium and/or tryptophan starvation conditions.

Experimental Procedures

Bacterial strains and culture conditions. B. subtilis wild type 168 (trpC2) was grown aerobically at 37°C under vigorous agitation in Belitsky minimal medium (BMM) as described previously [Stülke et al., 1993]. For ammonium or tryptophan starvation cells were grown in

BMM containing 0.7 mM instead of 15 mM (NH4)2SO4 or 4 µM instead of 80 µM tryptophan, respectively. In each starvation experiment the stationary phase was reached at an optical density at 500 nm (OD500) of about 1.

Assay for sporulation frequency. Cells grown under ammonium and tryptophan starvation conditions were diluted at different times along the growth curve in 0.9% NaCl solution and aliquots of appropriate dilutions were incubated at 80°C for 10 min to kill the cells. All 115 appropriate dilutions containing either viable cells or survived spores were plated on LB plates, incubated overnight at 37°C and counted for colony forming units that indicates the number of spores. The number of spores was related to the number of viable cells at each time point.

Preparation of the cytoplasmic L-[35S]methionine-labeled protein fraction. Cells grown in minimal medium were pulse-labeled for 5 min each with 10 µCi of L-[35S]methionine per ml at an OD500 of 0.4 (for control) and at several time points (transition point [1] and 10, 30 and 60 min) after the transition into the stationary phase caused by ammonium or tryptophan starvation. L-[35S]methionine incorporation was stopped after 5 min by addition of 1mg of chloramphenicol per ml and an excess of cold L-methionine (10 mM) on ice. The cells were disrupted by ultrasonication, and the soluble protein fraction was separated from the cell debris by centrifugation. Incorporation of L-[35S]methionine was measured by precipitation of aliquots of protein extracts with 10% trichloroacetic acid on filter papers, as described previously [Bernhardt et al., 1999; Eymann et al., 2004].

Two-dimensional (2D) gel electrophoresis. The protein content was determined using the Bradford assay [Bradford, 1976] and 80 µg of the L-[35S]methionine-labeled protein extract were separated by two-dimensional gel electrophoresis (2D-PAGE) using the non-linear immobilized pH gradients (IPG) in the pH range 4-7 (Amersham Biosciences) and a Multiphor II apparatus (Amersham Pharmacia Biotech) as described previously [Bernhardt et al., 1999]. The gels were stained with silver nitrate, dried on filter paper and exposed to Phosphor screens (Molecular Dynamics, Sunnyvale, Calif.) which were read out with a Phosphor Imager SI instrument (Molecular Dynamics) [Bernhardt et al., 1999]. For identification of the proteins by mass spectrometry, nonradioactive protein samples of 200 µg were separated by preparative 2D-PAGE. The resulting 2D gels were fixed in 40% (v/v) ethanol, 10% (v/v) acetic acid and stained with Colloidal Coomassie Brilliant Blue (Amersham Biosciences).

Quantitative image analysis. Quantitative image analysis was performed with the DECODON Delta 2D software, version 3.3 (http://www.decodon.com) which is based on the dual channel image analysis technique [Bernhardt et al., 1999]. Using this software the 2D gel images from ammonium or tryptophan starvation experiments were fitted to the corresponding control image by using a warp transformation. To avoid incomplete groups of matching spots a fused 2D gel was created for spot detection. For preparing such a fusion gel, all 2D gel images of the ammonium or tryptophan starvation experiments were combined using the spot preserving “union fusion” algorithm of Delta2D [Luhn et al., 2003]. Spot detection was performed in the fusion gel containing all spots present in any gel of one starvation experiment according to the automatically suggested parameters for background subtraction, average spot size, and spot sensitivity. The resulting spot shapes were reviewed 116 and manually edited if necessary. The reviewed spot mask was applied to the individual gels to guide the spot detection and quantitation. Normalization was performed by calculating the quantity of each single spot in percentage related to the total spot quantity per gel. Proteins showing an induction of at least threefold compared to the control during the L- [35S]methionine pulse in two independent experiments were designated as marker proteins for ammonium or tryptophan starvation, respectively.

Protein identification by MALDI-TOF-TOF Mass Spectrometry. Spot cutting from Colloidal Coomassie-stained 2D gels, tryptic digestion of the proteins and spotting of the resulting peptides onto MALDI-targets (Voyager DE-STR, PerSeptive Biosystems) were performed using the Ettan Spot Handling Workstation (Amersham-Biosciences, Uppsala, Sweden), according to the standard protocol described previously [Eymann et al., 2004]. The MALDI- TOF-TOF measurement of spotted peptide solutions was carried out on a Proteome- Analyzer 4700 (Applied Biosystems, Foster City, CA, USA) and protein identification was performed using the Mascot search engine (Matrix Science Ltd, London, UK) as described previously [Eymann et al., 2004].

Northern blot experiments. Total RNA of B. subtilis wild type was isolated from cells during the exponential growth (for control) and after the transition into the stationary phase provoked by ammonium or tryptophan starvation. For isolation of total RNA the cell pellets were resuspended in Lysis buffer II (3 mM EDTA; 200 mM NaCl), mechanically disrupted using the RiboLyser (Thermo Electron Corporation GmbH, Dreieich, Germany) and the RNA was purified using the KingFisher (Thermo Electron Corporation GmbH, Dreieich, Germany) and the MagNA Pure LC RNA Isolation Kit I (Roche Diagnostics, Penzberg, Germany). Northern blot analyses were performed as described previously [Wetzstein et al., 1992]. Hybridizations specific for ureA/C, oppA and trpB were conducted with the digoxigenin- labeled RNA probes synthesized in vitro with T7 RNA polymerase from T7 promoter containing internal PCR products of ureA/C, oppA or trpB. The following primers were used for PCR, respectively: ureA-for (5’-ATGAAACTGACACCAGTTGAAC-3’) and ureA-rev (5’- CTAATACGACTCACTATAGGGAGA/TGACTTCACCTCCGCAGAAA-3’); ureC-for (5’-ACGG ATTTATGGATCGAAGTC-3’) and ureC-rev (5’-CTAATACGACTCACTATAGGGAGAGATGA

TGTCATGCTGATCGC-3’); oppA-for (5’-AATGATTCAGTATCAGGCGG-3’) and oppA-rev (5’-CTAATACGACTCACTATAGGGAGATACTGCTTGAGCGATTTTCG-3’); trpB-for (5’-GG AAACACTCATGCAGCCG-3`) and trpB-rev (5’-CTAATACGACTCACTATAGGGAGATCCAC CGCTTCTTCATCGG-3’).

Transcriptome analysis by DNA microarray hybridization. After isolation of total RNA (see above), RNA concentration and quality were determined with the Bioanalyzer 2100 (Agilent Technologies, Berlin, Germany) according to the instructions of the manufacturer. 117

Generation of fluorescence-labelled cDNA and hybridization with B. subtilis whole-genome microarrays (Eurogentec) was performed according to the instructions of the manufacturer as described previously [Jürgen et al., 2005]. Quantification of hybridization signals, background subtraction were performed with the ScanArray® Express image analysis software of the ScanArray® Express scanner (PerkinElmer Life and Analytical Sciences, Rodgau- Jügesheim, Germany). Calculation of normalized intensity values and ratios for the two dyes were performed with the Genespring software from Agilent Technologies (version 7.1). Induced and repressed genes with an expression level ratio of ≥3 or ≤0.33 in both independent experiments, respectively were regarded as significant genes. Final evaluation of the microarray data included the consideration of putative operons derived from the genome sequence, using the SubtiList database (http://genolist.pasteur.fr/SubtiList/) as well as previously known transcriptional units. The induced genes/proteins were classified according to previously described regulons including TnrA [Fisher and Débarbouillé, 2002; Yoshida et al., 2003], σL [Débarbouillé et al., 1999; Gardan et al., 1995], TRAP [Babitzke and Gollnick, 2001; Sarsero et al., 2000a,b], RelA [Eymann et al., 2002], σH [Lee and Price, 1993; Stover and Driks, 1999; McQuade et al., 2001; Britton et al., 2002], CodY [Lazazzera et al.,

1999; Molle et al., 2003], σF [Steil et al., 2005], σE [Feucht et al., 2003, Eichenberger et al., 2003, Steil et al., 2005], σB [Petersohn et al., 2001], and carbon catabolite control [Renna et al., 1993; Yoshida et al., 2001; Moreno et al., 2001; Blencke et al., 2003] using the Genespring software from Agilent Technologies (version 7.1).

ACKNOWLEDGEMENTS We thank Britta Jürgen and Stefanie Leja for the help with the microarray experiments, Ulrike Mäder for help with data analysis and critical reading of the manuscript and the Decodon company for support with the Decodon Delta 2D software. This work was supported by a scholarship of the “Ministry of Education and Training of Viet Nam” (MOET) to L.T.T., and grants from the “Deutsche Forschungsgemeinschaft” (DFG), the “Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie” (BMFT), the “Fonds der Chemischen Industrie” and Genencor International (Palo Alto, California, USA) to MH.

References

Atkinson MR, Blauwkamp TA, Bondarenko V, Studitsky V, Ninfa AJ: Activation of the glnA, glnK, and nac promoters as Escherichia coli undergoes the transition from nitrogen excess growth to nitrogen starvation. J Bacteriol 2002;184:5358-5363. 118

Auger S, Gomez MP, Danchin A, Martin-Verstraete I: The PatB protein of Bacillus subtilis is a C-S-lyase. Biochimie 2005;87:231-238.

Babitzke P, Gollnick P: Posttranscription initiation control of tryptophan metabolism in Bacillus subtilis by the trp RNA-binding attenuation protein (TRAP), anti-TRAP, and RNA structure. J Bacteriol 2001;183:5795-5802.

Belitsky BR, Sonenshein AL: Modulation of activity of Bacillus subtilis regulatory proteins GltC and TnrA by glutamate dehydrogenase. J Bacteriol 2004;186:3399-3407.

Belitsky BR, Wray LV, Jr., Fisher SH, Bohannon DE, Sonenshein AL: Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. J Bacteriol 2000;182:5939-5947.

Bernhardt J, Buttner K, Scharf C, Hecker M: Dual channel imaging of two-dimensional electropherograms in Bacillus subtilis. Electrophoresis 1999;20:2225-2240.

Blagova EV, Levdikov VM, Tachikawa K, Sonenshein AL, Wilkinson AJ: Crystallization of the GTP-dependent transcriptional regulator CodY from Bacillus subtilis. Acta Crystallogr D Biol Crystallogr 2003;59:155-157.

Blencke HM, Homuth G, Ludwig H, Mader U, Hecker M, Stulke J: Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab Eng 2003;5:133-149.

Blencke HM, Reif I, Commichau FM, Detsch C, Wacker I, Ludwig H, Stulke J: Regulation of citB expression in Bacillus subtilis: integration of multiple metabolic signals in the citrate pool and by the general nitrogen regulatory system. Arch Microbiol 2006:1-11.

Brandenburg JL, Wray LV, Jr., Beier L, Jarmer H, Saxild HH, Fisher SH: Roles of PucR, GlnR, and TnrA in regulating expression of the Bacillus subtilis ure P3 promoter. J Bacteriol 2002;184:6060-6064.

Britton RA, Eichenberger P, Gonzalez-Pastor JE, Fawcett P, Monson R, Losick R, Grossman AD: Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J Bacteriol 2002;184:4881-4890.

Brown SW, Sonenshein AL: Autogenous regulation of the Bacillus subtilis glnRA operon. J Bacteriol 1996;178:2450-2454.

Cashel M, Gentry DR, Hernandez VJ, Vinella D: The stringent response; in Neidhardt FC, Curtiss R III, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE (ed.): Escherichia coli and Salmonella: cellular and molecular biology. ASM, Washington DC, 1996, pp. 1458-1496. 119

Chatterji D, Ojha AK: Revisiting the stringent response, ppGpp and starvation signaling. Curr Opin Microbiol 2001;4:160-165.

Dean DR, Aronson AI: Selection of Bacillus subtilis mutants impaired in ammonia assimilation. J Bacteriol 1980;141:985-988.

Debarbouille M, Gardan R, Arnaud M, Rapoport G: Role of bkdR, a transcriptional activator of the sigL-dependent isoleucine and valine degradation pathway in Bacillus subtilis. J Bacteriol 1999;181:2059-2066.

Debarbouille M, Martin-Verstraete I, Kunst F, Rapoport G: The Bacillus subtilis sigL gene encodes an equivalent of sigma 54 from gram-negative bacteria. Proc Natl Acad Sci U S A 1991;88:9092-9096.

Detsch C, Stulke J: Ammonium utilization in Bacillus subtilis: transport and regulatory functions of NrgA and NrgB. Microbiology 2003;149:3289-3297.

Drzewiecki K, Eymann C, Mittenhuber G, Hecker M: The yvyD gene of Bacillus subtilis is under dual control of sigmaB and sigmaH. J Bacteriol 1998;180:6674-6680.

Eichenberger P, Jensen ST, Conlon EM, van Ooij C, Silvaggi J, Gonzalez-Pastor JE, Fujita M, Ben-Yehuda S, Stragier P, Liu JS, Losick R: The sigmaE regulon and the identification of additional sporulation genes in Bacillus subtilis. J Mol Biol 2003;327:945-972.

Errington J: Regulation of endospore formation in Bacillus subtilis. Nat Rev Microbiol 2003;1:117-126.

Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Buttner K, Buurman G, Scharf C, Venz S, Volker U, Hecker M: A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics 2004;4:2849-2876.

Eymann C, Homuth G, Scharf C, Hecker M: Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. J Bacteriol 2002;184:2500-2520.

Eymann C, Mittenhuber G, Hecker M: The stringent response, sigmaH-dependent gene expression and sporulation in Bacillus subtilis. Mol Gen Genet 2001;264:913-923.

Ferson AE, Wray LV, Jr., Fisher SH: Expression of the Bacillus subtilis gabP gene is regulated independently in response to nitrogen and amino acid availability. Mol Microbiol 1996;22:693-701.

Feucht A, Evans L, Errington J: Identification of sporulation genes by genome-wide analysis of the sigmaE regulon of Bacillus subtilis. Microbiology 2003;149:3023-3034. 120

Fisher SH, Débarbouillé M: Nitrogen source utilization and its regulation; in Sonenshein AL, Hoch JA, Losick R (ed.): Bacillus subtilis and its closest relatives: from genes to cells. ASM, Washington DC, 2002, pp. 181-191.

Fisher SH: Regulation of nitrogen metabolism in Bacillus subtilis: vive la difference! Mol Microbiol 1999;32:223-232.

Fisher SH, Sonenshein AL: Control of carbon and nitrogen metabolism in Bacillus subtilis. Annu Rev Microbiol 1991;45:107-135.

Freese E, Heinze JE, Galliers EM: Partial purine deprivation causes sporulation of Bacillus subtilis in the presence of excess ammonia, glucose and phosphate. J Gen Microbiol 1979;115:193-205.

Gardan R, Rapoport G, Debarbouille M: Expression of the rocDEF operon involved in arginine catabolism in Bacillus subtilis. J Mol Biol 1995;249:843-856.

Gardan R, Rapoport G, Debarbouille M: Role of the transcriptional activator RocR in the arginine-degradation pathway of Bacillus subtilis. Mol Microbiol 1997;24:825-837.

Goupil-Feuillerat N, Cocaign-Bousquet M, Godon JJ, Ehrlich SD, Renault P: Dual role of alpha-acetolactate decarboxylase in Lactococcus lactis subsp. lactis. J Bacteriol 1997;179:6285-6293.

Hecker M, Richter A, Schroeter A, Wolfel L, Mach F: [Synthesis of heat shock proteins following amino acid or oxygen limitation in Bacillus subtilis relA+ and relA strains]. Z Naturforsch [C] 1987;42:941-947.

Hecker M, Volker U: Non-specific, general and multiple stress resistance of growth-restricted Bacillus subtilis cells by the expression of the sigmaB regulon. Mol Microbiol 1998;29:1129- 1136.

Hecker M, Volker U: General stress response of Bacillus subtilis and other bacteria. Adv Microb Physiol 2001;44:35-91.

Hoch JA: The phosphorelay signal transduction pathway in the initiation of Bacillus subtilis sporulation. J Cell Biochem 1993;51:55-61.

Hu P, Leighton T, Ishkhanova G, Kustu S: Sensing of nitrogen limitation by Bacillus subtilis: comparison to enteric bacteria. J Bacteriol 1999;181:5042-5050.

Inaoka T, Ochi K: RelA protein is involved in induction of genetic competence in certain Bacillus subtilis strains by moderating the level of intracellular GTP. J Bacteriol 2002;184:3923-3930. 121

Inaoka T, Takahashi K, Ohnishi-Kameyama M, Yoshida M, Ochi K: Guanine nucleotides guanosine 5'-diphosphate 3'-diphosphate and GTP co-operatively regulate the production of an antibiotic bacilysin in Bacillus subtilis. J Biol Chem 2003;278:2169-2176.

Jiang M, Shao W, Perego M, Hoch JA: Multiple histidine kinases regulate entry into stationary phase and sporulation in Bacillus subtilis. Mol Microbiol 2000;38:535-542.

Jurgen B, Tobisch S, Wumpelmann M, Gordes D, Koch A, Thurow K, Albrecht D, Hecker M, Schweder T: Global expression profiling of Bacillus subtilis cells during industrial-close fed- batch fermentations with different nitrogen sources. Biotechnol Bioeng 2005;92:277-298.

Kim HJ, Roux A, Sonenshein AL: Direct and indirect roles of CcpA in regulation of Bacillus subtilis Krebs cycle genes. Mol Microbiol 2002;45:179-190.

Kroos L, Yu YT: Regulation of sigma factor activity during Bacillus subtilis development. Curr Opin Microbiol 2000;3:553-560.

Lazazzera BA, Kurtser IG, McQuade RS, Grossman AD: An autoregulatory circuit affecting peptide signaling in Bacillus subtilis. J Bacteriol 1999;181:5193-5200.

Lee S, Price CW: The minCD locus of Bacillus subtilis lacks the minE determinant that provides topological specificity to cell division. Mol Microbiol 1993;7:601-610.

Lopez JM, Dromerick A, Freese E: Response of guanosine 5'-triphosphate concentration to nutritional changes and its significance for Bacillus subtilis sporulation. J Bacteriol 1981;146:605-613.

Luhn S, Berth M, Hecker M, Bernhardt J: Using standard positions and image fusion to create proteome maps from collections of two-dimensional gel electrophoresis images. Proteomics 2003;3:1117-1127.

McQuade R S, Comella N, Grossman AD: Control of a family of phosphatase regulatory genes (phr) by the alternate sigma factor sigmaH of Bacillus subtilis. J Bacteriol 2001; 183:4905-4909.

Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein A L: Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. J Bacteriol 2003; 185:1911-1922.

Monnet C, Nardi M, Hols P, Gulea M, Corrieu G, Monnet V: Regulation of branched-chain amino acid biosynthesis by alpha-acetolactate decarboxylase in Streptococcus thermophilus. Lett Appl Microbiol 2003;36:399-405.

Nakano MM, Yang F, Hardin P, Zuber P: Nitrogen regulation of nasA and the nasB operon, which encode genes required for nitrate assimilation in Bacillus subtilis. J Bacteriol 1995; 177:573-579. 122

Nakano MM, Hoffmann T, Zhu, Y, Jahn D: Nitrogen and oxygen regulation of Bacillus subtilis nasDEF encoding NADH-dependent nitrite reductase by TnrA and ResDE. J Bacteriol 1998; 180:5344-5350.

Ochi K, Kandala JC, Freese E: Initiation of Bacillus subtilis sporulation by the stringent response to partial amino acid deprivation. J Biol Chem 1981;256:6866-6875.

Perego M: A peptide export-import control circuit modulating bacterial development regulates protein phosphatases of the phosphorelay. Proc Natl Acad Sci USA 1997; 94:8612-8617.

Petersohn A, Brigulla M, Haas S, Hoheisel JD, Völker U, Hecker M. Global analysis of the general stress response of Bacillus subtilis. J Bacteriol 2001; 183:5617-5631.

Ratnayake-Lecamwasam M, Serror P, Wong KW, Sonenshein AL: Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes Dev 2001; 15:1093- 1103.

Renna MC, Najimudin N, Winik LR, Zahler SA: Regulation of the Bacillus subtilis alsS, alsD, and alsR genes involved in post-exponential-phase production of acetoin. J Bacteriol 1993; 175:3863-3875.

Sarsero JP, Merino E, Yanofsky C: A Bacillus subtilis operon containing genes of unknown function senses tRNATrp charging and regulates expression of the genes of tryptophan biosynthesis. Proc Natl Acad Sci U S A 2000a;97:2656-2661.

Sarsero JP, Merino E, Yanofsky C: A Bacillus subtilis gene of previously unknown function, yhaG, is translationally regulated by tryptophan-activated TRAP and appears to be involved in tryptophan transport. J Bacteriol 2000b;182:2329-2331.

Schreier HJ, Sonenshein AL: Altered regulation of the glnA gene in glutamine synthetase mutants of Bacillus subtilis. J Bacteriol 1986; 167:35-43.

Schreier HJ, Brown SW, Hirschi KD, Nomellini JF, Sonenshein AL: Regulation of Bacillus subtilis glutamine synthetase gene expression by the product of the glnR gene. J Mol Biol 1989; 210:51-63.

Serror P, Sonenshein AL: Interaction of CodY, a novel Bacillus subtilis DNA-binding protein, with the dpp promoter region. Mol Microbiol 1996; 20:843-852.

Shivers RP, Sonenshein AL: Activation of the Bacillus subtilis global regulator CodY by direct interaction with branched-chain amino acids. Mol Microbiol 2004; 53:599-611.

Sonenshein AL: Metabolic regulation of sporulation and other stationary phase phenomena; in Smith I, Slepecky R, Setlow P (ed.): Regulation of prokaryotic development. ASM, Washington DC, 1989, pp. 109-130. 123

Steil L, Serrano M, Henriques AO, Völker U: Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology 2005; 151:399-420.

Stover AG, Driks A: Regulation of synthesis of the Bacillus subtilis transition-phase, spore- associated antibacterial protein TasA. J Bacteriol 1999; 181:5476-5481.

Stülke J, Hanschke R, Hecker M: Temporal activation of beta-glucanase synthesis in Bacillus subtilis is mediated by the GTP pool. J Gen Microbiol 1993; 139:2041-2045.

Swanton M, Edlin G: Isolation and characterization of an RNA relaxed mutant of Bacillus subtilis. Biochem Biophys Res Commun 1972; 46:583-588.

Tanaka K, Kobayashi K, Ogasawara N: The Bacillus subtilis YufLM two-component system regulates the expression of the malate transporters MaeN (YufR) and YflS, and is essential for utilization of malate in minimal medium. Microbiology 2003; 149:2317-2329.

Tojo S, Satomura T, Morisaki K, Yoshida K, Hirooka K, Fujita Y: Negative transcriptional regulation of the ilv-leu operon for biosynthesis of branched-chain amino acids through the Bacillus subtilis global regulator TnrA. J Bacteriol 2004; 186:7971-7979.

Turinsky AJ, Moir-Blais TR, Grundy FJ, Henkin T: M. Bacillus subtilis ccpA gene mutants specifically defective in activation of acetoin biosynthesis. J Bacteriol (2000). 182:5611-5614.

Wendrich TM, Marahiel MA: Cloning and characterization of a relA/spoT homologue from Bacillus subtilis. Mol Microbiol 1997; 26:65-79.

Wetzstein M, Volker U, Dedio J, Lobau S, Zuber U, Schiesswohl M, Herget C, Hecker M, Schumann W: Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis. J Bacteriol 1992; 174:3300-3310.

Wray LV Jr, Atkinson MR, Fisher SH: The nitrogen-regulated Bacillus subtilis nrgAB operon encodes a membrane protein and a protein highly similar to the Escherichia coli glnB- encoded PII protein. J Bacteriol 1994; 176:108-114.

Wray LV Jr, Ferson AE, Rohrer K, Fisher SH: TnrA, a transcription factor required for global nitrogen regulation in Bacillus subtilis. Proc Natl Acad Sci USA 1996; 93:8841-8845.

Wray LV Jr, Ferson AE, Fisher SH: Expression of the Bacillus subtilis ureABC operon is controlled by multiple regulatory factors including CodY, GlnR, TnrA, and Spo0H. J Bacteriol 1997; 179:5494-5501.

Wray LV Jr, Zalieckas JM, Fisher SH. Bacillus subtilis glutamine synthetase controls gene expression through a protein-protein interaction with transcription factor TnrA. Cell 2001; 107:427-435. 124

Yang WJ, Yanofsky C: Effects of tryptophan starvation on levels of the trp RNA-binding attenuation protein (TRAP) and anti-TRAP regulatory protein and their influence on trp operon expression in Bacillus subtilis. J Bacteriol 2005; 187:1884-1891.

Ye RW, Tao W, Bedzyk L, Young T, Chen M, Li L: Global gene expression profiles of Bacillus subtilis grown under anaerobic conditions. J Bacteriol 2000;182:4458-4465.

Yoshida K, Kobayashi K, Miwa Y, Kang CM, Matsunaga M, Yamaguchi H, Tojo S, Yamamoto M, Nishi R, Ogasawara N, Nakayama T, Fujita Y: Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucleic Acids Res 2001; 29:683-692.

Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y: Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Mol Microbiol 2003; 49:157-165.

[Supplemental material] Table 2: Genes repressed by ammonium (N) or tryptophan (T) starvation as revealed by transcriptome analysis Operon1) Gene Transcriptome2) Function/Similarity3) Regulon4) N1/ 2 T1/ 2

RelA regulon: cell wall/peptidoglycan biosynthesis murAA murAA 0.26/ 0.47 0.26/ 0.30 (N)T UDP-N-acetylglucosamine 1-carboxyvinyltransferase RelA murE-mraY-murD murE 0.21/ 0.45 0.24/ 0.21 (N)T UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase RelA murD 0.30/ 0.40 0.25/ 0.21 (N)T UDP-N-acetylmuramoylalanyl-D-glutamate ligase mraY 0.31/ 0.51 0.28/ 0.23 (N)T phospho-N-acetylmuramoyl-pentapeptide transferase dltABCDE dltC 0.31/ 0.26 0.39/ 0.35 N(T) D-alanine carrier protein RelA gcaD-prs gcaD 0.22/ 0.47 0.26/ 0.31 (N)T UDP-N-acetylglucosamine pyrophosphorylase RelA prs 0.24/ 0.36 0.29/ 0.24 (N)T phosphoribosylpyrophosphate synthetase membrane bioenergetics atpIBEFHAGDC atpI 0.25/ 0.28 0.16/ 0.16 NT ATP synthase (subunit i) RelA atpB 0.38/ 0.30 0.16/ 0.16 (N)T ATP synthase (subunit a) atpE 0.36/ 0.24 0.14/ 0.14 (N)T ATP synthase (subunit c)

atpF 0.27/ 0.20 0.14/ 0.16 NT ATP synthase (subunit b) 125 atpH 0.32/ 0.24 0.12/ 0.12 NT ATP synthase (subunit delta) atpA 0.39/ 0.24 0.12/ 0.12 (N)T ATP synthase (subunit alpha) atpG 0.45/ 0.20 0.12/ 0.12 (N)T ATP synthase (subunit gamma) atpD 0.42/ 0.15 0.16/ 0.16 (N)T ATP synthase (subunit beta) atpC 0.73/ 0.21 0.14/ 0.14 (N)T ATP synthase (subunit epsilon) transcription and translation (1) infA-rpmJ-rpsMK-rpoA-rplQ infA 0.75/ 0.16 0.11/ 0.14 (N)T initiation factor IF-1 RelA rpmJ 0.64/ 0.21 0.18/ 0.20 (N)T ribosomal protein L36 (ribosomal protein B) rpsM 0.80/ 0.19 0.27/ 0.20 (N)T ribosomal protein S13 rpsK 0.51/ 0.14 0.25/ 0.27 (N)T ribosomal protein S11 (BS11) rpoA 0.64/ 0.14 0.19/ 0.21 (N)T RNA polymerase (alpha subunit) rplQ 0.98/ 0.16 0.27/ 0.21 (N)T ribosomal protein L17 (BL15) infC-rpmI-rplT infC 0.57/ 0.35 0.17/ 0.18 T initiation factor IF-3 RelA rpmI 0.57/ 0.29 0.15/ 0.12 (N)T ribosomal protein L35 rplT 0.68/ 0.42 0.23/ 0.23 T ribosomal protein L20 nusB nusB 0.67/ 0.51 0.23/ 0.27 T probable transcription termination RelA pyrH-frr pyrH 0.23/ 0.32 0.16/ 0.19 NT uridylate kinase RelA frr 0.30/ 0.24 0.18/ 0.20 NT ribosome recycling factor rnc rnc 0.35/ 0.62 0.29/ 0.30 T ribonuclease III RelA rplJL-ybxB-rpoBC rplJ 0.24/ 0.14 0.06/ 0.03 NT ribosomal protein L10 (BL5) RelA ybxB 0.30/ 0.25 0.14/ 0.15 NT similar to unknown proteins Operon1) Gene Transcriptome2) Function/Similarity3) Regulon4) N1/ 2 T1/ 2 transcription and translation (2) rpoB 0.38/ 0.56 0.28/ 0.21 T RNA polymerase (beta subunit) rpoC 0.39/ 0.44 0.24/ 0.33 T RNA polymerase (beta' subunit) rplKA rplA 0.26/ 0.29 0.23/ 0.16 NT ribosomal protein L1 (BL1) RelA rplS rplS 0.71/ 0.30 0.14/ 0.13 (N)T ribosomal protein L19 RelA rplU-ysxB-rpmA rplU 0.48/ 0.77 0.32/ 0.27 T ribosomal protein L21 (BL20) RelA ysxB 0.63/ 0.83 0.30/ 0.32 T unknown rpsB rpsB 0.30/ 0.30 0.80/ 0.41 N ribosomal protein S2 RelA rpsF-ssb-rpsR rpsF 0.37/ 0.23 0.24/ 0.24 (N)T ribosomal protein S6 (BS9) RelA ssb 0.44/ 0.23 0.24/ 0.29 (N)T single-strand DNA-binding protein rpsJ----adk-map rpsJ 0.22/ 0.18 0.14/ 0.14 NT ribosomal protein S10 (BS13) RelA rplC 0.22/ 0.16 0.09/ 0.09 NT ribosomal protein L3 (BL3) rplD 0.28/ 0.20 0.10/ 0.12 NT ribosomal protein L4 rplW 0.32/ 0.17 0.09/ 0.11 NT ribosomal protein L23 rplB 0.35/ 0.18 0.07/ 0.05 (N)T ribosomal protein L2 (BL2) rpsS 0.34/ 0.14 0.08/ 0.06 (N)T ribosomal protein S19 (BS19)

rplV 0.40/ 0.17 0.08/ 0.05 (N)T ribosomal protein L22 (BL17) 126 rpsC 0.45/ 0.16 0.08/ 0.09 (N)T ribosomal protein S3 (BS3) rplP 0.47/ 0.11 0.11/ 0.08 (N)T ribosomal protein L16 rpmC 0.39/ 0.09 0.10/ 0.09 (N)T ribosomal protein L29 rpsQ 0.44/ 0.10 0.12/ 0.08 (N)T ribosomal protein S17 (BS16) rplN 0.44/ 0.10 0.11/ 0.12 (N)T ribosomal protein L14 rplX 0.45/ 0.10 0.13/ 0.09 (N)T ribosomal protein L24 (BL23) (histone-like protein HPB12) rplE 0.46/ 0.12 0.15/ 0.12 (N)T ribosomal protein L5 (BL6) rpsN 0.52/ 0.12 0.14/ 0.10 (N)T ribosomal protein S14 rpsH 0.58/ 0.10 0.11/ 0.17 (N)T ribosomal protein S8 (BS8) rplF 0.41/ 0.13 0.22/ 0.13 (N)T ribosomal protein L6 (BL8) rplR 0.59/ 0.18 0.22/ 0.15 (N)T ribosomal protein L18 rpsE 0.55/ 0.11 0.17/ 0.14 (N)T ribosomal protein S5 rpmD 0.62/ 0.07 0.14/ 0.13 (N)T ribosomal protein L30 (BL27) rplO 0.76/ 0.15 0.15/ 0.21 (N)T ribosomal protein L15 secY 0.38/ 0.11 0.16/ 0.13 (N)T preprotein translocase subunit adk 0.51/ 0.10 0.11/ 0.10 (N)T adenylate kinase map 0.55/ 0.10 0.14/ 0.11 (N)T methionine aminopeptidase tig tig 0.17/ 0.28 0.41/ 0.29 N(T) trigger factor (prolyl isomerase) RelA tsf tsf 0.32/ 0.22 0.25/ 0.19 NT elongation factor Ts RelA (ybxA-ybaEF)-truA-rplM-rpsI ybxA 0.57/ 0.38 0.29/ 0.25 (N)T similar to ABC transporter RelA ybaF 0.51/ 0.36 0.30/ 0.31 (N)T similar to cobalt transport protein Operon1) Gene Transcriptome2) Function/Similarity3) Regulon4) N1/ 2 T1/ 2 transcription and translation (3) truA 0.39/ 0.25 0.23/ 0.16 (N)T pseudouridylate synthase I rplM 0.29/ 0.46 0.24/ 0.19 (N)T ribosomal protein L13 rpsI 0.45/ 0.35 0.25/ 0.20 (N)T ribosomal protein S9 ybxF-rpsLG-fus-tufA ybxF 0.27/ 0.22 0.10/ 0.12 NT similar to ribosomal protein L7AE family RelA rpsL 0.33/ 0.26 0.10/ 0.08 NT ribosomal protein S12 (BS12) rpsG 0.28/ 0.26 0.10/ 0.09 NT ribosomal protein S7 (BS7) ylbN-rpmF ylbN 0.23/ 0.23 0.16/ 0.17 NT predicted metal-binding, possibly nucleic acid-binding protein RelA ylxS-nusA-ylxRQ-infB-ylxP-rbfA-polC ylxS 0.23/ 0.32 0.25/ 0.23 NT unknown RelA ylxR 0.31/ 0.24 0.14/ 0.19 NT similar to nucleic acid-binding protein ylxQ 0.35/ 0.22 0.18/ 0.15 (N)T similar to ribosomal protein L7AE family nusA 0.30/ 0.30 0.15/ 0.23 NT transcription termination rbfA 0.85/ 0.27 0.32/ 0.30 (N)T ribosome-binding factor A

RNA modification rnpA rnpA 0.27/ 0.30 0.33/ 0.31 NT protein component of ribonuclease P (RNase P) RelA

TnrA regulon: 127 synthesis of branched chain amino acids ilvBN-ilvC-leuABCD leuA 0.16/ 0.27 0.68/ 0.83 N 2-isopropylmalate synthase TnrA- leuB 0.17/ 0.28 0.59/ 0.65 N 3-isopropylmalate dehydrogenase leuC 0.25/ 0.30 0.58/ 0.59 N 3-isopropylmalate dehydratase (large subunit) leuD 0.22/ 0.29 0.64/ 0.65 N 3-isopropylmalate dehydratase (small subunit) other regulation: glycolysis (1) cggR-gapA-pgk-tpi-pgm-eno cggR 0.10/ 0.16 0.52/ 0.47 N(T) transcriptional repressor of gapA CggR pgk 0.47/ 0.20 0.30/ 0.24 (N)T phosphoglycerate kinase pgm 0.49/ 0.42 0.31/ 0.27 (N)T phosphoglycerate mutase eno 0.46/ 0.21 0.32/ 0.23 (N)T enolase pdhABCD pdhA 0.46/ 0.14 0.17/ 0.28 (N)T pyruvate dehydrogenase (E1 alpha subunit) pdhB 0.50/ 0.08 0.08/ 0.06 (N)T pyruvate dehydrogenase (E1 beta subunit) pdhC 0.40/ 0.13 0.16/ 0.14 (N)T pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit) pdhD 0.78/ 0.57 0.17/ 0.17 T pyruvate dehydrogenase / 2-oxoglutarate dehydrogenase (dihydrolipoamide amino acid biosynthesis (1) argCJBD-carAB-argF argC 0.06/ 0.97 0.05/ 0.06 (N)T N-acetylglutamate gamma-semialdehyde dehydrogenase argJ 0.03/ 0.80 0.05/ 0.03 (N)T ornithine acetyltransferase / amino-acid acetyltransferase argB 0.07/ 1.06 0.05/ 0.04 (N)T N-acetylglutamate 5-phosphotransferase argD 0.06/ 0.80 0.03/ 0.03 (N)T N-acetylornithine aminotransferase Operon1) Gene Transcriptome2) Function/Similarity3) Regulon4) N1/ 2 T1/ 2 amino acid biosynthesis (2) carA 0.03/ 0.90 0.02/ 0.03 (N)T carbamoyl-phosphate transferase-arginine (subunit A) carB 0.04/ 0.94 0.03/ 0.02 (N)T carbamoyl-phosphate transferase-arginine (subunit B) argF 0.03/ 1.05 0.03/ 0.02 (N)T ornithine carbamoyltransferase argGH-ytzD argG 0.05/ 0.63 0.06/ 0.05 (N)T argininosuccinate synthase argH 0.02/ 0.66 0.04/ 0.04 (N)T argininosuccinate lyase ytzD 0.04/ 0.60 0.04/ 0.07 (N)T unknown asnB asnB 0.38/ 0.34 0.29/ 0.32 T asparagine synthetase hisZGDBHAFI hisZ 0.48/ 0.05 0.17/ 0.28 (N)T histidyl-tRNA synthetase hisG 0.44/ 0.13 0.22/ 0.29 (N)T ATP phosphoribosyltransferase hisB 0.76/ 0.05 0.08/ 0.06 (N)T imidazoleglycerol-phosphate dehydratase hisH 0.97/ 0.02 0.09/ 0.10 (N)T amidotransferase hisA 1.26/ 0.05 0.08/ 0.07 (N)T phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase hisF 1.51/ 0.08 0.06/ 0.06 (N)T HisF cyclase-like protein hisI 0.16/ 0.11 0.09/ 0.09 NT phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphohydrolase hisD 0.68/ 0.08 0.12/ 0.11 (N)T histidinol dehydrogenase purine and pyrimidine biosynthesis (1) 128 purA purA 0.79/ 0.48 0.29/ 0.23 T adenylosuccinate synthetase PurR purB purB 0.30/ 0.07 0.05/ 0.04 NT adenylosuccinate lyase PurR purEKBCSQLFMNHD purE 0.62/ 0.12 0.06/ 0.08 (N)T phosphoribosylaminoimidazole carboxylase I PurR purK 0.43/ 0.10 0.07/ 0.10 (N)T phosphoribosylaminoimidazole carboxylase II purB 0.30/ 0.07 0.05/ 0.04 NT adenylosuccinate lyase purC 0.50/ 0.18 0.20/ 0.17 (N)T phosphoribosylaminoimidazole succinocarboxamide synthetase purS 0.39/ 0.17 0.08 /0.10 (N)T required for phosphoribosylformylglycinamidine synthetase activity purL 0.69/ 0.09 0.09/ 0.07 (N)T phosphoribosylformylglycinamidine synthetase II purQ 0.63/ 0.03 0.06/ 0.06 (N)T phosphoribosylformylglycinamidine synthetase I purF 1.37/ 0.06 0.07/ 0.06 (N)T glutamine phosphoribosylpyrophosphate amidotransferase purM 0.73/ 0.14 0.07/ 0.05 (N)T phosphoribosylaminoimidazole synthetase purN 0.72/ 0.08 0.08/ 0.06 (N)T phosphoribosylglycinamide formyltransferase purH 0.91/ 0.14 0.10/ 0.13 (N)T phosphoribosylaminoimidazole carboxy formyl formyltransferase / inosine-monophosphate purD 0.88/ 0.05 0.09/ 0.06 (N)T phosphoribosylglycinamide synthetase pyrRPBC-AA-AB-KDFE pyrR 0.14/ 0.19 0.25/ 0.25 NT activity PyrR pyrP 0.27/ 0.40 0.12/ 0.17 (N)T uracil permease pyrB 0.19/ 0.14 0.07/ 0.08 NT aspartate carbamoyltransferase pyrC 0.28/ 0.24 0.12/ 0.24 NT dihydroorotase pyrAA 0.27/ 0.18 0.06/ 0.05 NT carbamoyl-phosphate synthetase (glutaminase subunit) pyrAB 0.41/ 0.14 0.10/ 0.14 (N)T carbamoyl-phosphate synthetase (catalytic subunit) pyrK 0.38/ 0.13 0.13/ 0.11 (N)T dihydroorotate dehydrogenase (electron transfer subunit) Operon1) Gene Transcriptome2) Function/Similarity3) Regulon4) N1/ 2 T1/ 2 purine and pyrimidine biosynthesis (2) pyrD 0.53/ 0.14 0.13/ 0.14 (N)T dihydroorotate dehydrogenase (catalytic subunit) pyrF 0.52/ 0.14 0.17/ 0.21 (N)T orotidine 5'-phosphate decarboxylase pyrE 0.70/ 0.12 0.21/ 0.14 (N)T orotate phosphoribosyltransferase metabolism of coenzymes and prosthetic groups bioI bioI 0.46/ 0.83 0.23/ 0.22 T cytochrome P450 enzyme folD-yqiBCD folD 0.72/ 0.65 0.27/ 0.28 T methylenetetrahydrofolate dehydrogenase / methenyltetrahydrofolate cyclohydrolase yqiC 0.54/ 0.67 0.29/ 0.26 T similar to exodeoxyribonuclease VII (small subunit) yqiD 0.39/ 0.44 0.27/ 0.29 T similar to geranyltranstransferase panBCD panB 0.31/ 0.38 0.31/ 0.23 (N)T ketopantoate hydroxymethyltransferase panC 0.27/ 0.27 0.22/ 0.21 NT pantothenate synthetase

Protein modification dnaJ-yqeTUV yqeT 0.34/ 0.52 0.28/ 0.26 T similar to ribosomal protein L11 methyltransferase pcp pcp 0.80/ 0.63 0.32/ 0.32 T pyrrolidone-carboxylate peptidase transport (1) pbuG pbuG 0.62/ 0.31 0.27/ 0.17 (N)T hypoxanthine/guanine permease 129 xpt-pbuX pbuX 0.83/ 0.32 0.32/ 0.31 (N)T xanthine permease ptsGHI ptsG 0.40/ 0.23 0.12/ 0.11 (N)T PTS glucose-specific enzyme IICBA component yfiY yfiY 0.26/ 0.78 0.16/ 0.10 (N)T similar to iron(III) dicitrate transport permease yhfQ yhfQ 0.44/ 0.70 0.22/ 0.19 T similar to iron(III) dicitrate-binding protein ykaA-pit ykaA 0.32/ 0.36 0.24/ 0.21 (N)T putative gamma glutamyl tranferase pit 0.29/ 0.43 0.28/ 0.31 (N)T probable low-affinity inorganic phosphate transporter ykoFEDC ykoD 0.48/ 0.59 0.23/ 0.23 T similar to cation ABC transporter ykoC 0.72/ 0.53 0.27/ 0.32 T cobalt transport protein yoaDCB yoaD 0.19/ 0.31 0.74/ 0.70 N similar to phosphoglycerate dehydrogenase S-box yoaC 0.20/ 0.19 0.52/ 0.44 N similar to xylulokinase yoaB 0.26/ 0.16 0.25/ 0.34 NT similar to alpha-ketoglutarate permease yqiXYZ yqiX 0.04/ 0.81 0.06/ 0.04 (N)T similar to amino acid ABC transporter (binding protein) yqiY 0.11/ 1.24 0.13/ 0.13 (N)T similar to amino acid ABC transporter (permease) yqiZ 0.04/ 1.28 0.10/ 0.07 (N)T similar to amino acid ABC transporter (ATP-binding protein) others (1) ackA ackA 0.16/ 0.26 0.18/ 0.18 NT acetate kinase cca cca 0.35/ 0.45 0.32/ 0.30 T tRNA nucleotidyltransferase comQ comQ 0.39/ 0.20 0.25/ 0.27 transcriptional regulator of late competence operon (comG) and surfactin expression (srfA) dacA-yaaDE dacA 0.22/ 0.30 0.26/ 0.28 NT penicillin-binding protein 5 (D-alanyl-D-alanine carboxypeptidase) yaaD 0.92/ 0.62 0.27/ 0.24 T similar to pyridoxine biosynthesis protein Operon1) Gene Transcriptome2) Function/Similarity3) Regulon4) N1/ 2 T1/ 2 others(2) yaaE 1.05/ 0.70 0.27/ 0.28 T similar to amidotransferase degQ degQ 0.30/ 0.17 0.27/ 0.28 NT degradative enzyme production metK metK 0.38/ 0.26 0.17/ 0.18 (N)T S-adenosylmethionine synthetase mpr-ybfJ ybfJ 0.54/ 0.45 0.30/ 0.31 T unknown ndhF-ybcCDFHI ndhF 0.19/ 0.30 6.1/ 4.7 N NADH dehydrogenase (subunit 5) ybcC 0.17/ 0.14 5.2/ 3.8 N unknown pucH pucH 0.24/ 0.38 0.15/ 0.19 (N)T allantoinase sat-cysC-ylnD sat 0.44/ 0.20 0.23/ 0.32 (N)T probable sulfate adenylyltransferase S-box cysC 0.46/ 0.17 0.20/ 0.25 (N)T probable adenylylsulfate kinase ylnD 0.44/ 0.25 0.28/ 0.28 (N)T similar to uroporphyrin-III C-methyltransferase thrS thrS 0.28/ 0.25 0.24/ 0.30 NT threonyl-tRNA synthetase (major) ybaC ybaC 0.46/ 0.26 0.22/ 0.30 (N)T similar to proline iminopeptidase ybfFE ybfE 0.52/ 0.24 0.22/ 0.20 (N)T unknown yjlCD yjlC 0.40/ 0.34 0.24/ 0.25 T unknown RelA yjlD 0.52/ 0.44 0.23/ 0.24 T similar to NADH dehydrogenase RelA

yrrMNO-udk yrrM 0.26/ 0.32 0.18/ 0.22 NT similar to caffeoyl-CoA O-methyltransferase 130 yrrN 0.29/ 0.33 0.22/ 0.21 NT similar to protease udk 0.39/ 0.23 0.28/ 0.23 (N)T uridine kinase yscAB yscA 0.51/ 0.30 0.23/ 0.24 (N)T unknown yuzC yuzC 0.31/ 0.31 0.36/ 0.32 NT unknown yvgRQ yvgQ 0.37/ 0.14 0.11/ 0.12 (N)T similar to sulfite reductase 1) Repressed genes/proteins were assigned to known or potential operon structures. 2) The transcription level ratios (normalized intensity t0/normalized intensity control ) of two different experiments are indicated. Only genes with induction factors of ≤ 0.33 during the transition phase as revealed by transcriptome analyses were considered as significant. Missed genes on microarray are indicate d by “---“. 3) The function or similarity is derived from the SubtiList database ( http://genolist.fr/SubtiList/ ). 4) All listed genes were classified according to the previously described regulons: TnrA (Débarbouillé and Fisher, 2002; Yoshid a et al., 2003), RelA (Eymann et al., 2002) using the Genespring software from Silicon Genetics (version 7.1). The genes/proteins were assigned to main regulons that are given i n bold. 131

Chapter 5

Differential gene expression in response to

phenol and catechol reveal different metabolic activities for the

degradation of aromatic compounds in Bacillus subtilis

Le Thi Tam1, Christine Eymann1, Dirk Albrecht1, Rabea Sietmann1, Frieder Schauer1,

Michael Hecker1 and Haike Antelmann1#

#corresponding author

1Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität Greifswald, F.-L.-Jahn-Str. 15, D-

17487 Greifswald, Germany

# To whom correspondence should be addressed: Tel. +49-3834-864237, Fax. +49-

3834-864202, e-mail: [email protected]

Key words: Bacillus subtilis/ cytoplasmic proteome signatures/ transcriptomics/ phenol/ catechol/ extradiol dioxygenase

This chapter is in press in Environmental Microbiology. Doi:10.11111/j.1462-

2920.2006.01034.x

Blackwell Publishing LtdOxford, UKEMIEnvironmental Microbiology 1462-2912© 2006 The Authors; Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd2006••••Original ArticleB. subtilis response to phenol and catecholL. T. Tam et al.

