To Long-Chain ,-Diols from Free Fatty Acids Using CYP153A

catalysts

Article Biosynthesis of Medium- to Long-Chain α,ω-Diols from Free Fatty Acids Using CYP153A Monooxygenase, Carboxylic Acid Reductase, and E. coli Endogenous Aldehyde Reductases

Md Murshidul Ahsan 1 ID , Sihyong Sung 2, Hyunwoo Jeon 2, Mahesh D. Patil 2, Taeowan Chung 1 and Hyungdon Yun 2,*

1 School of Biotechnology, Yeungnam University, Gyeongsan 38541, Korea; [email protected] (M.M.A.); [email protected] (T.C.) 2 Department of Systems Biotechnology, Konkuk University, Seoul 050-29, Korea; [email protected] (S.S.); [email protected] (H.J.); [email protected] (M.D.P.) * Correspondence: [email protected]; Tel.: +82-2-450-0496; Fax: +82-2-450-0686

Received: 27 November 2017; Accepted: 22 December 2017; Published: 24 December 2017

Abstract: α,ω-Diols are important monomers widely used for the production of polyesters and polyurethanes. Here, biosynthesis of α,ω-diols (C8–C16) from renewable free fatty acids using CYP153A monooxygenase, carboxylic acid reductase, and E. coli endogenous aldehyde reductases is reported. The highest yield of α,ω-diol was achieved for the production of 1,12-dodecanediol. In the nicotinamide adenine dinucleotide phosphate (NADPH) cofactor regeneration system, 5 g/L of 1,12-dodecanediol was synthesized in 24 h reaction from the commercial ω-hydroxy dodecanoic acid. Finally, 1.4 g/L 1,12-dodecanediol was produced in a consecutive approach from dodecanoic acids. The results of this study demonstrated the scope of the potential development of bioprocesses to substitute the petroleum-based products in the polymer industry.

Keywords: carboxylic acid reductase; CYP153A monooxygenase; diols; polyester; polyurethanes

1. Introduction The utilization of renewable feedstock-derived raw materials and development of bioprocesses thereof to substitute petroleum-based products in polymer industry has shown a steep surge in recent years [1–3] due to concern of future shortage of petroleum resources and in consideration of green production [4,5]. Compared to chemical catalysis, biocatalysis has countless advantages including high efﬁciency, increased stability, high degree of selectivity (regio-, chemo-, and enantio-selectivity), and safe reaction conditions [6,7]. α,ω-Diols are used as monomers for the production of polyesters and polyurethanes [1,2]. At present, industrial-scale preparation has only been conﬁned to short-chain diol biosynthesis, while biosynthesis of medium- to long-chain α,ω-diols (C8–C16) has not been studied extensively [8,9]. Microbial synthesis of α,ω-diol (>C12) has been originally reported in some yeasts species belonging to genus Candida [10–12]. Further microbial synthesis α,ω-diols (C5–C12) from alkanes employing cytochrome P450 (CYP5153A) from Acinetobacter sp. OC4 in Escherichia coli with the highest yielded for 1,8-octanediol (722 mg/L) has been reported [10,13]. Similar ability of producing α,ω-diols from alkanes through in vitro biocatalytic reactions using CYP153A