Environmental Microbiology (2006) 132 doi:10.1111/j.1462-2920.2006.01034.x

Differential gene expression in response to phenol and catechol reveals different metabolic activities for the degradation of aromatic compounds in Bacillus subtilis

Le Thi Tam, Christine Eymann, Dirk Albrecht, essential for the growth and viability of B. subtilis in Rabea Sietmann, Frieder Schauer, Michael Hecker the presence of catechol. Thus, our studies revealed and Haike Antelmann* that the catechol-2,3-dioxygenase YfiE is the key Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität enzyme of a meta cleavage pathway in B. subtilis Greifswald, F.-L.-Jahn-Straße 15, D-17487 Greifswald, involved in the catabolism of catechol. Germany. Introduction Summary Large amounts of aromatic compounds are present in the Aromatic organic compounds that are present in the environment that must be removed as these often are environment can have toxic effects or provide carbon toxic to cellular systems. The catabolism of natural and sources for bacteria. We report here the global xenobiotic aromatic compounds was studied in variety of response of Bacillus subtilis 168 to phenol and cate- soil bacteria including also Bacillus species that are able chol using proteome and transcriptome analyses. to use these as sole carbon and energy source (van der Phenol induced the HrcA, sB and CtsR heat-shock Meer et al., 1992; Timmis et al., 1994). For example, phe- regulons as well as the Spx disulfide stress regulon. nol degrading strains of Bacillus stearothermophilus, Catechol caused the activation of the HrcA and CtsR Bacillus thermoleovorans and Bacillus thermoglucosida- heat-shock regulons and a thiol-specific oxidative sius have been isolated and the corresponding genes stress response involving the Spx, PerR and FurR involved in phenol degradation were cloned and charac- regulons but no induction of the sB regulon. The most terized (Dong et al., 1992; Kim and Oriel, 1995; Duffner surprising result was that several catabolite-con- and Muller, 1998; Milo et al., 1999; Duffner et al., 2000). trolled genes are derepressed by catechol, even if In contrast, B. subtilis ATCC 7003 was regarded as a glucose is taken up under these conditions. This dere- ‘secondary degrader’ in phenol degrading microbial con- pression of the carbon catabolite control was depen- sortia (DuTeau et al., 1998). Secondary degraders do not dent on the glucose concentration in the medium, as grow on the primary substrate (e.g. phenol), but rather glucose excess increased the derepression of the utilize secondary metabolites produced by primary CcpA-dependent lichenin utilization licBCAH operon degraders that are able to grow on the primary substrate and the ribose metabolism rbsRKDACB operon by (Senior et al., 1976). catechol. Growth and viability experiments with cate- Aerobic bacteria initially hydroxylate the aromatic ring chol as sole carbon source suggested that B. subtilis of phenolic compounds, producing catecholic metabolites is not able to utilize catechol as a carbon-energy with hydroxyl groups at adjacent carbon atoms that are source. In addition, the microarray results revealed channelled into the ortho cleavage pathway (also termed the very strong induction of the yfiDE operon by cate- as β-ketoadipate pathway) or the meta cleavage pathway chol of which the yfiE gene shares similarities to (Harayama et al., 1992; Eltis and Bolin, 1996). Although glyoxalases/bleomycin resistance proteins/extradiol bacteria are able to degrade aromatic phenolic com- dioxygenases. Using recombinant His6-YfiEBs we pounds, the bioremediation processes are often limited by demonstrate that YfiE shows catechol-2,3-dioxygen- slow conversion rates and many xenobiotics cause toxic ase activity in the presence of catechol as the metab- effects in the cell, such as membrane or protein damage. olite 2-hydroxymuconic semialdehyde was measured. For example aromatic substances like benzoate, aniline, Furthermore, both genes of the yfiDE operon are phenol and catechol have been shown to induce biodegradation-related enzymes as well as other heat or oxidative stress-specific proteins in soil bacteria (Giuffrida Received 24 January, 2005; accepted 9 March, 2006. *For correspondence. E-mail [email protected]; Tel. (+49) 3834 864237; et al., 2001). These stress proteins confer resistance Fax (+49) 3834 864202. mechanisms against the aromatic compounds to protect

2 L. T. Tam et al. 133 the cell against the deleterious effects of these toxic the function of a catechol-induced ring cleavage extradiol compounds. The induction of stress reponses caused by dioxygenase (YfiE) in B. subtilis 168, which is required for aromatic phenolic compounds has been shown in the growth and viability in the presence of catechol and Pseudomonas putida (Lupi et al., 1995), Methylocystis sp. probably involved in the degradation of catechol but not (Uchiyama et al., 1999), Burkholderia sp. (Cho et al., phenol. 2000), Acinetobacter radioresistens (Giuffrida et al., 2001), Acinetobacter calcoaceticus (Benndorf et al., Results 2001), Acinetobacter lwoffii (Kim et al., 2004), Stenotro- phomonas sp. (Ho et al., 2004) or P. putida (Santos et al., Growth curves and viable counts for phenol and catechol 2004; Segura et al., 2005). Specifically, a heat-shock in B. subtilis 168 response was found to be induced by phenol in To study the gene expression profiles of B. subtilis 168 in A. calcoaceticus whereas catechol predominantly the presence of phenol and catechol, proteome and tran- induced oxidative stress proteins as revealed by proteome scriptome analyses were performed. For these analyses analyses (Benndorf et al., 2001). It has been shown that cells were treated with sublethal but growth-inhibitory con- phenol and other chaotropic solutes that do not affect centrations that decreased the growth rate halfmaximal, turgor reduce water activity, perturb macromolecule– for phenol 16 mM (1× MIC, minimal inhibitory concentra- water interactions and destabilize cellular macromole- tion) and for catechol stress 2.4 mM (8× MIC) (Fig. 1A and cules, inhibit the growth and are powerful mediators of B). In the case of catechol stress, higher concentrations water stress in P. putida. In addition, the chaotropic solute- than 2.4 mM did not result in a stronger decrease of the induced water stress resulted in the induction of proteins growth rate and the medium was red-coloured in 4.8 mM involved in stabilization of protein structures, in lipid catechol (16× MIC). In addition, the number of viable metabolism and membrane composition in P. putida counts was determined in response to these sublethal (Hallsworth et al., 2003). concentrations of phenol and catechol (Fig. 1A and B). In Bacillus subtilis 168 several stress and starvation These survival assays revealed that the number of cells regulons have been extensively studied using proteome is increased after the addition of 16 mM phenol and and transcriptome techniques and a complex data set is 2.4 mM catechol suggesting that these concentrations of now available indicating specific or more general stress or phenol and catechol are not toxic to the cells (Fig. 1A and starvation responses (Petersohn et al., 2001; Yoshida B). After different times of exposure to stress (10–30 min) et al., 2001; Cao et al., 2002; Eymann et al., 2002; Bern- samples were taken for L-[35S]-methionine-labelling or hardt et al., 2003; Helmann et al., 2003; Leichert et al., RNA preparation and subjected to analytical proteome 2003; Nakano et al., 2003; Mostertz et al., 2004; Koburger analysis or DNA microarray analysis. et al., 2005). At the second stage the stimulons are classified in better defined regulons by the comparative pro- Phenol stress induced a heat-shock response in teome and transcriptome analyses of wild-type strains B. subtilis 168 and regulatory mutants (e.g. HrcA, CtsR, PerR, Fur, MntR, Zur, CodY, CcpA, σB, σM, σW, σX, etc.). These complex data The transcriptome analysis in response to 16 mM phenol sets of regulons and the inducing conditions should be the stress revealed the induction of 122 genes and repression basis now to predict the mode of action for aromatic phe- of 199 genes after 10 min (Table 1, and Supplementary nolic compounds in B. subtilis 168. material Table S1) in two independent stress experiments. Currently, there is only little information about the The induction of these 122 genes was most strongly after response of B. subtilis 168 to aromatic phenolic com- 10 min of phenol stress and decreased at the 20 and pounds, which are often found in contaminated soils. Fur- 30 min time points after phenol stress (data not shown). thermore, it is not known if B. subtilis 168 is able to Genes with at least threefold induction ratios in both inde- degrade and detoxify these toxic compounds. Thus, we pendent experiments were considered to be induced. The have analysed the expression profile after the exposure most strongly induced genes after phenol stress belong of B. subtilis 168 to sublethal concentrations of phenol to the heat-shock stimulon including class I, II, III heat- and catechol using the proteomic and transcriptomic shock genes. As phenol resulted in the induction of the approaches. The results showed a classical heat-shock HrcA-regulon (three- to 12-fold), the CtsR regulon (three- signature for phenol involving the HrcA, CtsR and σB re- to 10-fold) as well as of 44 σB-dependent general stress gulons as well as a disulfide stress response conferred by genes (three- to 21-fold), the transcriptome results are the Spx regulatory protein. In contrast, catechol caused a indicative for a heat-shock signature (Table 1). Consistent derepression of several catabolite-controlled proteins, a with these DNA array results a classical heat-shock pro- thiol-specific oxidative stress response and a type I and teome signature was obtained after phenol stress as class III heat-shock response. Finally, we were able to describe I, II and III heat-shock proteins were most strongly induced

134 B. subtilis response to phenol and catechol 3 10 1010 10 1010 A B

1 109 1 109 500 500 OD CFU/ml CFU/ml OD

0.1 108 0.1 108

0.01 107 0.01 107 050100 150 200 250 300 350 400 450 050100150 200 250 300 350 400 450 Time (min) Time (min)

control OD 8 mM phenol OD 16 mM phenol OD 500 500 500 control OD500 2.4 mM catechol OD500 3.6 mM catechol OD500 control CFU/ml 8 mM phenol CFU/ml 16 mM phenol CFU/ml control CFU/ml 2.4 mM catechol CFU/ml 3.6 mM catechol CFU/ml

Fig. 1. Growth curves and viable counts of B. subtilis 168 in the presence of different concentrations of phenol (A) and catechol (B). Bacillus subtilis was grown in minimal medium to an OD500 of 0.4 and treated with different concentrations of phenol and catechol, which is indicated by arrows. Appropriate dilutions were plated for viable counts (cfu ml−1). in the cytoplasmic proteome after phenol stress (Fig. 2). tome analysis (Table 2 and Supplementary material Interestingly, also the Spx regulon involved in mainte- Table S2). The induction of these 154 genes was most nance of thiol homeostasis was induced in the transcrip- strongly after 10 min and decreased after 20 and 30 min tome analysis including for example trxA (four- to sixfold), of exposure to catechol stress (data not shown). The tpx (three- to fourfold), msrA (four- to fivefold), nfrA (six- response triggered by catechol was different from that of to 11-fold), which indicate that cells suffer from thiol-spe- phenol. For example, class I and III heat-shock genes cific stress (Nakano et al., 2003; Zuber, 2004). The Spx were strongly induced by catechol but we detected no regulon induction by phenol was also reflected in the induction of the σB-dependent general stress genes proteome that showed increased synthesis of NfrA, Tpx (Table 2). Interestingly, most of the significantly upregu- and TrxA (Fig. 2). In addition, the ECF sigma factor sigY- lated genes were members of the oxidative stress-specific yxlCDEF operon (five- to 11-fold) and the LiaRS two- PerR and Spx regulons that are induced also by diamide component system (five- to sevenfold) were induced by (Helmann et al., 2003; Leichert et al., 2003; Nakano et al., phenol stress (Cao et al., 2003; Mascher et al., 2004). 2003; Mostertz et al., 2004). In accordance with the tran- The addition of phenol caused a reduced growth rate scriptome results, the proteome signature induced by cat- that is indicated by the induction of the RelA-dependent echol showed overlaps to that of diamide indicating a thiol- yvyD gene as well as the repression of negatively RelA- specific oxidative stress response (Fig. 3). In addition, controlled genes involved in protein biosynthesis (genes genes and proteins involved in sulfur assimilation and for elongation factors and ribosomal proteins). Further- biosynthesis of sulfur-containing amino acids methionine more, other growth-phase-regulated genes involved in the and cysteine were induced also by catechol (Table 2, metabolism of purine and pyrimidine, ATP generation, bio- Fig. 3). synthesis of cysteine and histidine, cell wall metabolism, The transcriptome analyses suggested that catechol motility and chemotaxis are repressed by phenol (Supple- derepressed 39 genes that are under CcpA-dependent mentary material Table S1). and CcpA-independent carbon catabolite control (Table 2). Of the 30 CcpA-dependent genes we found most strongly derepressed the licBCAH operon (20- to Catechol caused the derepression of the carbon 160-fold) involved in the transport and metabolism of oli- catabolite repression and the thiol-specific oxidative and gomeric β-glucosides that are produced by degradation of heat stress response in B. subtilis 168 lichenan (Tobisch et al., 1997). In addition, the bglPH In response to 2.4 mM catechol stress, 154 genes were operon was derepressed by catechol, which is involved in induced and 118 genes were repressed in the transcrip- the utilization of aryl-β-glucosides like salicin or arbutin

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 4 L. T. Tam et al. 135 Table 1. Induction proﬁle after 10 min of phenol stress as revealed by transcriptome and proteome analyses.

Regulona Operonb Genec Transcriptomed Proteomee Function/similarityf

HrcA hrcA-grpE- dnaK 3.7 3 3.02 3.4 Class I heat-shock protein (molecular chaperone) dnaK-dnaJ hrcA 4.1 4.1 Transcriptional repressor of class I heat-shock genes groESL groEL 11.1 5.9 3.3 13 Class I heat-shock protein (chaperone) groES 12 9.2 Class I heat-shock protein (chaperone) sB csbC 3.6 3.6 Putative sugar transporter csbD 11.5 15.9 SigmaB-controlled gene ctc _ 2.9 2.5 10.1 General stress protein dps _ 6.8 2.5 5.7 DNA-protecting protein gsiB 10.7 21.5 3.8 26.6 General stress protein gspA 10.9 16.7 5.4 10.1 General stress protein gtaB __3.3 22 Glycosylation of teichoic acid σF katX 5.05 3.2 Major catalase in spores rsbR 33 Positive regulator of sigmaB activity ybyB 7.7 13 Unknown ycbP 4.3 7.3 Integral membrane protein ycdFG ycdF 3.2 4.7 ND 22.2 Similar to glucose 1-dehydrogenase σW yceCDEFGH yceC 3.1 2.4 3.6 4.2 Similar to tellurium resistance protein yceD 3.1 2.5 3.7 5.3 Similar to tellurium resistance protein yceH 3.7 3.2 2.5 2.4 Similar to toxic anion resistance protein ydaDE ydaD 7.4 13.1 Oxidoreductase ydaE 6.4 8.4 4.1 9.8 Unknown ydaT 4.1 4.2 Unknown ydaP 4.7 7.3 Similar to pyruvate oxidase ydbD 10.5 14.7 Similar to manganese-containing catalase yfkM 10.1 3.1 4.3 7 General stress protein yﬂH 4.8 5.2 Unknown yﬂT* 8.1 15.1 General stress protein ygxB 11.9 12.8 Permeases of the major facilitator superfamily yhdF 5.5 5.9 Short-chain dehydrogenase/reductase SDR yhdN 3.9 4.1 3.5 7.1 Similar to aldo/keto reductase yjgB 4.1 4.5 Unknown yjgCD yjgC 3.6 4.7 Similar to formate dehydrogenase yjgD 5.8 8.9 Hypothetical protein ykzA 7 10.6 4.2 6.2 Similar to organic hydroperoxide resistance protein yocK 4.3 4.1 Similar to general stress protein yoxC 6.6 7.4 Similar to general stress protein Spx yraA 4.3 5.8 General stress protein ysnF 12 9.9 3.4 52.7 Hypothetical protein σH ytxGHJ ytxG 3 4.2 Similar to general stress protein ytxH 3.3 3.4 2.3 3.2 Similar to general stress protein yvaA 3.9 4.5 Oxidoreductase yvgN 6.8 5 Oxidoreductase, aldo/keto reductase family σH yvyD 10.2 10.8 4.2 10.3 Similar to sigma-54 modulating factor ywsB 5.1 6.5 N-acetylmuramoyl-L-alanine amidase ywzA 6.6 8.8 Transglycosylase-associated protein yxaB 5.7 4.5 Exopolysaccharide biosynthesis protein yxkO 3.4 4.2 Member of a ribokinase-like superfamily, putative kinase yycD 8.7 6.2 Unknown

CtsR clpE 2.6 2.5 8.7 10.9 ATP-dependent Clp protease-like σB clpP 6.5 8.1 3.1 6.8 ATP-dependent Clp protease proteolytic subunit σB ctsR-mcsAB- ctsR 6.6 5.8 Transcriptional repressor of class III stress genes clpC-radA-yacK mcsA 4.7 4 Modulator of CtsR repression mcsB 7.9 8.2 Modulator of CtsR repression clpC 10.3 8.2 3 23.2 Class III stress response-related ATPase radA 3.4 4.1 DNA repair protein homologue yacK 3.5 4.1 DNA-binding protein

Spx hemH 4.7 4.2 Ferrochelatase iolS 4.1 3.6 3.1 6.8 Myo-inositol catabolism mecA 3 3.4 Negative regulator of competence msrA 4.4 4.9 Peptidyl methionine sulfoxide reductase

Regulona Operonb Genec Transcriptomed Proteomee Function/similarityf

σD nfrA-ywcH nfrA 10.6 5.9 3.1 5.3 FMN-containing NADPH-linked nitro/ﬂavin reductase ywcH 4 3.8 Similar to monooxygenase tpx 3 3.6 2.8 3.8 Probable thiol peroxidase

σB trxA *45.9 Thioredoxin yhfK 3.6 4.1 7 5 Nucleoside-diphosphate-sugar epimerase yhfJ 4.4 3 Similar to lipoate-protein ligase σM σB yjbCD spx (yjbD) 3.9 2.9 Glutaredoxin family protein Spx yjbG 6.3 3.7 2 5.1 Oligoendopeptidase F homologue yjbH 3.7 3.5 Dithiol-disulﬁde isomerase yrzG 3.2 3.7 Probable serine/threonine-protein kinase yuaE 4.5 7.4 3.3 103 Unknown ywrO 3 4.2 General stress protein yfjR 2.3 2.3 3.1 4.6 Dehydrogenase precursor yugJ 3.9 3.7 2.7 3 Probable NADH-dependent butanol dehydrogenase 1

RelA ureABC ureA 66 Urease (gamma subunit) TnrA, CodY ureB 8.5 7.7 Urease (beta subunit) ureC 7.4 6.2 ND 4.2 Urease (alpha subunit) ytzB 6.9 7.9 Unknown ytzE 3.6 6 Probable transcriptional regulator

Others cydD 3.2 3 ABC transporter required for expression of cytochrome bd dhaS 4.8 3.3 ND 8.3 Aldehyde dehydrogenase fabHB 13.7 7.8 Beta-ketoacyl-acyl carrier protein synthase III Fnr fnr 4.4 6 Transcriptional regulator of anaerobic genes gcvPA 4.3 3.1 Probable glycine decarboxylase (subunit 1) gcvT 4.3 3.6 Probable aminomethyltransferase lipA 3.6 4.4 Probable lipoic acid synthetase pel 3.1 3.2 Pectate lyase rapG-phrG rapG 2.1 2.6 ND 4.4 Response regulator aspartate phosphatase σH phrG 3.3 3.9 Phosphatase (RapG) regulator rapB 3.2 5.3 Response regulator aspartate phosphatase – dephosphorylates Spo0F-P rapC-phrC rapC 3.3 3 Response regulator aspartate phosphatase σY sigY-yxlCDEFG sigY 11.2 8.9 RNA polymerase ECF-type sigma factor yxlC 8.8 6.3 Hypothetical protein yxlD 10.2 7.4 Hypothetical protein yxlE 9.1 8.1 Hypothetical protein yxlF 6.4 4.6 Similar to ABC transporter (ATP-binding protein) yacA 3.6 3.1 tRNA(Ile)-lysidine synthase ybgE 3 3.1 Similar to branched-chain amino acid aminotransferase yfhJ 3 4.3 Unknown yhaA 4.6 3.9 Similar to aminoacylase yhdP 3.4 3.2 Similar to haemolysin yhfE 4.5 3.1 ND 7.7 Similar to glucanase yhfP 8 4.2 Similar to unknown proteins yhgC 5 5.5 Signal transduction protein TRAP yhjL 8.8 15.4 Similar to sensory transduction pleiotropic regulatory protein yhzC 3.9 4.3 Unknown ykgB 3.9 3 6-Phosphogluconolactonase ykrL 6.2 3.9 Similar to heat-shock protein yotE 5.2 5.7 Hypothetical protein yppQ 6 5.3 Similar to peptide methionine sulfoxide reductase yrzF 4.3 5.2 Probable serine/threonine-protein kinase yunF 4.4 5.7 Unknown yusU 5.8 4.2 Hypothetical protein yusV 5.6 4.6 Similar to iron(III) dicitrate transport permease yvcT 3.5 3.6 2.3 7.5 Similar to glycerate dehydrogenase LiaRS liaIHGFSR liaR 7.2 5.2 Reponse regulator induced by cell wall active antibiotics (yvqC) vancomycin, bacitracin

Regulona Operonb Genec Transcriptomed Proteomee Function/similarityf

liaS 5.8 6.3 Sensor histidine kinase induced by cell wall active (yvqE) antibiotics vancomycin, bacitracin ywfI 4.3 6.1 3.3 4.6 Chlorite dismutase yxiE 9.1 5.9 Hypothetical protein yxlH 4.1 4 Major facilitator (MFS) superfamily protein salA 4.1 2.7 2.9 4.4 ATPase involved in chromosome partitioning (ybaL) yisK 4.1 3 2.8 3.4 Fumarylacetoacetate (FAA) hydrolase a–c. All genes with an induction factors of at least three as revealed by proteome or transcriptome analyses were classiﬁed according to the array data of previously described regulons (HrcA, σB, CtsR, Spx, RelA) (Petersohn et al., 2001; Eymann et al., 2002; Nakano et al., 2003) and the operon structure is indicated. The main regulator of the induced genes is shown in bold. d. For the transcriptome analysis the induction ratios of two reproducible experiments were shown. Genes that were missed in the microarrays but for which induction ratios were measured in the proteome analysis are indicated by dash (–). e. The protein synthesis ratios correspond to two independent stress experiments. *In the case of yﬂT and trxA no protein induction ratio could be calculated as this protein migrates at the bottom line of the 2-D gel. f. The function is derived from the SubtiList database (http://genolist.fr/SubtiList/).

Fig. 2. The dual-channel image of the protein pH 7 4 synthesis pattern of B. subtilis 168 before (green image) and 10 min after the exposure to control 16 mM phenol (red image). Cytoplasmic proteins were labelled with L-[35S]methionine and separated by 2D-PAGE as described in Exper- phenol imental procedures. Image analysis of the autoradiograms was performed using the Decodon ClpC ClpC stress ClpE Delta 2D software. Proteins that are synthe- DnaK sized at increased levels in response to phenol YjbG UreC stress in at least two independent experiments GroEL are indicated by red labels. Their respective induction ratios are listed in Table 1. Spot iden- tiﬁcation was performed using MALDI-TOF– DhaS TOF mass spectrometry from Coomassie- stained 2-D gels as described in the Experi- YhfE YsnF mental procedures section.

YceH RapG YhdN YugJ

IolS YvcT YisK GspA GtaB Ctc YcdF GtaB

YfjR NfrA YhfK YvyD YceC YwfI YceD

YfkM ClpP

YdaE YuaE

YtxH Dps

Tpx GsiB

YkzA

TrxA YflT

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 138 B. subtilis response to phenol and catechol 7 Table 2. Induction proﬁle after 10 min of catechol stress as revealed by transcriptome and proteome analyses.

Regulona Operonb Genec Transcriptomed Proteomee Function/similarityf

HrcA groELS groEL 4.2 5.7 4.4 5 Class I heat-shock protein (chaperonin) groES 5.5 7.3 7.3 ND Class I heat-shock protein (chaperonin) hrcA-grpE- hrcA 3.9 6.5 Transcriptional repressor of class I heat-shock genes dnaK-dnaJ

CtsR clpE 9.8 20 7.6 12.2 ATP-dependent Clp protease-like σB clpP 6.3 5.8 5.4 4.4 ATP-dependent Clp protease proteolytic subunit σB ctsR-mcsAB- ctsR 7.4 10.7 Transcriptional repressor of class III stress genes clpC-radA-yacK mcsA 4.5 7.7 Modulator of CtsR repression mcsB 5.5 13.5 Modulator of CtsR repression clpC 6.1 12.2 3.9 4.6 Class III stress response-related ATPase lonA 3.4 3.5 Class III heat-shock ATP-dependent protease

PerR ahpCF ahpC 2.2 2.5 2.1 2.3 Alkyl hydroperoxide reductase (small subunit) ahpF 3.8 3.4 2.2 2.9 Alkyl hydroperoxide reductase (large subunit) katA 3.8 6.5 5.9 9.6 Vegetative catalase 1 mrgA 3.9 _ 3.7 14.2 Metalloregulation DNA-binding stress protein

Fur dhbACEBF dhbB 3 5.6 Isochorismatase (siderophore 2,3-dihydroxybenzoate synthesis) dhbE 3.4 21.9 2,3-dihydroxybenzoate-AMP ligase (siderophore 2,3-dihydroxybenzoate synthesis) Spx gapTD gabD 4.9 10.3 Succinate-semialdehyde dehydrogenase ykuNOP ykuN 4.7 8.5 Probable ﬂavodoxin 1 ykuO 6.3 11 Glycoside hydrolase ykuP 7 8.5 Probable ﬂavodoxin 2

Sulfur- yrrT-mtn- cysK 4.4 5.5 2.5 7.7 Cysteine synthetase A limitation yrhA-yrhB yrrT 5.8 8.7 Probable S-adenosylmethionine mtn 5 5.8 Methylthioadenosine nucleosidase yrhA 11.7 10.8 Cysteine synthase yrhB 10.2 23.8 4.3 10.2 Cystathionine gamma-lyase ytlI 35 Transcriptional regulator, LysR family Spx yxeIJKLMNOPQ yxeI 10.4 14.1 Choloylglycine hydrolase yxeJ 4 3.6 Unknown yxeK 3 2.6 Xenobiotic compound monooxygenase, DszA family yxeL 5 5.1 Acetyltransferase, GNAT family yxeM 4.2 3.7 Probable amino-acid ABC transporter-binding protein yxeN 3.6 3.1 Probable amino-acid ABC transporter permease protein yxeO 3.6 3.2 Probable amino-acid ABC transporter ATP-binding protein yxeP –– 8.6 8.1 Peptidase, M20/M25/M40 family

Spx nfrA-ywcH nfrA 8.6 9.6 2.7 4.4 FMN-containing NADPH-linked nitro/flavin reductase σB σM spx (yjbD) 4.1 5.6 Glutaredoxin family protein Spx σB trxA 5.1 8 2.8 ND Thioredoxin trxB 2.9 5.2 2.8 2.1 Thioredoxin reductase tpx 4.4 3.3 2.9 Thiol peroxidase msrA 4.7 6.8 Peptidyl methionine sulfoxide reductase hemH 5.7 4.6 Ferrochelatase IolR iolS 3 5.2 2.1 3.6 Myo-inositol catabolism mecA 6.3 8.7 Negative regulator of competence zwf 4.5 3.4 Glucose-6-phosphate 1-dehydrogenase citZ 2.9 3 2.1 6.1 Citrate synthase II yfjR 2.9 4.2 2.4 3.4 Dehydrogenase precursor yhfK 5.4 5.5 18.7 54.8 Nucleoside-diphosphate-sugar epimerase yhdQ 4.2 4.8 HTH-type transcriptional regulator cueR yjbG 3.8 6 2.7 2 Oligoendopeptidase F homologue yjbH 5 4.6 Dithiol-disulfide isomerase yjbI 3.9 3.7 Haemoglobin-like protein yqiG 2.9 4 2.6 2.7 NADH-dependent flavin oxidoreductase yraA 10.6 9.9 General stress protein yrzF 5.1 7.9 Probable serine/threonine-protein kinase yrzG 4.3 6.3 Probable serine/threonine-protein kinase yuaE 4.4 7.8 2.9 3 Unknown yugJ 3.1 3.3 2 2.6 Probable NADH-dependent butanol dehydrogenase 1 ywrO 3.3 3.7 General stress protein 14

Regulona Operonb Genec Transcriptomed Proteomee Function/similarityf

RelA ureABC ureA 2.7 4.6 Urease (gamma subunit) CodY, TnrA, ureB 3.8 6.1 Urease (beta subunit) GlnR ureC 3.1 5.8 6.8 6.2 Urease (alpha subunit) ytzB 3.5 4 Unknown ytzE 4.1 4.5 Grobable transcriptional regulator σB σH yvyD 4.4 6.1 4.4 6.9 Similar to sigma-54 modulating factor

Catabolite acoR 3.8 4.4 control – CcpA acsA 7.2 5.1 3.4 4.7 Acetyl-CoA synthetase LicT bglPH-yxiE bglP 5.1 6.3 PTS beta-glucoside-specific enzyme IIBCA component bglH __ 6.4 11 Beta-glucosidase yxiE 9.5 18 Probably universal stress protein uspA and related nucleotide-binding proteins citM-yflN citM 10.6 11.6 Secondary transporter of divalent metal ions/citrate complexes yflN 3.8 7.9 Metal-dependent hydrolase cstA 4.9 5.2 Carbon starvation-induced protein glpFK glpF 7.7 11.1 Glycerol uptake facilitator glpK 7.6 7.8 3 4.3 Glycerol kinase GntR gntRKPZ gntR 6.4 5.1 Transcriptional repressor of the gluconate operon gntK 7.3 6.8 Gluconate kinase gntP 6.7 4.8 Gluconate permease gntZ 8.1 14.3 6-Phosphogluconate dehydrogenase LevR levDEFGsacC levD 4.2 8.5 PTS fructose-specific enzyme IIA component levE 2.6 4.1 PTS fructose-specific enzyme IIB component levF 3.8 4.1 PTS fructose-specific enzyme IIC component levG 4.4 4.1 PTS fructose-specific enzyme IID component sacC 3.4 4 Levanase LicR licBCAH licB 76.9 161 PTS lichenan-specific enzyme IIB component licC 21.8 20 PTS lichenan-specific enzyme IIC component licA 32.5 41.5 PTS lichenan-specific enzyme IIA component licH 22.3 22.4 102.4 61.3 6-Phospho-beta-glucosidase licR 4.5 3.5 Transcriptional activator of the lichenan operon RbsR rbsRKDACB rbsR 7.9 5.2 Transcriptional repressor of the ribose operon rbsK 12 8.4 Ribokinase rbsD 8.7 8.2 Ribose ABC transporter (membrane protein) rbsA 14.8 18.6 3.1 3.3 Ribose ABC transporter rbsC 12.9 7.4 Ribose ABC transporter (permease) rbsB 22.2 23.7 Ribose ABC transporter – not CcpA iolABCDEFGHIJ mmsA 3 5.7 Methylmalonate-semialdehyde dehydrogenase (IolA) IolR iolB 4.5 4.4 Myo-inositol catabolism iolC 4.4 5.2 Similar to fructokinases, 2-keto-3-deoxygluconate kinases and ribokinases iolD 4.5 5.8 Similar to acetolactate synthases iolE 5.2 6.6 Similar to MocC of Rhizobium meliloti iolF 3.2 3 Inositol transport protein idh (iolG) 4.8 5.8 Myo-inositol 2-dehydrogenase iolH 3.6 6.5 Myo-inositol catabolism iolI 3.8 4.5 Similar to glyoxylate-induced protein SacT sacPA sacP 4.4 7 PTS sucrose-specific enzyme IIBC component sacA 11.6 10.6 Sucrase-6-phosphate hydrolase

Others dhaS 3.4 7.6 Aldehyde dehydrogenase σH cah 3.2 4.6 2.5 8.3 Cephalosporin C deacetylase luxS 3.6 3.3 Probable autoinducer-2 production protein σE phoPR phoP 3.4 4.3 Two-component response regulator involved in phosphate regulation phoR 3.1 3.7 Two-component sensor histidine kinase involved in phosphate regulation yacA 3.6 3.8 tRNA(Ile)-lysidine synthase

Regulona Operonb Genec Transcriptomed Proteomee Function/similarityf

ydfNO ydfN 5 18.8 8.4 17.6 Nitroreductase ydfO 3.9 16.2 4.4 3.4 Glyoxalase/bleomycin resistance protein yerA 6.2 12.3 Adenine deaminase yetG 5.5 8 Antibiotic biosynthesis monooxygenase domain protein yezD 7.5 3.3 Unknown yfhJ 7.4 15.2 Unknown yfiDE yfiD 70.2 87.8 Conserved membrane protein yfiE 45.6 40.1 Glyoxalase/bleomycin resistance protein/dioxygenase yhaA 4 5.2 Similar to aminoacylase yhaSTU yhaS 3 3.6 Unknown yhdP 3.7 4.3 Similar to haemolysin yhzC 3.6 4.8 Unknown ykcA 9.6 19 3.5 4.8 Glyoxalase/bleomycin resistance protein/dioxygenase domain ykoM 3.8 6.3 Similar to transcriptional regulator (MarR family) ylbP 22.1 24.5 GCN5-related N-acetyltransferase yocJ 36.7 42.1 5.4 32.4 NAD(P)H dehydrogenase yodB 3.5 4 Transcriptional regulator, MarR family yodC 5.1 9.2 2.8 5.6 Similar to nitroreductase yodD 5.1 10.9 Phospholipase/carboxylesterase family yojF 3 4.1 Unknown yppQ 6.2 8.2 Similar to peptide methionine sulfoxide reductase yqaR 3.2 4 Unknown yqkE 3.3 4.5 Unknown yrbE 3.9 4.8 Oxidoreductase, NAD-binding, GFO/IDH/MOCA family yrhO 3.1 3.4 Similar to cyclodextrin metabolism ysfE 3.3 4.8 Glyoxalase family protein ytdI 3.6 4.2 ATP-NAD kinase ytwI 3 3.5 Conserved membrane protein yunF 8.2 9.4 Unknown yusZ 3.8 6.2 Short-chain dehydrogenase/reductase yvgN 8.7 9.6 Oxidoreductase, aldo/keto reductase family CssRS htrB 5 6.7 cssRS-dependent htrA-like protease induced by secretion (yvtA) stress ywdA 4.9 4.9 Unknown ywfI 3 3.4 2.8 3.1 Chlorite dismutase ywlF 3.2 3.4 Similar to ribose 5-phosphate epimerase (pentose phosphate) ywnAB ywnA 15.4 28.9 Putative DNA binding protein ywnB 7.2 29.9 NADH-dependent flavin oxidoreductase ywnF 8.2 7.6 Unknown σB ywsB 11.9 16.3 N-acetylmuramoyl-L-alanine amidase ywsC 3.8 3.6 Similar to capsular polyglutamate biosynthesis yxlA 3.9 10.4 Similar to purine-cytosine permease yvaB –– 6.2 23.2 Similar to NAD(P)H dehydrogenase (quinone) yybR 3.8 4.4 Similar to ester hydrolase a–c. All genes with an induction factors of at least three as revealed by proteome or transcriptome analyses were classified according to the array data of previously described regulons (HrcA, CtsR, PerR, Fur, Spx, RelA, CcpA) (Petersohn et al., 2001; Yoshida et al., 2001; Eymann et al., 2002; Bernhardt et al., 2003; Helmann et al., 2003; Nakano et al., 2003; Mostertz et al., 2004; Koburger et al., 2005) and the operon structure is indicated. The main regulator of the induced genes is shown in bold. d. For the transcriptome analysis the induction ratios of two independent experiments were shown. Genes that were missed in the microarrays but for which induction ratios were measured in the proteome analysis are indicated by dash (–). e. The protein synthesis ratios correspond to two independent stress experiments. f. The function is derived from the SubtiList database (http://genolist.fr/SubtiList/).

(Krüger and Hecker, 1995). Other catechol-induced cata- reﬂected in the cytoplasmic proteome (Fig. 3). Thus, the bolite-controlled genes are involved in the catabolism of global response to catechol shows overlaps with the alternative carbohydrates like acetate (acsA), glycerol expression proﬁle when B. subtilis was grown under glu- (glpF, K), levan (levD, E, F, G), ribose (rbsR, A, B, C, D, cose starvation conditions (Yoshida et al., 2001; Bern- K), inositol (iolA, B, C, D, E, F, G, H, I, J, R, S), gluconate hardt et al., 2003; Koburger et al., 2005). (gntK, P, R, Z). The induction of the catabolite-controlled As the exposure to 2.4 mM catechol provoked also a proteins AcsA, BglH, GlpK, LicH and RbsA was also reduced growth rate (see Fig. 1) the stringent response

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 10 L. T. Tam et al. 141 pH 7 4 Fig. 3. The dual-channel image of the protein synthesis pattern of B. subtilis 168 before MrgA (green image) and 10 min after the exposure to control 2.4 mM catechol (red image). Cytoplasmic proteins were labelled with L-[35S]methionine and separated by 2D-PAGE as described in Exper- catechol imental procedures. Image analysis of the auto- ClpE stress ClpC radiograms was performed using the Decodon Delta 2D software. Proteins that are synthe- YjbG UreC GroEL AcsA sized at increased levels in response to KatA catechol stress in at least two independent BglH RbsA LicH DhaS AhpF experiments are indicated by red labels. Their GlpK respective induction ratios are listed in Table 2.

YqiG Spot identiﬁcation was performed using YrhB MALDI-TOF–TOF mass spectrometry from CitZYxeP YugJ Coomassie-stained 2-D gels as described in YdfO the Experimental procedures section. YkcA IolS Cah TrxB

YfjR CysK YwfI NfrA YhfK YvaB YdfN YvyD YodC ClpP YocJ YuaE AhpC

Tpx

MrgA

TrxA GroES

was also induced by catechol reflected by the induction of aliquots of cells were separated from the growth medium yvyD and the repression of genes involved in protein by centrifugation and re-suspended in fresh minimal synthesis (Supplementary material Table S2). In addition, medium to measure the optical density (OD). The results other growth-phase-regulated genes involved in purine showed a very slightly increased OD with higher amounts and pyrimidine metabolism, ATP generation, cell wall of catechol (1.2–3.6 mM) as sole carbon source (Fig. 4A). metabolism, motility and chemotaxis were also repressed However, determination of the viable counts revealed that in the presence of catechol (Supplementary material the number of cells decreased 1000-fold with all catechol Table S2). concentrations that were supplied as sole carbon source (Fig. 4A). Furthermore, cells could not use catechol to overcome the glucose starvation response (Fig. 4B). This Growth rate, viable counts and glucose uptake of indicates that cells are not able to grow with catechol as B. subtilis 168 in the presence of catechol as sole and sole carbon source and that catechol is toxic for cells at alternative carbon-energy source low densities. We raised the question whether B. subtilis is able to utilize We further investigated if the glucose uptake is influ- catechol as sole or alternative carbon-energy source. The enced by the addition of catechol. The glucose concen- growth curves and viable counts of B. subtilis were deter- tration in the medium was measured along the growth mined in Belitsky minimal medium without citrate (BOC curve in the absence (control) and presence of 2.4 mM medium) with different concentration of catechol in the catechol and 16 mM phenol, which were added to expo- absence of glucose (Fig. 4A) or with limiting amounts of nentially growing cells. The results reflected that in all 0.05% glucose (Fig. 4B). As the BOC medium was red- conditions (control, catechol, phenol) the glucose amount coloured in the presence of higher catechol amounts, in the medium is decreased along the growth curve and

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 142 B. subtilis response to phenol and catechol 11 Catechol in BOC medium without glucose Catechol in BOC medium with 0.05 % glucose 1 1 A B

0.1 1010

108 500 500 0.01 0.1 OD OD 106 CFU/ml

0.001 104

102 0.01 050100 150 200 250 300 350 400 450 0 100 200 300 400 500 Time (min) Time (min)

control OD500 control CFU/ml 0.05% glucose 0.3 mM catechol OD 0.3 mM CFU/ml 500 0.05% glucose + 1.2 mM catechol 1.2 mM catechol OD 1.2 mM CFU/ml 500 0.05% glucose + 2.4 mM catechol 2.4 mM catechol OD500 2.4 mM CFU/ml 3.6 mM catechol OD500 3.6 mM CFU/ml

Fig. 4. Growth curve and viable counts of B. subtilis 168 in the presence of catechol in minimal medium without citrate and glucose (A) and with 0.05% glucose (B). Bacillus subtilis was grown in Belitsky minimal medium without citrate (BOC medium) in the absence (control) and presence of different concentrations of catechol (0.3–3.6 mM), which were added at the beginning without glucose (A) or at an OD500 of 0.4 in the presence of 0.05% glucose (B). The addition of catechol is indicated by arrows. Appropriate dilutions were plated for viable counts (cfu ml−1). exhausted at the transition into the stationary phase (28 mM), 1% (56 mM) and 2% (112 mM) glucose that (Fig. 5). Consequently, cells are able to take up and utilize were exposed to 2.4 mM catechol. The transcriptional glucose in the presence of catechol. induction of the carbon catabolite-repressed licBCAH and rbsRKDACB operons in the presence of catechol and different amounts of glucose was analysed using Northern Analysis of the mechanism of carbon catabolite blots (Fig. 6). The results showed that the derepression of derepression in the presence of catechol and the licBCAH and rbsRKDACB operons is most strongly different concentrations of glucose after 10 min of catechol stress and depends indeed on the We investigated whether the derepression of the carbon glucose concentration in the medium as we detected a catabolite control by catechol can be overcome by an much stronger induction of the licBCAH and rbsRKDACB excess of glucose in the medium. For this purpose RNA operons with 2% glucose. These results support the was isolated from B. subtilis cells grown with 0.5% notion that there is a relation between the glucose amount

control 2.4 mM catechol 16 mM phenol 10 4 10 4 10 4 ) A B C /l 3.5 3.5 3.5 (g

3 3 3 1 1 1 2.5 2.5 2.5 500 500 2 500 2 2 OD OD 1.5 OD 1.5 1.5 0.1 0.1 0.1 1 1 1 Glucose concentration/ OD (g/l) Glucose concentration/ OD 0.5 0.5 Glucose concentration/ OD (g/l) 0.5

0.01 0 0.01 0 0.01 0 0100200 300 400 500 0 100 200 300 400 500 0 100 200 300 400 500 Time (min) Time (min) Time (min)

OD500 Glucose concentration medium /OD [ g/l ]

Fig. 5. Measurement of the glucose concentration in the medium in the absence (A) and presence of catechol (B) and phenol (C). Bacillus subtilis was grown in Belitsky minimal medium and 2.4 mM catechol (B) or 16 mM phenol (C) were added at an OD500 of 0.4. The glucose determination in the medium that indicates for the glucose exhaustion was performed as described in the Experimental procedures section. Arrows indicate the time points of exposure to catechol or phenol stress.

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 12 L. T. Tam et al. 143 0.5% 1% Fig. 6. Transcript analyses of the carbon 2% glucose catabolite-controlled licBCAH and rbsRKDACB operons in response to 2.4 mM catechol stress kb M co 10 30 60 co 10 30 60 co 10 30 60 in the presence of different glucose concentrations. For Northern blot experiments 5 µg RNA 6.9 _ _ each was applied isolated from B. subtilis wild- 4.7 type 168 grown with different glucose amounts (0.5%, 1%, 2%) before (co) and at different times (10, 30, 60 min) after the exposure to licBCAH 3.3 _ 2.4 mM catechol. The arrows point towards the 2.66 size of the licBCAH- and rbsRKDACB-speciﬁc transcripts. 1.5 _ _ 1.05

0.5% 1% 2% glucose kb M co 10 30 60 co 10 30 60 co 10 30 60 _ rbsRKDACB 6.9 5.6 _ 4.7

_ 2.66

1.5 _ _ 1.05

in the medium and the degree of carbon catabolite dere- 2004). The yfiE gene shares more than 50% similarity to pression caused by catechol. glyoxalases/bleomycin resistance proteins/ring-cleavage extradiol dioxygenases. According to the PROSITE Docu- mentation (http://www.expasy.org/prosite/) for extradiol Specific induction of the putative catechol-degrading dioxygenases (PDOC00078) this family includes cate- extradiol dioxygenase operon yfiDE by catechol chol-2,3-dioxygenases involved in the extradiol ring- We were also interested if there is a specific catabolic cleavage of monocyclic aromatic compounds (catechol) pathway for the degradation of phenolic compounds in B. subtilis 168. Of the numerous induced genes that could not be assigned to specific regulons the transcriptome kb M co 10` 30` 60` 90` 120` results revealed the very strong induction for the yfiD and yfiE genes (40- to 90-fold) after catechol stress. To verify 2.66 that the yfiD and yfiE genes are cotranscribed, we performed Northern blot analyses using a yfiE-specific mRNA probe. One major transcript of 1.3 kb size was detected, 1.5 yfiDE 1.3 which is consistent with the hypothesis that the yfiDE 1.05 genes form a bicistronic operon (Fig. 7). The yfiDE operon is weakly transcribed in exponentially growing cells and increased very strongly after catechol stress. Fig. 7. Transcript analyses of the yfiDE operon in response to The yfiD gene encodes an integral membrane protein 2.4 mM catechol stress. For Northern blot experiments 5 µg RNA with similarity to the DoxD-subunit of the thiosulfate : each was applied isolated from B. subtilis wild-type 168 before (co) and at different times (10, 30, 60, 90, 120 min) after the exposure to quinone oxidoreductase in Acidianus ambivalens that is 2.4 mM catechol. The arrow points towards the size of the yfiDE- involved in the early steps of sulfur oxidation (Müller et al., specific transcript.

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 144 B. subtilis response to phenol and catechol 13 as well as enzymes required for the degradation of poly- decreased during the first hour of catechol exposure in cyclic aromatic compounds (naphthalene and biphenyl) the yfiD and yfiE mutants and then slightly increased (Harayama et al., 1992). Bacillus subtilis YfiE is most (Fig. 8A and B). Thus, the yfiD and yfiE mutant strains related to the 2,3-dihydroxybiphenyl dioxygenases BphC2 displayed an increased sensitivity to catechol stress in and BphC3 of Rhodococcus globerulus. From these simi- comparison with the wild type. The yfiD and yfiE mutants larities we suggest that YfiE is the catechol-2,3-dioxygen- were constructed by integration of the non-replicating ase involved in the meta cleavage of catechol to 2- pMutin4 plasmid in the target gene via a single cross-over hydroxymuconic semialdehyde. recombination (Vagner et al., 1998). The expression of the downstream gene is controlled by an isopropyl-β-D-thiogalactoside (IPTG) inducible P promoter present on the Phenotypes of yfiE and yfiD mutants that are spac inserted plasmid. Consequently, growth of the yfiD more sensitive to catechol pMutin4 strain with IPTG should allow expression of YfiE. To analyse whether the yfiDE operon is required for the To analyse whether the yfiD mutation has a polar effect growth and viability of B. subtilis in the presence of cate- on the downstream yfiE gene, we compared the growth chol, yfiD and yfiE mutant cells were exposed to 3.6 mM of the yfiD mutant in the absence and presence of IPTG catechol. In contrast to the wild type, the growth of both after exposure to catechol. The results showed that the the yfiD and yfiE mutant strains was completely inhibited growth was slightly increased but could be not restored to at 3.6 mM catechol (Fig. 8A and B). In addition, determi- wild-type level in the presence of IPTG-induced YfiE nations of viable counts revealed that the number of cells (Fig. 8C). This indicates that both genes of the yfiDE

10 10 A 12 B 10 1012

11 1 10 1 1011

500 10 10 500 1010 OD OD 0.1 109 CFU/ml 0.1 109 CFU/ml

108 108

0.01 107 0.01 107 050100150200 250 300 350 400 450 050100150200 250 300 350 400 450 500 Time (min) Time (min)

wt control OD wt 3.6 mM catechol OD wt control OD500 wt 3.6 mM catechol OD500 ∆yfiE 500 ∆yfiE 500 ∆yfiD ∆yfiD control OD500 3.6 mM catechol OD500 control OD500 3.6 mM catechol OD500 wt control CFU/ml wt 3.6 mM catechol CFU/ml wt control CFU/ml wt 3.6 mM catechol CFU/ml ∆yfiE control CFU/ml ∆yfiE 3.6 mM catechol CFU/ml ∆yfiD control CFU/ml ∆yfiD 3.6 mM catechol CFU/ml

10 C

1 00 5 OD 0.1 wt 3.6 mM catechol yfiD 3.6 mM + IPTG yfiD 3.6 mM - IPTG

0.01 050100150 200 250 300 350 400 450 Time (min)

Fig. 8. Effects of catechol on the growth rate and viable counts of B. subtilis wild type (wt), yfiE mutant (A) and yfiD mutant (B and C). Bacillus subtilis strains were grown in minimal medium to an OD500 of 0.4 and treated with 3.6 mM catechol, which is indicated by arrows. Appropriate dilutions were plated for viable counts (cfu). For the growth curve in C the yfiD mutant strain was grown in the presence of 1 mM IPTG for expression of the downstream yfiE gene, which is under control of the IPTG-inducible Pspac promoter.

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 14 L. T. Tam et al. 145 Imidazole gradient purification of His -YfiE Overproduction of His6-YfiE 6

kDa M 1 2 3 4 5 6 80 90 100 110 120 130 140 mM

170 130 100 72

55 40

33 His6-YfiE His6-YfiE

17 A B

Fig. 9. SDS-PAGE of crude lysate of E. coli BL21(DE3)/pLysS expressing His6-tagged YfiEBs before and after YfiE-overproduction (A) and purification of His6-YfiE using different imidazole-concentration (B). A. Escherichia coli crude lysates were subjected to 12.5% SDS-PAGE. M, ladder of molecular weight standards; lane 1, crude lysate of non- induced cells of E. coli with pRSETA His6-YfiE; lane 2, crude lysate of induced E. coli cells without pRSETA His6-YfiE after 1 h; lane 3, crude lysate of induced E. coli cells with pRSETA only (without His6-YfiE) after 1 h; lanes 4–6, crude lysates of induced E. coli cells with pRSETA His6- YfiE after 1, 2, 3 h respectively. The arrow points towards the His6-YfiEBs protein that migrates as a 32 kDa protein and was verified by MALDI- TOF–TOF mass spectrometry.

B. His6-YfiE was purified from crude lysates of induced E. coli cells with pRSETA His6-YfiE after 2 h using different concentrations of imidazole (80–140 mM) as indicated in the figure. The arrow indicates the purified His6-YfiEBs protein.

operon are essential for growth in the presence of cate- (MALDI-TOF)–TOF identification the His6-YfiEBs protein chol and are probably involved in the metabolism or was induced in crude extracts of E. coli BL21(DE3)pLysS detoxification of catechol. cells with His6-YfiEBs after IPTG addition, which was absent in control-cells of E. coli BL21(DE3)pLysS without His -YfiE (Fig. 9). The crude extracts from induced cells Overexpressed His -YfiE protein displays catechol- 6 Bs 6 Bs showed catechol-2,3-dioxygenase activity in the pres- 2,3-dioxygenase activity ence of catechol (3.5 µmol min−1 mg−1) (Table 3). In con- All attempts to detect a catechol-2,3-dioxygenase activity trast, no catechol-2,3-dioxygenase activity was detected in crude extracts of catechol-exposed B. subtilis cells in non-induced control cells of E. coli BL21(DE3)/pLysS failed (data not shown). Consequently, His6-YfiEBs protein without His6-YfiEBs. Determination of the catechol-2,3- was overproduced in Escherichia coli by the addition of dioxygenase activity after purification of His6-YfiEBs 1 mM IPTG. As revealed by SDS-PAGE and subsequent revealed that this enzyme has a specific activity of matrix-assisted laser-desorption/ionization – time of flight 1 µmol min−1 mg−1 (Table 3). These results support the

Table 3. Extradiol dioxygenase activity of His6-YﬁEBs.

Protein amount C-2,3-O activityb Samplea (mg ml−1) (µmol min−1 mg−1)

Crude extract of non-induced E. coli BL21(DE3)/pLysS 91.5 0

Crude extract of non-induced E. coli BL21(DE3)/pLysS His6-YﬁEBs 67.5 0.63

Crude extract of induced E. coli BL21(DE3)/pLysS His6-YﬁEBs 123 3.50

Puriﬁed His6-YﬁEBs eluted with 90 mM imidazole 7.7 0.26

Puriﬁed His6-YﬁEBs eluted with 100 mM imidazole 1.5 1.04

a. The E. coli BL21(DE3)/pLysS cells expressing His6-tagged YfiEBs were grown in LB and harvested before (non-induced cells) and 2 h after YfiE-overproduction (induced cells). Cells were disrupted by sonication and His6-tagged YfiEBs was purified from induced cells as described in the Experimental procedures section. b. For catechol-2,3-dioxygenase (C-2,3-O) activity measurements the crude extracts of E. coli BL21(DE3)/pLysS cells without His6-YfiEBs and Ni2+ with His6-YfiEBs as well as the purified protein fractions eluted with 90 mM and 100 mM imidazole from the -NTA agarose column were incubated with 10 mM and 25 mM catechol and analysed as described in the Experimental procedures section.

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 146 B. subtilis response to phenol and catechol 15 hypothesis that YfiE is the key enzyme of a novel identi- various phenolic compounds are glucosylated to aryl-β- fied meta pathway in B. subtilis for the extradiol cleavage glucosides by a transglucosylating reaction of α-amylase of aromatic catecholic compounds. in B. subtilis X-23 (Nishimura et al., 1994a). Furthermore, the solubility and stability of the glucosides was higher than that of the aglucones (Nishimura et al., 1994b). Thus, Discussion it might be possible that catechol is transglucosylated also The capabilities of bacteria in the degradation of aromat- in B. subtilis 168 and utilized in its glucosylated form. The ics have been well studied and most of the metabolic derepression of catabolite repression could be caused by pathways are known (Harayama et al., 1992). In this study the exhaustion of glucose in the transglucosylation reac- we monitored the gene expression profile of B. subtilis in tion of catechol. Indeed, our data supported the view that response to the aromatic compounds phenol and catechol there is a relation between glucose and catechol as the using proteomics and transcriptomics to: (i) define the derepression of the carbon catabolite-controlled licBCAH mode of action of these aromatic compounds; and (ii) and rbsRKDACB operons was strongly increased with an elucidate if specific degradative enzymes are induced in excess of 2% glucose. Future studies should elucidate if B. subtilis that are involved in degradation of aromatic catechol glucosides are produced upon exposure to cat- compounds. Phenol induced a classical heat-shock echol stress in B. subtilis 168 and if glucose is exhausted expression profile in B. subtilis as has been shown also by transglucosylation of catechol. in A. calcoaceticus or P. putida (Benndorf et al., 2001; Interestingly, the strong activation of the licABCH Hallsworth et al., 2003). Because chaotrope solutes such operon and the rbsABCDK operon was also found in as phenol cause water stress in P. putida, the induction of B. subtilis cells that are exposed to the natural brominated heat-shock proteins is required for stabilization of macro- furanone isolated from the red alga Delisea pulchra that molecular structures (Hallsworth et al., 2003). In addition, was found to inhibit growth of Gram-positive bacteria (Ren the activation of Spx-dependent genes was shown by et al., 2004). Thus, the exposure to furanone also pro- phenol that are induced by thiol-specific oxidative stress vokes the derepression of carbon catabolite repression in as for example by diamide. However, whereas the dia- B. subtilis, which could be also caused by the glucosyla- mide-induced stimulon also includes the oxidative stress tion of furanone. Moreover, we found a strong overlap in regulon PerR no oxidative stress response was observed the global gene expression profile between furanone- and in phenol-treated cells. Consequently, we suggest that catechol-treated cells as class I and III heat-shock genes both diamide and phenol are able to generate non-native as well as Spx-dependent genes were also strongly disulfide bonds that induce the Spx regulon but only dia- induced by furanone indicating protein damage like non- mide not phenol produces reactive oxygen species that native disulfide bond formation. One exception was the trigger the peroxide response. The expression profile of induction of the peroxide-specific PerR and Fur regulons, catechol was only partly overlapping with that of phenol which was only observed after catechol stress but not in but even more similar to the disulfide response triggered furanone-treated cells. The induction of the Fur-regulated by diamide as the class I and III heat-shock regulons as genes involved in the biosynthesis of the 2,3-dihydroxy- well as the thiol-specific oxidative stress response were benzoic acid (DHBA) by catechol is an interesting finding, induced including the Spx, PerR and Fur regulons. The as DHBA is the precursor of the catecholate siderophore induction of the heat-shock and peroxide-specific oxida- Corynebactin involved in the Fe-uptake in response to Fe tive stress response by catechol was also observed in starvation. Several related catechol compounds were A. calcoaceticus (Benndorf et al., 2001). Furthermore, the shown to be also involved in Fe-uptake and suppress induction of oxidative stress-specific proteins by catechol siderophore production (Peters and Warren, 1968; 1970). in A. calcoaceticus increased the resistance of the cells In addition to the heat and thiol-specific oxidative stress to lethal concentration of H2O2, which suggests that reac- response as well as the derepression of catabolite-con- tive oxygen species like peroxides are generated during trolled genes by catechol the transcriptome results iden- catechol detoxification or metabolism in the cell that prob- tified a key enzyme of the meta cleavage pathway for ably damage the proteins. Thus, not only the stress catechol degradation, the catechol-2,3-dioxygenase YfiE. responses but also the mode of action seem to be differ- Overproduced YfiE was incubated with catechol and the ent for phenol and catechol. catechol-2,3-dioxygenase activity could be demonstrated The transcriptome data revealed that many carbon by measuring the accumulation of 2-hydroxymuconic catabolite-controlled genes are derepressed by catechol semialdehyde spectrophotometrically. Thus, for the first even if glucose is present and taken up under these con- time it was demonstrated that B. subtilis 168 is able to ditions. Our growth and viability experiments suggested degrade catechol by the catechol-2,3-dioxygenase YfiE. that B. subtilis is not able to utilize catechol as sole car- Moreover, the inactivation of yfiE increased the sensitivity bon-energy source. It has been shown previously, that of the cells to the growth and viability in response to

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 16 L. T. Tam et al. 147 catechol. Interestingly, the yfiE gene was also among the gradation system YfiDE for B. subtilis, which should be most strongest furanone-induced genes (Ren et al., used as a signature to elucidate if other xenobiotic or 2004). Thus, it seems possible that catechol and the fura- antimicrobial aromatic compounds can be metabolized in none are subject to degradation by the extradiol dioxyge- B. subtilis using the newly identified meta cleavage nase YfiE resulting in different metabolites that are able pathway. to either generate reactive oxygen radicals like peroxides and thiol-specific oxidative stress (for catechol) or induce Experimental procedures only non-native disulfide bonds (for furanone). Our North- ern blot analyses suggested that the yfiE gene forms a Bacterial strains and growth conditions bicistronic operon together with yfiD encoding a putative The bacterial strains used were B. subtilis 168 (trpC2) (Anag- oxidoreductase that is strongly induced by catechol. Thus, nostopoulos and Spizizen, 1961), ∆yfiE (trpC2, yfiE::pMutin4; it might be possible that YfiD is involved in the metabolism contains a transcriptional yfiE–lacZ fusion; Emr); ∆yfiD of 2-hydroxymuconic semialdehyde. Future studies (trpC2, yfiD::pMutin4; contains a transcriptional yfiD–lacZ should now elucidate the unknown transcriptional regula- fusion; Emr). Escherichia coli strains DH5α and BL21(DE3)/ tor that is involved in the control of the catechol-induced pLysS were used for standard cloning procedures (Sambrook yfiDE operon. Our transcriptome and proteome results did et al., 1989; Studier et al., 1990). B. subtilis strains were cul- ° not identify further enzymes of the meta cleavage pathway tivated under vigorous agitation at 37 C in Belitsky minimal medium described previously supplemented with 0.2% glu- involved in the degradation of 2-hydroxymuconic semial- cose (Stülke et al., 1993). Glucose starvation was provoked dehyde to pyruvate and acetyl-CoA, which were identified by cultivation of B. subtilis in BOC supplemented with 0.05% in phenol-degrading Pseudomonas species (Tsirogianni glucose. Escherichia coli strains were grown in Luria–Bertani et al., 2004). In addition, the search for the respective broth medium (LB). The following antibiotics were used: − genes according to the SubtiList database did not reveal ampicillin at 100 µg ml 1 in E. coli and erythromycin at µ −1 candidate genes that could be involved in the degradation 1 g ml in B. subtilis. of 2-hydroxymuconic semialdehyde. Thus, it is subject to future studies to identify further enzymes of the meta Phenol and catechol MIC assays cleavage pathway for catechol degradation. In different Pseudomonas species phenol degradation The MICs of the xenobiotic substances phenol and catechol is initiated by the multicomponent phenol hydroxylase in B. subtilis 168 were determined in test tubes containing 5 ml of Belitsky minimal medium supplemented with 0.2% complex by insertion of oxygen into the aromatic ring, glucose and appropriate concentrations of the respective providing catechol (Shingler et al., 1992). The dihydroxy- compound inoculated with 105 cells ml−1. The tubes were lated intermediate catechol is channelled into the ortho incubated at 37°C for 18 h. The MIC was defined as the or the meta cleavage pathways (Harayama et al., 1992). lowest concentration that inhibited visible growth, in the case Furthermore, it was shown that both enzymes respon- of phenol 16 mM and for catechol 0.3 mM. For growth exper- sible for the primary attack of phenol, the phenol hydro- iments different concentrations of phenol and catechol were xylase and the catechol 2,3-dioxygenase are expressed added to exponentially growing cultures when the cultures reached an OD of 0.4. For quantitative 2-D polyacrylamide in other more thermophilic Bacillus species as for 500 gel electrophoresis (2D-PAGE) analysis, inhibitor concentra- example B. stearothermophilus, B. thermoleovorans and tions that led to reduced growth rates were applied (1× MIC B. thermoglucosidasius (Dong et al., 1992; Kim and Oriel, for phenol and 8× MIC for catechol). 1995; Duffner and Muller, 1998; Milo et al., 1999; Duffner et al., 2000). In contrast, B. subtilis ATCC 7003 was hitherto regarded as a ‘secondary degrader’ (DuTeau et al., Assay for viable counts 1998). Our microarray data support the hypothesis that Cells grown in Belitsky minimal medium were exposed to

B. subtilis 168 encodes no phenol hydroxylase and is not catechol stress at an OD500 of 0.4 and diluted before and at able to metabolize phenol into catechol as the main different times after the exposure to catechol in 0.9% NaCl enzyme of the meta cleavage pathway YfiE was not solution. Appropriate dilutions were plated on LB plates, incu- ° induced by phenol. Thus, it is not surprising that the gene bated overnight at 37 C and counted for colony forming units (cfu) that indicates the number of viable cells. expression profiles differ strongly between phenol and catechol in B. subtilis. In summary, the transcriptome and proteome analyses Glucose concentration measurement of B. subtilis in response to phenol and catechol revealed The concentration of glucose in the medium was determined overlapping heat-shock and disulfide responses but differ- using the test combinations of D-glucose (Boehringer Man- ences that are due to the different metabolic activities of nheim) according to the instructions of the manufacturer. The the cells regarding the degradation of both aromatic com- determinations were based on enzymatic reactions resulting pounds. Specifically, this study identifies a catechol de- in the formation of NADPH, which was measured at 340 nm

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 148 B. subtilis response to phenol and catechol 17 and used for the glucose concentration calculation as recom- catechol (8× MIC). L-[35S]methionine incorporation was mended by the manufacturer. stopped after the 5 min pulse-labelling by the addition of 1 mg of chloramphenicol per millilitre and an excess of cold L- methionine (10 mM) on ice. The cells were disrupted by DNA techniques ultrasonic treatment, and the soluble protein fraction was separated cell debris by centrifugation. Incorporation of L- Procedures for DNA purification, restriction, ligation, agarose [35S]methionine was measured by precipitation of aliquots of gel electrophoresis and transformation of competent E. coli protein extracts with 10% trichloroacetic acid on filter papers, cells were carried out as described previously (Sambrook as described previously (Bernhardt et al., 1999). et al., 1989). Bacillus subtilis was transformed as described by Hoch and colleagues (1991). Enzymes were from Roche Molecular Biochemicals. Polymerase chain reaction (PCR) Two-dimensional (2-D) gel electrophoresis and was carried out with the Taq (Roche Molecular Biochemicals) image analysis or Pfx (Invitrogen) DNA polymerases, using chromosomal DNA of B. subtilis 168 as a template. The protein content was determined using the Bradford assay (Bradford, 1976) and 80 µg of the L-[35S]methionine- labelled protein extract was separated by 2D-PAGE using the Overproduction and purification of His6-tagged YfiE non-linear immobilized pH gradients (IPG) in the pH range protein 4–7 (Amersham Biosciences) and a Multiphor II apparatus (Amersham Pharmacia Biotech) as described previously For overproduction of B. subtilis His -YfiE in E. coli, the entire 6 (Bernhardt et al., 1999). The gels were stained with silver yfiE coding sequence was amplified by PCR using the nitrate, dried on filter paper, exposed to Phosphor screens primers yfiE-Hisfor (5′CGGGATCCATGACCAGCATTCATG (Molecular Dynamics, Sunnyvale, CA), which were detected AGGAT3′) and yfiE-Hisrev (5′CGAATTCAATCACAAATG with a Phosphor Imager SI instrument (Molecular Dynamics) TAATATAGGCGC3′) containing restriction sites for BamHI (Bernhardt et al., 1999). For identification of the proteins by and EcoRI, respectively, at their 5′ ends. The obtained PCR mass spectrometry, non-radioactive protein samples of fragment was digested with BamHI and EcoRI and cloned 200 µg were separated by preparative 2D-PAGE. The result- into appropriate prepared pRSETA overexpression vectors ing 2-D gels were fixed in 40% (v/v) ethanol, 10% (v/v) acidic (Invitrogen) containing the codons for six N-terminal histidine acid and stained with Colloidal Coomassie brilliant blue residues and a linker region fused to the target protein in (Amersham Biosciences). The quantitative image analysis E. coli DH5α and BL21(DE3)/pLysS. Recombinant His- was performed with the DECODON Delta 2D software tagged protein (His -YfiE) was expressed in E. coli at least 6 (http://www.decodon.com), which is based on the dual chan- 2 h after the addition of 1 mM IPTG and purified by Ni- nel image analysis (Bernhardt et al., 1999). Using this soft- nitrilotriacetic acid chelate affinity chromatography under ware the master image (represented by green spots) is native conditions according to the standard procedures of the warped with the sample image (represented by red spots) manufacturer (Qiagen). after setting specific vector points. Consequently, green protein spots in the dual channel image are predominantly Extradiol dioxygenase assay present in the master image, while red protein spots are predominantly present in the sample image. Yellow protein spots Catechol-2,3-dioxygenase activity was measured using an are present at similar amounts in both images. After back- Uvicon 941 plus spectrophotometer (Kontron instruments, ground subtraction, normalization was performed in order to Eching) following the formation of the meta cleavage product equalize the grey values in each image and quantification 2-hydroxymuconic semialdehyde at 375 nm and 25°C over a was performed automatically. Proteins showing an induction period of 30 s (ε = 36 mM−1 cm−1) as described previously of at least twofold during the L-[35S]methionine pulse in two (Sala-Trepat and Evans, 1971; Heiss et al., 1995). The reac- independent experiments were designated marker proteins. tion mixture contained 10 mM catechol, 62.5 mM phosphate buffer at pH 7.0 and 50 µl of the enzyme extract, within a total volume of 1 ml. For enzyme activity, we tested the crude Protein identification by MALDI-TOF–TOF mass extract of E. coli BL21(DE3)/pLysS His6-YfiE before and 1– spectrometry

4 h after overexpression of His6-YfiE as well as the purified Spot cutting from Colloidal Coomassie-stained 2-D gels, tryp- His6-YfiE protein. One unit is defined as the amount of enzyme producing 1 µmol of 2-hydroxymuconic semialde- tic digestion of the proteins and spotting of the resulting hyde per minute at 25°C. peptides onto the MALDI-targets (Voyager DE-STR, PerSep- tive Biosystems) were performed using the Ettan Spot Handling Workstation (Amersham-Biosciences, Uppsala, Preparation of the cytoplasmic L-[35S]methionine-labelled Sweden), according to the standard protocol described preprotein fraction viously (Eymann et al., 2004). The MALDI-TOF–TOF measurement of spotted peptide solutions was carried out on a

Cells grown in minimal medium to an OD500 of 0.4 were pulse- Proteome-Analyzer 4700 (Applied Biosystems, Foster City, labelled for 5 min each with 10 µCi of L-[35S]methionine per CA, USA) and protein identiﬁcation was performed using the millilitre before the stress (control) and after 10, 20 and Mascot search engine (Matrix Science, London, UK) as 30 min of exposure to 16 mM phenol (1× MIC) and 2.4 mM described previously (Eymann et al., 2004).

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 18 L. T. Tam et al. 149 Transcriptome analysis Benndorf, D., Loffhagen, N., and Babel, W. (2001) Protein synthesis patterns in Acinetobacter calcoaceticus induced For isolation of total RNA the cell pellets were re-suspended by phenol and catechol show specificities of responses to in Lysis buffer II (3 mM EDTA; 200 mM NaCl), mechanically chemostress. FEMS Microbiol Lett 200: 247–252. disrupted using the RiboLyser (Thermo Electron Corporation Bernhardt, J., Büttner, K., Scharf, C., and Hecker, M. (1999) GmbH, Dreieich, Germany) and the RNA was purified using Dual channel imaging of two-dimensional electrophero- the KingFisher (Thermo Electron Corporation GmbH, Dreie- grams in Bacillus subtilis. Electrophoresis 20: 2225–2240. ich, Germany) and the MagNA Pure LC RNA Isolation Kit I Bernhardt, J., Weibezahn, J., Scharf, C., and Hecker, M. (Roche Diagnostics, Penzberg, Germany). RNA concentra- (2003) Bacillus subtilis during feast and famine: visualization and quality were determined with the Bioanalyzer 2100 tion of the overall regulation of protein synthesis during (Agilent Technologies, Berlin, Germany) according to the glucose starvation by proteome analysis. Genome Res 13: instructions of the manufacturer. Generation of fluorescence- 224–237. labelled cDNA and hybridization with B. subtilis whole- Bradford, M.M. (1976) A rapid and sensitive method for the genome microarrays (Eurogentec) was performed according quantitation of microgram quantities of protein utilizing the to the instructions of the manufacturer as described previ- principle of protein-dye binding. Anal Biochem 72: 248– ously (Jürgen et al., 2005). The fluorescence intensities of 254. ® the two dyes were detected via the ScanArray Express Cao, M., Wang, T., Ye, R., and Helmann, J.D. (2002) Antibi- scanner (PerkinElmer Life and Analytical Sciences, Rodgau- otics that inhibit cell wall biosynthesis induce expression of ® Jügesheim, Germany) using the ScanArray Express image the Bacillus subtilis sigma(W) and sigma(M) regulons. Mol analysis software. For each condition, duplicates of microar- Microbiol 45: 1267–1276. ray experiments were performed. Cao, M., Salzberg, L., Tsai, C.S., Mascher, T., Bonilla, C., Wang, T., et al. (2003) Regulation of the Bacillus subtilis Northern blot experiments extracytoplasmic function protein sigma(Y) and its target promoters. J Bacteriol 185: 4883–4890. Total RNA of the B. subtilis strains was isolated from cells Cho, Y.S., Park, S.H., Kim, C.K., and Oh, K.H. (2000) Induc- before and after the exposure of the cells to catechol stress tion of stress shock proteins DnaK and GroEL by phenox- by the acid phenol method as described (Majumdar et al., yherbicide 2,4-D in Burkholderia sp. YK-2 isolated from rice 1991). Northern blot analyses were performed as described field. Curr Microbiol 41: 33–38. previously (Wetzstein et al., 1992). Hybridization specific for Dong, F.M., Wang, L.L., Wang, C.M., Cheng, J.P., He, Z.Q., yfiE, licB and rbsB were conducted with the digoxigenin- Sheng, Z.J., and Shen, R.Q. (1992) Molecular cloning and labelled RNA probes synthesized in vitro with T7 RNA poly- mapping of phenol degradation genes from Bacillus stearo- merase from T7 promoter containing internal PCR products thermophilus FDTP-3 and their expression in Escherichia of yfiE, licB and rbsB using the following primers respectively: coli. Appl Environ Microbiol 58: 2531–2535. ′ ′ ′ yfiE_for(5 TCACAATTCGCAGTCTGGAG3 ), yfiE_rev(5 Duffner, F.M., and Muller, R. (1998) A novel phenol hydrox- CTAATACGACTCACTATAGGGAGAAAATCCAGCTCCTCTT ylase and catechol 2,3-dioxygenase from the thermophilic ′ ′ ′ GGTG3 ), licB_for(5 TTACTCGTTTGTGCAGCAGG3 ), Bacillus thermoleovorans strain A2: nucleotide sequence ′ licB_rev(5 CTAATACGACTCACTATAGGGAGAGACACATGT and analysis of the genes. FEMS Microbiol Lett 161: 37– ′ ′ CCAAGCTGTTC3 ), rbsB_for(5 GCAAAGCCATCAAACTC 45. ′ ′ GGG3 ), rbsB_rev(5 CTAATACGACTCACTATAGGGAGAC Duffner, F.M., Kirchner, U., Bauer, M.P., and Muller, R. ′ CGATTAATTCAGGCTGCTG3 ). (2000) Phenol/cresol degradation by the thermophilic Bacillus thermoglucosidasius A7: cloning and sequence Acknowledgements analysis of five genes involved in the pathway. Gene 256: 215–221. We thank the Decodon company for support with the De- DuTeau, N.M., Rogers, J.D., Bartholomay, C.T., and Rear- codon Delta 2D software, Stefanie Leja and Britta Jürgen for don, K.F. (1998) Species-specific oligonucleotides for enu- the help with the microarray experiments and Jörg Stülke for meration of Pseudomonas putida F1, Burkholderia sp. helpful discussion of the results. This work was supported by strain JS150, and Bacillus subtilis ATCC 7003 in biodegra- a scholarship of the ‘Ministry of Education and Training of Viet dation experiments. Appl Environ Microbiol 64: 4994–4999. Nam’ (MOET) to L.T.T., and grants from the Deutsche For- Eltis, L.D., and Bolin, J.T. (1996) Evolutionary relationships schungsgemeinschaft, the Bundesministerium für Bildung among extradiol dioxygenases. J Bacteriol 178: 5930– und Forschung, the Fonds der Chemischen Industrie, the 5937. Bildungsministerium of the country Mecklenburg-Vorpom- Eymann, C., Homuth, G., Scharf, C., and Hecker, M. (2002) mern (EMAU 0202120), European Union grants (LSHG-CT- Bacillus subtilis functional genomics: global characteriza- 2004-503468) and Genencor International (Palo Alto, Califor- tion of the stringent response by proteome and transcrip- nia, USA) to M.H. tome analysis. J Bacteriol 184: 2500–2520. Eymann, C., Dreisbach, A., Albrecht, D., Bernhardt, J., References Becher, D., Gentner, S., et al. (2004) A comprehensive proteome map of growing Bacillus subtilis cells. Proteom- Anagnostopoulos, C., and Spizizen, J. (1961) Requirements ics 4: 2849–2876. for transformation in Bacillus subtilis. J Bacteriol 81: 741– Giuffrida, G., Pessione, E., Mazzoli, R., Dellavalle, G., Bar- 746. rello, C., Conti, A., and Giunta, C. (2001) Media containing

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 150 B. subtilis response to phenol and catechol 19 aromatic compounds induce peculiar proteins in Acineto- van der Meer, J.R., de Vos, W.M., Harayama, S., and bacter radioresistens, as revealed by proteome analysis. Zehnder, A.J.B. (1992) Molecular mechanisms of genetic Electrophoresis 22: 1705–1711. adaptation to xenobiotic compounds. Microbiol Rev 56: Hallsworth, J.E., Heim, S., and Timmis, K.N. (2003) Chaotro- 677–694. pic solutes cause water stress in Pseudomonas putida. Milo, R.E., Duffner, F.M., and Muller, R. (1999) Catechol 2,3- Environ Microbiol 5: 1270–1280. dioxygenase from the thermophilic, phenol-degrading Harayama, S., Kok, M., and Neidle, E.L. (1992) Functional Bacillus thermoleovorans strain A2 has unexpected low and evolutionary relationships among diverse oxygenases. thermal stability. Extremophiles 3: 185–190. Annu Rev Microbiol 46: 565–601. Mostertz, J., Scharf, C., Hecker, M., and Homuth, G. (2004) Heiss, G., Stolz, A., Kuhm, A.E., Müller, C., Klein, J., Alten- Transcriptome and proteome analysis of Bacillus subtilis buchner, J., and Knackmuss, H.J. (1995) Characterization gene expression in response to superoxide and peroxide of a 2,3-dihydroxybiphenyl dioxygenase from the naphtha- stress. Microbiology 150: 497–512. lenesulfonate-degrading bacterium strain BN6. J Bacteriol Müller, F.H., Bandeiras, T.M., Urich, T., Teixeira, M., Gomes, 177: 5865–5871. C.M., and Kletzin, A. (2004) Coupling of the pathway of Helmann, J.D., Wu, M.F., Gaballa, A., Kobel, P.A., Morshedi, sulphur oxidation to dioxygen reduction: characterization of M.M., Fawcett, P., and Paddon, C. (2003) The global tran- a novel membrane-bound thiosulphate : quinone oxi- scriptional response of Bacillus subtilis to peroxide stress doreductase. Mol Microbiol 53: 1147–1160. is coordinated by three transcription factors. J Bacteriol Nakano, S., Kuster-Schock, E., Grossman, A.D., and Zuber, 185: 243–253. P. (2003) Spx-dependent global transcriptional control is Ho, E.M., Chang, H.W., Kim, S.I., Kahng, H.Y., and Oh, K.H. induced by thiol-specific oxidative stress in Bacillus subtilis. (2004) Analysis of TNT (2,4,6-trinitrotoluene)-inducible cel- Proc Natl Acad Sci USA 100: 13603–13608. lular responses and stress shock proteome in Stenotroph- Nishimura, T., Kometani, T., Takii, H., Terada, Y., and Okada, omonas sp. OK-5. Curr Microbiol 49: 346–352. S. (1994a) Purification and some properties of α-amylase Hoch, J.A. (1991) Genetic analysis in Bacillus subtilis. Meth- from Bacillus subtilis X-23 that glucosylates phenolic com- ods Enzymol 204: 305–320. pounds such as hydroquinone. J Ferment Bioeng 78: 31– Jürgen, B., Tobisch, S., Wumpelmann, M., Gordes, D., Koch, 36. A., Thurow, K., et al. (2005) Global expression profiling of Nishimura, T., Kometani, T., Takii, H., Terada, Y., and Okada, Bacillus subtilis cells during industrial-close fed-batch fer- S. (1994b) Acceptor specificity in the glucosylation reaction mentations with different nitrogen sources. Biotechnol of Bacillus subtilis X-23 α-amylase towards various phe- Bioeng 92: 277–298. nolic compounds and the structure of kojic acid glucoside. Kim, I.C., and Oriel, P.J. (1995) Characterization of the Bacil- J Ferment Bioeng 78: 37–41. lus stearothermophilus BR219 phenol hydroxylase gene. Peters, W.J., and Warren, R.A. (1968) Phenolic acids and Appl Environ Microbiol 61: 1252–1256. iron transport in Bacillus subtilis. Biochim Biophys Acta Kim, E.A., Kim, J.Y., Kim, S.J., Park, K.R., Chung, H.J., 165: 225–232. Leem, S.H., and Kim, S.I. (2004) Proteomic analysis of Peters, W.J., and Warren, R.A. (1970) The mechanism of iron Acinetobacter lwoffii K24 by 2-D gel electrophoresis and uptake in Bacillus subtilis. Can J Microbiol 16: 1285–1291. electrospray ionization quadrupole-time of flight mass Petersohn, A., Brigulla, M., Haas, S., Hoheisel, J.D., Volker, spectrometry. J Microbiol Methods 57: 337–349. U., and Hecker, M. (2001) Global analysis of the general Koburger, T., Weibezahn, J., Bernhardt, J., Homuth, G., and stress response of Bacillus subtilis. J Bacteriol 183: 5617– Hecker, M. (2005) Genome-wide mRNA profiling in glu- 5631. cose starved Bacillus subtilis cells. Mol Genet Genomics Ren, D., Bedzyk, L.A., Setlow, P., England, D.F., Kjelleberg, 274: 1–12. S., Thomas, S.M., et al. (2004) Differential gene expres- Krüger, S., and Hecker, M. (1995) Regulation of the putative sion to investigate the effect of (5Z)-4-bromo-5-(bromome- bglPH operon for aryl-beta-glucoside utilization in Bacillus thylene)-3-butyl-2(5H)-furanone on Bacillus subtilis. Appl subtilis. J Bacteriol 177: 5590–5597. Environ Microbiol 70: 4941–4949. Leichert, L.I., Scharf, C., and Hecker, M. (2003) Global char- Sala-Trepat, J.M., and Evans, W.C. (1971) The meta cleav- acterization of disulfide stress in Bacillus subtilis. J Bacte- age of catechol by Azotobacter species. 4-Oxalocrotonate riol 185: 1967–1975. pathway. Eur J Biochem 20: 400–413. Lupi, C.G., Colangelo, T., and Mason, C.A. (1995) Two- Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu- dimensional gel electrophoresis of the response of lar Cloning: A Laboratory Manual, 2nd edn. Cold Spring Pseudomonas putida KT2442 to 2-chlorophenol. Appl Harbor, NY, USA: Cold Spring Harbor Laboratory Press. Environ Microbiol 61: 2863–2872. Santos, P.M., Benndorf, D., and Sa-Correia, I. (2004) Majumdar, D., Avissar, Y.J., and Wyche, J.H. (1991) Simul- Insights into Pseudomonas putida KT2440 response to taneous and rapid isolation of bacterial and eukaryotic phenol-induced stress by quantitative proteomics. Pro- DNA and RNA – a new approach for isolating DNA. Bio- teomics 4: 2640–2652. Techniques 11: 94–101. Segura, A., Godoy, P., van Dillewijn. P., Hurtado, A., Arroyo, Mascher, T., Zimmer, S.L., Smith, T.A., and Helmann, J.D. N., Santacruz, S., and Ramos, J.L. (2005) Proteomic anal- (2004) Antibiotic-inducible promoter regulated by the cell ysis reveals the participation of energy- and stress-related envelope stress-sensing two-component system LiaRS of proteins in the response of Pseudomonas putida DOT-T1E Bacillus subtilis. Antimicrob Agents Chemother 48: 2888– to toluene. J Bacteriol 187: 5937–5945. 2896. Senior, E., Bull, A.T., and Slater, J.H. (1976) Enzyme evolu-

© 2006 The Authors Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology 20 L. T. Tam et al. 151 tion in a microbial community growing on the herbicide Vagner, V., Dervyn, E., and Ehrlich, S.D. (1998) A vector for Dalapon. Nature 263: 476–479. systematic gene inactivation in Bacillus subtilis. Microbiol- Shingler, V., Powlowski, J., and Marklund, U. (1992) Nucle- ogy 144: 3097–3104. otide sequence and functional analysis of the complete Wetzstein, M., Völker, U., Dedio, J., Löbau, S., Zuber, U., phenol/3,4-dimethylphenol catabolic pathway of Pseudo- Schiesswohl, M., et al. (1992) Cloning, sequencing, and monas sp. strain CF600. J Bacteriol 174: 711–724. molecular analysis of the dnaK locus from Bacillus subtilis. Studier, F.W., Rosenberg, A.H., Dunn, J.J., and Dubendorff, J Bacteriol 174: 3300–3310. J.W. (1990) Use of T7 RNA polymerase to direct expres- Yoshida, K., Kobayashi, K., Miwa, Y., Kang, C.M., Matsu- sion of cloned genes. Methods Enzymol 185: 60–89. naga, M., Yamaguchi, H., et al. (2001) Combined transcrip- Stülke, J., Hanschke, R., and Hecker, M. (1993) Temporal tome and proteome analysis as a powerful approach to activation of β-glucanase synthesis in Bacillus subtilis is study genes under glucose repression in Bacillus subtilis. mediated by the GTP pool. J Gen Microbiol 139: 2041–2045. Nucleic Acids Res 29: 683–692. Timmis, K.N., Steffan, R.J., and Unterman, R. (1994) Design- Zuber, P. (2004) Spx–RNA polymerase interaction and global ing microorganisms for the treatment of toxic wastes. Annu transcriptional control during oxidative stress. J Bacteriol Rev Microbiol 48: 525–557. 186: 1911–1918. Tobisch, S., Glaser, P., Krüger, S., and Hecker, M. (1997) Identification and characterization of a new beta-glucoside utilization system in Bacillus subtilis. J Bacteriol 179: 496– Supplementary material 506. Tsirogianni, I., Aivaliotis, M., Karas, M., and Tsiotis, G. (2004) The following supplementary material is available for this Mass spectrometric mapping of the enzymes involved in article online: the phenol degradation of an indigenous soil pseudo- Table S1. Repression profile after 10 min of phenol stress in monad. Biochim Biophys Acta 1700: 117–123. the transcriptome analyses. Uchiyama, H., Shinohara, Y., Tomioka, N., and Kusakabe, I. Table S2. Repression profile after 10 min of catechol stress (1999) Induction and enhancement of stress proteins in a in the transcriptome analyses. trichloroethylene-degrading methanotrophic bacterium, This material is available as part of the online article from Methylocystis sp. M. FEMS Microbiol Lett 170: 125–130. http://www.blackwell-synergy.com

[Supplemental material] Table S1: Repression profile after 10 minutes of phenol stress in the transcriptome analysis Regulator Gene Repression ratio Function/Similarity Membrane bioenergetics (electron transport chain and ATP synthase) RelA atpI 0.2 ATP synthase (subunit i) RelA atpB 0.2 ATP synthase (subunit a) RelA atpE 0.2 ATP synthase (subunit c) RelA atpF 0.3 ATP synthase (subunit b) RelA atpH 0.2 ATP synthase (subunit delta) RelA atpA 0.2 ATP synthase (subunit alpha) RelA atpG 0.2 ATP synthase (subunit gamma) RelA atpD 0.2 ATP synthase (subunit beta) RelA atpC 0.3 ATP synthase (subunit epsilon) yjlD 0.3 similar to NADH dehydrogenase cell wall RelA murE 0.2 UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase mraY 0.2 phospho-N-acetylmuramoyl-pentapeptide transferase murD 0.2 UDP-N-acetylmuramoylalanyl-D-glutamate ligase RelA gcaD 0.3 UDP-N-acetylglucosamine pyrophosphorylase mreD 0.2 cell-shape determining protein tagF 0.2 CDP-glycerol:polyglycerol phosphate glycero-phosphotransferase Cell division gid 0.3 glucose-inhibited division protein Transport/binding proteins and lipoproteins cysP 0.2 sulfate uptake- sulfate permease opuCB 0.3 high affinity transport of glycine betaine, carnitine, and choline opuCC 0.2 high affinity transport of glycine betaine, carnitine, and choline pbuG 0.3 hypoxanthine/guanine permease ptsG 0.1 glucose transport and phosphorylation yclP 0.3 similar to ferrichrome ABC transporter yfiY 0.3 similar to iron(III) dicitrate transport permease ykoD 0.2 similar to cation ABC transporter (ATP-binding protein) yoaB 0.2 similar to alpha-ketoglutarate permease yxeM 0.3 similar to amino acid ABC transporter Motility and chemotaxis (1) ylxG 0.3 similar to flagellar hook assembly protein fliL 0.3 required for flagellar formation fliM 0.3 flagellar motor switch protein fliY 0.3 flagellar motor switch protein fliZ 0.3 required for flagellar formation fliP 0.3 required for flagellar formation fliQ 0.3 required for flagellar formation fliR 0.3 required for flagellar formation ylxH 0.2 similar to flagellar biosynthesis switch protein cheB 0.2 chemotaxis receptor demethylation/two-component response regulator-like cheA 0.2 two-component sensor histidine kinase chemotactic signal modulator cheW 0.2 modulation of CheA activity in response to attractants cheC 0.3 inhibition of CheR-mediated methylation of MCPs cheD 0.3 required for methylation of methyl-accepting chemotaxis proteins by CheR fliS 0.3 flagellar protein Protein secretion secY 0.1 preprotein translocase subunit 153

Regulator Gene Repression ratio Function/Similarity Specific pathway lacA 0.3 beta-galactosidase ybcM 0.3 similar to glucosamine-fructose-6-phosphate aminotransferase ylxY 0.2 similar to deacetylase ykrW 0.2 similar to ribulose-bisphosphate carboxylase yoaD 0.3 similar to phosphoglycerate dehydrogenase yoaC 0.2 similar to xylulokinase yvkC 0.3 similar to pyruvate,water dikinase Metabolism of amino acids and related molecules aroD 0.3 shikimate 5-dehydrogenase cysH 0.2 phosphoadenosine phosphosulfate sat 0.1 sulfate adenylyltransferase cysC 0.1 adenylylsulfate kinase gltB 0.1 glutamate synthase (small subunit) hisD 0.3 histidinol dehydrogenase hisB 0.2 imidazoleglycerol-phosphate dehydratase hisH 0.2 amidotransferase hisA 0.2 phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase hisF 0.2 synthesis of D-erythro-imidazole glycerol phosphate hisI 0.3 phosphoribosyl-AMP cyclohydrolase/ATP pyrophosphohydrolase yaaE 0.3 similar to amidotransferase Metabolism of nucleotides and nucleic acids (1) adk 0.08 adenylate kinase guaA 0.2 GMP synthetase pucH 0.2 allantoinase purA 0.3 adenylosuccinate synthetase (AMP biosynthesis) PurR purE 0.09 phosphoribosylaminoimidazole carboxylase I purK 0.1 phosphoribosylaminoimidazole carboxylase II purB 0.04 adenylosuccinate lyase purC 0.2 phosphoribosylaminoimidazole succinocarboxamide synthetase purS 0.2 required for phosphoribosylformylglycinamidine synthetase activity purQ 0.07 phosphoribosylformylglycinamidine synthetase I purL 0.08 phosphoribosylformylglycinamidine synthetase II purF 0.04 glutamine phosphoribosylpyrophosphate amidotransferase purN 0.06 phosphoribosylglycinamide formyltransferase purH 0.1 monophosphate cyclohydrolase purD 0.07 phosphoribosylglycinamide synthetase PyrR pyrB 0.1 aspartate carbamoyltransferase pyrC 0.2 dihydroorotase pyrAA 0.08 carbamoyl-phosphate synthetase (glutaminase subunit) pyrAB 0.09 carbamoyl-phosphate synthetase (catalytic subunit) pyrK 0.1 dihydroorotate dehydrogenase (electron transfer subunit) pyrD 0.1 dihydroorotate dehydrogenase (catalytic subunit) pyrF 0.1 orotidine 5'-phosphate decarboxylase pyrE 0.1 orotate phosphoribosyltransferase pyrP 0.2 uracil permease RelA pyrH 0.1 uridylate kinase pyrR 0.1 attenuation of the pyrimidine operon in the presence of UMP udk 0.2 uridine kinase Metabolism of lipids accD 0.3 acetyl-CoA carboxylase (beta subunit) yusQ 0.3 similar to acyloate catabolism 154

Regulator Gene Repression ratio Function/Similarity Metabolism of coenzymes and prosthetic groups bioA 0.3 adenosylmethionine-8-amino-7-oxononanoate aminotransferase bioF 0.2 8-amino-7-oxononanoate synthase bioD 0.2 dethiobiotin synthetase bioB 0.2 biotin synthetase bioI 0.2 cytochrome P450 enzyme thiC 0.3 biosynthesis of the pyrimidine moiety of thiamin thiF 0.3 hydroxyethylthiazole phosphate biosynthesis yrrM 0.3 similar to caffeoyl-CoA O-methyltransferase yrrN 0.3 similar to protease ylnD 0.1 similar to uroporphyrin-III C-methyltransferase ylnF 0.2 similar to uroporphyrin-III C-methyltransferase Metabolism of phosphate ybfM 0.3 similar to alkaline phosphatase DNA replication dnaN 0.2 DNA polymerase III (beta subunit) polC 0.3 initation of replication cycle and DNA elongation ssb 0.1 single-strand DNA-binding protein RNA synthesis Transcription regulation comQ 0.2 regulation of late competence operon and surfactin expression yybE 0.3 similar to transcriptional regulator (LysR family) Transcription elongation rpoA 0.2 RNA polymerase (alpha subunit) rpoB 0.2 RNA polymerase (beta subunit) rpoC 0.3 RNA polymerase (beta' subunit) Transcription termination rho 0.3 transcriptional terminator Rho nusA 0.2 transcription termination RNA modification trmD 0.3 tRNA methyltransferase rnpA 0.3 cleavage of precursor sequences from the 5' ends of pre-tRNAs Protein synthesis Ribosomal proteins (1) RelA rpsJ 0.1 ribosomal protein S10 (BS13) RelA rplC 0.07 ribosomal protein L3 (BL3) RelA rplD 0.06 ribosomal protein L4 RelA rplW 0.07 ribosomal protein L23 RelA rplB 0.07 ribosomal protein L2 (BL2) RelA rpsS 0.05 ribosomal protein S19 (BS19) RelA rplV 0.04 ribosomal protein L22 (BL17) RelA rpsC 0.05 ribosomal protein S3 (BS3) RelA rplP 0.05 ribosomal protein L16 RelA rpmC 0.06 ribosomal protein L29 RelA rpsQ 0.05 ribosomal protein S17 (BS16) RelA rplN 0.05 ribosomal protein L14 RelA rplX 0.06 ribosomal protein L24 (BL23) (histone-like protein HPB12) RelA rplE 0.08 ribosomal protein L5 (BL6) RelA rpsN 0.08 ribosomal protein S14 RelA rpsH 0.06 ribosomal protein S8 (BS8) RelA rplF 0.09 ribosomal protein L6 (BL8) 155

Regulator Gene Repression ratio Function/Similarity Ribosomal proteins (2) RelA rplR 0.1 ribosomal protein L18 RelA rpsE 0.09 ribosomal protein S5 RelA rpmD 0.06 ribosomal protein L30 (BL27) RelA rplO 0.1 ribosomal protein L15 RelA rpsL 0.08 ribosomal protein S12 (BS12) RelA rpsG 0.07 ribosomal protein S7 (BS7) RelA rpmJ 0.1 ribosomal protein L36 (ribosomal protein B) RelA rpsM 0.2 ribosomal protein S13 RelA rpsK 0.1 ribosomal protein S11 (BS11) RelA rplQ 0.2 ribosomal protein L17 (BL15) RelA rpmI 0.2 ribosomal protein L35 RelA rplT 0.3 ribosomal protein L20 RelA rplA 0.3 ribosomal protein L1 (BL1) RelA rplJ 0.2 ribosomal protein L10 (BL5) RelA rplL 0.1 ribosomal protein L12 (BL9) RelA rpsB 0.2 ribosomal protein S2 RelA rpsD 0.2 ribosomal protein S4 (BS4) RelA rpsF 0.09 ribosomal protein S6 (BS9) rpsR 0.2 ribosomal protein S18 RelA rpsP 0.3 ribosomal protein S16 (BS17) RelA rpmF 0.2 ribosomal protein L32 RelA rplU 0.2 ribosomal protein L21 (BL20) RelA rplS 0.3 ribosomal protein L19 RelA rpmE 0.3 ribosomal protein L31 RelA ybxF 0.08 similar to ribosomal protein L7AE family ylxQ 0.1 similar to ribosomal protein L7AE family Aminoacyl-tRNA synthetases thrS 0.3 threonyl-tRNA synthetase (major) Translation initiation RelA infA 0.07 initiation factor IF-1 infB 0.3 initiation factor IF-2 RelA infC 0.2 initiation factor IF-3 Translation elongation (1) RelA fusA 0.1 elongation factor G RelA tufA 0.3 elongation factor Tu RelA tsf 0.1 elongation factor Ts Translation termination RelA frr 0.1 ribosome recycling factor Protein modification pcp 0.3 pyrrolidone-carboxylate peptidase map 0.09 methionine aminopeptidase Adaptation to atypical conditions degQ 0.2 hyperproduction of levansucrase and other extracellular degradative enzymes Unknown (1) ykoC 0.2 similar to cobalt transport protein ykoE 0.2 conserved hypothetical protein ylxS 0.1 hypothetical conserved protein ylxR 0.1 conserved hypothetical protein ybxB 0.1 conserved hypothetical protein yjlC 0.2 conserved hypothetical protein 156

Regulator Gene Repression ratio Function/Similarity Unknown (2) ylbN 0.1 conserved hypothetical protein ylnE 0.1 similar to ferrochelatase ysxB 0.2 conserved hypothetical protein ybcH 0.3 unknown ykrX 0.3 similar to hydrolase ykrY 0.2 similar to aldolase ykrZ 0.2 similar to 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase ylqC 0.2 conserved hypothetical protein ylqD 0.2 conserved hypothetical protein ylxM 0.2 conserved hypothetical protein yonS 0.3 unknown yqeG 0.3 similar to hydrolase yqeH 0.3 similar to GTP-binding protein yqeI 0.3 conserved hypothetical protein yqeJ 0.2 similar to nicotinate-nucleotide adenylyltransferase yqeK 0.3 similar to hydrolase yqeL 0.3 similar to Iojap-related protein yueB 0.2 conserved hypothetical protein yuzC 0.3 conserved hypothetical protein yxaI 0.2 unknown yvcA 0.2 conserved hypothetical protein yvzA 0.3 unknown ywqH 0.3 conserved hypothetical protein 157

[Supplemental material] Table S2: Repression profile after 10 minutes of catechol stress in the transcriptome analysis Regulator Gene Repression ratio Function/Similarity Membrane bioenergetics (electron transport chain and ATP synthase) RelA atpI 0.2 ATP synthase (subunit i) RelA atpB 0.1 ATP synthase (subunit a) RelA atpE 0.2 ATP synthase (subunit c) RelA atpH 0.2 ATP synthase (subunit delta) RelA atpA 0.3 ATP synthase (subunit alpha) RelA atpG 0.2 ATP synthase (subunit gamma) RelA atpC 0.3 ATP synthase (subunit epsilon) cell wall mreC 0.3 cell-shape determining protein mreD 0.2 cell-shape determining protein dacA 0.2 penicillin-binding protein 5 (D-alanyl-D-alanine carboxypeptidase) murG 0.3 UDP-N-acetylglucosamine-N-acetylmuramyl-(pentapeptide)pyrophosphoryl- RelA murE 0.2 UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase mraY 0.2 phospho-N-acetylmuramoyl-pentapeptide transferase murD 0.2 UDP-N-acetylmuramoylalanyl-D-glutamate ligase RelA gcaD 0.2 UDP-N-acetylglucosamine pyrophosphorylase Transport/binding proteins and lipoproteins yfnI 0.3 similar to anion-binding protein ykoD 0.2 similar to cation ABC transporter (ATP-binding protein) Motility and chemotaxis fliL 0.3 required for flagellar formation fliY 0.3 flagellar motor switch protein cheY 0.3 modulation of flagellar switch bias/two component response regulator fliZ 0.3 required for flagellar formation fliP 0.3 required for flagellar formation fliR 0.3 required for flagellar formation ylxH 0.2 similar to flagellar biosynthesis switch protein cheB 0.2 chemotaxis receptor demethylation/two-component response regulator-like mcpA 0.3 chemotaxis toward glucose and alpha-methyl-glucoside tlpB 0.2 methyl-accepting chemotaxis protein Protein secretion RelA secY 0.3 preprotein translocase subunit ffh 0.3 presecretory protein translocation lytA 0.3 involved in the secretion of major autolysin LytC (amidase) Main glycolytic pathways CcpA pgk 0.3 phosphoglycerate kinase CcpA pdhB 0.2 pyruvate dehydrogenase (E1 beta subunit) CcpA pdhC 0.4 pyruvate dehydrogenase CcpA pdhD 0.4 pyruvate dehydrogenase Specific pathway CcpA ackA 0.2 conversion of acetyl-CoA to acetate Metabolism of nucleotides and nucleic acids (1) pucH 0.2 allantoinase PurR purE 0.09 phosphoribosylaminoimidazole carboxylase I purK 0.3 phosphoribosylaminoimidazole carboxylase II purB 0.04 adenylosuccinate lyase purS 0.2 required for phosphoribosylformylglycinamidine synthetase activity purQ 0.1 phosphoribosylformylglycinamidine synthetase I purL 0.1 phosphoribosylformylglycinamidine synthetase II 158

Regulator Gene Repression ratio Function/Similarity Metabolism of nucleotides and nucleic acids (2) purF 0.05 glutamine phosphoribosylpyrophosphate amidotransferase purM 0.09 phosphoribosylaminoimidazole synthetase purN 0.09 phosphoribosylglycinamide formyltransferase purH 0.1 monophosphate cyclohydrolase purD 0.09 phosphoribosylglycinamide synthetase purR 0.3 transcriptional repressor of the purine operons PyrR pyrB 0.1 aspartate carbamoyltransferase pyrC 0.2 dihydroorotase pyrAA 0.05 carbamoyl-phosphate synthetase (glutaminase subunit) pyrAB 0.1 carbamoyl-phosphate synthetase (catalytic subunit) pyrP 0.1 uracil permease pyrR 0.07 attenuation of the pyrimidine operon in the presence of UMP RelA pyrH 0.1 uridylate kinase RelA prs 0.2 phosphoribosylpyrophosphate synthetase udk 0.2 uridine kinase Metabolism of coenzymes and prosthetic groups bioD 0.3 dethiobiotin synthetase bioB 0.3 biotin synthetase bioI 0.3 cytochrome P450 enzyme yrrM 0.3 similar to caffeoyl-CoA O-methyltransferase yrrN 0.3 similar to protease DNA replication dnaA 0.3 initiation of chromosome replication dnaN 0.3 DNA polymerase III (beta subunit) ssb 0.1 single-strand DNA-binding protein DNA restriction/modification and repair radC 0.3 DNA repair protein RNA synthesis Transcription elongation RelA rpoB 0.3 RNA polymerase (beta subunit) Transcription termination RelA nusA 0.2 transcription termination RNA modification trmD 0.3 tRNA methyltransferase Protein synthesis Ribosomal proteins (1) RelA ybxF 0.1 similar to ribosomal protein L7AE family RelA rpsL 0.2 ribosomal protein S12 (BS12) RelA rpsG 0.2 ribosomal protein S7 (BS7) RelA rpmJ 0.3 ribosomal protein L36 (ribosomal protein B) RelA rpmI 0.3 ribosomal protein L35 RelA rplT 0.2 ribosomal protein L20 RelA rplJ 0.1 ribosomal protein L10 (BL5) RelA rplL 0.1 ribosomal protein L12 (BL9) RelA rpsB 0.2 ribosomal protein S2 RelA rpsD 0.2 ribosomal protein S4 (BS4) RelA rpsF 0.1 ribosomal protein S6 (BS9) rpsR 0.3 ribosomal protein S18 RelA rpsJ 0.1 ribosomal protein S10 (BS13) RelA rplC 0.3 ribosomal protein L3 (BL3) RelA rplW 0.3 ribosomal protein L23 159

Regulator Gene Repression ratio Function/Similarity Ribosomal proteins (2) RelA rplB 0.2 ribosomal protein L2 (BL2) RelA rpsS 0.2 ribosomal protein S19 (BS19) RelA rplV 0.2 ribosomal protein L22 (BL17) RelA rpsC 0.1 ribosomal protein S3 (BS3) RelA rplP 0.2 ribosomal protein L16 RelA rpmC 0.2 ribosomal protein L29 RelA rpsQ 0.3 ribosomal protein S17 (BS16) RelA rplN 0.3 ribosomal protein L14 RelA rplX 0.3 ribosomal protein L24 (BL23) (histone-like protein HPB12) RelA rpsE 0.3 ribosomal protein S5 RelA rpmD 0.2 ribosomal protein L30 (BL27) RelA rplO 0.3 ribosomal protein L15 RelA rpsP 0.3 ribosomal protein S16 (BS17) RelA rpmF 0.2 ribosomal protein L32 RelA rplU 0.2 ribosomal protein L21 (BL20) RelA ylxQ 0.2 similar to ribosomal protein L7AE family Translation initiation RelA infA 0.2 initiation factor IF-1 infB 0.3 initiation factor IF-2 RelA infC 0.2 initiation factor IF-3 Translation elongation RelA fusA 0.3 elongation factor G RelA tufA 0.2 elongation factor Tu RelA tsf 0.1 elongation factor Ts Translation termination RelA frr 0.1 ribosome recycling factor Protein folding RelA tig 0.3 trigger factor (prolyl isomerase) Unknown RelA ylxS 0.1 conserved hypothetical protein RelA ylxR 0.2 conserved hypothetical protein ybxB 0.1 conserved hypothetical protein RelA ylbN 0.09 conserved hypothetical protein ysxB 0.2 conserved hypothetical protein ykoE 0.2 conserved hypothetical protein ylqD 0.3 conserved hypothetical protein ylxM 0.2 conserved hypothetical protein yonS 0.3 unknown ysaA 0.2 similar to hydrolase 160

161

Chapter 6

Proteome signature catalog of Bacillus subtilis in response to stress, aromatic substances and nutrient starvation

162

This catalog describes proteome signatures of Bacillus subtilis after exposure to heat, salt, peroxide, superoxide and diamide stress, in response to the aromatic substances: phenol, catechol, 6-brom-2-vinyl-chroman-4-on, 2-methyl hydroquinone, salicylic acid as well as after ammonium, tryptophan, glucose and phosphate starvation conditions. It includes informations about the chemical structure, minimal inhibitory concentration (MIC), growth curve and mode of action in response to the stressor or aromatic substance, the growth curves in response to the specific nutrient starvation conditions, the proteome signatures up to 30 min after the stress or during the transition phase (t0) to stationary phase (10, 30 and 60 min after t0) as reflected by the dual channel images [stress or starvation image (red image) in comparison to the untreated control image (green image)], the induced marker proteins as classified into specifically and generally induced stress and/or starvation regulons and the table presenting the overlaps with other analyzed stress and starvation conditions as revealed by the same color.

Minimal inhibitory concentration (MIC) determination. The MICs of the aromatic substances in B. subtilis 168 were determined in test tubes containing 5 ml of Belitsky minimal medium and appropriate concentrations of the respective compound inoculated with 105 cells/ml. The tubes were incubated at 37°C for 18 h. The MIC was defined as the lowest concentration that inhibited visible growth. For growth experiments, different concentrations of the compounds were added to exponentially growing cultures when the cultures reached an optical density at 500 nm (OD500) of 0.4 as marked by arrows.

Proteome analysis. Cells grown in minimal medium were pulse-labeled for 5 min each with 35 10 µCi/ml of L-[ S]methionine at an OD500 of 0.4 (for control), at different times (5, 10, 20 and 30 min) after exposure to stress and aromatic substances or during transition phase (t0) and 10, 30 and 60 min after transition to stationary phase caused by ammonium, tryptophan, glucose or phosphate starvation. L-[35S]methionine incorporation was stopped after 5 min by addition of 1mg/ml of chloramphenicol and an excess of cold L-methionine (10 mM) on ice. 80 µg of the L-[35S]methionine-labeled protein extract were separated by two-dimensional gel electrophoresis (2D-PAGE) using the non-linear immobilized pH gradients (IPG) in the pH range 4-7 (Amersham Biosciences) and a Multiphor II apparatus (Amersham Pharmacia Biotech) as described previously [Bernhardt et al., 1999]. The gels were stained with silver nitrate, dried on filter paper, exposed to Phosphor screens (Molecular Dynamics, Sunnyvale, Calif.) which were detected with a Phosphor Imager SI instrument (Molecular Dynamics) [Bernhardt et al., 1999]. For identification of the proteins by mass spectrometry, 163 nonradioactive protein samples of 200 µg were separated by preparative 2D-PAGE and stained with Colloidal Coomassie Brilliant Blue (Amersham Biosciences).

Quantitative image analysis. Quantitative image analysis was performed with the DECODON Delta 2D software (http://www.decodon.com) which is based on the dual channel image analysis technique pioneered in 1999 [Bernhardt et al., 1999]. Using this software the 2D gel images from stress and starvation experiments were aligned to a reference image (control) by using a warp transformation. To avoid incomplete groups of matching spots a fused 2D gel was created for spot detection. For preparing such a fusion gel, all 2D gel images from each single stress or starvation experiments were combined using the spot preserving “union fusion” algorithm of Delta2D [Luhn et al., 2003]. Spot detection was performed in the fusion gel containing all spots present in any gel of one stress or starvation experiment according to the automatically suggested parameters for background subtraction, average spot size, and spot sensitivity. The resulting spot shapes were reviewed and manually edited in the fusion gel if necessary. This reviewed spot mask serves as a spot detection consensus for all gel images of the stress or starvation experiment and was applied to the individual gels to guide the spot detection and quantitation. This enables spot quantitation in all gels at the same locations resulting in 100% matching and in a reliable analysis of complete expression profiles. Normalization was performed by calculating the quantity of each single spot in percentage related to the total spot quantity per gel.

Marker proteins. Proteins showing an induction of at least twofold compared to the control during the L-[35S]methionine pulse in any time point of two independent stress or starvation experiments were designated as stress or starvation induced marker proteins and listed in the table of “Summary of marker proteins for stress and starvation in B. subtilis” for all conditions. The proteins not detected in these experiments but identified in previous proteome analyses or in the alkaline pH range were marked by an x. Proteins that are not expressed in the vegetative proteome map are indicated by *. All newly identified proteins that are absent in vegetative proteome map and also not detected in previous proteome analyses for stress and starvation are indicated by ** [Antermann et al., 2000; Bernhardt et al., 2003; Eymann et al., 1996; Eymann et al., 2002; Höper et al., 2006; Leichert et al., 2003; Mostertz et al., 2004; Bandow et al., 2003]. In case of diamide stress and the treatment with chromanon and 2-methylhydroquinone, the proteome datas are derived from previous studies of Leichert et al. [Leichert et al. 2003] and the diploma thesis of Carmen Wolf [Wolf, 2005]. Marker proteins are classified according to the array data of previously described regulons (HrcA, σB, CtsR, PerR, Fur, Spx, RecA, CymR, S-box, TnrA, σL, BkdR, RocR, 164

AcoR, TRAP, CcpA, CcpN, PhoPR, CodY, RelA, σH, σF, σE ) [Leichert et al., 2003; Mostertz et al., 2004; Nakano et al. 2003; Petersohn et al., 2001; Ollinger et al., 2006; Helmann et al., 2003; Fernandez et al., 2000; Yoshida et al., 2003; Débarbouillé et al., 1999; Eichenberger et al., 2003; Feucht et al., 2003; Molle et al., 2003; Gardan et al., 1997; Yoshida et al., 2001; Koburger et al., 2005; Britton et al., 2002; Babitzke and Gollnick, 2001; Servant et al., 2005; Allenby et al., 2005; Blencke et al., 2003; Mascher et al., 2004; Baichoo et al., 2002; Steil et al., 2005; Bergara et al., 2003; Wray et al., 1997; Eymann., 2002; Even et al., 2006]. The function is derived from the SubtiList database (http://genolist.fr/SubtiList/). The functions of the Fur-regulated genes are derived from genetic and physiological studies reported previously [Ollinger et al., 2006]. All not identified marker proteins are labelled according to the stress or substance (e.g. SAL-1,2,3,4,5 for salt stress, DIA-1,2,3,4,5,6 for diamide stress and GLU-1,2,3,4 for glucose starvation). The marker proteins with another superscript protein show mix spots on 2D gel. The marker proteins that could not be detected on 2D gel are marked by “n.q”

165

1. Stress conditions Growth 1.1. Heat stress 10

480 C 1

500 OD 0.1

Control at 37°C Heat shock at 48°C 0.01 0 100 200 300 400 500 Time (min)

control (370C)/ heat shock (480C, 5 min)

ClpC ClpE HtpG DnaK GroEL YjbG

YsnF YkgB /YvaA YqiG YhdN YceH

IolS SigB NadE YcdF GtaB Ctc GspA NfrA GrpE YhfK YwfI

ClpP YceD SodA YfkM YvyD

YdaG YtxH RsbW

GsiB Dps YkzA

PtsH GroES

pI7 pI4 pI4 166

Mode of action: The high temperature provokes protein damage as revealed by misfolded and aggregated proteins and non-native disulfide bond formation [Wickner et al., 1999]. Consequently, chaperones and proteases are induced that either assist in proper folding or degrade these misfolded proteins.

Marker proteins:

Protein Induction ratio Description 5 10 20 HrcA regulon DnaK 4.9 3.3 1.6 class I heat-shock protein (molecular chaperone) GroEL 13.4 13.8 5.6 class I heat-shock protein (chaperone) GroES 3.2 n.q n.q class I heat-shock protein (chaperone) GrpE 4.2 3.6 1.0 heat-shock protein (activation of DnaK) σB regulon Ctc 4.2 n.q n.q general stress protein Dps 2.8 1.9 1.2 stress- and starvation-induced gene GsiB 50.4 43.8 21.2 general stress protein GspA* 19.4 15.4 2.5 general stress protein GtaB 8.7 11.9 7.0 glucosylation of teichoic acid NadE 2.2 1.9 1.6 NAD biosynthesis RsbW 1.8 1.2 0.5 anti-sigma factor of sigmaB SigB 3.7 2.0 1.2 general stress sigma factor YcdF 2.3 n.q n.q similar to glucose 1-dehydrogenase YceD 5.0 5.6 2.1 similar to tellurium resistance protein YceH 2.1 1.5 1.6 similar to toxic anion resistance protein YdaG 2.9 3.4 2.5 general stress protein YfkM 5.9 5.2 2.7 general stress protein YhdN 6.4 5.0 2.0 similar to aldo/keto reductase YkzA 3.7 n.q n.q similar to organic hydroperoxide resistance protein YsnF 22.3 3.7 6.5 unknown YtxH 2.6 1.8 1.2 similar to general stress protein YvaA (YkgB) 5.1 4.4 2.6 similar to oxidoreductase YvyD 3.6 n.q n.q similar to sigma-54 modulating factor CtsR regulon ClpC 23.4 16.8 1.5 class III stress response-related ATPase ClpE* 343 56.8 5.3 ATP-dependent Clp protease-like ClpP 6.6 7.6 1.7 ATP-dependent Clp protease proteolytic subunit HtpG 8.4 5.9 6.6 class III heat-shock protein (molecular chaperone) Spx regulon IolS 2.9 3.6 1.8 myo-inositol catabolism NfrA 3.2 0.8 1.3 FMN-containing NADPH-linked nitro/flavin reductase SodA 5.8 7.7 1.7 superoxide dismutase YhfK 2.7 n.q n.q nucleoside-diphosphate-sugar epimerase YjbG 2.3 1.1 1.3 oligoendopeptidase F homolog YqiG 3.5 2.0 1.3 probable NADH-dependent flavin oxidoreductase Other PtsH 3.6 n.q n.q phosphocarrier protein of the PTS (HPr protein) YkgB(YvaA) 5.1 4.4 2.6 similar to 6-phosphogluconolactonase YwfI 1.8 n.q n.q similar to chlorite dismutase

167

Overlap

Condition Specific responses HEAT HrcA, σB, CtsR, Spx SALT σB, CtsR, Spx PHENOL HrcA, σB, CtsR, Spx 6-BROM-2-VYNYL- HrcA, σB, CtsR, Spx (YcnD) CHROMAN-4-ON SALICYLIC HrcA, σB, CtsR, Spx, CymR, CodY Other marker for acid decarboxylation: PadC, YclC 2-METHYL- HrcA, CtsR, PerR, Spx (YcnD) HYDROQUINONE Other marker for degradation: YdfNO

H2O2 PerR, Fur, SOS, Spx PARAQUAT PerR, Fur, CymR, S-box, Spx DIAMIDE HrcA, CtsR, PerR, CymR, Spx CATECHOL HrcA, CtsR, PerR, Fur, CymR, Spx (YcnD), CcpA Other marker for degradation: YfiDE, YdfNO, YkcA GLUCOSE CcpA, CcpN, σL, AcoR, σF, σE, σB, σH, (RapA) AMMONIUM TnrA, GlnR, σL, BkdR, CodY, RelA, σF, σE, σB, σH, (RapA) TRYPTOPHAN TRAP, CodY, RelA, σH, (RapA) PHOSPHATE PhoPR, CodY, σB, σH, (RapA)

168

1.2 Salt stress

6% NaCl Growth 10

1 500

OD 0.1

Control 6% salt 0.01 0 100 200 300 400 500 Time (min) control / salt stress ( 6% NaCl, 10 min)

ClpC ClpE KatE

YdaP YurU

SAL - 4 FabF

YceH YsnF SAL -5 YhdN

YdaD SigB NadE

GspA YcdF Ctc GtaB YfhM SAL- 1 YjbC NfrA YurY ClpP SAL-2 YvyD YceC SodA SAL-3 YocK YfkM YuaE YtxH YdaG RsbW Dps

GsiB

pI7 YkzA pI4 169

Mode of action: A rise in the external salinity and osmolality triggers the outflow of water from the cell, results in a reduction in turgor and dehydration of the cytoplasm [Bremer, 2002]. The increases in salinity affect the phospholipid composition of the cytoplasmic membrane [Lopez et al., 2000], the properties of the cell wall [Lopez et al., 1998], and the synthesis of the cell wall-associated protein WapA [Dartois et al., 1998]. Salt stress also causes the increase in negative supercoiling of reporter plasmids [Alice and Sanchez-Rivas, 1997] and a behavioral response (osmotaxis)

Marker proteins:

Protein Induction ratio Description 10 20 30 σB regulon Ctc 19.2 22.2 36.5 general stress protein Dps 9.1 9.6 7.1 stress- and starvation-induced gene GsiB 1.1 23.6 37.6 general stress protein GspA* 0.5 5.7 2.0 general stress protein GtaB 5.5 6.2 4.1 glucosylation of teichoic acid KatE 0.4 4.4 7.5 catalase 2 NadE 3.7 6.1 4.8 NAD biosynthesis RsbW 13.2 13.6 12.9 anti-sigma factor of sigmaB SigB 12.8 13.3 10.8 general stress sigma factor YcdF 0.8 3.6 4.7 similar to glucose 1-dehydrogenase YceC 10.7 11.0 12.3 similar to tellurium resistance protein YceH 2.5 5.3 6.9 similar to toxic anion resistance protein YdaD* 0.4 13.4 4.0 oxidoreductase YdaG 3.9 2.0 9.3 general stress protein YdaP 2.8 9.5 8.4 similar to pyruvate oxidase YfhM 2.5 3.9 10.2 similar to epoxide hydrolase YfkM 11.8 18.6 20.3 general stress protein YhdN 3.8 4.8 3.0 similar to aldo/keto reductase YkzA 12.2 30.7 50.1 similar to organic hydroperoxide resistance protein YocK* 11.6 17.6 19.4 similar to general stress protein YsnF 4.8 9.7 31.6 unknown YtxH 6.1 8.6 6.8 similar to general stress protein YvyD 16.8 1.1 4.0 similar to sigma-54 modulating factor of negative bacteria CtsR regulon ClpC 0.3 3.0 7.1 class III stress response-related ATPase ClpE* 1.2 15.6 21.7 ATP-dependent Clp protease-like ClpP 2.4 5.9 6.8 ATP-dependent Clp protease proteolytic subunit Spx regulon NfrA 0.6 1.2 3.2 FMN-containing NADPH-linked nitro/flavin reductase SodA 3.3 4.2 3.8 superoxide dismutase YjbC 1.8 1.9 6.6 simialar to N-acetyltransferase YuaE 1.3 1.4 48.3 unknown Other FabF 2.6 2.1 1.5 beta-ketoacyl-acyl carrier protein synthase II YurU 1.1 1.9 1.6 similar to ABC transporter YurY 2.2 2.9 3.4 similar to ABC transporter (ATP-binding protein) SAL-1 28.7 26.7 22.1 induced under only salt stress SAL-2 43.9 46.3 36.5 induced under only salt stress SAL-3 28.4 11.1 25.9 induced under only salt stress SAL-4 17.6 9.8 40.7 induced under only salt stress SAL-5 19.3 18.0 20.0 induced under only salt stress

170

Overlap

171

1.3. Hydrogen peroxide stress (H2O2)

116 µM H2O2 Growth 10

O 1

O 500

H OD 01 control in stress 58 µM H2O2

stress 116 µM H2O2 0.01 0 200 400 600 Time (min)

control / H2O2 (116 µM, 10min)

MrgA

UvrB KatA DhbE YurU AhpF

AmhX RecA DhbC YqiG YugJ DhbB YclQ YxbC FeuA YwbM YfiY IolS HemH YcgT YxeB YfjR NfrA DhbA YwfI

AhpC YuaE

Tpx

MrgA

pI7 pI4

172

Mode of action: Peroxides are weak oxidizing agents that react with thiol groups in proteins or reduced glutathione by formation of disulfide bonds or sulfonic acid derivatives.

H2O2 is able (i) to generate carbonyl groups in lysine, arginine, threonine, and proline residues; (ii) to oxidize methionine to sulfoxide adducts; (iii) to react with reduced iron or • − copper ions to generate OH during the Fenton reaction (Fe(II)+ H2O2 → Fe(III)+ OH + OH) which in turn oxidizes nucleic acids, membrane lipids and proteins of the cell [Storz and Zheng, 2000; Imlay, 2003]

Marker proteins:

Protein Induction ratio Description 10 20 30 PerR regulon AhpC 4.9 4.2 2.3 alkyl hydroperoxide reductase (small subunit) AhpF 3.1 2.6 1.2 alkyl hydroperoxide reductase (large subunit) KatA 13.6 3.9 0.3 vegetative catalase 1 MrgA 15.4 2.1 1.6 metalloregulation DNA-binding stress protein YxbC 3.8 1.5 1.1 similar to unknown proteins Fur regulon DhbA* 10.4 1.7 0.9 bacillibactin siderophore biosynthesis DhbB* 48.0 9.3 2.2 bacillibactin siderophore biosynthesis DhbC* 4.0 2.1 0.6 bacillibactin siderophore biosynthesis DhbE* 23.4 6.7 0.6 bacillibactin siderophore biosynthesis FeuA* 5.1 2.6 0.6 ABC-transporter binding protein (bacillibactin and enterobactin uptake) YcgT* 1.7 1.4 1.0 similar to thioredoxin reductase YfiY* 1.5 1.1 0.8 ABC transporter binding protein (schizokinin, arthrobactin uptake) YxeB* 13.6 1.9 1.7 ABC transporter binding protein (ferrioxamine uptake) YclQ 1.2 1.0 0.7 ABC-transporter binding protein (siderophore uptake) YwbM* 2.9 0.9 1.0 elemental Fe transport (yeast FTS3 homolog) SOS regulon RecA 5.9 6.5 4.9 multifunctional SOS repair regulator UvrB** 2.6 2.9 2.3 excinuclease ABC (subunit B) Spx regulon HemH 5.0 2.6 1.1 incorporation of iron into protoporphyrin IX giving protoheme IX IolS 2.1 0.9 0.9 myo-inositol catabolism NfrA 2.3 0.7 0.7 FMN-containing NADPH-linked nitro/flavin reductase Tpx 2.6 1.1 1.1 thiol peroxidase YfjR 3.0 1.1 1.1 dehydrogenase precursor YqiG 2.3 0.9 0.7 probable NADH-dependent flavin oxidoreductase YuaE 2.9 1.4 0.2 unknown YugJ 2.3 0.9 0.9 probable NADH-dependent butanol dehydrogenase 1 Other AmhX 0.4 1.0 9.1 amidohydrolase YurU 2.5 2.3 2.1 similar to ABC transporter YwfI 2.0 1.1 1.1 similar to chlorite dismutase

173

Overlap

174

1.4. Paraquat stress (Par) Growth 100 µM of paraquat 10

1 + + CH3 N N CH3 500 OD 0.1 Control paraquat stress 0.01 0 200 400 Time (min) control / paraquat (100 µM, 10 min)

MrgA

MetE

YjbG DhbE KatA YitJ AhpF

DhbC YbaL/YrhB YxeK DhbB YxeP/YpsC YqiG YwbM YcgT YugJ HemH Cah CysK YxeB YfjR YhfK

DhbA YvyD NfrA AhpC

YuaE

Tpx

MrgA

TrxA pI 7 pI 4 175

Mode of action: Paraquat generates the superoxide radical anions, O2¯ which attack proteins containing thiol groups and (Fe-S)4 clusters, resulting in the release of iron and loss of enzyme activity [Brown et al., 1995]. O2¯ inhibits the synthesis of branched-chain and aromatic amino acids by inactivating the [4Fe-4S] family of dehydratase or transketolase

[Benov et al., 1996; Benov and Fridovich, 1999; Benov, 2000; Imlay, 2006]. O2¯ is also able to dismutate spontaneously to H2O2 which in turn provokes oxidative damage of cellular components [Imlay, 2003].

Marker proteins:

Protein Induction ratio Description 10 20 30 PerR regulon AhpC 11.2 11.7 18.0 alkyl hydroperoxide reductase (small subunit) AhpF 9.3 12.0 11.2 alkyl hydroperoxide reductase (large subunit) KatA 107 147 139 vegetative catalase 1 MrgA 23.6 0.9 0.5 metalloregulation DNA-binding stress protein Fur regulon DhbA* 8.5 13.8 9.7 bacillibactin siderophore biosynthesis DhbB* 19.6 33.1 27.5 bacillibactin siderophore biosynthesis DhbC* 2.8 4.2 2.8 bacillibactin siderophore biosynthesis DhbE* 14.2 20.2 14.2 bacillibactin siderophore biosynthesis YcgT* 2.1 2.1 2.4 similar to thioredoxin reductase YxeB* 12.2 12.3 9.0 ABC transporter binding protein (ferrioxamine uptake) YwbM* 3.6 7.4 6.8 elemental Fe transport (yeast FTS3 homolog) CymR/S-box regulon CysK 4.7 0.7 2.3 cysteine synthetase A MetE 2.8 1.9 3.2 cobalamin-independent methionine synthase YrhBYbaL** 5.6 1.5 2.7 cystathionine gamma-lyase YitJ 3.2 1.3 3.4 similar to homocysteine S-methyltransferase YxeK** 2.0 1.7 2.2 similar to monooxygenase YxePYpsC** 6.2 1.9 3.4 peptidase, M20/M25/M40 family Spx regulon HemH 2.0 2.0 2.0 incorporation of iron into protoporphyrin IX giving protoheme IX NfrA 3.9 5.6 4.2 FMN-containing NADPH-linked nitro/flavin reductase Tpx 2.0 2.4 3.1 thiol peroxidase TrxA 2.4 2.5 2.7 thioredoxin YfjR 1.8 2.5 2.5 dehydrogenase precursor YhfK 1.5 3.0 3.2 nucleoside-diphosphate-sugar epimerase YjbG 2.9 3.5 3.2 oligoendopeptidase F homolog YqiG 2.8 1.6 1.7 probable NADH-dependent flavin oxidoreductase YuaE 5.2 6.2 6.2 unknown YugJ 3.8 2.7 3.2 probable NADH-dependent butanol dehydrogenase 1 Other Cah 7.6 1.3 2.9 cephalosporin C deacetylase YbaLYrhB 5.6 1.5 2.7 similar to ATP-binding Mrp-like protein YpsCYxeP** 6.2 1.9 3.4 similar to methyltransferase YvyD 2.2 6.5 9.0 similar to σ54 modulating factor

176

Overlap

177

1.5. Diamide (Diam)

1 mM of diamide

CH O 3

N N H C CH3 3 N N O CH3

control / diamide (1 mM diamide, 10 min)

MrgA 12mer

ClpE

KatA DIA-1

YbaL Hag HemH

CysK

YfjR DIA-2 YhfK NfrA YvyD YkuQ YodC DIA-3 ClpP/YocJ YocJ YuaE GreA DIA-4

MrgA DIA-5

GroES

TrxA DIA-6 pI 7 pI 4 178

Mode of action: Diamide is a thiol-specific oxidant that reacts with free thiol groups in proteins to generate non-native disulfide bonds [Leichert et al., 2003; Bardwell, 1994; Deneke, 2000] .

Marker proteins

Protein Induction ratio Description 10 30 50 HrcA regulon GroES 2.8 n.q 1.6 class I heat-shock protein (chaperonin) CtsR regulon ClpE* ∞ ∞ ∞ ATP-dependent Clp protease-like (class III stress gene) ClpP 4.7 6.3 6.7 ATP-dependent Clp protease proteolytic subunit PerR regulon KatA 8.2 13.5 20.5 vegetative catalase 1 MrgA 19.2 17.7 10.8 metalloregulation DNA-binding stress protein Spx regulon GreA 2.8 3.5 3.2 transcription elongation factor HemH n.q n.q n.q incorporation of iron into protoporphyrin IX giving protoheme IX NfrA n.q n.q n.q FMN-containing NADPH-linked nitro/flavin reductase TrxA 4.6 11.3 13.6 Thioredoxin YfjR n.q n.q n.q dehydrogenase precursor YhfK n.q n.q n.q nucleoside-diphosphate-sugar epimerase YuaE ∞ ∞ ∞ unknown CymR regulon CysK 5.6 5.1 5.5 cysteine synthetase A Other Hag 2.3 2.6 2.1 flagellin protein YbaL 7.6 3.6 4.7 similar to ATP-binding Mrp-like protein YkuQ 5.6 3.5 4.5 similar to tetrahydrodipicolinate succinylase YocJ 4.7 6.3 6.7 similar to acyl-carrier protein phosphodiesterase YodC 4.5 7.0 8.2 similar to nitroreductase YvyD 2.7 2.8 3.5 similar to sigma-54 modulating factor of gram-negative bacteria DIA-1 n.q n.q n.q induced only under diamide stress DIA-2 n.q n.q n.q induced only under diamide stress DIA-3 n.q n.q n.q induced only under diamide stress DIA-4 n.q n.q n.q induced only under diamide stress DIA-5 n.q n.q n.q induced only under diamide stress DIA-6 n.q n.q n.q induced only under diamide stress n.q: not quantitate; ∞: the basal level of the spot is too low, so the ratio is very high

179

Overlap

180

1.6. Phenol (Phen) Growth MIC 16 mM 10

OH 1

500 OD

0.1 control 0.5xMIC 1xMIC 2xMIC 4xMIC 0.01 0 200 400 600 Time (min) control / phenol (16 mM, 10 min)

ClpC ClpE DnaK YjbG UreC GroEL YdaP

DhaS AmhX YsnF YhfE

YqiG YceH RapG YhdN

YugJ HemH IolS YvcT YdaD YisK Cah GspA Ctc YcdF GtaB YfjR YhfK YvyD YceC YwfI NfrA YceD YfkM ClpP YdaE YuaE YtxH Dps

Tpx GsiB

YkzA TrxA pI7 pI4

181

Mode of action: The toxicity of phenol correlates with the hydrophobicity of this compound. Phenol causes membrane damage by stopping and reversing the efflux of cellular metabolites and ions [Heipieper et al., 1991]

Marker proteins:

Protein Induction ratio Description 10 20 30 HrcA regulon DnaK 3.4 0.9 0.8 class I heat-shock protein (molecular chaperone) GroEL 13.0 10.1 6.1 class I heat-shock protein (chaperone) σB regulon Ctc 10.1 0.8 0.8 general stress protein Dps 5.7 1.6 0.9 stress- and starvation-induced gene GsiB 26.6 10.8 2.0 general stress protein GspA* 10.1 0.8 1.3 general stress protein GtaB 22.0 13.9 7.5 glucosylation of teichoic acid YcdF 22.2 2.9 2.9 similar to glucose 1-dehydrogenase YceC 4.2 3.2 2.6 similar to tellurium resistance protein YceD 5.3 0.5 0.4 similar to tellurium resistance protein YceH 2.4 1.8 2.0 similar to toxic anion resistance protein YdaD* n.q n.q n.q oxidoreductase YdaE* 9.8 28.9 19.0 probable spore coat polysaccharide biosynthesis protein YdaP n.q n.q n.q similar to pyruvate oxidase YfkM 7.0 2.1 3.1 general stress protein YhdN 7.1 2.0 1.5 similar to aldo/keto reductase YkzA 6.2 1.2 0.4 similar to organic hydroperoxide resistance protein YsnF 52.7 22.4 8.9 Unknown YtxH 3.2 1.6 0.9 similar to general stress protein YvyD 9.5 10.5 5.0 similar to sigma-54 modulating factor of gram-negative bacteria CtsR regulon ClpC 23.2 9.3 3.0 class III stress response-related ATPase ClpE 10.9 2.5 1.0 ATP-dependent Clp protease-like ClpP 6.8 3.6 2.2 ATP-dependent Clp protease proteolytic subunit Spx regulon HemH n.q n.q n.q incorporation of iron into protoporphyrin IX giving protoheme IX IolS 6.8 5.6 4.5 myo-inositol catabolism NfrA 4.7 3.1 1.8 FMN-containing NADPH-linked nitro/flavin reductase Tpx 3.8 2.3 1.9 thiol peroxidase TrxA n.q n.q n.q Thioredoxin YfjR 4.6 0.5 0.5 dehydrogenase precursor YhfK 5.0 3.3 3.1 nucleoside-diphosphate-sugar epimerase YjbG 5.1 5.4 4.1 oligoendopeptidase F homolog YqiG 2.1 0.4 0.3 probable NADH-dependent flavin oxidoreductase YuaE 103 2.7 2.1 Unknown YugJ 3.0 2.5 1.9 probable NADH-dependent butanol dehydrogenase 1 Other AmhX 2.7 3.9 3.2 Amidohydrolase Cah 20.0 3.2 3.1 cephalosporin C deacetylase DhaS 8.3 3.6 3.9 aldehyde dehydrogenase RapG** 4.4 4.0 3.5 response regulator aspartate phosphatase UreC 4.2 4.8 3.3 urease (alpha subunit) YhfE 7.7 1.5 2.0 similar to glucanase YisK 3.5 4.1 3.1 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase YvcT 7.5 5.9 3.5 similar to glycerate dehydrogenase YwfI 4.6 4.0 4.0 similar to chlorite dismutase

182

Overlap

183

1.7. Catechol (Cate)

MIC 0.3 mM Growth 10 OH

1 OH 500

OD 0.1 control 1xMIC 4xMIC 8xMIC 0.01 0 100 200 300 400 500 Time (min)

control / catechol (8xMIC, 10 min)

MrgA

ClpC ClpE

YjbG GroEL AcsA UreC KatA BglH AhpF DhaS

RbsA GlpK YqiG LicH YxePYrhB YdfO

CitZ YugJ DhbB YkcA IolS HemH Cah TrxB

YfjR NfrA CysK YhfK YwfI YcnD DhbA YvaB YvyD YocJ YdfN YodC YuaE ClpP/YocJ

AhpC

Tpx

MrgA

TrxA GroES pI 7 4 184

Mode of action: Catechol can autoxidize to form toxic quinines, reactive oxygen species pI 7 (ROS) and various free radicals which enhance the potential for cell damage. It is also able4 to release iron from ferritin and cause lipid peroxidation [Bendorf et al., 2001; Pereira et al., 2004]. It can change the morphology of the cell, fatty acids and membrane protein composition [Park et al., 2001]

Marker proteins:

Protein Induction ratio Description 10 20 30 HrcA regulon GroEL 4.6 4.0 2.5 class I heat-shock protein (chaperone) GroES n.q n.q n.q class I heat-shock protein (chaperone) CtsR regulon ClpC 4.6 8.9 11.5 class III stress response-related ATPase ClpE* 12.2 11.1 15.4 ATP-dependent Clp protease-like ClpP 4.4 5.6 3.0 ATP-dependent Clp protease proteolytic subunit PerR regulon AhpC 1.3 2.6 3.2 alkyl hydroperoxide reductase (small subunit) AhpF 2.9 4.8 4.0 alkyl hydroperoxide reductase (large subunit) KatA 9.6 31.3 28.0 vegetative catalase 1 MrgA 14.2 27.2 24.3 metalloregulation DNA-binding stress protein Fur regulon DhbA* 1.3 1.7 7.3 siderophore 2,3-dihydroxybenzoate (DHB) synthesis DhbB* 0.4 0.6 2.8 isochorismatase- siderophore 2,3-DHB synthesis CymR regulon CysK 7.7 6.8 3.6 cysteine synthetase A YrhB** 10.2 11.5 6.4 cystathionine gamma-lyase YxeP** 8.1 5.0 3.2 peptidase, M20/M25/M40 family Spx regulon HemH n.q n.q n.q incorporation of iron into protoporphyrin IX giving protoheme IX IolS 3.6 6.1 6.4 myo-inositol catabolism NfrA 4.4 6.4 5.8 FMN-containing NADPH-linked nitro/flavin reductase TpxpI 7 2.9 2.6 1.2 thiol peroxidase 4 TrxA n.q n.q n.q thioredoxin TrxB 2.1 2.8 2.4 thioredoxin reductase YcnD 3.4 7.2 4.3 similar to NADPH-flavin oxidoreductase YfjR 3.4 5.8 5.7 dehydrogenase precursor YhfK 54.8 21.2 46.2 nucleoside-diphosphate-sugar epimerase YjbG 2.0 4.7 4.7 oligoendopeptidase F homolog YqiG 1.7 3.0 0.7 probable NADH-dependent flavin oxidoreductase YuaE 2.5 11.7 3.4 unknown YugJ 1.6 2.6 2.3 probable NADH-dependent butanol dehydrogenase 1 CcpA regulon AcsA* 4.7 7.8 5.8 acetyl-CoA synthetase BglH* 11.0 3.3 2.6 beta-glucosidase CitZ 6.1 3.7 2.8 citrate synthase II (major) GlpK 4.3 4.3 4.2 glycerol kinase LicH* 61.3 73.8 37.6 6-phospho-beta-glucosidase RbsA* 3.3 1.0 2.2 ribose ABC transporter Other Cah n.q n.q n.q cephalosporin C deacetylase DhaS 1.5 5.0 4.1 Aldehyde dehydrogenase UreC 6.2 7.0 5.4 urease (alpha subunit) YdfN** 17.6 4.8 4.8 similar to NAD(P)H nitroreductase YdfO** 3.4 1.1 1.0 similar to glyoxalase family protein YkcA** 4.8 4.5 4.1 similar to glyoxalase family protein YocJ 32.4 32.9 31.6 similar to acyl-carrier protein phosphodiesterase YodC 6.6 5.8 7.4 similar to nitroreductase 185

YvaB 23.2 19.2 15.2 similar to NAD(P)H dehydrogenase (quinone) YvyD 6.9 10.6 15.0 similar to sigma-54 modulating factor of gram-negative bacteria YwfI 3.1 3.2 3.4 similar to chlorite dismutase

Overlap

Condition Specific response HEAT HrcA, σB, CtsR, Spx SALT σB, CtsR, Spx PHENOL HrcA, σB, CtsR, Spx 6-BROM-2-VYNYL- HrcA, σB, CtsR, Spx (YcnD) CHROMAN-4-ON SALICYLIC HrcA, σB, CtsR, Spx, CymR, CodY Other marker for acid decarboxylation: PadC, YclC 2-METHYL- HrcA, CtsR, PerR, Spx (YcnD) HYDROQUINONE Other marker for degradation: YdfNO

186

1.8. 6- Brom-2-vinyl-chroman-4-on (Chro)

MIC 10 µg/ml Growth 10

Br 1 500

OD 0.1 Control O 5xMIC 10xMIC 0.01 0 100 200 300 400 Time (min)

control / 6-brom-2-vinyl-chroman-4-on (10xMIC, 10 and 30 min)

CitB OdhA ClpE ClpC

YjbG GroEL SdhA AcsA

GroEL_F DhaS Zwf YhfE YqiG YceH CitZ YbaL YfmJ HemH GcvT YugJ YqkF TrxB IolS GtaB GspA

YcnD YhfK NfrA YceC YvyD YwfI YtkL YdgI YfkO YoxD ClpP YuaE SodA YfkM YodC YocJ

Tpx

GsiB

pI7 TrxA pI4 187

Mode of action: 6- Brom- 2- vinyl- chroman- 4- on is a derivative of 2-vinyl-chroman-4- on. It exhibits remarkable antibiotic activity against several humanpathogenic bacteria and yeast [Albrecht et al., 2005]

Marker proteins:

Protein Induction ratio Description 10 min 30 min HrcA regulon DnaK 2.0 0.5 class I heat-shock protein (molecular chaperone) GroEL 4.9 3.9 class I heat-shock protein (chaperone) GroES 11.9 7.4 class I heat-shock protein (chaperone) σB regulon GsiB 8.2 1.1 general stress protein GspA* 6.0 4.4 general stress protein YceC 5.9 4.1 similar to tellurium resistance protein YceH 3.2 2.0 similar to toxic anion resistance protein YvyD 5.0 2.1 similar to sigma-54 modulating factor of gram-negative bacteria CtsR regulon ClpC 11.8 2.1 class III stress response-related ATPase ClpE* 49.3 1.7 ATP-dependent Clp protease-like ClpP 4.1 2.3 ATP-dependent Clp protease proteolytic subunit Spx regulon GreA 2.4 1.7 transcription elongation factor HemH 2.7 1.3 incorporation of iron into protoporphyrin IX giving protoheme IX NfrA 5.8 3.7 FMN-containing NADPH-linked nitro/flavin reductase SodA 2.8 3.6 superoxide dismutase TrxB 2.4 1.3 thioredoxin reductase Tpx 4.1 4.3 thiol peroxidase YcnD 2.0 6.0 similar to NADPH-flavin oxidoreductase YhfK 6.3 4.7 nucleoside-diphosphate-sugar epimerase YjbG 11.5 4.1 oligoendopeptidase F homolog YoxD 3.8 3.9 similar to 3-oxoacyl- acyl-carrier protein reductase YqiG 6.3 4.2 probable NADH-dependent flavin oxidoreductase YtkL 3.6 3.3 similar to unknown proteins YuaE 8.3 1.2 Unknown YugJ 3.3 2.3 probable NADH-dependent butanol dehydrogenase 1 Zwf 3.5 2.4 probable glucose-6-phosphate 1-dehydrogenase Carbon catabolite repression AcsA* 4.1 6.8 acetyl-CoA synthetase CitB 1.6 5.0 aconitate hydratase CitZ 1.6 2.9 citrate synthase II (major) IolS 24.0 24.3 myo-inositol catabolism OdhA 2.7 3.7 2-oxoglutarate dehydrogenase (E1 subunit) OdhB 1.2 2.1 2-oxoglutarate dehydrogenase ( E2 subunit) SdhA 6.6 6.7 succinate dehydrogenase (flavoprotein subunit) Other DhaS 1.7 3.1 aldehyde dehydrogenase GcvT 2.2 3.4 Aminomethyltransferase YbaL 3.6 3.9 similar to ATP-binding Mrp-like protein YdgI** 7.8 6.8 similar to NADH dehydrogenase YfkO** 0.6 6.0 similar to NAD(P)H-flavin oxidoreductase YfmJ 4.1 4.0 similar to quinone oxidoreductase YhfE 3.2 3.8 similar to glucanase YkuQ 2.3 2.4 similar to tetrahydrodipicolinate succinylase YqkF 4.9 3.7 similar to oxidoreductase YwfI 3.5 2.9 similar to chlorite dismutase

188

Overlap

189

1.9. 2- Methylhydroquinone (HyQ)

MIC 1.4 µg/ ml Growth 10

OH CH 1 3 500

OD 0.1 Control 30xMIC 40xMIC OH 0.01 0 100 200 300 400 Time (min)

control / methylhydroquinone (30xMIC, 10 min and 30 min)

MrgA

ClpC ClpE

GroEL KatA AhpF

YqiG YbaL

HemH YdfO YkcA YugJ TrxB IolS YqkF

YfjR YcnD

NfrA YhfK YwfI YdfN YvyD YtkL ClpP AhpC YfkO YocJ YvaB YdgI YocJ YuaE YpiB

Tpx

GsiB MrgA pI7 pI4

190

Mode of action: 2-Methylhydroquinon is a newly synthesized phenolic compound.

Marker proteins:

Protein Induction ratio Description 10 min 30 min HrcA regulon GroEL 4.9 2.7 class I heat-shock protein (chaperone) GroES 3.2 1.7 class I heat-shock protein (chaperone) CtsR regulon ClpC 9.5 1.1 class III stress response-related ATPase ClpE 30.0 1.4 ATP-dependent Clp protease-like ClpP 4.9 1.1 ATP-dependent Clp protease proteolytic subunit PerR regulon AhpC 7.7 5.6 alkyl hydroperoxide reductase (small subunit) AhpF 4.7 3.5 alkyl hydroperoxide reductase (large subunit) KatA 25.3 4.2 vegetative catalase 1 MrgA 36.3 2.0 metalloregulation DNA-binding stress protein Spx regulon GreA 2.8 0.8 transcription elongation factor HemH 6.5 0.9 incorporation of iron into protoporphyrin IX giving protoheme IX IolS 21.4 2.7 myo-inositol catabolism NfrA 10.6 0.9 FMN-containing NADPH-linked nitro/flavin reductase SodA 2.8 1.5 superoxide dismutase TrxB 3.3 0.7 thioredoxin reductase Tpx 4.7 1.3 thiol peroxidase YcnD 2.0 n.q similar to NADPH-flavin oxidoreductase YfjR 8.7 0.6 dehydrogenase precursor YhfK 4.2 0.6 nucleoside-diphosphate-sugar epimerase YjbG 2.9 0.9 oligoendopeptidase F homolog YqiG 6.5 2.2 probable NADH-dependent flavin oxidoreductase YtkL 2.6 0.6 similar to unknown proteins YuaE 9.7 0.6 Unknown YugJ 4.9 0.9 probable NADH-dependent butanol dehydrogenase 1 Other GsiB 4.6 0.1 general stress protein YbaL 3.4 1.3 similar to ATP-binding Mrp-like protein YdfN** 137.4 5.6 similar to NAD(P)H nitroreductase YdgI** 3.9 0.5 similar to NADH dehydrogenase YfkO** 2.2 8.8 similar to NAD(P)H-flavin oxidoreductase YocJ 13.6 13.8 similar to acyl-carrier protein phosphodiesterase YqkF 3.2 0.6 similar to oxidoreductase YvaB 53.1 9.4 similar to NAD(P)H dehydrogenase (quinone) YvyD 6.7 0.4 similar to sigma-54 modulating factor of gram-negative bacteria YwfI 3.1 0.7 similar to chlorite dismutase

191

Overlap

192

1.10. Salicylic acid (Sali)

MIC: 4 mM Growth 10 O 1

OH 500 OD 0.1 Control 0.5xMIC 1xMIC OH 2xMIC 4xMIC 0.01 0 100 200 300 400 Time (min)

control / salicylic acid (1xMIC, 10 min)

OdhA

ClpC ClpE

DnaK AcsA YjbG UreC OdhB YdaP GroEL SdhA

AmhX YclC Ald

YbaL/YrhB YxeP/YpsC YsnF YhdN GcvT YdaD IolS CysK GtaB GspA

YwfI YceC YvaB ClpP NfrA YvyD YfkM

YpiB YuaE YjcG

GreA

PadC GsiB Dps YfmP YkzA YneT YflT pI7 PtsH pI4 pI7 pI4 193

Mode of action: Salicylic acid can cause significant changes in the structure and function of membrane components of the cell [Sikkema et al., 1995]. It can also cause K+ depletion in the cell [Scharff and Perry, 1976].

Marker proteins:

Protein Induction ratio Description 10 20 30 HrcA regulon DnaK 2.4 1.5 1.0 class I heat-shock protein (molecular chaperone) GroEL 1.9 2.2 1.5 class I heat-shock protein (chaperone) σB regulon Dps 2.7 0.9 0.5 stress- and starvation-induced gene GsiB 6.6 4.2 2.3 general stress protein GspA 4.6 2.4 2.1 general stress protein GtaB 5.9 4.0 2.2 glucosylation of teichoic acid YceC 2.9 2.1 1.4 similar to tellurium resistance protein YdaD* 17.9 4.6 2.2 similar to alcohol dehydrogenase YdaP 5.4 1.8 1.4 similar to pyruvate oxidase YfkM 5.5 1.8 0.7 general stress protein YflT 8.6 3.1 1.1 similar to general stress protein YhdN 3.1 0.8 0.3 similar to aldo/keto reductase YkzA 5.5 2.7 1.7 similar to organic hydroperoxide resistance protein YsnF 9.0 4.9 2.1 Unknown YvyD 7.3 7.6 4.8 similar to sigma-54 modulating factor of gram-negative bacteria CtsR regulon ClpC 8.1 3.3 2.1 class III stress response-related ATPase ClpE* 25.7 21.5 11.2 ATP-dependent Clp protease-like (class III stress gene) ClpP 2.4 2.0 1.0 ATP-dependent Clp protease proteolytic subunit (class III heat-shock protein) Spx regulon GreA 3.8 0.9 0.4 transcription elongation factor IolS 4.9 6.2 4.8 myo-inositol catabolism NfrA 2.7 2.1 1.1 FMN-containing NADPH-linked nitro/flavin reductase YjbG 2.2 4.2 3.7 similar to oligoendopeptidase YpiB** 2.2 1.8 1.3 Unknown YuaE 5.1 3.6 1.7 Unknown CymR regulon CysK 4.4 3.4 3.1 cysteine synthetase A YrhB YbaL** 3.8 4.4 5.0 similar to cystathionine gamma-synthase YxePYpsC** 1.1 2.1 4.0 similar to aminoacylase Catabolite repression OdhA 1.0 3.6 5.6 2-oxoglutarate dehydrogenase (E1 subunit) OdhB 1.2 5.3 12.3 2-oxoglutarate dehydrogenase (dihydrolipoamide transsuccinylase, E2 subunit) PtsH 5.8 2.7 2.1 histidine-containing phosphocarrier protein of the PTS (HPr protein) SdhA 4.4 9.6 15.2 succinate dehydrogenase (flavoprotein subunit) CodY regulon AcsA* 1.5 3.6 5.5 acetyl-CoA synthetase AmhX 3.9 3.2 3.3 Amidohydrolase UreC 3.2 5.9 7.2 urease (alpha subunit) YfmP** 19.0 8.7 8.3 similar to transcriptional regulator (MerR family) YjcG 3.2 2.8 2.2 hypothetical conserved protein Other Ald 1.4 4.2 5.7 L-alanine dehydrogenase GcvT 2.0 4.2 4.8 probable aminomethyltransferase PadC** 6.1 6.8 8.3 phenolic acid decarboxylase YbaL (YrhB) 3.8 4.4 5.0 similar to ATP-binding Mrp-like protein YclC** 2.3 5.7 7.9 similar to carboxylyase-related protein YneT 2.6 2.4 2.0 similar to succinyl-CoA synthetase, alpha subunit-related enzymes 194

YpsCYxeP 1.1 2.1 4.0 similar to methyltransferase YvaB 3.9 3.3 2.9 similar to NAD(P)H dehydrogenase (quinone) YwfI 4.0 2.0 1.1 similar to chlorite dismutase

Overlap

195

2. Starvation conditions

2.1. Ammonium starvation (Amm) Growth

0.7 mM (NH4)2SO4 10 3 4 1 1 co

500 500 2

OD 0.1

0.7 mM (NH4)2SO4 0.01 0 100 200 300 400 500 Time (min) exponential phase / transient phase

CitB SpoVID

PrkA KatX Vpr YjbG GlmS AsnO UreC AcsA YusJ YurU KamA KatA PucL PbpE YaaH SpoIVA RocA YcgN OppA DhaS GlnA LpdV YpwA SafA AmhX SpoVR YhbH YurO Bcd RocD YjbX YurJ RapG YxbC OppD AsnZ CitZ RapA YhdN AsnZ_F YqeH SpoIIQ GcvT AppD BkdAA IspA YurP YvcT IolS SigB Dat YxbB SigF/RsfA Cah YisK RocF FolD/MenB MinD/DppA MurB YfhM TasA AroD YuxI Spo0A YwfC YvqH YjbC YvyD YsiB/YsnA YvaB YpiB SpoVT YuaE YdaE YtxH YjcK Dps

YxiE SpoVG pI7 pI4

196

Mode of action: Starvation of ammonium as main nitrogen source induces pathways for

+ nitrogen-assimilation, the synthesis of amino acid permeases and NH4 -generating catabolic enzymes such as urease, asparaginase, arginase and branched chain amino acid degradative enzymes [Atkinson and Fisher, 1991; Silberbach et al., 2005].

Marker proteins:

Protein Induction ratio Regulon Description t0 10 30 60 TnrA regulon AsnZ/YccC** 7.6 3.6 6.0 7.1 TnrA, σH asparaginase Cah 16.6 24.1 13.3 25.1 TnrA cephalosporin C deacetylase DppAMinD** 5.9 8.0 6.8 5.8 TnrA, CodY, D-alanyl-aminopeptidase glu- GlnA 2.5 2.3 3.1 3.0 TnrA glutamine synthetase OppA 3.7 5.6 12.0 8.6 TnrA required for initiation of sporulation, competence development, and oligopeptide transport OppD n.q n.q n.q 3.0 TnrA required for initiation of sporulation, competence development, oligopeptide transport PucL** 4.1 5.1 26.7 18.3 TnrA, σE, PucR uricase TasA 2.1 3.6 2.8 2.6 TnrA, σH translocation-dependent antimicrobial spore component UreC 19.4 74.9 24.9 12.2 TnrA, CodY, σH urease (alpha subunit) Vpr 9.3 21.8 12.6 7.7 TnrA, σH minor extracellular serine protease YxbB** 9.5 11.2 10.7 12.4 TnrA, CodY, similar to methyltransferase glu- σL regulon Bcd 9.0 12.3 14.4 7.9 CodY, σL leucine dehydrogenase BkdAA 10.0 6.0 1.3 0.8 CodY, σL branched-chain alpha-keto acid dehydrogenase E1 subunit (2-oxoisovalerate dehydrogenase alpha subunit) LpdV 5.8 4.6 1.0 1.2 CodY, σL branched-chain fatty acid biosynthesis RocA 23.7 11.6 0.6 0.3 CodY, σL, pyrroline-5 carboxylate dehydrogenase RocR, CcpA RocD 3.6 3.8 2.5 1.2 CodY, σL, ornithine aminotransferase RocR, CcpA RocF 4.9 2.5 0.9 0.7 CodY, σL, arginase RocR, CcpA Carbon catabolite control CitZ 3.3 4.0 6.9 5.4 CcpA, Spx citrate synthase II (major) GlmS 6.6 7.8 8.0 10.4 Glu- L-glutamine-D-fructose-6-phosphate amidotransferase IolS 2.8 2.5 0.5 3.0 Glu-, IolR, Spx myo-inositol catabolism YsiBYsnA 0.7 0.4 1.1 5.5 CcpA similar to 3-hydroxbutyryl-CoA dehydratase CodY regulon AcsA* 5.0 6.4 9.3 5.3 CodY, CcpA acetyl-CoA synthetase AmhX 4.2 4.2 3.7 3.4 CodY amidohydrolase AppD** 3.7 3.1 4.5 6.7 CodY, RelA, oligopeptide transport CcpA CitB 2.4 4.3 2.6 3.9 CodY, CcpA, aconitate hydratase CcpC RapA** 8.0 6.9 8.8 13.5 CodY, RelA, prevents sporulation by dephosphorylating CcpA Spo0F-P YurJ** 2.6 3.2 1.1 0.4 CodY, TnrA- similar to multiple sugar ABC transporter YurP 3.8 4.3 3.4 1.4 CodY, TnrA- similar to glutamine-fructose-6-phosphate transaminase YurO 4.3 6.7 6.9 2.2 CodY, TnrA- similar to multiple sugar-binding protein YxbC 6.5 8.9 9.5 11.0 CodY, RelA, unknown PerR

197

σH regulon MinDDppA 5.9 8.0 6.8 5.8 σH cell-division inhibition (septum placement) RapG** 6.5 5.2 5.3 6.6 σH response regulator aspartate phosphatase Spo0A 6.7 6.2 7.4 6.3 σH, RelA, CodY central role in the initiation of sporulation SigFRsfA** 3.0 4.5 9.9 10.8 σH early forespore-specific gene expression SpoVG 10.3 8.0 3.2 2.6 σH, RelA required for spore cortex synthesis YisK 3.5 2.8 1.4 0.7 σH similar to 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase YpiB** 3.4 3.0 6.5 5.1 σH, RelA, Spx unknown YtxH 5.5 4.9 4.3 4.9 σH, RelA, σB similar to general stress protein YuxI** 27.9 25.2 21.1 28.5 σH unknown YvyD 46.6 13.0 3.2 2.5 σH, RelA, σB similar to sigma-54 modulating factor of gram- negative bacteria YwfC 4.8 2.9 2.6 2.7 σH unknown σF regulon RsfA SigF** 3.0 4.5 9.9 10.8 σF probable regulator of transcription of sigma-F- dependent genes SpoIIQ** 0.5 2.8 17.6 11.6 σF required for completion of engulfment SpoVT** Coo σF positive and negative regulation of sigma-G- dependent genes σE regulon AsnO** Coo σE involved in sporulation KamA** Coo σE involved in the degradation of lysine as a source of both carbon and nitrogen KatA 2.9 4.7 3.5 2.9 σE, PerR vegetative catalase 1 PrkA 1.0 1.9 12.7 70.7 σE serine protein kinase SafA** 2.1 4.4 12.0 53.4 σE probably involved in assembly of some coat proteins SpoIVA 1.2 0.8 19.4 128 σE required for proper spore cortex formation and coat assembly SpoVR** 2.1 0.9 2.2 6.1 σE involved in spore cortex synthesis SpoVID** 0.3 0.6 0.6 14.2 σE required for assembly of the spore coat YaaH** 1.3 3.3 26.5 104 σE, σB similar to cortical fragment-lytic enzyme YhbH** 0.9 1.1 3.8 20.4 σE similar to glycosyltransferase YjbX** 0.8 0.7 1.4 10.9 σE unknown YuaE 9.8 10.3 32.0 29.6 σE, CodY, Spx unknown σB regulon Dps 2.4 1.6 1.7 3.5 σB DNA-protecting protein KatX n.q n.q n.q 2.6 σB, σF major catalase in spores SigB 1.0 1.2 5.1 7.0 σB general stress sigma factor (class II genes) YdaE 9.3 9.1 8.3 8.7 σB probable spore coat polysaccharide biosynthesis protein E YhdN 3.1 2.5 2.5 4.1 σB similar to aldo/keto reductase YfhM 3.8 5.3 18.6 16.1 σB, σW similar to epoxide hydrolase YjbC 2.7 2.7 2.9 3.3 σB, Spx, σM similar to GCN5-related N-acetyltransferase Other AroD 3.0 3.6 19.2 36.5 shikimate 5-dehydrogenase Dat 3.5 3.2 4.0 3.3 probable D-alanine aminotransferase DhaS 2.6 1.0 7.7 7.9 aldehyde dehydrogenase FolDMenB 0.8 0.9 1.8 13.1 methylenetetrahydrofolate dehydrogenase / methenyltetrahydrofolate cyclohydrolase GcvT n.q n.q n.q 6.4 probable aminomethyltransferase IspA** n.q n.q n.q 7.3 major intracellular serine protease MenBFolD 0.8 0.9 1.8 13.1 dihydroxynapthoic acid synthetase MurB 5.0 6.1 7.5 9.1 UDP-N-acetylenolpyruvoylglucosamine reductase PbpE 34.5 17.2 14.2 9.8 spore cortex formation YcgN 3.2 19.8 15.7 9.6 similar to 1-pyrroline-5-carboxylate dehydrogenase YjbG 3.3 4.7 4.1 3.5 similar to oligoendopeptidase YjcK** 2.6 2.9 5.9 6.0 similar to ribosomal-protein-alanine N- acetyltransferase YpwA n.q n.q n.q 2.3 similar to carboxypeptidase YqeH 1.0 1.6 6.1 14.8 similar to GTP-binding protein YsnAYsiB 0.7 0.4 1.1 5.5 similar to xanthosine triphosphate pyrophosphatase 198

YurU 4.4 8.1 11.9 8.3 probable iron-regulated ABC transporter YusJ* 3.2 5.4 2.2 1.5 similar to butyryl-CoA dehydrogenase YvaB 1.9 2.2 3.2 3.6 similar to NAD(P)H dehydrogenase (quinone) YvcT n.q n.q n.q 12.2 similar to glycerate dehydrogenase LiaH/YvqH* n.q n.q n.q 4.6 similar to phage shock protein YxiE* 6.2 5.6 10.9 6.6 unknown Coo: detected only on coomassi gel

Overlap

199

2.2. Tryptophan starvation (Trp)

4 µM of tryptophan Growth 10 1 3 4 co 1

500 2 OD 0.1

0.004 mM tryptophan 0.01 0 100 200 300 400 500 Time (min)

exponential phase / transient phase

YusJ AdeC UreC IlvD KatA TrpE

YcgN Hom AmhX YurO Ald FtsA YurJ RapA RapG TrpB CitZ TrpD DegS AppD YurP YxbB Dat Cah MurB YisK YybI MinD/DppA YurL FolD/MenB TrpA YuxI DegU YwfC YurY YvyD Spo0A PabA YpiB

YdaE YjcK YtxH

GsiB

SpoVG pI7 pI4 200

Mode of action: B. subtilis 168 is tryptophan auxotroph strain. Starvation of tryptophan activates the trp-RNA-binding attenuation protein (TRAP) and induces the TRAP regulated tryptophan biosynthesis enzymes [Yang and Yanofsky, 2005]

Marker proteins:

Protein Induction ratio Regulon Description t0 10 30 60 TRAP regulon PabA** 38.4 35.7 32.5 22.8 TRAP para-aminobenzoate synthase glutamine amidotransferase (subunit B) / anthranilate synthase (subunit II) TrpE** 25.0 22.8 31.6 31.8 TRAP anthranilate synthase TrpD** 11.7 11.3 10.7 8.2 TRAP anthranilate phosphoribosyltransferase TrpB** 8.5 8.3 11.8 11.1 TRAP tryptophan synthase (beta subunit) TrpA** 15.0 14.5 16.2 14.5 TRAP tryptophan synthase (alpha subunit) CodY regulon AppD** 4.4 4.2 4.9 3.2 CodY, ReA, oligopeptide transport CcpA AmhX 3.4 2.6 3.8 3.8 CodY amidohydrolase DppA(MinD)** 3.2 3.6 5.7 6.5 CodY, TnrA, D-alanyl-aminopeptidase glu- IlvD 1.6 1.9 2.6 2.8 CodY dihydroxy-acid dehydratase RapA** 5.2 5.4 10.8 17.9 CodY, RelA, prevents sporulation by dephosphorylating Spo0F- CcpA P UreC 2.2 2.2 2.6 2.9 CodY, σH, urease (alpha subunit) PucR, TnrA YurJ** 19.3 19.3 13.3 9.3 CodY, TnrA- similar to multiple sugar ABC transporter (ATP- binding protein) YurP 1.7 2.3 2.1 1.3 CodY, TnrA- similar to glutamine-fructose-6-phosphate transaminase YurO** 9.8 10.1 10.9 6.1 CodY, TnrA- similar to multiple sugar-binding protein YurL 8.2 7.4 8.6 3.9 CodY, TnrA- similar to ribokinase YxbB 6.2 6.8 8.6 10.0 CodY, TnrA-, similar to methyltransferase glu- σH regulon FtsA 4.8 4.5 4.0 3.9 σH, CcpA required for septum formation during sporulation MinD(DppA) 3.2 3.6 5.7 6.5 σH cell-division inhibition (septum placement) RapG** 3.7 4.2 8.7 10.9 σH response regulator aspartate phosphatase Spo0A 3.6 2.5 4.0 3.0 σH, RelA, central role in the initiation of sporulation CodY SpoVG 6.4 12.1 13.1 3.1 σH, RelA required for spore cortex synthesis SpoVS** n.q n.q n.q n.q σH required for dehydratation of the spore core and assembly of the coat YisK 4.7 4.8 4.5 3.3 σH similar to 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase YpiB** 6.0 4.3 5.9 4.4 σH, RelA, Spx unknown YtxH 6.4 7.4 6.4 5.6 σH, RelA, σB similar to general stress protein YuxI** 2.3 2.1 2.7 2.8 σH unknown YvyD 76 62.7 50.5 36.2 σH, RelA, σB similar to sigma-54 modulating factor of gram- negative bacteria YwfC 1.8 1.8 2.5 3.2 σH unknown σE regulon KatA 2.0 2.5 4.5 5.3 σE vegetative catalase 1 YybI** 9.4 2.5 8.4 7.4 σE unknown σB regulon GsiB 1.5 3.1 2.8 2.4 σB general stress protein YdaE* 10.2 5.2 8.8 6.0 σB spore coat polysaccharide biosynthesis protein E Other AdeC 3.6 5.4 5.9 3.3 RelA adenine deaminase Ald 3.7 3.8 5.8 8.1 RelA, TnrA- L-alanine dehydrogenase 201

Cah 13.4 17.7 25.9 32.3 TnrA+ cephalosporin C deacetylase CitZ 3.4 2.8 3.4 4.0 CcpA, Spx citrate synthase II (major) Dat 2.6 2.3 3.4 2.9 D-alanine aminotransferase DegS* 7.6 5.8 6.2 5.5 DegSU degradative enzyme and competence regulation DegU 4.8 4.9 6.0 4.6 DegSU essential for degradative enzyme expression and competence regulation (positive regulation of comK expression) FolD(MenB) 5.4 4.3 2.7 5.4 methylenetetrahydrofolate dehydrogenase / methenyltetrahydrofolate cyclohydrolase Hom 3.1 3.4 3.9 2.5 homoserine dehydrogenase MenB(FolD) 5.4 4.3 2.7 5.4 dihydroxynapthoic acid synthetase MurB 2.1 1.0 4.2 10.6 UDP-N-acetylenolpyruvoylglucosamine reductase YcgN 5.3 5.9 4.3 8.1 similar to 1-pyrroline-5-carboxylate dehydrogenase YjcK** 8.0 6.8 8.1 7.5 similar to ribosomal-protein-alanine N- acetyltransferase YurY 28.3 29.1 35.2 30.5 similar to ABC transporter (ATP-binding protein) YusJ* 1.4 1.8 5.4 2.5 similar to butyryl-CoA dehydrogenase

Overlap

202

2.3. Phosphate starvation (Pho) Growth 0.2 mM KH2PO4 10

2 3 4 1

500 1

OD co 0.1

0.2 mM KH2PO4 0.01 0 100 200 300 400 Time (min)

exponential phase / transient phase

AcsA HtpG RocA YdaP GlgA TuaD DhaS YhjL YsnF YjbX YhfE Ald RapG YxbC RapA Hag

YvcT Dat YxbB SigB Cah TuaH PstS YisK GtaB MurB SigF/RsfA YfhM GspA MinD PhoP YgxA YuxI YdhF PksC YjbC YvyD SpoOA YwjH YfkM YpiB YdaE YtxH RsbW YdaT YjcK

Dps YaaQ Tpx GsiB YkzA

YxiE SpoVG pI7 pI4

203

Mode of action: Phosphate starvation induces the PhoPR system that regulates genes involved in the uptake and utilization of alternative phosphorous sources such as teichoic acids, phospholipids or phosphonucleotides as well as the switch from the phosphate-rich teichoic acids to phosphate-less teichuronic acids in the cell wall [Ying and Hulett, 1998].

Marker proteins:

Protein Induction ratio Regulon Description t0 10 30 60 PhoPR regulon TuaD* 22.0 19.4 17.6 12.8 PhoPR, σF biosynthesis of teichuronic acid TuaH** 1.0 7.9 0.9 1.0 PhoPR, σF biosynthesis of teichuronic acid PhoB* X PhoPR, σE alkaline phosphatase III PhoD* X PhoPR phosphodiesterase/alkaline phosphatase PhoP 1.9 3.2 3.8 4.4 PhoPR, σE involved in phosphate regulation PstBB/PstBA* X PhoPR involved in high-affinity phosphate uptake PstS* 53.2 66.2 119 153 PhoPR involved in high-affinity phosphate uptake YdhF* 9.3 13.2 23.4 16.3 PhoPR, σE unknown CodY regulon AcsA* 1.6 3.7 5.7 5.4 CodY, CcpA acetyl-CoA synthetase Hag 0.7 4.1 4.0 2.1 CodY flagellin protein RapA** 1.7 9.8 8.3 4.2 CodY, RelA, prevents sporulation by dephosphorylating CcpA Spo0F-P YxbC 1.5 4.0 3.6 7.8 CodY, RelA, unknown PerR Carbon catabolite control RocA 2.1 5.9 4.9 1.1 CcpA, CodY, pyrroline-5 carboxylate dehydrogenase RocR, σL YxbB** 2.3 4.8 3.1 7.8 Glu-, CodY, similar to methyltransferase TnrA YwjH 2.7 4.6 1.3 0.1 Glu- similar to transaldolase (pentose phosphate) σH regulon MinD 1.0 2.9 3.0 5.3 σH cell-division inhibition (septum placement) RapG** 2.1 8.7 7.9 4.4 σH response regulator aspartate phosphatase Spo0A 1.7 2.9 3.0 4.0 σH, CodY, RelA central role in the initiation of sporulation SigFRsfA** 0.5 3.0 6.2 6.0 σH early forespore-specific gene expression SpoVG 1.8 4.2 3.8 3.1 σH, RelA required for spore cortex synthesis YisK 1.8 4.2 4.1 2.7 σH 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase YpiB** 1.3 5.2 5.3 2.2 σH, RelA, Spx unknown YtxH 1.5 2.0 3.9 2.1 σH, RelA, σB similar to general stress protein YuxI** 2.1 16.5 52.0 38.8 σH unknown YvyD 8.1 22.2 21.3 2.9 σH, RelA, σB sigma-54 modulating factor of gram- negative bacteria Sporulation regulons GlgA** 2.2 3.1 5.3 6.4 σE synthesizes alpha-1,4-glucan chains using ADP-glucose RsfASigF** 0.5 3.0 6.2 6.0 σF involved in the prespore-specific regulation of sigma-F-dependent genes YjbX** 1.3 1.5 5.8 3.9 σE unknown σB regulon Ctc X σB general stress protein Dps 1.1 1.8 1.7 2.0 σB stress- and starvation-induced gene controlled by σB GsiB 1.2 1.6 3.9 2.3 σB general stress protein GspA 1.5 4.1 3.5 3.4 σB general stress protein GtaB 2.1 2.4 4.2 1.4 σB glucosylation of teichoic acid KatE X σB catalase 2 RsbW 1.0 1.4 1.4 2.0 σB negative regulation of sigma-B-dependent gene expression; phosphorylation of RsbV SigB 1.2 1.5 1.8 1.0 σB general stress sigma factor (class II genes) YdaD* x σB similar to alcohol dehydrogenase 204

YdaE* 1.8 3.2 5.4 2.7 σB spore coat polysaccharide biosynthesis protein E YdaG x σB similar to general stress protein YdaP 1.9 3.4 4.1 4.1 σB similar to pyruvate oxidase YdaT 1.5 1.6 7.0 0.5 σB unknown YdbD* x σB similar to manganese-containing catalase YfhM 2.0 4.5 8.6 5.0 σB, σW similar to epoxide hydrolase YfkM 1.8 9.1 5.8 3.2 σB general stress protein YflT X σB similar to general stress protein YkzA 1.0 1.5 2.0 1.5 σB similar to organic hydroperoxide resistance protein YjbC 1.4 3.7 4.0 4.2 σB, Spx, σM similar to GCN5-related N-acetyltransferase YocK* x σB similar to general stress protein YsnF 2.2 1.7 8.5 27.4 σB unknown Other Cah 1.0 8.1 8.5 15.6 TnrA cephalosporin C deacetylase Ald 1.1 1.8 4.0 3.3 RelA, TnrA- L-alanine dehydrogenase Dat 1.2 3.4 3.1 1.9 D-alanine aminotransferase DhaS 0.6 2.6 7.2 7.4 aldehyde dehydrogenase HtpG 3.3 5.1 3.9 0.5 class III heat-shock protein (molecular chaperone) MurB 0.9 1.1 4.4 2.5 UDP-N-acetylenolpyruvoylglucosamine reductase PksC** 1.6 5.0 9.5 7.3 involved in polyketide synthesis Tpx 1.1 3.1 2.8 1.6 Spx thiol peroxidase YhjL** 3.7 5.5 25.6 216 sensory transduction pleiotropic regulatory protein YaaQ 1.4 1.0 2.7 0.2 unknown YhfE 1.1 2.0 2.9 1.3 similar to glucanase YjcK** 1.2 2.1 3.4 2.3 similar to ribosomal-protein-alanine N- acetyltransferase YvcT 0.7 1.5 3.3 1.7 similar to glycerate dehydrog YxiE* 1.1 1.9 2.3 0.5 unknown Overlap

2.4. Glucose starvation (Glu) Growth 0.05% glucose, without citrate 10

1 3 4 co 1

500 2 OD 0.1

0.004 mM tryptophan 0.01 0 100 200 300 400 500 Time (min) exponential phase / transient phase

CitB

GLU- 1 KatE PrkA YusJ GlmS SdhA KamA AcsA MalL AcoC SpoIVA PckA MalA RocA YcgN DhaS GlpK SafA AcoL BglH YsnF LicH KbI RocG AckA YvdG GLU- 3 CitZ RbsK AcoB RocD RapA GapB GLU- 2 AcoA SucC SigB Mdh NadE SigF/RsfA EtfB SucD YisK RocF GspA GtaB EtfA YfhM FolD/ MenB Ctc

GLU- 4 YuxI Spo0A YsiB/ YsnA YvyD

YocK YpiB YfkM

YdaE YuaE RsbW YtxH

YdaG Dps GsiB YkzA

YflT pI7 PstH pI4 206

Mode of action: Glucose starvation derepresses the carbon catabolite control which regulates genes that are involved in the uptake and utilization of alternative carbon sources such as acetate, glycerol, levan, ribose, inositol or gluconate [Bernhardt et al., 2003].

Marker proteins:

Protein Induction ratio Regulon Description t0 10 30 60 CcpA regulon AcsA* 1.1 4.5 13.4 21.8 CcpA, CodY, σB acetyl-CoA synthetase BglH* 0.9 6.7 2.4 0.9 CcpA beta-glucosidase CitZ 0.9 1.8 1.6 2.9 CcpA, Spx citrate synthase II (major) GlpK 0.8 7.0 2.8 11.9 CcpA, σE glycerol kinase LicH* 1.2 54.5 19.2 3.7 CcpA 6-phospho-beta-glucosidase MalA 0.9 1.5 7.9 57.3 CcpA, CodY splits maltose-6-P MalL** 3.9 6.0 0.3 0.5 CcpA maltodextrin utilization RapA** 1.5 1.8 3.6 7.0 CcpA, CodY, prevents sporulation by dephosphorylating RelA Spo0F-P RbsA* 1.2 15.3 5.4 24.9 CcpA ribose transp RbsK 1.3 2.5 1.4 5.2 CcpA ribokinase RocA 1.3 1.4 13.0 12.4 CcpA, σL, RocR, pyrroline-5 carboxylate dehydrogenase CodY RocD 0.8 1.1 6.7 3.9 CcpA, σL, RocR, ornithine aminotransferase CodY RocF 0.8 0.4 1.7 5.3 CcpA, σL, RocR, arginase CodY RocG 1.0 1.6 2.5 12.7 CcpA, σL, CodY glutamate dehydrogenase YsiBYsnA 0.7 2.9 3.8 6.6 CcpA similar to 3-hydroxbutyryl-CoA dehydratase YvdG* 0.9 0.9 0.4 11.3 CcpA similar to maltose/maltodextrin-binding prot CcpN regulon GapB* 1.0 1.1 5.0 25.6 Glu- anabolic enzyme PckA 1.2 0.5 1.1 17.2 Glu- phosphoenolpyruvate carboxykinase CcpA-independent AckA 1.0 0.5 3.0 4.7 Glu- conversion of acetyl-CoA to acetate AcoA* 0.7 0.6 1.1 16.8 glu-,σL, AcoR, acetoin dehydrogenase E1 component (TPP- CodY dependent alpha subunit) AcoB* 0.7 0.5 0.3 14.0 glu-,σL, AcoR, acetoin dehydrogenase E1 component (TPP- CodY dependent beta subunit) AcoC* 0.6 0.7 5.4 265 glu-,σL, AcoR, acetoin dehydrogenase E2 component CodY (dihydrolipoamide acetyltransferase) AcoL* 1.0 0.8 1.0 22.7 glu-,σL, AcoR, acetoin dehydrogenase E3 component CodY (dihydrolipoamide dehydrogenase) GlmS 0.7 0.9 0.4 11.1 Glu- L-glutamine-D-fructose-6-phosphate amidotransferase Kbl* 0.3 0.7 5.8 14.8 Glu- 2-amino-3-ketobutyrate CoA ligase PtsH 0.5 2.0 9.1 1.0 Glu- transfers phosphate from enzyme I to specific enzymes II/III permeases; mediates carbon catabolite repression (CCR) σH regulon Spo0A 0.9 1.0 0.9 2.0 σH, CodY, RelA central role in the initiation of sporulation SigFRsfA** 0.8 2.2 2.3 3.1 σH early forespore-specific gene expression YisK 0.7 1.2 4.6 17.3 σH 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase YpiB** 1.0 5.3 6.0 2.8 σH, RelA, Spx unknown YtxH 0.7 2.9 5.6 1..1 σH, RelA, σB similar to general stress protein YuxI** 0.8 0.5 2.7 3.1 σH unknown YvyD 0.6 5.5 30.5 2.7 σH, RelA, σB sigma-54 modulating factor of gram-negative bacteria Sporulation regulons KamA** 0.9 6.6 10.3 31.6 σE involved in the degradation of lysine as a source of both carbon and nitrogen 207

PrkA 1.0 2.8 1.9 5.7 σE serine protein kinase RsfASigF** 0.8 2.2 2.3 3.1 σF involved in the prespore-specific regulation of sigma-F-dependent genes SafA** 0.8 4.4 1.6 7.4 σE probably involved in assembly of some coat proteins which have roles in both spore lysozyme resistance and germination SpoIVA 0.7 3.3 0.9 3.2 σE required for proper spore cortex formation and coat assembly YjbX** 0.9 2.7 2.6 5.3 σE unknown YuaE 0.8 1.0 1.5 3.2 σE, CodY, Spx unknown σB regulon Ctc 0.6 3.1 19.2 1.1 σB general stress protein Dps 0.6 3.0 2.3 0.6 σB stress- and starvation-induced gene GsiB 0.5 0.2 57.8 5.5 σB general stress protein GspA* 0.5 1.1 9.1 1.7 σB general stress protein GtaB 0.7 0.9 11.8 4.7 σB glucosylation of teichoic acid KatE 0.8 0.5 7.9 2.7 σB catalase 2 NadE 0.9 1.0 4.1 0.9 σB NH3-dependent NAD+ synthetase RsbW 0.5 1.7 3.7 1.0 σB negative regulation of sigma-B-dependent gene expression; phosphorylation of RsbV SigB 0.8 1.1 3.2 1.7 σB general stress sigma factor (class II genes) YdaE* 0.4 3.6 8.7 1.4 σB probable spore coat polysaccharide biosynthesis protein E YdaG 0.8 1.0 4.6 0.7 σB similar to general stress protein YfkM 0.5 4.3 14.5 3.4 σB, Fur similar to general stress protein YflT 0.6 4.0 18.1 2.2 σB similar to general stress protein YkzA 0.3 1.6 22.1 2.1 σB similar to organic hydroperoxide resistance protein YocK* 0.5 1.3 12.6 1.8 σB similar to general stress protein YsnF 0.4 2.6 15.3 7.4 σB unknown Other DhaS 0.9 2.2 2.2 6.0 aldehyde dehydrogenase EtfA** 0.6 2.1 10.1 18.9 electron transfer flavoprotein (alpha subunit) EtfB** 0.8 4.0 13.4 40.9 electron transfer flavoprotein (beta subunit) FolD(MenB) 1.2 3.6 1.4 4.8 methylenetetrahydrofolate dehydrogenase / methenyltetrahydrofolate cyclohydrolase MenB(FolD) 1.2 3.6 1.4 4.8 dihydroxynapthoic acid synthetase YcgN 0.7 1.6 28.2 4.0 similar to 1-pyrroline-5-carboxylate dehydrogenase YsnAYsiB 0.7 2.9 3.8 6.6 similar to xanthosine triphosphate pyrophosphatase YusJ* 0.7 3.9 40.2 78.4 similar to butyryl-CoA dehydrogenase GLU-1 2.5 2.5 75.2 19.8 induced under only starvation of glucose GLU-2 0.9 8.4 6.7 13.4 induced under only starvation of glucose GLU-3 0.4 0.8 12.4 24.0 induced under only starvation of glucose GLU-4 0.8 5.9 65.6 4.8 induced under only starvation of glucose

208

Overlap

209

Summary of marker proteins for stress and starvation in Bacillus subtilis

210

Table 1: Summary of marker proteins for stress and starvation in B. subtilis 1) Gene or Operon Protein Regulon Amm Trp Glu Pho Heat Salt Stress proteome signatures

HrcA regulon hrcA-grpE-dnaKJ GrpE HrcA 4.2 DnaK HrcA 4.9 groESL GroEL HrcA 19.1 GroES HrcA 3.2

CtsR regulon ClpE* CtsR 343.6 21.7 ClpP CtsR, σB 7.6 6.8 ctsR-mcsAB-clpC-radA-yacK ClpC CtsR, σB 23.4 36.5

PerR regulon ahpCF AhpC PerR AhpF PerR KatA PerR, σE 4.7 5.3 MrgA PerR

Fur regulon dhbACEBF DhbA* Fur DhbC* Fur DhbE* Fur DhbB* Fur FeuAlipo* Fur YclQlipo Fur YcgT* Fur, Spx YfiYlipo* Fur YxeBlipo* Fur ywbLMN YwbM* Fur

SOS regulon RecA RecA/LexA uvrBA UvrB** RecA/LexA

CymR and S-box regulons CysK CymR (YrzC) MetE S-box YitJ S-box yrrT-mtn-yrhAB YrhB** CymR (YrzC) yxeIJKLMNOPQ YxeP** CymR (YrzC) YxeK** CymR (YrzC)

Spx regulon GreA Spx hemEHY HemH Spx iolABCDEFGHIJ IolS IolR, Spx 3.0 3.6 nfrA-ywcH NfrA Spx 3.2 3.2 SodA Spx, σB 7.7 4.2 Tpx Spx 3.1 TrxA Spx, σB TrxB Spx YcnD Spx YfjR Spx yhfIJK YhfK Spx 2.7 yjbCD YjbC Spx, σM, σB 3.3 4.2 6.6 YjbG Spx 4.7 2.3 YoxD Spx YpwA Spx 2.3 YqiG Spx 3.5 YtkL Spx YuaE Spx, σE, CodY 32.0 3.2 48.3 YugJ Spx Zwf Spx 211

2) Protein H2O2 Par Diam Phen Cate Chro HyQ Sali function / similarity

GrpE heat-shock protein (activation of DnaK) DnaK 3.4 2.0 class I heat-shock protein (molecular chaperone) GroEL 13.1 5.0 4.9 4.9 class I heat-shock protein (chaperone) GroES 2.8 n.q 11.9 3.2 class I heat-shock protein (chaperone)

ClpE* n.q 10.9 22.6 49.3 30.0 25.7 ATP-dependent Clp protease-like ClpP 6.7 6.8 5.6 4.1 4.9 2.4 ATP-dependent Clp protease proteolytic subunit ClpC 23.3 16.7 11.8 9.5 8.1 class III stress response-related ATPase

AhpC 4.9 18.0 3.2 7.7 alkyl hydroperoxide reductase (small subunit) AhpF 3.1 11.2 4.8 4.7 alkyl hydroperoxide reductase (large subunit) KatA 13.6 139.7 13.5 31.3 25.3 vegetative catalase 1 MrgA 15.4 6.3 19.2 45.1 36.3 metalloregulation DNA-binding stress protein

DhbA* 10.4 13.8 7.3 bacillibactin siderophore biosynthesis DhbC* 4.0 4.2 bacillibactin siderophore biosynthesis DhbE* 23.4 20.2 bacillibactin siderophore biosynthesis DhbB* 48.0 33.1 2.8 bacillibactin siderophore biosynthesis FeuAlipo* 5.1 ABC-transporter binding protein (bacillibactin and enterobactin uptake) YclQlipo 1.2 ABC-transporter binding protein (siderophore uptake) YcgT* 1.7 2.4 similar to thioredoxin reductase YfiYlipo* 1.5 ABC transporter binding protein (schizokinin, arthrobactin uptake) YxeBlipo* 13.6 12.3 ABC transporter binding protein (ferrioxamine uptake) YwbM* 2.9 7.4 elemental Fe transport (yeast FTS3 homolog)

RecA 6.5 multifunctional SOS repair regulator UvrB** 2.9 excinuclease ABC (subunit B)

CysK 4.7 5.6 7.7 4.4 cysteine synthetase A MetE 3.2 cobalamin-independent methionine synthase YitJ 3.4 similar to homocysteine s-methyltransferase YrhB** 5.6 11.5 5.0 cystathionine gamma-lyase YxeP** 6.2 8.1 4.0 peptidase, M20/M25/M40 family YxeK** 2.2 similar to monooxygenase

GreA 3.5 2.3 2.8 3.8 transcription elongation factor HemH 5.0 2.0 n.q n.q n.q 2.7 6.5 ferrochelatase IolS 2.1 6.8 6.1 24.3 21.4 6.2 myo-inositol catabolism NfrA 2.3 5.9 n.q 4.7 6.4 5.8 10.6 2.7 FMN-containing NADPH-linked nitro/flavin reductase SodA 3.6 2.8 superoxide dismutase Tpx 2.6 3.1 3.9 2.9 4.3 4.7 thiol peroxidase TrxA 2.7 11.3 n.q n.q thioredoxin TrxB 2.8 2.4 3.3 thioredoxin reductase YcnD 7.2 6.0 2.0 similar to NADPH-flavin oxidoreductase YfjR 3.0 2.5 n.q 4.6 5.8 8.7 dehydrogenase precursor YhfK 3.2 n.q 5.0 54.8 6.3 4.2 nucleoside-diphosphate-sugar epimerase YjbC simialar to N-acetyltransferase YjbG 3.5 5.5 4.7 11.5 2.9 4.2 oligoendopeptidase F homolog YoxD 3.9 similar to 3-oxoacyl- acyl-carrier protein reductase YpwA similar to carboxypeptidase YqiG 2.3 2.8 2.1 3.0 6.3 6.5 probable NADH-dependent flavin oxidoreductase YtkL 3.6 2.6 similar to metal-dependent hydrolase YuaE 2.9 6.2 n.q 103.3 11.7 8.3 9.7 5.1 unknown YugJ 2.3 3.8 3.0 2.6 3.3 4.9 probable NADH-dependent butanol dehydrogenase 1 Zwf 3.5 probable glucose-6-phosphate 1-dehydrogenase 212

Gene or Operon Protein Regulon Amm Trp Glu Pho Heat Salt Starvation proteome signatures

TnrA regulon asnZ (yccC) AsnZ** TnrA+ 7.6 Cah TnrA+ 25.0 32.3 15.6 dppABCDE DppA** TnrA+,CodY 8.0 6.5 glnRA GlnA TnrA-,GlnR 3.0 oppABCDEF OppAlipo TnrA+ 12.0 OppD TnrA+ 3.0 pucJKLM PucL** TnrA+,σE, PucR 26.7 tasA TasAs TnrA+,σH 3.6 ureABC UreC TnrA+, CodY,σH, PucR 74.9 2.9 vpr Vprs* TnrA+,σH 21.8 yxbB-A.yxnB-asnH-yxaM YxbB** TnrA+,CodY 12.4 10.0 7.8

σL regulon (+BkdR,RocR,AcoR) bkdR-ptb-bcd-buk- Bcd CodY, σL, BkdR 14.4 -lpdV-bkdAA/AB/B BkdAA CodY, σL, BkdR 10.0

LpdV CodY, σL, BkdR 5.8 rocABC RocA CodY,σL,RocR,CcpA 23.7 13.0 5.9 rocDEF RocD CodY,σL,RocR,CcpA 3.8 6.7 rocDEF RocF CodY,σL,RocR,CcpA 4.9 5.3 RocG CodY, σL, CcpA 12.7 acoABCL AcoA* CodY, σL, AcoR 16.8 AcoB* CodY, σL, AcoR 14.0 AcoC* CodY, σL, AcoR 264.8

AcoL* CodY, σL, AcoR 22.7

TRAP regulon pabBAC PabA** TRAP, RelA 38.4 trpEDCFBA TrpE** TRAP 31.8 TrpD** TRAP 11.7 TrpB** TRAP 11.8 TrpA** TRAP 16.2

CodY regulon AcsA* CodY,CcpA 9.3 21.8 5.7 amhX AmhX CodY 4.2 3.8 appDFA AppD** CodY,RelA,CcpA 6.7 4.9 CitB CodY,CcpC, CcpA 4.3 Hag CodY 4.0 IlvD CodY 2.8 rapA-phrA RapA** CodY,RelA,CcpA 13.5 17.9 7.0 9.8 YfmP** CodY YjcG CodY YurJ** CodY,TnrA- 3.2 19.3 yurPONML YurP CodY,TnrA- 4.3 2.3 YurOlipo** CodY,TnrA- 6.7 10.9 YurL CodY,TnrA- 8.6 yxbCD YxbC CodY,RelA, PerR 11.0 7.8

CcpA regulon bglPH-yxiE BglH* CcpA 6.7 citZ-icd-mdh CitZ CcpA, Spx 6.9 4.0 2.9 glpFK GlpK CcpA, σE 11.9 licBCAH LicH* CcpA 54.5 malA MalA CcpA, CodY 57.3 malL MalL** CcpA 6.0 rbsRKDACB RbsA* CcpA 24.9 RbsK CcpA 5.2 ysiB YsiB CcpA 5.5 6.6 yvdGHI YvdGlipo** CcpA 11.3 213

2) Protein H2O2 Par Diam Phen Cate Chro HyQ Sali function / similarity

AsnZ** similar to asparaginase Cah 7.6 20.0 n.q cephalosporin C deacetylase DppA** D-alanyl-aminopeptidase GlnA glutamine synthetase OppAlipo oligopeptide ABC transporter (binding protein) OppD oligopeptide ABC transporter (ATP-binding protein) PucL** uricase TasAs translocation-dependent antimicrobial spore component UreC 4.8 7.0 7.2 urease (alpha subunit) Vprs* minor extracellular serine protease YxbB** similar to methyltransferase

Bcd leucine dehydrogenase BkdAA branched-chain alpha-keto acid dehydrogenase E1 subunit (2-oxoisovalerate dehydrogenase alpha subunit) LpdV branched-chain alpha-keto acid dehydrogenase E3 subunit (dihydrolipoamide dehydrogenase) RocA pyrroline-5 carboxylate dehydrogenase RocD ornithine aminotransferase RocF arginase RocG glutamate dehydrogenase (major) AcoA* acetoin dehydrogenase E1 comp. (TPP-dep. a subunit) AcoB* acetoin dehydrogenase E1 comp. (TPP-dep. b subunit) AcoC* acetoin dehydrogenase E2 component (dihydrolipoamide acetyltransferase) AcoL* acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)

PabA** para-aminobenzoate synthase glutamine amidotransferase (subunit B) TrpE** anthranilate synthase TrpD** anthranilate phosphoribosyltransferase TrpB** tryptophan synthase (beta subunit) TrpA** tryptophan synthase (alpha subunit)

AcsA* 8.1 6.8 5.5 acetyl-CoA synthetase AmhX 0.4 3.9 3.9 amidohydrolase AppD** oligopeptide ABC transporter (ATP-binding protein) CitB 5.0 aconitate hydratase Hag 2.6 flagellin protein IlvD dihydroxy-acid dehydratase RapA** response regulator aspartate phosphatase YfmP** 19.0 similar to transcriptional regulator (MerR family) YjcG 3.2 similar to unknown proteins YurJ** multiple sugar ABC transporter (ATP-binding protein) YurP similar to glutamine-fructose-6-phosphate transaminase YurOlipo** similar to multiple sugar-binding protein YurL similar to ribokinase YxbC 3.8 similar to unknown proteins

BglH* 11.0 beta-glucosidase CitZ 6.1 2.9 citrate synthase II (major) GlpK 4.3 glycerol kinase LicH* 73.8 6-phospho-beta-glucosidase MalA 6-phospho-alpha-glucosidase MalL** maltose-inducible alpha-glucosidase RbsA* 3.3 ribose ABC transporter RbsK ribokinase YsiB similar to 3-hydroxbutyryl-CoA dehydratase YvdGlipo** maltose/maltodextrin-binding protein 214

Gene or Operon Protein Regulon Amm Trp Glu Pho Heat Salt Starvation proteome signatures (continued)

CcpN regulon gapB GapB* CcpN 25.6 PckA CcpN 17.2

PhoPR regulon tuaABCDEFGH TuaD* PhoPR, σF 22.0 TuaH** PhoPR, σF 7.9 phoPR PhoP PhoPR, σE, CcpA 4.4 phoB-ydhF PhoBs* PhoPR, σE x PhoDs* PhoPR x PstBA/BB* PhoPR x pstSAC/BA/BB PstSs* PhoPR 152.9 YdhFs* PhoPR, σE 23.4

σB regulon Ctc σB 19.2 x 4.2 36.5 Dps σB 3.5 3.0 2.0 2.8 9.6 GsiB σB 3.1 57.8 3.9 50.4 37.6 GspA* σB 9.1 4.1 19.4 5.7 GtaB σB 11.8 4.2 11.9 6.2 KatE σB 7.9 x 7.5 NadE σB 4.1 2.2 6.1 rsbRSTUVW-sigB-rsbX RsbW σB 3.7 2.0 1.8 13.6 SigB σB 7.0 3.2 3.7 13.3 ycdFG YcdF σB 2.3 4.7 yceCDEFGH YceC σW, σB 11.0 YceD σW, σB 5.6 YceH σW, σB 2.1 6.9 YfhM σW, σB 18.6 14.7 8.6 10.2 ydaDEFG YdaD* σB x 13.4 YdaE* σB 9.3 10.2 8.7 5.4 YdaG σB 4.6 x 3.4 9.3 ydaP YdaP σB 4.1 9.5 ydaTS YdaT* σB 7.0 YdbD* σB x YfkM σB 14.5 9.1 5.9 20.3 yfmA-yflT YflT σB 18.1 x YhdN σB 4.1 6.4 4.8 YkzA σB 22.1 x 15.4 50.1 YocK* σB 12.6 x 19.4 YvaA σB 5.1 YsnF σB 15.3 27.4 22.3 31.6

σH regulon ftsAZ FtsA σH,CcpA 4.8 minCD MinD σH 8.0 6.5 5.3 rapG-phrG RapG** σH 6.6 10.9 8.7 Spo0A σH,RelA,CodY 7.4 4.0 2.0 4.0 spoIIAA/AB-sigF SigF** σH 10.8 3.1 6.2 SpoVG σH,RelA 10.3 13.1 4.2 SpoVS** σH n.q YisK σH 3.5 4.8 17.3 4.2 ypiABF-qcrABC YpiB** σH,RelA, Spx 6.5 6.0 6.0 5.3 ytxGHJ YtxH σH,RelA,σB 5.5 7.4 5.6 3.9 2.6 8.6 yuxI-yukJ YuxI** σH 28.5 2.8 3.1 52.0 YvyD σH,RelA,σB 46.6 76.0 30.5 22.2 3.6 16.8 ywfBCDEFG YwfC σH 4.8 3.2

σF regulon KatX* σF, σB 2.6 RsfA** σF 10.8 3.1 6.2 SpoIIQ** σF 17.6 SpoVT** σF coo 215

2) Protein H2O2 Par Diam Phen Cate Chro HyQ Sali function / similarity

GapB* glyceraldehyde-3-phosphate dehydrogenase PckA phosphoenolpyruvate carboxykinase

TuaD* biosynthesis of teichuronic acid TuaH** biosynthesis of teichuronic acid PhoP two-component response regulator for phosphate regulation PhoBs* alkaline phosphatase III PhoDs* alkaline phosphatase/phosphodiesterases PstBA/BB* phosphate ABC transporter (ATP-binding protein) PstSs* phosphate ABC transporter (phosphate binding protein) YdhFs* lipoprotein

Ctc 10.1 general stress protein Dps 5.7 2.7 stress- and starvation-induced DNA binding protein GsiB 26.7 8.2 4.6 6.6 general stress protein GspA* 10.1 6.0 4.6 general stress protein GtaB 22.0 5.9 glucosylation of teichoic acid KatE catalase 2 NadE NAD biosynthesis RsbW anti-σ factor of σB SigB general stress σ factor YcdF 22.2 similar to glucose 1-dehydrogenase YceC 4.2 5.9 2.9 similar to tellurium resistance protein YceD 5.3 similar to tellurium resistance protein YceH 2.4 3.2 similar to toxic anion resistance protein YfhM similar to epoxide hydrolase YdaD* n.q 17.9 oxidoreductase YdaE* 29.0 probable spore coat polysaccharide biosynthesis protein YdaG general stress protein YdaP n.q 5.4 similar to pyruvate oxidase YdaT* unknown YdbD* similar to manganese-containing catalase YfkM 7.1 5.5 general stress protein YflT 8.6 general stress protein YhdN 7.1 3.1 similar to aldo/keto reductase YkzA 6.2 5.5 similar to organic hydroperoxide resistance protein YocK* similar to general stress protein YvaA similar to oxidoreductase YsnF 52.8 9.0 unknown

FtsA required for septum formation during sporulation MinD cell-division inhibitor (septum placement) RapG** 4.4 response regulator aspartate phosphatase Spo0A two-component response regulator for initiation of sporulation SigF** sporulation forespore-specific σ factor SpoVG required for spore cortex synthesis SpoVS** required for dehydratation of the spore core YisK 4.1 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase YpiB** 2.2 similar to unknown proteins YtxH 3.2 similar to general stress protein YuxI** unknown YvyD 9.0 2.8 10.5 15.0 5.0 6.7 7.6 similar to σ54 modulating factor YwfC similar to bacilysin biosynthesis protein bacA

KatX* major catalase in spores RsfA** regulator of transcription of σF-dependent genes SpoIIQ** required for completion of engulfment SpoVT** positive and negative regulator of σG-dependent genes 216

Gene or Operon Protein Regulon Amm Trp Glu Pho Heat Salt

Starvation proteome signatures (continued)

σE regulon AsnO** σE coo glgBCDAP GlgA** σE, σH 6.4 KamA** σE coo 31.6 PrkA σE 70.7 5.7 SafA** σE 53.4 7.4 SpoIVA σE 128.4 3.3 SpoVR** σE 6.1 spoVID-ysxE SpoVID** σE, TnrA+ 14.2 YaaH** σE, σB 104.9 YhbH** σE 20.4 YjbX** σE 10.9 5.3 5.8 YybI** σE 9.4

Other starvation or stress induced proteins ackA AckA glu- 4.7 adeC AdeC RelA 5.9 ald Ald RelA,TnrA- 8.1 4.0 aroD AroD 36.5 dat Dat 4.0 3.4 3.4 degSU DegS* DegSU 7.6 DegU DegSU 6.0 dhaS DhaS 7.9 6.0 7.4 EtfA** 18.9 EtfB** 40.9 FabF 2.6 folD FolD 13.15.4 4.8 htpG HtpG 5.1 8.4 gcvT-gcvPAB GcvT 6.4 glmS GlmS glu- 10.4 11.1 hom Hom 3.9 IspA** 7.3 Kbl* glu- 14.8 menB MenB 13.05.4 4.8 murB MurB 9.1 10.6 4.4 OdhA glu OdhB glu PadC** pbpE PbpEwall 34.5 pksBCDE-acpK-pksF PksC** 9.5 ptsGHI PtsH glu- 9.1 3.6 SdhA glu- YaaQ 2.7 YbaL ycgN YcgN 19.8 8.1 28.2 yclBCD YclC** YdfN** YdfO YdgI** YfkO** YfmJ YhfE 2.9 YhjL** 216.7 yjcLK YjcK** 6.0 8.1 3.4 YkcA** YkgB 5.1 ykuNOPQ YkuQ YneT YocJ YocdC YpsC** YqeH 14.8 YqkF ysnA YsnA 5.5 6.6 217

2) Protein H2O2 Par Diam Phen Cate Chro HyQ Sali function / similarity

AsnO** asparagine synthetase GlgA** starch (bacterial glycogen) synthase KamA** lysine 2,3-aminomutase PrkA serine protein kinase SafA** morphogenetic protein associated with spoVID SpoIVA required for spore cortex formation and coat assembly SpoVR** involved in spore cortex synthesis SpoVID** required for assembly of the spore coat YaaH** similar to cortical fragment-lytic enzyme YhbH** putative stress response protein YjbX** glutamic acid-rich protein YybI** unknown

AckA acetate kinase AdeC adenine deaminase Ald 5.7 L-alanine dehydrogenase AroD shikimate 5-dehydrogenase Dat probable D-alanine aminotransferase DegS* two-comp. sensor kinase for degradative enzymes DegU two-comp. response regulator for degradative enzymes DhaS 8.3 5.0 3.1 aldehyde dehydrogenase EtfA** electron transfer flavoprotein (alpha subunit) EtfB** electron transfer flavoprotein (beta subunit) FabF beta-ketoacyl-acyl carrier protein synthase II FolD methylenetetrahydrofolate dehydrogenase / HtpG class III heat-shock protein (molecular chaperone) GcvT 3.4 4.8 aminomethyltransferase GlmS L-glutamine-D-fructose-6-phosphate amidotransferase Hom homoserine dehydrogenase IspA** major intracellular serine protease Kbl* 2-amino-3-ketobutyrate CoA ligase MenB dihydroxynapthoic acid synthetase MurB UDP-N-acetylenolpyruvoylglucosamine reductase OdhA 3.7 5.6 2-oxoglutarate dehydrogenase (E1 subunit) OdhB 2.1 12.3 2-oxoglutarate dehydrogenase (E2 subunit) PadC** 8.3 phenolic acid decarboxylase PbpEwall penicillin-binding protein 4 PksC** involve in polyketide synthesis PtsH 5.8 phosphocarrier protein of the PTs (HPr protein) SdhA 6.7 15.2 succinate dehydrogenase (flavoprotein subunit) YaaQ unknown YbaL 5.6 7.6 3.9 3.4 5.0 similar to ATP-binding Mrp-like protein YcgN similar to 1-pyrroline-5-carboxylate dehydrogenase YclC** 7.9 carboxylase-related protein YdfN** 17.6 137.4 similar to NAD(P)H nitroreductase YdfO 3.4 glyoxylase/bleomycine resistance protein YdgI** 7.8 3.9 similar to NADH dehydrogenase YfkO** 6.0 8.8 similar to NAD(P)H-flavin oxidoreductase YfmJ 4.1 similar to quinone oxidoreductase YhfE 7.7 3.8 similar to glucanase YhjL** sensory transduction pleiotropic regulatory protein YjcK** similar to ribosomal-protein-alanine N-acetyltransferase YkcA** 4.8 glyoxylase/bleomycine resistance protein YkgB similar to 6-phosphogluconolactonase YkuQ 5.6 2.4 similar to tetrahydrodipicolinate succinylase YneT 2.6 similar to succinyl-CoA synthetase YocJ 6.3 32.9 13.8 similar to acyl-carrier protein phosphodiesterase YodC 7.0 7.4 similar to nitroreductase YpsC** 6.2 similar to methyltransferase YqeH similar to GTP-binding protein YqkF 4.9 3.2 similar to oxidoreductase YsnA similar to xanthosine triphosphate pyrophosphatase 218

Gene or Operon Protein Regulon Amm Trp Glu Pho Heat Salt

Starvation proteome signatures (continued)

Other starvation or stress induced proteins yurU YurU 11.9 7.1 yurY YurY 35.2 3.4 yusJ YusJ* 5.4 5.4 78.4 yvaCB YvaB 3.6 YvcT 12.2 3.3 liaIHGFSR LiaH* LiaRS 4.6 yxiE YxiE 10.9 2.3 YwfI 1.8 YwjH glu- 4.6

1) All marker proteins with induction factors of at least twofold in two independently repeated proteome experiments were classified according to the array data of previously described regulons (HrcA, σB, CtsR, PerR, Fur, Spx, RecA, CymR, S-box, TnrA, σL, BkdR, RocR, AcoR, TRAP, CcpA, CcpN, PhoPR, CodY, σH, σF, σE ) [Leichert et al., 2003; Mostertz et al., 2004; Nakano et al. 2003; Petersohn et al., 2001; Ollinger et al., 2006; Helmann et al., 2003; Fernandez et al., 2000; Yoshida et al., 2003; Debarboiile et al., 1999; Eichenberger et al., 2003; Feucht et al., 2003; Molle et al., 2003; Gardan et al., 1997; Yoshida et al., 2001; Koburger et al., 2005; Britton et al., 2002; Babitzke and Gollnick, 2001; Servant et al., 2005; Allenby et al., 2005; Blencke et al., 2003; Even et al., 2006] and the operon structure is indicated. The protein synthesis ratios correspond to the highest induction ratios from different times after the exposure to stress (5, 10, 20 or 30 min) and in response to starvation during the transition phase and 10, 30 and 60 min after the transition to stationary phase in one representative experiment. The proteins not detected in these experiments but identified in previous proteome analyses or in the alkaline pH range were marked by an x. Proteins not quantitated were marked by "n.q". Proteins only detected in coomassie- stained 2D gels but not in the synthesis gels were marked with Coo. Proteins that are under glucose repression according to previous array data are indicated with "glu-" [Yoshida et al., 2001; Blencke et al., 2003; Koburger et al., 2005]. Proteins that are secreted are indicated by "s", lipoproteins are marked with "lipo" and cell wall proteins are indicated by "wall". Proteins that are not expressed in the vegetative proteome map are indicated by * [Eymann et al., 2004]. All newly identified proteins that are absent in vegetative proteome map and also not detected in previous proteome analyses for stress and starvation are indicated by ** [Antermann et al., 2000; Bernhardt et al., 2003; Eymann et al., 1996; Eymann et al., 2002; Hoper et al., 2006; Leichert et al., 2003; Mostertz et al., 2004; Bandow et al., 2003].

2) The function is derived from the SubtiList database (http://genolist.fr/SubtiList/). The functions of the Fur-regulated genes are derived from genetic and physiological studies reported previously [Ollinger et al., 2006]. 219

2) Protein H2O2 Par Diam Phen Cate Chro HyQ Sali function / similarity

YurU 2.5 similar to FeS cluster assembly system YurY similar to ABC transporter (ATP-binding protein) YusJ* similar to butyryl-CoA dehydrogenase YvaB 23.2 53.1 3.9 similar to NAD(P)H dehydrogenase (quinone) YvcT 7.5 similar to glycerate dehydrogenase LiaH* similar to phage shock protein YxiE similar to universal stress protein YwfI 2.0 4.6 3.4 3.5 3.1 4.0 similar to chlorite dismutase YwjH similar to transaldolase (pentose phosphate) 220

221

Chapter 7

General discussion

222

1. The vegetative proteome map of B. subtilis

By combination of high-resolution 2D gel electrophoresis and high-throughput mass spectrometry, a vegetative core proteome map of growing B. subtilis cells was constructed. This proteome map contains 693 identified proteins in the standard pH range 4-7, 52 alkaline proteins that were exclusively identified in the pH range 6-11 and 130 intrinsic membrane proteins. Two main proteome fractions (pI 4-7 and pI 6-11) should be sufficient to capture the most essential changes of the proteome in growing cells. The coverage in the standard gel region of pI 4-7 can be substantially increased by a zoom gel of the pI range 4.5-5.5. The identified proteins cover more than 40% of all theoretically in growing cells expressed proteins according to transcriptome data. They are involved in the central metabolism of carbohydrates, amino acids, nucleotides, fatty acids as well as in replication, transcription, translation, motility, secretion and cell wall synthesis. Comparing the theoretical pI and Mr values with those experimentally determined, a reasonable correlation was found for the majority of protein spots. The outliers with dramatic deviations in charge or mass were visualized indicating post-translational modifications. Such data set can now be explored to compare physiologically different growth conditions and to reveal the proteomics signatures of particular environmental conditions.

Moreover, the vegetative proteins that are involved in the metabolism of growing cells were inserted into a comprehensive metabolic map (Fig. 4, chapter 2). This comprehensive proteomic information of growing cells enables us to analyze the regulation of entire metabolic pathways, which was already done for the regulation of glycolysis and citric acid cycle in B. subtilis. These studies have indicated that glycolysis is strongly stimulated by glucose and the citric acid cycle is repressed if glutamate is available even in the presence of oxygen. The excess glucose intermediates can not enter the citric acid cycle because it is repressed but have to be secreted into the extracellular medium (overflow metabolism). This phenomenon known as Crabtree effect depends on CcpA, the global regulator of carbon catabolite repression.

However, the evaluation of the proteome of growing cells (vegetative proteome) has to be succeeded by the analysis of proteomes of stationary phase cells in order to gain a comprehensive experimental validation/description of the entire theoretical proteome. The single proteome of nongrowing cells will probably show more differences than proteome of cells grown under different conditions, because the stress or starvation stimuli that trigger the nongrowing state normally induce a huge number of stress or starvation-specific genes [Bernhardt et al., 2003; Sonenshein, 2000; Hecker and Völker, 2001; Kobayashi et al., 2001; Eichenberger et al., 2003; Fawcett et al., 2000]

223

2. Proteome signatures of B. subtilis in response to stress, starvation and xenobiotics

2.1. The catalog of proteome signatures of B. subtilis

The 2D gel-based proteome approach has been proven as powerful tool in the study of the bacterial response to different antibiotics [Bandow et al., 2002; Brötz-Oesterhelt et al, 2005]. A catalog of B. subtilis proteome signatures in response to 30 different antibiotics has been developed by Bandow and coworkers that can be used as tool to predict the target and mode of action of new antibiotics, antimicrobials or xenobiotic substance. In this thesis, a catalog of proteome signatures was created for B. subtilis in response to different stress and starvation conditions. Moreover, the stress and starvation induced proteins could be classified into specific and general stress and starvation regulons. As novel gel-based approach to classify all proteome signatures, fused proteome maps of all stress or starvation conditions were created and the induction profiles of the marker proteins are visualized by the color coding approach. This catalog should provide the basis to predict the stimulons and regulons that are induced also by other stress conditions or in response to antibiotics, antimicrobials or xenobiotics. Thus, a comprehensive 2D gel-based database was developed in this thesis to describe and compare different proteome signatures in B. subtilis. Concerning the antibiotic proteome signature catalog the “marker protein concept” was improved by the “induced regulon concept” since most inductions can be explained by the induction of specific or general regulon.

In this thesis, we established a “proteome signature catalog for stress and starvation in B. subtilis” that includes signatures for heat, salt, disulfide (diamide) and oxidative stress

(H2O2, paraquat); in response to different aromatic compounds (phenol, catechol, salicylic acid, 2-methylhydroquinone, 6-brom-2-vinyl-chroman-4-on; and in response to starvation of glucose, phosphate, ammonium and tryptophan. The proteome signatures for diamide and 2- methylhydroquinone, 6-brom-2-vinyl-chroman-4-on have been defined in previous studies [Leichert et al., 2003; Wolf, 2005] and completed by new marker proteins in this thesis. All induced marker proteins are classified into specific and general stress or starvation regulons in one complete table (Table 1, chapter 6). In total, we could identify 224 marker proteins for all conditions that include a maximum of 84 marker proteins induced after ammonium starvation. Of these, 89 proteins are absent in the vegetative proteome map [chapter 2, Eymann et al., 2004], 52 of them are also not detected in previous proteome analyses for stress and starvation [Antelmann et al., 2000; Bernhardt et al., 2003; Eymann et al., 1996; Eymann et al., 2002; Höper et al., 2006; Leichert et al., 2003; Mostertz et al., 2004; Bandow et al., 2003].

224

2.2. Proteome signatures of B. subtilis in response to stress and xenobiotics

The detected proteome signatures are consistent with existing knowledge about the regulation mechanisms for the stress and starvation responses in B. subtilis. For example, the heat shock signature is indicated by the induction of the heat-specific HrcA-dependent chaperones as indicators for misfolded, denaturated or aggregated proteins and the general induction of the σB, CtsR and Spx regulons [Hecker and Völker, 2001; Schumann et al., 2002]. The treatment with hydrogen peroxide and paraquat caused reactive oxygen-species in the cell resulting in the oxidative stress specific PerR and Fur regulons as well as in the Spx regulon as general indicator for protein damages by non-native disulfide bond formation [Helmann et al., 2003; Mostertz et al., 2004]. In contrast, the SOS regulon induction is specific for DNA damages caused by peroxides only and the CymR and S-box regulon are induced in response to superoxides only [Grundy and Henkin, 1998; Even et al., 2006; Mostertz et al., 2004]. Diamide is a thiol-specific oxidant that causes the formation of non- native disulfide bonds in the cell [Leichert et al., 2003; Bardwell, 1994; Deneke, 2000]. The thiol-specific oxidative stress response is indicated by the induction of the Spx, PerR regulon as well as by the HrcA and CtsR heat shock regulons that respond to oxidatively damaged protein [Leichert et al., 2003]. The specific adaptative functions of the stress specific regulons (e.g. HrcA, PerR) are to confer specific resistance mechanisms against the stress and thereby enable the cell (i) to neutralize the stressor, (ii) to adapt to the specific stressor or (iii) to repair damages caused by the stressor [Hecker and Völker, 2004]. In contrast, the σB- dependent general stress regulon encodes proteins with different functions conferring a multiple, non-specific and preventive stress resistance to non-growing B. subtilis cells in anticipation of future stress possibly encountered during long-term stationary growth stages [Hecker and Völker, 2004; Gaidenko and Price, 1998]. Induction of the general stress response by one stress affords significant cross-protection against other stresses [Hecker and Völker, 2004].

The “induced regulon concept” could be applied to predict the stress responses and mode of actions of some novel aromatic compounds that are included in our proteome signature catalog such as phenol, catechol, salicylic acid, 2-methylhydroquinone, 6-brom-2- vinyl-chroman-4-on [Bandow et al., 2003]. Phenol is a chaotrope solute that caused water stress in P. putida [Hallsworth et al., 2003]. In B. subtilis phenol induced a classical heat shock signature as revelaled by the induction of the HrcA, σB and CtsR heat shock regulons as well as the Spx disulfide stress regulon. The induction of heat shock proteins by phenol was detected also in A. calcoaceticus or P. putida and seems to be required for stabilization of macromolecular structures [Benndorf et al., 2001; Hallsworth et al., 2003]. Since phenol induced no further specific marker proteins besides the heat shock proteome signature in B. subtilis, the mode of action seems to be induced protein damages. The proteome signature

225 of salicylic acid was similar to that of phenol which indicates that both substances cause a heat shock response in B. subtilis provoked by protein damages. However, salicylic acid induced also important specific marker proteins such as the phenolic acid decarboxylases YclC and PadC that are involved in the decarboxylation of salicylic acid to phenol. Based on these specific marker proteins, salicylic acid may be converted to phenol which in turn causes the heat shock response in B. subtilis. The heat shock proteome signature was also detected in response to 6-Brom-2-vinyl-chroman-4-on (chromanon) as revealed by the HrcA, σB, CtsR and Spx regulons [Wolf, 2005]. Catechol and 2-methylhydroquinone caused the induction of the protein damage indicating HrcA and CtsR regulons and a thiol-specific oxidative stress response involving the Spx, PerR regulons. Thus, both substances showed proteome signatures that overlap with diamide reflecting that these aromatic substances cause thiol-specific oxidative stress and protein damage in the cell [Wolf, 2005]. In addition, catechol showed a proteome signature that overlaps partly to the proteome signature of glucose starved cells as revealed by the induction of CcpA-dependent marker proteins (AcsA, BglH, GlpK, LicH and RbsA). This signature was typical for catechol only, but not for diamide or 2-methylhydroquinone.

2.3. Proteome signatures of B. subtilis in response to starvation

For the first time a fused proteome map for ammonium, tryptophan, glucose and phosphate starvation was created that provided the tool to define specifically induced starvation regulons and more generally induced transition phase regulons (Fig. 4 and 5, chapter 3). The induction of the TnrA- and σL/BkdR-dependent catabolic enzymes for alternative nitrogen sources indicates an ammonium starvation specific proteome signature (Fig. 5, chapter 3) [Fisher, 1999; Yoshida et al., 2003; Débarbouillé et al., 1999]. In contrast, the induction of the TRAP-regulated tryptophan biosynthesis enzymes is the specific proteome signature for tryptophan starvation (Fig. 5, chapter 3) [Babitzke and Gollnick, 2001; Gollnick et al., 2005]. In response to glucose starvation several carbon catabolite controlled marker proteins are specifically activated in the absence of glucose and repressed in the presence of glucose by CcpA, CcpN and AcoR (Fig. 5, chapter 3) [Servant et al., 2005; Koburger et al., 2005]. Finally, the induction of the PhoPR regulon is the specific proteome signature for phosphate starvation (Fig. 5, chapter 3) [Allenby et al., 2005; Hulett, 2002; Antelmann et al., 2000; Eymann et al., 1996]. These specific starvation regulons such as TnrA, TRAP, CcpA or PhoPR were shown to be specifically involved in the uptake and utilization of alternative nutrient sources in response to the specific nutrient limitation. Consequently, the specific starvation response is strongly induced during the transition phase and remains constant until 60 min after transition to stationary phase (Table 1, chapter 3).

226

The general proteome signature for different kinds of nutrient limitation is mediated by the CodY, σB and σH transition phase regulons (Fig. 5, chapter 3). These general starvation regulons are required for the adaptation of the cell to post-exponential stationary phase processes such as survival under non-growing conditions, competence or sporulation. The induction of the CodY regulon after ammonium and tryptophan starvation is reflective for the reduced growth rate resulting in the drop of the GTP level and consequently CodY derepression [Molle et al., 2003; Ratnayake-Lecamwasam et al., 2001]. The CodY regulon encodes proteins that allow broader adaptation to nutrient depletion including extracellular degradative enzymes, transporter proteins, catabolic enzymes, factors involved in genetic competence, antibiotic synthesis pathways, chemotaxis proteins, and sporulation proteins [Molle et al., 2003]. In addition, the σB regulon is the general proteome signature for glucose and phosphate starvation and required for the stationary phase survival upon starvation [Hecker and Völker, 2004; Gaidenko and Price, 1998].

As a novel finding, the color coded fused proteome map for starvation defined six σH- dependent proteins YvyD, YtxH, YisK, YpiB, Spo0A, YuxI and the CodY-dependent RapA as general starvation proteins indicating the transition phase in response to nutrient limitation (Fig. 5, chapter 3). σH directs the transcription of several genes that function in the transition from exponential growth to stationary phase, including the initiation of spore formation and genetic competence [Britton et al., 2002]. In addition, σH controls many genes that are required for general adaptation to nutrient depletion. These genes are involved in transport, generation of potential nutrient sources, cell wall metabolism, proteolysis and cytochrome biogenesis [Britton et al., 2002]. It has been shown that both σB and σH contribute to stationary phase survival under acidic and alkaline conditions and this effect was independent from the simple loss of sporulation ability [Gaidenko and Price, 1998]. It is currently unknown whether these σH-dependent general starvation proteins contribute to the stationary phase survival which has been demonstrated previously for σB and σH [Gaidenko and Price, 1998]. Thus, the fused starvation proteome map and color code approach provide important leads for future research on protein functions of the novel identified general starvation proteins during stationary phase survival in B. subtilis.

3. The response of B. subtilis to ammonium and tryptophan starvation

In this study, the global cellular responses of B. subtilis to ammonium and tryptophan starvations are analyzed by proteome and transcriptome analyses. The response of B. subtilis to ammonium or tryptophan starvation includes the generally induced CodY-, RelA- and σH-regulons as well as regulons induced specifically by ammonium (e.g. TnrA, GlnR, σL [BkdR/RocR]) or tryptophan starvation (TRAP). The general starvation regulons overlap also

227 with other starvation conditions (glucose and phosphate) which might indicate the starvation- caused transition to stationary phase. The specific response of B. subtilis to ammonium starvation consists of the uptake of ammonium and synthesis of glutamate as substrates for glutamine synthetase (GlnA). This is demonstrated by the upregulation of the known ammonium transporter (nrgAB) and glutamate generating enzymes such as aspartate aminotranferase (yurG), ornithine aminotransferase (rocD), alanine transaminase (alaT), other potential α-ketoglutarate utilizing aminotransferases (ycbU, patB), γ- glutamyltransferase (ywrD) as well as aconitase (citB) that is involved in the synthesis of α- ketoglutarate/glutamate. Alternate nitrogen sources or their degradation products such as γ- aminobutyrate (gabP) or aspartate (asnZ) might function as amino group donors for aminotransferases. Glutamate is also generated by degradation of proline and arginine as indicated by the specific induction of the rocA,D,F genes. These reactions and the inhibition of rocG expression indicate that the level of glutamate as substrate for glutamine synthetase and nitrogen donor for transaminations is critical and should be maintained. In addition to GlnA, the asparagine synthetase AsnO might be involved in ammonium assimilation during ammonium starvation. In contrast, the TnrA- and CodY-dependent asnH gene encoding another asparagine synthetase was induced in response to both, ammonium and tryptophan starvation as well [Molle et al., 2003; Yoshida et al., 2003].

In summary, several genes with unknown functions are induced in our transcriptome analyses that provide major leads for future research on protein functions in response to ammonium and/or tryptophan starvation.

4. The response of Bacillus subtilis to the aromatic compounds phenol and catechol

In this study we monitored the gene expression profile of B. subtilis in response to the aromatic compounds phenol and catechol using proteomics and transcriptomics to (1) define the mode of action of these aromatic compounds and (2) to elucidate if specific degradative enzymes are induced in B. subtilis that are involved in degradation of aromatic compounds. Many carbon catabolite controlled genes are derepressed by catechol even if glucose is present and taken up under these conditions. Our growth and viability experiments suggested that B. subtilis is not able to utilize catechol as sole carbon-energy source. It has

228 been shown previously, that various phenolic compounds are glucosylated to aryl-β- glucosides by a transglucosylating reaction of α-amylase in B. subtilis X-23 [Nishimura et al., 1994a]. Furthermore, the solubility and stability of the glucosides was higher than that of the aglucones [Nishimura et al., 1994b]. Thus, it might be possible that catechol is transglucosylated also in B. subtilis 168 and utilized in its glucosylated form. The derepression of catabolite repression could be caused by the exhaustion of glucose in the transglucosylation reaction of catechol. Indeed, our data supported the view that there is a relation between glucose and catechol since the derepression of the carbon catabolite controlled licBCAH and rbsRKDACB operons was strongly increased with an excess of 2% glucose. Future studies should elucidate if catechol glucosides are produced upon exposure to catechol stress in B. subtilis 168 and if glucose is exhausted by transglucosylation of catechol.

In addition to the heat and thiol specific oxidative stress response as well as the derepression of catabolite controlled genes by catechol the transcriptome results identified a key enzyme of the meta cleavage pathway for catechol degradation, the catechol-2,3- dioxygenase YfiE. Overproduced YfiE was incubated with catechol and the catechol-2,3- dioxygenase activity could be demonstrated by measuring the accumulation of 2- hydroxymuconic semialdehyde spectrophotometrically. Thus, for the first time it was demonstrated that B. subtilis 168 is able to degrade catechol by the catechol-2,3- dioxygenase YfiE. Moreover, the inactivation of yfiE increased the sensitivity of the cells to the growth and viability in response to catechol. Our Northern blot analyses suggested that the yfiE gene forms a bicistronic operon together with yfiD encoding a putative oxidoreductase that is strongly induced by catechol. Thus, it might be possible that YfiD is involved in the metabolism of 2-hydroxymuconic semialdehyde. Future studies should now elucidate the unknown transcriptional regulator that is involved in the control of the catechol- induced yfiDE operon. Our transcriptome and proteome results did not identify further enzymes of the meta cleavage pathway involved in the degradation of 2-hydroxymuconic semialdehyde to pyruvate and acetyl-CoA which were identified in phenol-degrading Pseudomonas species [Tsirogianni et al., 2004]. In addition, the search for the respective genes according to the SubtiList database did not reveal candidate genes that could be involved in the degradation of 2-hydroxymuconic semialdehyde. Thus, it is subject to future studies to identify further enzymes of the meta cleavage pathway for catechol degradation.

Recent results of C. Wolf and Nguyen van Duy showed similar proteome signatures as well as strong transcriptional inductions of the yfiDE operon after treatment with 2-methyl hydroquinone and catechol which might indicate similar mode of actions to these two compounds [Wolf, 2005; Nguyen van Duy, personal communication]. In addition, the transcriptome analyses revealed further interesting genes that might be involved in the

229 degradation of catecholic comounds. For example, the ydfNOP operon that is induced by catechol and 2-methyl hydroquinone is related to the yfiDE operon as revealed by the similarities for nitroreductases (ydfN), glyoxalases/bleomycin resistance proteins/dioxygenases (ydfO) and DoxD-like oxidoreductases (ydfP). Further candidate genes for degradation of aromatic compounds are also induced by catechol and methyl hydroquinone as revealed by yodB,C,D,E, ykcA, ycnD (Duy NV, PhD thesis). Of these, yodB encodes a putative MarR-type transcriptional regulator; ykcA and yodE are also similar to glyoxalases/bleomycin resistance proteins/dioxygenases; yodC and ycnD are related to NADPH-flavin oxidoreductases.

In different Pseudomonas species phenol degradation is initiated by the multicomponent phenol hydroxylase complex by insertion of oxygen into the aromatic ring, providing catechol [Shingler et al., 1992]. The dihydroxylated intermediate catechol is channelled into the ortho or the meta cleavage pathways [Harayama et al., 1992; Diaz, 2004]. Furthermore, it was shown that both enzymes responsible for the primary attack of phenol, the phenol hydroxylase and the catechol 2,3-dioxygenase are expressed in other more thermophilic Bacillus species as for example B. stearothermophilus, B. thermoleovorans and B. thermoglucosidasius [Dong et al., 1992; Kim and Oriel, 1995; Duffner and Muller, 1998; Duffner et al., 2000; Milo et al., 1999]. In contrast, B. subtilis ATCC 7003 was hitherto regarded as a “secondary degrader” [DuTeau et al., 1998]. Our microarray data support the hypothesis that B. subtilis 168 encodes no phenol hydroxylase and is not able to metabolize phenol into catechol since the main enzyme of the meta cleavage pathway YfiE was not induced by phenol. Thus, it is not surprising that the gene expression profiles differ strongly between phenol and catechol in B. subtilis.

In summary, the transcriptome and proteome analyses of B. subtilis in response to phenol and catechol revealed overlapping heat shock and disulfide responses but differences that are due to the different metabolic activities of the cells regarding the degradation of both aromatic compounds. Specifically, this study identifies a catechol degradation system YfiDE for B. subtilis which should be used as a signature to elucidate if other xenobiotic or antimicrobial aromatic compounds can be metabolized in B. subtilis using the newly identified meta cleavage pathway.

230

References

Albrecht U, Lalk M, and Langer P. 2005. Synthesis and structure-activity relationships of 2- vinylchroman-4-ones as potent antibiotic agents. Bioorganic and Medicinal Chemistry 13. 1531-1536.

Alice AF, Sanchez-Rivas C. 1997. DNA supercoiling and osmoresistance in Bacillus subtilis 168. Curr Microbiol 35, 309-15.

Allenby NE, O'Connor N, Pragai Z, Carter NM, Miethke M, Engelmann S, Hecker M, Wipat A, Ward AC, Harwood CR. 2004. Post-transcriptional regulation of the Bacillus subtilis pst operon encoding a phosphate-specific ABC transporter. Post-transcriptional regulation of the Bacillus subtilis pst operon encoding a phosphate-specific ABC transporter. Microbiology 150, 2619-28.

Allenby NE, O'Connor N, Pragai Z, Ward AC, Wipat A, Harwood CR. 2005. Genome-wide transcriptional analysis of the phosphate starvation stimulon of Bacillus subtilis. J Bacteriol 187, 8063-80.

Alper S, Dufour A, Garsin DA, Duncan L, Losick R. 1996. Role of adenosine nucleotides in the regulation of a stress-response transcription factor in Bacillus subtilis. J Mol Biol 260, 165-77.

Antelmann H, Engelmann S, Schmid R, Sorokin A, Lapidus A, Hecker M. 1997. Expression of a stress- and starvation-induced dps/pexB-homologous gene is controlled by the alternative sigma factor sigmaB in Bacillus subtilis. J Bacteriol 179, 7251-6.

Antelmann H, Scharf C, Hecker M. 2000. Phosphate starvation-inducible proteins of Bacillus subtilis: proteomics and transcriptional analysis. J Bacteriol 182, 4478-90.

Antelmann H, Tjalsma H, Voigt B, Ohlmeier S, Bron S, van Dijl JM and Hecker M. 2001. A proteomic view on genome-based signal peptide predictions. Genome Res 9, 1484-502.

Antelmann H, Williams RC, Miethke M, Wipat A, Albrecht D, Harwood CR, Hecker M. 2005. The extracellular and cytoplasmic proteomes of the non-virulent Bacillus anthracis strain UM23C1-2. Proteomics 5, 3684-95.

Antelmann H, Yamamoto H, Sekiguchi J, Hecker M. 2002. Stabilization of cell wall proteins in Bacillus subtilis: a proteomic approach. Proteomics 2, 591-602.

Apfel CM, Locher H, Evers S, Takacs B, Hubschwerlen C, Pirson W, Page MG, Keck W. 2001. Peptide deformylase as an antibacterial drug target: target validation and resistance development. Antimicrob Agents Chemother 45, 1058-64. 231

Archibald AR, Hancock IC, and Harwood CR. 1993. Cell wall structure, synthesis and turnover. In Sonenshein AL, Hoch JA, and Losick R (eds) Bacillus subtilis and other Gram- positive bacteria. American Society for Microbiology, Washington DC, 381-410.

Atkinson MR and Fisher SH. 1991. Identification of genes and gene products whose expression is activated during nitrogen-limited growth in Bacillus subtilis. Journal of Bacteriology 173, 23-27.

Babitzke P, Gollnick P. 2001. Posttranscription initiation control of tryptophan metabolism in Bacillus subtilis by the trp RNA-binding attenuation protein (TRAP), anti-TRAP, and RNA structure. J Bacteriol 183, 5795-802. Review.

Babitzke P, Yanofski C. 1995. Structural features of L-tryptophan required for activation of TRAP, the trp RNA-binding attenuation protein of Bacillus subtilis. J. Biol. Chem 26, 12452-6.

Babitzke P. 1997. Regulation of tryptophan biosynthesis: Trp-ing the TRAP or how Bacillus subtilis reinvented the wheel. Mol Microbiol 26, 1-9. Review.

Bai U, Lewandoski M, Dubnau E, Smith I. 1990. Temporal regulation of the Bacillus subtilis early sporulation gene spo0F. J Bacteriol 172, 5432-9.

Baichoo N, Wang T, Ye R and Helmann JD. 2002. Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Molecular Microbiology 45, 1613-1629.

Bandow JE, Brötz H, Leichert LIO, Labischinski H, and Hecker M. 2002. Proteomic approach to understanding antibiotic action. Antimicrobial Agents and Chem. otherapy 47, 948-955.

Bardwell JC. 1994. Building bridges: disulfide bond formation in the cell. Mol Microbiol 14, 199-205.

Beckering CL, Steil L, Weber MH, Völker U, Marahiel MA. 2002. Genomewide transcriptional analysis of the cold shock response in Bacillus subtilis. J Bacteriol 184, 6395-402.

Belitsky BR, Brill J, Bremer E, Sonenshein AL. 2001. Multiple genes for the last step of proline biosynthesis in Bacillus subtilis. J Bacteriol 183, 4389-92.

Belitsky BR, Wray LV Jr, Fisher SH, Bohannon DE, Sonenshein AL. 2000. Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. J Bacteriol 182, 5939-47

Benndorf D, Loffhagen N, Babel W. 2001. Protein synthesis patterns in Acinetobacter calcoaceticus induced by phenol and catechol show specificities of responses to chemostress. FEMS Microbiol Lett 200, 247-252.

Benov L, Fridovich I. 1999. Why superoxide imposes an aromatic amino acid auxotrophy on Escherichia coli. The transketolase connection. J Biol Chem 274, 4202-6. 232

Benov L, Kredich NM, Fridovich I. 1996. The mechanism of the auxotrophy for sulfur- containing amino acids imposed upon Escherichia coli by superoxide. J Biol Chem 271, 21037-40.

Benov L. 2000. How superoxide radical damages the cell. Protoplasma 217, 33-6. Review.

Bergara F, Ibarra C, Iwamasa J, Patarroyo JC, Aguilera R, Marquez-Magana LM. 2003. CodY is a nutritional repressor of flagellar gene expression in Bacillus subtilis. J Bacteriol 185, 3118-26.

Bernard R, El Ghachi M, Mengin-Lecreulx D, Chippaux M, Denizot F. 2005. BcrC from Bacillus subtilis acts as an undecaprenyl pyrophosphate phosphatase in bacitracin resistance. J Biol Chem 280, 28852-7.

Bernhardt J, Buttner K, Scharf C, Hecker M. 1999. Dual channel imaging of two-dimensional electropherograms in Bacillus subtilis. Electrophoresis 20, 2225-40.

Bernhardt J, Völker U, Völker A, Antelmann H, Schmid R, Mach H, Hecker M. 1997. Specific and general stress proteins in Bacillus subtilis--a two-dimensional protein electrophoresis study. Microbiology, 43, 999-1017.

Bernhardt J, Weibezahn J, Scharf C, Hecker M. 2003. Bacillus subtilis during feast and famine: visualization of the overall regulation of protein synthesis during glucose starvation by proteome analysis. Genome Res 13, 224-37.

Beyer D, Kroll HP, Endermann R, Schiffer G, Siegel S, Bauser M, Pohlmann J, Brands M, Ziegelbauer K, Haebich D, Eymann C, Brötz-Oesterhelt H. 2004. New class of bacterial phenylalanyl-tRNA synthetase inhibitors with high potency and broad-spectrum activity. Antimicrob Agents Chemother 48, 525-32.

Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J. 2003. Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab Eng 5, 133-49.

Boch J, Kempf B, and Bremer E. 1994. Osmoregulation in Bacillus subtilis: synthesis of the osmoprotectant glycine betaine from exogenously provided choline. J. Bacteriol 176, 5364– 5371.

Bremer E, and Kramer R. 2000. Coping with osmotic challenges: osmoregulation through accumulation and release of compatible solutes in bacteria. In G. Storz, and R. Hengge- Aronis (eds.), Bacterial stress responses. ASM Press, Washington, D.C. 79–97.

Bremer E. 2002. Adaptation to changing osmolarity. In: Sonenshein AL, Hoch JA, Losick R (eds) Bacillus subtilis and its closest relatives: from genes to cels. ASM Press, Washington DC, 385-391. 233

Britton RA, Eichenberger P, Gonzalez-Pastor JE, Fawcett P, Monson R, Losick R, Grossman AD. 2002. Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J Bacteriol 184, 4881-90.

Brody MS, Vijay K, Price CW. 2001. Catalytic function of an alpha/beta hydrolase is required for energy stress activation of the sigma(B) transcription factor in Bacillus subtilis. J Bacteriol 183, 6422-8.

Brötz-Oesterhelt H, Bandow JE, Labischinski H. 2005. Bacterial proteomics and its role in antibacterial drug discovery. Mass Spectrom Rev 24, 549-65. Review.

Brown OR, Smyk-Randall E, Draczynska-Lusiak B, Fee JA. 1995. Dihydroxy-acid dehydratase, a [4Fe-4S] cluster-containing enzyme in Escherichia coli: effects of intracellular superoxide dismutase on its inactivation by oxidant stress. Arch Biochem Biophys 319, 10- 22.

Brown SW, Sonenshein AL. 1996. Autogenous regulation of the Bacillus subtilis glnRA operon. J Bacteriol 178, 2450-4.

Bukau B. 1993. Regulation of the Escherichia coli heat-shock response. Mol Microbiol 9, 671-80.

Bunai, K., Ariga, M., Inoue, T., Nozaki, M., Ogane, S., Kakeshita, H., Nemoto, T., Nakanishi, H., Yamane, K. 2004. Profiling and comprehensive expression analysis of ABC transporter solute-binding proteins of Bacillus subtilis membrane based on a proteomic approach. Electrophoresis. 25, 141-155.

Burbulys D, Trach KA, Hoch JA. 1991. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64, 545-52.

Cao M, Helmann JD. 2002. Regulation of the Bacillus subtilis bcrC bacitracin resistance gene by two extracytoplasmic function sigma factors. J Bacteriol 184, 6123-9.

Cao M, Kobel PA, Morshedi MM, Wu MF, Paddon C, Helmann JD. 2002a. Defining the Bacillus subtilis sigma(W) regulon: a comparative analysis of promoter consensus search, run-off transcription/macroarray analysis (ROMA), and transcriptional profiling approaches. J Mol Biol 316, 443-57.

Cao M, Moore CM, Helmann JD. 2005. Bacillus subtilis paraquat resistance is directed by sigmaM, an extracytoplasmic function sigma factor, and is conferred by YqjL and BcrC. J Bacteriol 187, 2948-56.

Cao M, Wang T, Ye R, Helmann JD. 2002b. Antibiotics that inhibit cell wall biosynthesis induce expression of the Bacillus subtilis sigma (W) and sigma(M) regulons. Mol Microbiol 45, 1267-76. 234

Cashel M, Gentry DR, Hernandez VJ, and Vinella D. 1996. The stringent respons. In FC Neidhardt, R. Curtiss III, JL. Ingraham, ECC. Lin, KB. Low, B. Magasanik, WS. Reznikoff, M. Riley, M. Schaechter and HE. Umbarger (eds). Escherichia coli and Salmonella: cellular and molecular biology. ASM Press,Washington DC, 1458-1496.

Chatterji D, Ojha AK. 2001. Revisiting the stringent response, ppGpp and starvation signaling. Curr Opin Microbiol 4, 160-165.

Chaudhry GR, and Chapalamadugu S. 1991. Biodegradation of halogeneated organic compounds. Microbiological Reviews 55, 59-79.

Chauvaux S, Paulsen IT, Saier MH Jr. 1998. CcpB, a novel transcription factor implicated in catabolite repression in Bacillus subtilis. J Bacteriol 180, 491-7.

Cho YS, Park SH, Kim CK and Oh KH. 2000. Induction of stress shock proteins DnaK and GroEL by phenoxyherbicide 2,4-D in Burkholderia sp. YK-2 isolated from rice field. Curr Microbiol 41, 33-38.

Choe LH, Lee KH. 2003. Quantitative and quanlitative measure of intralaboratory two- dimensional protein gel reproducibility and the effects of sample preparation, sample load, and image analysis. Electrophoresis 24, 3500-3507.

Choi SK, Saier MH Jr. 2005. Regulation of sigL expression by the catabolite control protein CcpA involves a roadblock mechanism in Bacillus subtilis: potential connection between carbon and nitrogen metabolism. J Bacteriol 187, 6856-61.

Commichau FM, Forchhammer K, Stülke J. 2006. Regulatory links between carbon and nitrogen metabolism. Curr Opin Microbiol 9, 167-72. Epub 2006 Feb 2.

Dartois V, Débarbouillé M, Kunst F, Rapoport G. 1998. Characterization of a novel member of the DegS-DegU regulon affected by salt stress in Bacillus subtilis. J Bacteriol 180, 1855- 61.

Dean DR, Aronson AI. 1980. Selection of Bacillus subtilis mutants impaired in ammonia assimilation. J Bacteriol 141, 985-8.

Débarbouillé M, Gardan R, Arnaud M, Rapoport G. 1999. Role of bkdR, a transcriptional activator of the sigL-dependent isoleucine and valine degradation pathway in Bacillus subtilis. J Bacteriol 181, 2059-66

Demple B, Halbrook J. 1983. Inducible repair of oxidative DNA damage in Escherichia coli. Nature 304, 466-8.

Deneke, SM. 2000. Thiol-based antioxidants. Curr. Top. Cell Regul 36, 151-180. 235

Deuerling, E., B. Paeslack, and W. Schumann. 1995. The ftsH gene of Bacillus subtilis is transiently induced after osmotic and temperature upshift. J. Bacteriol 177, 4105–4112.

Deutscher J, Galinier A, and Martin-Verstraete I. 2002. Carbohydrate uptake and metabolism. In Sonenshein AL, Hoch JA and Losick R (eds). Bacillus subtilis and Its Closest Relatives: From Genes to Cells. Washington, DC: American Society for Microbiology Press, 129– 150.

Diaz E. 2004. Bacterial degradation of aromatic pollutants: a paradigm of metabolic versatility. Int Microbiol. 7, 173-80. Review.

Dong FM, Wang LL, Wang CM, Cheng JP, He ZQ, Sheng ZJ, and Shen RQ. 1992. Molecular cloning and mapping of phenol degradation genes from Bacillus stearothermophilus FDTP-3 and their expression in Escherichia coli. Appl Environ Microbiol 58, 2531- 2535.

Duffner FM, Kirchner U, Bauer MP and Muller R. 2000. Phenol/ cresol degradation by the thermophilic Bacillus thermoglucosidasius A7: cloning and sequence analysis of five genes involved in the pathway. Gene 256, 215-221.

Duffner FM, Muller R. 1998. A novel phenol hydroxylase and catechol 2,3- dioxygenase from the thermophilic Bacillus thermoleovorans strain A2: nucleotide sequence and analysis of the genes. FEMS Microbiol Lett 161, 37-45.

Dufour A, Haldenwang WG. 1994. Interactions between a Bacillus subtilis anti-sigma factor (RsbW) and its antagonist (RsbV). J Bacteriol 176, 1813-20.

DuTeau NM, Rogers JD, Bartholomay CT, Reardon KF. 1998. Species-specific oligonucleotides for enumeration of Pseudomonas putida F1, Burkholderia sp. strain JS150, and Bacillus subtilis ATCC 7003 in biodegradation experiments. Appl Environ Microbiol 64, 4994-4999.

Eaton RW. 1997. p-Cymene catabolic pathway in Pseudomonas putida F1: cloning and characterization of DNA encoding conversion of p-cymene to p-cumate. J Bacteriol 179, 3171-80.

Eichenberger P, Jensen ST, Conlon EM, van Ooij C, Silvaggi J, Gonzalez-Pastor JE, Fujita M, Ben-Yehuda S, Stragier P, Liu JS, Losick R. 2003. The sigmaE regulon and the identification of additional sporulation genes in Bacillus subtilis. J Mol Biol 327, 945-72.

Eltis LD, and Bolin JT. 1996. Evolutionary relationships among extradiol dioxygenases. J. Bacteriol 178, 5930-5937. 236

Even S, Burguiere P, Auger S, Soutourina O, Danchin A, and Martin-Verstraete I. 2006. Global control of cysteine metabolism by CymR in Bacillus subtilis. J Bacteriol 188, 2184- 2197.

Evers S, Di Padova K, Meyer M, Langen H, Fountoulakis M, Keck W, Gray CP. 2001. Mechanism-related changes in the gene transcription and protein synthesis patterns of Haemophilus influenzae after treatment with transcriptional and translational inhibitors. Proteomics 1, 522-44.

Eymann C, Homuth G, Scharf C, and Hecker M. 2002. Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. J Bacteriol 184, 2500-2520.

Eymann C, Mach H, Harwood CR, Hecker M. 1996. Phosphate-starvation-inducible proteins in Bacillus subtilis: a two-dimensional gel electrophoresis study. Microbiology 142, 3163-70.

Fawcett P, Eichenberger P, Losick R, Youngman P. 2000. The transcriptional profile of early to middle sporulation in Bacillus subtilis. Proc Natl Acad Sci U S A 97, 8063-8.

Fernandez S, Ayora S, Alonso JC. 2000. Bacillus subtilis homologous recombination: genes and products. Res Microbiol 151, 481-6. Review.

Ferrari E, Jarnagin AS, and Schmidt BF. 1993. Commercial production of extracellular enzymes. In: Sonendhein AL, Hoch JA, Losick R (eds) Bacillus subtilis and other Gram- positive bacteria: biochemistry, physiology and molecular genetics, 917-937.

Ferson AE, Wray LV Jr, Fisher SH. 1996. Expression of the Bacillus subtilis gabP gene is regulated independently in response to nitrogen and amino acid availability. Mol Microbiol 22, 693-701.

Feucht A, Evans L, Errington J. 2003. Identification of sporulation genes by genome-wide analysis of the sigmaE regulon of Bacillus subtilis. Microbiology 149, 3023-34.

Fisher SH, Débarbouillé M. 2002. Nitrogen source utilization and its regulation. In In Sonenshein AL, Hoch JA, Losick, 181-191.

Fisher SH, Sonenshein AL. 1991. Control of carbon and nitrogen metabolism in Bacillus subtilis. Annu Rev Microbiol 45, 107-135.

Fisher SH, Wray LV Jr. 2002. Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase. J Bacteriol 184, 2148-54.

Fisher SH. 1999. Regulation of nitrogen metabolism in Bacillus subtilis: vive la difference! Mol Microbiol 32, 223-32. Review. 237

Folio P, Chavant P, Chafsey I, Belkorchia A, Chambon C, Hebraud M. 2004. Two- dimensional electrophoresis database of Listeria monocytogenes EGDe proteome and proteomic analysis of mid-log and stationary growth phase cells. Proteomics 4, 3187-201.

Fuangthong M, Atichartpongkul S, Mongkolsuk S, Helmann JD. 2001. OhrR is a repressor of ohrA, a key organic hydroperoxide resistance determinant in Bacillus subtilis. J Bacteriol 183, 4134-41.

Gaidenko TA and Price CW. 1998. General stress transcription factor sigmaB and sporulation transcription factor sigmaH each contribute to survival of Bacillus subtilis under extreme growth conditions. J Bacteriol 180, 3730-3.

Galinski, E. A., and H. G. Trüper. 1994. Microbial behaviour in salt-stressed ecosystems. FEMS Microbiol. Rev 15, 95–108.

Gardan R, Rapoport G, Débarbouillé M. 1997. Role of the transcriptional activator RocR in the arginine-degradation pathway of Bacillus subtilis. Mol Microbiol 24, 825-37.

Geng H, Nakano S, Nakano MM. 2004. Transcriptional activation by Bacillus subtilis ResD: tandem binding to target elements and phosphorylation-dependent and -independent transcriptional activation. J Bacteriol 186, 2028-37.

Gerth U, Kirstein J, Mostertz J, Waldminghaus T, Miethke M, Kock H, Hecker M. 2004. Fine- tuning in regulation of Clp protein content in Bacillus subtilis. J Bacteriol 186, 179-91.

Gerth U, Kruger E, Derre I, Msadek T, Hecker M. 1998. Stress induction of the Bacillus subtilis clpP gene encoding a homologue of the proteolytic component of the Clp protease and the involvement of ClpP and ClpX in stress tolerance. Mol Microbiol 28, 787-802.

Gibson J, S Harwood C. 2002. Metabolic diversity in aromatic compound utilization by anaerobic microbes. Annu Rev Microbiol 56, 345-69. Review.

Giuffrida G, Pessione E, Mazzoli R, Dellavalle G, Barrello C, Conti A and Giunta C. 2001. Media containing aromatic compounds induce peculiar proteins in Acinetobacter radioresistens, as revealed by proteome analysis. Electrophoresis 22, 1705-1711.

Gohar M, Gilois N, Graveline R, Garreau C, Sanchis V, Lereclus D. 2005. A comparative study of Bacillus cereus, Bacillus thuringiensis and Bacillus anthracis extracellular proteomes. Proteomics 5, 3696-711.

Gollnick P, Babitzke P, Antson A, Yanofsky C. 2005. Complexity in regulation of tryptophan biosynthesis in Bacillus subtilis. Annu Rev Genet 39, 47-68. Review.

Gollnick P, Babitzke P, Merino E and Yanofsky C. 2002. Aromatic amino acid metabolism in Bacillus subtilis. In Sonenshein AL, Hoch JA, Losick R. Bacillus subtilis and its closest relatives: from genes to cells (eds). ASM Press Washington, DC. 233-244. 238

Griffin TJ, Gygi SP, Rist B, Aebersold R, Loboda A, Jilkine A, Ens W, Standing KG 2001. Quantitative proteomic analysis using a MALDI quadrupole time-of-flight mass spectrometer. Anal Chem 73, 978-986.

Grundy FJ, Henkin TM. 1998. The S box regulon: a new global transcription termination control system for methionine and cysteine biosynthesis genes in gram-positive bacteria. Mol Microbiol 30, 737-49.

Guedon E, Renault P, Ehrlich SD, Delorme C. 2001a. Transcriptional pattern of genes coding for the proteolytic system of Lactococcus lactis and evidence for coordinated regulation of key enzymes by peptide supply. J Bacteriol. 183, 3614-22.

Guedon E, Serror P, Ehrlich SD, Renault P, Delorme C. 2001b. Pleiotropic transcriptional repressor CodY senses the intracellular pool of branched-chain amino acids in Lactococcus lactis. Mol Microbiol 40, 1227-39.

Gygi SP, Rist B, Griffin TJ, Eng J, Aebersold R. 2002. Proteome analysis of low-abundance proteins using multidimensional chromatography and isotope-coded affinity tags. J Proteome Res 1, 47-54.

Hallsworth JE, Heim S, Timmis KN. 2003. Chaotropic solutes cause water stress in Pseudomonas putida. Environ Microbiol 5, 1270-80.

Harayama S, Kok M and Neidle EL. 1992. Functional and evolutionary relationships among diverse oxygenases. Annu. Rev. Microbiol 46, 565-601.

Hecker M, Völker U. 1990. General stress proteins in Bacillus subtilis. FEMS Microbiol Ecol 74, 197-213.

Hecker M, Schumann W and Völker U. 1996. Heat-shock and general stress response in Bacillus subtilis. Molecular Microbiology 19, 417-428.

Hecker M, Völker U. 1998. Non-specific, general, and multiplestress resistance of growth- restricted Bacillus subtilis cellsby the expression of the sigmaB regulon. Mol Microbiol 29, 1129–1136.

Hecker M, Völker U. 2001. General stress response of Bacillus subtilis and other bacteria. Adv Microb Physiol 44, 35-91. Review.

Hecker M, Völker U. 2004. Towards a comprehensive understanding of Bacillus subtilis cell physiology by physiological proteomics. Proteomics 4, 3727-50.

Hecker M. 2003. A proteomic view of cell physiology of Bacillus subtilis--bringing the genome sequence to life. Adv Biochem Eng Biotechnol 83, 57-92. 239

Heipieper HJ, Keweloh H, and Rehm HJ. 1991. Influence of phenols on growth and membrane permeability of free and immobilized Escherichia coli. Applied and Environmental Microbiology 57, 1213-1217.

Helmann JD, Wu MF, Gaballa A, Kobel PA, Morshedi MM, Fawcett P, Paddon C. 2003. The global transcriptional response of Bacillus subtilis to peroxide stress is coordinated by three transcription factors. J Bacteriol 185, 243-53.

Henkin TM. 1996. The role of CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis. FEMS Microbiol Lett 135, 9-15. Review.

Henner D and Yanofsky C. 1993. Biosynthesis of aromatic amino acids. In Sonenshein AL, Hoch JA, and Losick R. Editor. Bacillus subtilis and other Gram-positive bacteria: Biochemistry, Physiology and Molecular Genetics. AmericanSociety for Microbiology, Washington, D.C, 269-280.

Herbig AF, Helmann JD. 2001. Roles of metal ions and hydrogen peroxide in modulating the interaction of the Bacillus subtilis PerR peroxide regulon repressor with operator DNA. Mol Microbiol 41, 849-59.

Hindle Z, Smith CP. 1994. Substrate induction and catabolite repression of the Streptomyces coelicolor glycerol operon are mediated through the GylR protein. Mol Microbiol 12, 737-45.

Ho EM, Chang HW, Kim SI, Kahng HY, and Oh KH. 2004. Analysis of TNT(2,4,6- trinitrotoluene)-inducible cellular responses and stress shock proteome in Stenotrophomonas sp. OK-5. Curr Microbiol 49, 346-52.

Hoch JA. 1993. The phosphorelay signal transduction pathway in the initiation of Bacillus subtilis sporulation. J Cell Biochem 51, 55-61.

Hochgräfe F, Mostertz J, Albrecht D, Hecker M. 2005. Fluorescence thiol modification assay: oxidatively modified proteins in Bacillus subtilis. Mol Microbiol 58, 409-25.

Hoffmann T, Schutz A, Brosius M, Völker A, Völker U, Bremer E. 2002. High-salinity-induced iron limitation in Bacillus subtilis. J Bacteriol 184, 718-27.

Höper D, Bernhardt J and Hecker M. 2006. Salt stress adaptation of Bacillus subtilis: A physiological proteomics approach. Proteomics 6, 1550-1562.

Höper D, Völker U, Hecker M. 2005. Comprehensive characterization of the contribution of individual SigB-dependent general stress genes to stress resistance of Bacillus subtilis. J Bacteriol 187, 2810-26.

Hu P, Leighton T, Ishkhanova G, Kustu S. 1999. Sensing of nitrogen limitation by Bacillus subtilis: comparison to enteric bacteria. J Bacteriol 181, 5042-50. 240

Hulett FM, Bookstein C, Jensen K. 1990. Evidence for two structural genes for alkaline phosphatase in Bacillus subtilis. J Bacteriol 172, 735-40.

Hulett FM. 1996. The signal-transduction network for Pho regulation in Bacillus subtilis. Mol Microbiol 19, 933-9. Review.

Hulett FM. 2002. The Pho regulon. In Sonenshein AL, Hoch JA, Losick R (eds) Bacillus subtilis and its closest relatives: from genes to cells. ASM Press Washington DC, 193-201.

Imlay JA, Chin SM, Linn S. 1988. Toxic DNA damage by hydrogen peroxide through the Fenton reaction in vivo and in vitro. Science 240, 640-2.

Imlay JA. 2003. Pathways of oxidative damage. Annu Rev Microbiol 57, 395-418. Review.

Imlay JA. 2006. Iron-sulphur clusters and the problem with oxygen. Mol Microbiol 59, 1073- 1082.

Jongbloed JD, Antelmann H, Hecker M, Nijland R, Bron S, Airaksinen U, Pries F, Quax WJ, van Dijl JM, Braun PG. 2002. Selective contribution of the twin-arginine translocation pathway to protein secretion in Bacillus subtilis. J Biol Chem 277, 44068-78.

Jongbloed JD, Martin U, Antelmann H, Hecker M, Tjalsma H, Venema G, Bron S, van Dijl JM, Muller J. 2000. TatC is a specificity determinant for protein secretion via the twin-arginine translocation pathway. J Biol Chem 275, 41350-7.

Jourlin-Castelli C, Mani N, Nakano MM, Sonenshein AL. 2000. CcpC, a novel regulator of the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J Mol Biol 295, 865-78.

Kang CM, Vijay K, Price CW. 1998. Serine kinase activity of a Bacillus subtilis switch protein is required to transduce environmental stress signals but not to activate its target PP2C phosphatase. Mol Microbiol 30, 189-96.

Kappes RM, Kempf B, and Bremer B. 1996. Three transport systems for the osmoprotectant glycine betaine operate in Bacillus subtilis: characterization of OpuD. J. Bacteriol 178, 5071– 5079.

Kappes RM, Kempf B, Kneip S, Boch J, Gade J, Meier-Wagner J, and Bremer E. 1999. Two evolutionarily closely related ABC-transporters mediate the uptake of choline for synthesis of the osmoprotectant glycine betaine in Bacillus subtilis. Mol. Microbiol 32, 203–216.

Kempf B and Bremer E. 1995. OpuA, an osmotically regulated binding protein-dependent transport system for the osmoprotectant glycine betaine in Bacillus subtilis. J. Biol. Chem 270, 16701–16713. 241

Kempf B and Bremer E. 1998. Uptake and synthesis of compatible solutes as microbial stress responses to high osmolality environments. Arch. Microbiol 170, 319–330.

Kim EA, Kim JY, Kim SJ, Park KR, Chung HJ, Leem SH, Kim SI. 2004. Proteomic analysis of Acinetobacter lwoffii K24 by 2-D gel electrophoresis and electrospray ionization quadrupole- time of flight mass spectrometry. J. Microbiol Methods 57, 337-49.

Kim HJ, Jourlin-Castelli C, Kim SI, Sonenshein AL. 2002a. Regulation of the Bacillus subtilis ccpC gene by ccpA and ccpC. Mol Microbiol 43, -410.

Kim HJ, Roux A, Sonenshein AL. 2002b. Direct and indirect roles of CcpA in regulation of Bacillus subtilis Krebs cycle genes. Mol Microbiol 45, 179-90.

Kim IC and Oriel PJ. 1995. Characterization of the Bacillus stearothermophilus BR219 phenol hydroxylase gene. Appl Environ Microbiol 61, 1252-1256.

Kim YI, Burton RE, Burton BM, Sauer RT, Baker TA. 2000. Dynamics of substrate denaturation and translocation by the ClpXP degradation machine. Mol Cell 5, 639-48.

Klose J. 1975. Protein mapping by combined isoelectric focusing and electrophoresis of mouse tissues. A novel approach to testing for induced point mutations in mammals. Humangenetik 26, 231-43.

Kobayashi K, Ogura M, Yamaguchi H, Yoshida K, Ogasawara N, Tanaka T, Fujita Y. 2001. Comprehensive DNA microarray analysis of Bacillus subtilis two-component regulatory systems. J Bacteriol 183, 7365-70.

Koburger T, Weibezahn J, Bernhardt J, Homuth G, Hecker M. 2005. Genome-wide mRNA profiling in glucose starved Bacillus subtilis cells. Mol Genet Genomics 274, 1-12.

Kock H, Gerth U, Hecker M. 2004. The ClpP peptidase is the major determinant of bulk protein turnover in Bacillus subtilis. J Bacteriol 186, 5856-64.

Kruger E, Witt E, Ohlmeier S, Hanschke R, Hecker M. 2000. The clp proteases of Bacillus subtilis are directly involved in degradation of misfolded proteins. J Bacteriol 182, 3259-65.

Kunst F and Rapoport G. 1995. Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis. J. Bacteriol 177, 2403–2407.

Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V, Bertero MG, Bessieres P, Bolotin A, Borchert S, Borriss R, Boursier L, Brans A, Braun M, Brignell SC, Bron S, Brouillet S, Bruschi CV, Caldwell B, Capuano V, Carter NM, Choi SK, Codani JJ, Connerton IF, Danchin A, et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249-256. 242

Lazazzera BA, Kurtser IG, McQuade RS, Grossman AD. 1999. An autoregulatory circuit affecting peptide signaling in Bacillus subtilis. J Bacteriol 181, 5193-200.

Lee H, Griffin TJ, Gygi SP, Rist B, Aebersold R. 2002. Development of a multiplexed microcapillary liquid chromatography system for high-throughput proteome analysis. Anal Chem 74, 4353-4360.

Lee KJ, Bae SM, Lee MR, Yeon SM, Lee YH, Kim KS. 2006. Proteomic analysis of growth phase-dependent proteins of Streptococcus pneumoniae. Proteomics 6, 1274-82.

Leichert LIO, Scharf C, and Hecker M. 2003. Global characterization of disulfide stress in Bacillus subtilis. J Bacteriol 185, 1967-1975.

Levdikov VM, Blagova E, Joseph P, Sonenshein AL, Wilkinson AJ. 2006. The Structure of CodY, a GTP- and Isoleucine-responsive Regulator of Stationary Phase and Virulence in Gram-positive Bacteria. J Biol Chem 281, 11366-73.

Link AJ, Eng J, Schieltz DM, Carmack E, Mize GJ, Morris DR, Garvik BM, Yates JR III. 1999. Direct analysis of protein complexes using mass spectrometry. Nat Biotechnol 17, 676-82.

Liu J., and Zuber P. 2000. The ClpX protein of Bacillus subtilis indirectly influences RNA polymerase holoenzyme composition and directly stimulates H-dependent transcription. Mol. Microbiol 37, 885-897.

Liu W, Eder S, Hulett FM.. 1998. Analysis of Bacillus subtilis tagAB and tagDEF expression during phosphate starvation identifies a repressor role for PhoP-P. J Bac 180, 753-8.

Liu W, Hulett FM. 1998. Comparison of PhoP binding to the tuaA promoter with PhoP binding to other Pho-regulon promoters establishes a Bacillus subtilis Pho core binding site. Microbiology 144, 1443-50.

Lopez CS, Heras H, Garda H, Ruzal S, Sanchez-Rivas C, Rivas E. 2000. Biochemical and biophysical studies of Bacillus subtilis envelopes under hyperosmotic stress. Int J Food Microbiol 55, 137-42.

Lopez CS, Heras H, Ruzal SM, Sanchez-Rivas C, Rivas EA. 1998. Variations of the envelope composition of Bacillus subtilis during growth in hyperosmotic medium. Curr Microbiol 36, 55-61.

Lopez JM, Dromerick A, Freese E. 1981. Response of guanosine 5'-triphosphate concentration to nutritional changes and its significance for Bacillus subtilis sporulation. J Bacteriol 146, 605-13.

Luhn S, Berth M, Hecker M, Bernhardt J. 2003. Using standard positions and image fusion to create proteome maps from collections of two-dimensional gel electrophoresis images. Proteomics 3, 1117-27. 243

Lupi CG, Colangelo T, and Mason CA. 1995. Two-dimensional gel electrophoresis of the response of Pseudomonas putida KT2442 to 2-chlorophenol. Appl. Environ Microbiol 61, 2863-2872.

Maloy SR, Nunn WD. 1982. Genetic regulation of the glyoxylate shunt in Escherichia coli K- 12. J Bacteriol 149, 173-80.

Martinez A, Kolter R. 1997. Protection of DNA during oxidative stress by the nonspecific DNA-binding protein Dps. J Bacteriol 179, 5188-94.

Mascher T, Zimmer SL, Smith TA, Helmann JD. 2004. Antibiotic-inducible promoter regulated by the cell envelope stress-sensing two-component system LiaRS of Bacillus subtilis. Antimicrob Agents Chemother 48, 2888-96.

McDaniel BA, Grundy FJ, Artsimovitch I, Henkin TM. 2003. Transcription termination control of the S box system: direct measurement of S-adenosylmethionine by the leader RNA. Proc Natl Acad Sci U S A 100, 3083-8.

Mendez MB, Orsaria LM, Philippe V, Pedrido ME, Grau RR. 2004. Novel roles of the master transcription factors Spo0A and sigmaB for survival and sporulation of Bacillus subtilis at low growth temperature. J. Bacteriol 186, 989-1000.

Michaud S, Marin R, Tanguay RM. 1997. Regulation of heat shock gene induction and expression during Drosophila development. Cell Mol Life Sci 53, 104-13.

Milo RE, Duffner FM, Muller R. 1999. Catechol 2,3-dioxygenase from the thermophilic, phenol-degrading Bacillus thermoleovorans strain A2 has unexpected low thermal stability. Extremophiles 3, 185-190.

Miyauchi K, Adachi Y, Nagata Y, Takagi M. 1999. Cloning and sequencing of a novel meta- cleavage dioxygenase gene whose product is involved in degradation of gamma- hexachlorocyclohexane in Sphingomonas paucimobilis. J Bacteriol 181, 6712-9.

Mogk A, Homuth G, Scholz C, Kim L, Schmid FX, Schumann W. 1997. The groE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis. EMBO J 16, 4579-90.

Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL. 2003. Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. J Bacteriol 185, 1911-22.

Mongkolsuk S, Praituan W, Loprasert S, Fuangthong M, Chamnongpol S. 1998. Identification and characterization of a new organic hydroperoxide resistance (ohr) gene with a novel pattern of oxidative stress regulation from Xanthomonas campestris pv. Phaseoli. J Bacteriol 180, 2636-43. 244

Morano KA, Liu PC, Thiele DJ. 1998 Protein chaperones and the heat shock response in Saccharomyces cerevisiae. Curr Opin Microbiol, 1, 197-203.

Mostertz J, Scharf C, Hecker M, Homuth G. 2004. Transcriptome and proteome analysis of Bacillus subtilis gene expression in response to superoxide and peroxide stress. Microbiology 150, 497-512.

Msadek T, Dartois V, Kunst F, Herbaud ML, Denizot F, Rapoport G. 1998. ClpP of Bacillus subtilis is required for competence development, motility, degradative enzyme synthesis, growth at high temperature and sporulation. Mol Microbiol 27, 899-914.

Nakano MM, Hoffmann T, Zhu Y, Jahn D. 1998. Nitrogen and oxygen regulation of Bacillus subtilis nasDEF encoding NADH-dependent nitrite reductase by TnrA and ResDE. J Bacteriol 180, 5344-50.

Nakano MM, Yang F, Hardin P, Zuber P. 1995. Nitrogen regulation of nasA and the nasB operon, which encode genes required for nitrate assimilation in Bacillus subtilis. J Bacteriol 177, 573-9.

Nakano MM, Zhu Y, Liu J, Reyes DY, Yoshikawa H and Zuber P. 2000. Mutations conferring amino acid residue substitutions in the carboxy-terminal domain of RNA polymerase alpha can suppress clpX and clpP with respect to developmentally regulated transcription in Bacillus subtilis. Mol. Microbiol 37, 869-884.

Nakano MM, Zhu Y. 2001. Involvement of ResE phosphatase activity in down-regulation of ResD-controlled genes in Bacillus subtilis during aerobic growth. J Bacteriol 183, 1938-44.

Nakano S, Erwin KN, Ralle M, Zuber P. 2005. Redox-sensitive transcriptional control by a thiol/disulphide switch in the global regulator, Spx. Mol Microbiol 55, 498-510.

Nakano S, Kuster-Schock E, Grossman AD, and Zuber P. 2003. Spx-dependent global transcriptional control is induced by thiol-specific oxidative stress in Bacillus subtilis. PNAS 100, 13603-608.

Neidhardt FC, VanBogelen RA. 2000. Proteomic analysis of bacterial stress response. In : Storz G, Hengge-Aronis R (eds) Bacterial stress responses. ASM Press, Washington DC, 445-452.

Nishimura T, Kometani T, Takii H, Terada Y, and Okada S. 1994a. Purification and some properties of α-amylase from Bacillus subtilis X-23 that glucosylates phenolic compounds such as hydroquinone. J Ferment Bioeng 78, 31–36.

Nishimura T, Kometani T, Takii H, Terada Y, and Okada S. 1994b. Acceptor specificity in the glucosylation reaction of Bacillus subtilis X-23 -amylase towards various phenolic compounds and the structure of kojic acid glucoside. J Ferment Bioeng 78, 37–41. 245

O’Farrell PH. 1975. High resolution two-dimentional electrophoresis of proteins. J Biol Chem 250, 4007-21.

Ollinger J, Song K, Antelmann H, Hecker M, Helmann JD. 2006. Role of the Fur regulon in iron transport in Bacillus subtilis. J Bacteriol 188, in press.

Park SH, Ko YJ, Kini CK. 2001. Toxic effects of catechol and 4-chlorobenzoate stresses on bacterial cells. Journal of Microbiology 39, 206-212.

Pereira MRG, Oliveira ES, Aragao de Villar FAG, Grangeiro MS, Fonseca J, Silva AR, Costa MFD, Costa SL, El-Bacha RS. 2004. Cytotoxicity of catehcol toward human glioblastoma cells via superoxide and reactive quinones generation. J Bras Patol Med Lab 40, 280-5.

Petersohn A, Brigulla M, Haas S, Hoheisel JD, Völker U and Hecker M. 2001. Global analysis of the general stress response of Bacillus subtilis. J Bacteriol 183, 5617-5631.

Pietiainen M, Gardemeister M, Mecklin M, Leskela S, Sarvas M, Kontinen VP. 2005. Cationic antimicrobial peptides elicit a complex stress response in Bacillus subtilis that involves ECF- type sigma factors and two-component signal transduction systems. Microbiology 151, 1577- 92.

Pomposiello PJ, Demple B. 2001. Redox-operated genetic switches: the SoxR and OxyR transcription factors. Trends Biotechnol 19, 109-14. Review.

Pooley HM, Abellan FX, and Karamata. 1992. CDP-glycerol:poly(glycerophosphate) glycerophospho- transferase, which is involved in the synthesis of the major wall teichoic acid in Bacillus subtilis 168, is encoded by tagF (rodC). J. Bacteriol, 174. 646-649.

Pragai Z, Harwood CR. 2002. Regulatory interactions between the Pho and sigma(B)- dependent general stress regulons of Bacillus subtilis. Microbiology 48, 1593-602.

Predich M, Nair G, Smith I. 1992. Bacillus subtilis early sporulation genes kinA, spo0F, and spo0A are transcribed by the RNA polymerase containing sigma H. J Bacteriol 174, 2771-8.

Price CW, Fawcett P, Ceremonie H, Su N, Murphy CK, Youngman P. 2001. Genome-wide analysis of the general stress response in Bacillus subtilis. Mol Microbiol 41, 757-74.

Price CW. 2002. General stress response. In Sonenshein AL, Hoch JA, Losick R (eds) Bacillus subtilis and its closest relatives: from genes to cells. ASM Press Washington DC. 369-384.

Pummi T, Leskela S, Wahlstrom E, Gerth U, Tjalsma H, Hecker M, Sarvas M, Kontinen VP. 2002. ClpXP protease regulates the signal peptide cleavage of secretory preproteins in Bacillus subtilis with a mechanism distinct from that of the Ecs ABC transporter. J Bacteriol 184, 1010-8. 246

Ratnayake-Lecamwasam M, Serror P, Wong KW, Sonenshein AL. 2001. Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes Dev 15, 1093- 103.

Requena JR, Chao CC, Levine RL, Stadtman ER. 2001. Glutamic and aminoadipic semialdehydes are the main carbonyl products of metal-catalyzed oxidation of proteins. Proc Natl Acad Sci U S A 98, 69-74.

Resnekov O, Driks A, Losick R. 1995. Identification and characterization of sporulation gene spoVS from Bacillus subtilis. J Bacteriol 177, 5628-35.

Rieger PG, Meier HM, Gerle M, Vogt U, Groth T, Knackmuss HJ. 2002. Xenobiotics in the environment: present and future strategies to obviate the problem of biological persistence. J Biotechnol 94, 101-123.

Righetti PG, Castagna A, Herbert B, Candiano G. 2005. How to bring the “unseen” proteome to the limelight via electrophoretic pre-fractionation techniques. Biosci Rep 25, 3-17.

Robichon D, Arnaud M, Gardan R, Pragai Z, O'Reilly M, Rapoport G, Débarbouillé M. 2000. Expression of a new operon from Bacillus subtilis, ykzB-ykoL, under the control of the TnrA and PhoP-phoR global regulators. J Bacteriol 182, 1226-31.

Rotanova TV, Melnikov EE, Khalatova AG, Makhovskaya OV, Botos I, Wlodawer A, Gustchina A. 2004. Classification of ATP-dependent proteases Lon and comparison of the active sites of their proteolytic domains. Eur J Biochem 271, 4865-71.

Santos PM, Benndorf D, Sa-Correia I. 2004. Insights into Pseudomonas putida KT2440 response to phenol-induced stress by quantitative proteomics. Proteomics 4, 2640-52.

Sarsero JP, Merino E, Yanofsky C. 2000. A Bacillus subtilis operon containing genes of unknown function senses tRNATrp charging and regulates expressionof the gene of tryptophan biosynthesis. Proc. Natl. Acad. Sci USA 97, 2656-61.

Scharf C, Riethdorf S, Ernst H, Engelmann S, Völker U, Hecker M. 1998. Thioredoxin is an essential protein induced by multiple stresses in Bacillus subtilis. J Bacteriol 180, 1869-77.

Scharff TG, and Perry AC. 1976. The effects of salicyclic acid on metabolism and potassium ion content in yeast. Proc. Soc Exp Biol Med 151, 72-7.

Schreier HJ, Brown SW, Hirschi KD, Nomellini JF, Sonenshein AL. 1989. Regulation of Bacillus subtilis glutamine synthetase gene expression by the product of the glnR gene. Mol Biol 210, 51-63. 247

Schultz AC, Nygaard P, Saxild HH. 2001. Functional analysis of 14 genes that constitute the purine catabolic pathway in Bacillus subtilis and evidence for a novel regulon controlled by the PucR transcription activator. J Bacteriol 183, 3293-302.

Schulz A, Schumann W.1996. hrcA, the first gene of Bacillus subtilis dnaK operon encodes a negative regulator of class I heat shock genes. Journal of Bacteriology 178, 1088-93.

Schumann W, Hecker M, and Msadek T. 2002. Regulation and function of heat-inducible genes in Bacillus subtilis. In: Sonenshein AL, Hoch JA, Losick R (eds) Bacillus subtilis and closest relatives: from genes to cells. ASM Press Washington DC, 359-368.

Schumann W. 2003. The Bacillus subtilis heat shock stimulon. Cell stress and Chaperones 8, 207-217. Review.

Segura A, Godoy P, van Dillewijn P, Hurtado A, Arroyo N, Santacruz S, Ramos JL. 2005. Proteomic analysis reveals the participation of energy- and stress-related proteins in the response of Pseudomonas putida DOT-T1E to toluene. J Bacteriol 187, 5937-45.

Senior E, Bull AT, Slater JH. 1976. Enzyme evolution in a microbial community growing on the herbicide Dalapon. Nature 263, 476-9.

Serrano M, Hovel S, Moran CP Jr, Henriques AO, Völker U. 2001. Forespore-specific transcription of the lonB gene during sporulation in Bacillus subtilis. J Bacteriol 183, 2995- 3003.

Serror P, Sonenshein AL. 1996. CodY is required for nutritional repression of Bacillus subtilis genetic competence. J Bacteriol 178, 5910-5.

Servant P, Coq D and Aymeric S. 2005. CcpN (YqzB) a novel regulator for CcpA- independent catabolite repression of Bacillus subtilis gluconeogenic gene. Mol Mic 55, 1435- 51.

Shingler V 2003. Integrated regulation in response to aromatic compounds: from signal sensing to attractive behaviour. Environmental Microbiology 5, 1226-1241 .

Shingler V, Powlowski J, Marklund U. 1992. Nucleotide sequence and functional analysis of the complete phenol/3,4-dimethylphenol catabolic pathway of Pseudomonas sp. strain CF600. J Bacteriol 174, 711-24

Sikkema J, Bont JAM, and Poolman B. 1995. Mechanism of membrane toxicity of hydrocarbons. Microbiological Review 59, 201-222.

Silberbach M, Schafer M, Huser AT, Kalinowski J, Puhler A, Kramer R, Burkovski A. 2005. Addaptation of Corynebacterium glutamicum to ammonium limitation: a global analysis using transcriptome and proteome techniques. Appl Environ Microbiol 71, 2391-402. 248

Sonenshein AL. 1989. Metabolic regulation of sporulation and other stationary phase phenomena. In Smith I, Slepecky R, Setlow P (eds.): Regulation of prokaryotic development. ASM, Washington DC, 109-130.

Sonenshein AL. 2005. CodY, a global regulator of stationary phase and virulence in Gram- positive bacteria. Curr Opin Microbiol 8, 203-7. Review.

Stadtman ER and Levine RL. 2003. Free radical-mediated oxidation of free amino acids and amino acid residues in proteins. Amino Acids 25, 207–218.

Steil L, Hoffmann T, Budde I, Völker U, Bremer E. 2003. Genome-wide transcriptional profiling analysis of adaptation of Bacillus subtilis to high salinity. J Bacteriol 185, 6358-70.

Storz G and Zheng M. 2000. In Storz G and Hengge-Aronis (eds) Bacterial stress response. ASM Press, Washington DC. 47-59.

Stülke J and Hillen W. 2000. Regulation of carbon catabolism in Bacillus species. Annu Rev Microbiol 54, 849-880.

Timmis KN, SteffanRJ, and Unterman R. 1994. Designing microorganisms for the treatment of toxic wastes. Annu. Rev. Microbiol 48, 525-557.

Tjalsma H, Antelmann H, Jongbloed JD, Braun PG, Darmon E, Dorenbos R, Dubois JY, Westers H, Zanen G, Quax WJ, Kuipers OP, Bron S, Hecker M, van Dijl JM. 2004. Proteomics of protein secretion by Bacillus subtilis: separating the "secrets" of the secretome. Microbiol Mol Biol Rev 68, 207-33.

Tropel D and Roelof van der Meer J. 2004. Bacterial transcriptional regulators for degradation pathways of aromatic compounds. Microbiology and Molecular Biology Reviews 68, 474-500.

Tsirogianni I, Aivaliotis M, Karas M, Tsiotis G. 2004. Mass spectrometric mapping of the enzymes involved in the phenol degradation of an indigenous soil pseudomonad. Biochim Biophys Acta 1700, 117-23.

Uchiyama H, Shinohara Y, Tomioka N, and Kusakabe I. 1999. Induction and enhancement of stress proteins in a trichloroethylene-degrading methanotrophic bacterium, Methylocystis sp. M. FEMS Microbiol Lett 170, 25-130. van der Meer JR, de Vos WM, Harayama S and Zehnder AJB. 1992. Molecular mechanisms of genetic adaptation to xenobiotic compounds. Microbiol. Rev 56, 677-694.

VanBogelen RA 2003. Probing the molecular physiology of the microbial organism, Escherichia coli using proteomics. Adv Biochem Engin/Biotechnol 83, 27-55. 249

VanBogelen RA and Neidhardt FC. 1990. Ribosomes as sensors of heat and cold shock in Escherichia coli. Proc. Natl. Acad. Sci. USA 87,

VanBogelen RA, Schiller EE, Thomas JD, Neidherdt FC. 1999. Diagnosis of cellular state of microbial organisms using proteomics. Electrophoresis 20, 2149-2159.

VanBogelen RA, Olson ER, Wanner BL, and Neidhardt FC. 1996. Global analysis of protein synthesized during phosphorus restriction in Escherichia coli. Journal of Bacteriology 178, 4344-4366.

Velculescu VE, Zhang L, Zhou W, Vogelstein J, Basrai MA, Bassett Jr. DE, Hieter P, Vogelstein B, Kinzler KW. 1997. Characterization of the yeast transcriptome. Cell 88, 243- 251.

Vershinina OA and Znamenskaya LV. 2002. The Pho regulons of bacteria. Microbiology 71, 497-511.

Vijay K, Brody MS, Fredlund E, Price CW. 2000. A PP2C phosphatase containing a PAS domain is required to convey signals of energy stress to the sigmaB transcription factor of Bacillus subtilis. Mol Microbiol 35, 180-8.

Voigt B, Schweder T, Becher D, Ehrenreich A, Gottschalk G, Feesche J, Maurer KH, Hecker M. 2004. A proteomic view of cell physiology of Bacillus licheniformis. Proteomics 4, 1465- 90.

Voigt B, Schweder T, Sibbald MJ, Albrecht D, Ehrenreich A, Bernhardt J, Feesche J, Maurer KH, Gottschalk G, van Dijl JM, Hecker M. 2006. The extracellular proteome of Bacillus licheniformis grown in different media and under different nutrient starvation conditions. Proteomics 6, 1704-1705. von Blohn C, Kempf B, Kappes RM, Bremer E. 1997. Osmostress response in Bacillus subtilis: characterization of a proline uptake system (OpuE) regulated by high osmolarity and the alternative transcription factor sigma B. Mol Microbiol 25, 175-87.

Wandersman C, Delepelaire P. 2004. Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol 58, 611-47. Review.

Wendrich TM, and Marahiel MA. 1997. Cloning and characterization of the relA/spoT homoloue from Bacillus subtilis. Mol Microbiol 26, 65-79.

Wetzstein. M, Voelker. U, Dedio. J, Loenau. S, Zuber. U, Schiesswohl. M, Herget. C, Hecker. M, and Schumann. W. 1992. Cloning, sequencing and molecular analysis of the dnaK locus from Bacillus subtilis. Journal of Bacteriology 174, 3300-3310.

Whatmore AM, Chudek JA, and Reed RH. 1990. The effects of osmotic upshock on the intracellular solute pools of Bacillus subtilis. J. Gen. Microbiol 136, 2527–2535. 250

Whatmore AM., and Reed RH. 1990. Determination of turgor pressure in Bacillus subtilis: a possible role for K+ in turgor regulation. J. Gen. Microbiol 136, 2521–2526.

Wickner S, Maurizi MR, Gottesmann S. 1999. Postranslational quanlity control: folding, refolding and degrading proteins. Science 28, 1888-1893.

Wolf. C. 2005. Untersuchungen zum einfluss antimikrobieller substanzen auf das proteom von Bacillus subtilis. Diploma thesis.

Wolff S, Otto A, Albrecht D, Zeng JS, Büttner K, Glückmann M, Hecker M and Becher D. 2006. Gel-free and gel-based proteomics in Bacillus subtilis: A comparative study. Mol Cell Proteomics [Epub ahead of print].

Wray LV Jr, Ferson AE, Fisher SH. 1997. Expression of the Bacillus subtilis ureABC operon is controlled by multiple regulatory factors including CodY, GlnR, TnrA, and Spo0H. J Bacteriol 179, 5494-501.

Wray LV Jr, Ferson AE, Rohrer K, Fisher SH. 1996. TnrA, a transcription factor required for global nitrogen regulation in Bacillus subtilis. Proc Natl Acad Sci U S A 93, 8841-5.

Wray LV Jr, Zalieckas JM, Fisher SH. 2001. Bacillus subtilis glutamine synthetase controls gene expression through a protein-protein interaction with transcription factor TnrA. Cell 107, 427-35.

Wray LV. Jr, Petengill FK, and Fisher SH. 1994. Catabolite repression of the Bacillus subtilis hut operon requires a cis-acting site located downstream of the transcription initiation site. J. Bacteriol 176, 1894-1902.

Wright A, Wait R, Beggum S, Crossett B, Nagy J, Brown K, Fairweather N. 2005. Proteomic analysis of cell surface proteins from Clostridium difficile. Proteomics 5, 2443-52.

Wu JJ, Piggot PJ, Tatti KM, Moran CP Jr. 1991. Transcription of the Bacillus subtilis spoIIA locus. Gene 101, 113-6.

Yang WJ, and Yanofsky C. 2005. Effects of tryptophan starvation on levels of the trp-RNA- binding attenuation protein (TRAP) and anti-TRAP regulatory protein and their influence on trp operon expression in Bacillus subtilis. Journal of Bacteriology 187, 1884-1891.

Yang X, Kang CM, Brody MS, Price CW. 1996. Opposing pairs of serine protein kinases and phosphatases transmit signals of environmental stress to activate a bacterial transcription factor. Genes Dev 10, 2265-75.

Ying QI and Hulett FM. 1998. Role of PhoP~P in transcriptional regulation of genes involved in cell wall anionic polymer biosynthesis in Bacillus subtilis. Journal of Bacteriology 180, 4007-4010. 251

Yoshida K, Kobayashi K, Miwa Y, Kang C, Matsunaga M, Yamaguchi H, Tojo S, Yamamoto M, Nishi R, Ogasawara N, Nakayama T and Fujita Y. 2001. Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucleic Acids Research 29, 683-692.

Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y. 2003. Identification of additional TnrA- regulated genes of Bacillus subtilis associated with a TnrA box. Mol Microbiol 49, 157-65

Yura T, Kanemori M, Morita MT 2000. The heat shock response: Regulation and function. In: Stortz G, Hengge-Aronis R, editors. Bacterial stress responses. Washington: ASM Press, 3- 18.

Zanen G, Antelmann H, Meima R, Jongbloed JDH, Kolkman M, Hecker M, van Dijl JM, and Quax WJ. 2006. Proteomic dissection of Signal Recognition Particle-dependence in protein secretion by Bacillus subtilis. Proteomics 6: in press.

Ziebandt AK, Becher D, Ohlsen K, Hacker J, Hecker M, Engelmann S. 2004. The influence of agr and sigmaB in growth phase dependent regulation of virulence factors in Staphylococcus aureus. Proteomics 4, 3034-47.

Ziebandt AK, Weber H, Rudolph J, Schmid R, Höper D, Engelmann S, Hecker M. 2001. Extracellular proteins of Staphylococcus aureus and the role of SarA and sigma B. Proteomics 1, 480-93.

Zuber P. 2004. Spx-RNA polymerase interaction and global transcriptional control during oxidative stress. J Bacteriol 186, 1911-8. Review.

Zuber U and Schumann W. 1993. CIRCE, a novel heat shock element involved in reglulation of heat shock operon dnaK of Bacillus subtilis. Journal of Bacteriology 176, 1359-1363. 252

List of publication

1. Christine Eymann, A. Dreisbach, D. Albrecht, J. Bernhardt, D. Becher, S. Gentner, L.T. Tam, K. Buttner, G. Buurman, C. Scharf, S. Venz, U. Völker, and M. Hecker. 2004. Proteomics 4, 2849-2876

A comprehensive proteome map of growing Bacillus subtilis cells

2. Le Thi Tam, C. Eymann, D. Albrecht, R. Sietmann, F. Schauer, M. Hecker and H. Antelmann. 2006. Environmental Microbiology, in press

Differential gene expression in response to phenol and catechol reveal different metabolic activities for the degradation of aromatic compounds in Bacillus subtilis

3. Le Thi Tam, H. Antelmann, C. Eymann, D. Albrecht, J. Bernhardt and M. Hecker. In revision of Proteomics

Proteome signatures for stress and starvation in Bacillus subtilis as revealed by a 2D gel image color coding approach

4. Le Thi Tam, C. Eymann, H. Antelmann, D. Albrecht and M. Hecker. Submitted to Journal of Molecular Microbiology and Biotechnology

Global gene expression profiling of Bacillus subtilis in response to ammonium and tryptophan starvation as revealed by transcriptome and proteome analysis 253

CURRICULUM VITAE

Personal information:

Name Le, Thi Tam

Sex Female

Date of birth 08 Janu, 1979

Place of birth Bacninh

Nationality Vietnam

Marital status Married

Education and work experience:

2/2003-2006: Ph.D. student, Institute of Microbiology, Faculty of Mathematics- Naturalscience, Ernst-Moritz-Arndt University of Greifswald, Germany

10/2001-10/2002: Student of Diploma Equivalent course through Joint Graduate Educational Program held by Hanoi University of Science, Institute of Biotechnology, Vietnam and University of Greifswald, Germany

2000- 2003: Researcher of Institute of Biotechnology, Vietnam Academy of Science and Technology

1996-2000: B.Sc. in Biotechnology, Faculty of Biology, Hanoi National University, Vietnam

254

ACKNOWLEDGEMENTS

I would like to especially thank Prof. Michael Hecker who enabled me to study and complete my thesis in this Microbiology institute.

I am much obliged to Dr. Haike Henkel who is always beside me, give ideas and help me in the experiments and writing the papers. Without her patience and care, I would have not made it.

I greatly appreciate many helps and discussions of Dr. Christine Eymann during my first study year and her great supports for my paper.

I gratefully acknowledge the helps of Dr. Jörg Bernhardt, Dr. Dirk Albrecht and the MS group for DECODON analysis and protein identification.

I would like to express my thankfulness to Dr. Britta Jürgen, Stephanie Leja and Dr. Ulrike Mäder for their support in my micro array works.

I sincerely thank Prof. Frieder Schauer and Dr. Rabea Sietmann for many helpful discussions and supports in enzyme activity determination experiments.

I would like to thank Dr. Ulf Gerth and Dr. Daniela Zühlke for their helps in protein overproduction experiment.

I would like to thank Carmen Wolf and Nguyen Van Duy for sharing their results.

My special appreciation is expressed to Mrs. Anita Harang, Mrs Anke Arelt, Sebastian Grund and Anne Krause for their experimental supporting.

Many thanks to all members of Microbiology institute for the friendly working atmosphere.

I am very grateful for the 3-year-financial supporting from Ministry of Education and Training of Vietnam (MOET) as well as all members of 322 project enabled me to do this Ph.D. work. I am also highly appreciated the organization for my Ph.D. work of Joint Graduate Education Program between Institute of Biotechnology, Vietnam Academy of Science and Technology and University of Greifswald, especially Prof. Le Tran Binh, Dr. Le Thi Lai, Dr. Luu Lan Huong, Dr. Jörn Kasbohm and other organizers of this program.

Finally, I would like to thank my family for their endless love during my study and work. Many thanks to my friends in VietGrei group for their sharing. 255

Hiermit erkläre ich, dass diese Arbeit bisher von mir wieder an der Mathematisch- Naturwissenschaftlichen Fakultät der Ernst-Moritz-Arndt-Universität Greifswald noch einer anderen wissenschaftlichen Einrichtung zum Zwecke der Promotion eingereicht wurde.

Ferner erkläre ich, dass ich diese Arbeit selbständig verfasst und keine anderen als die darin angegebenen Hilfsmittel benutzt habe.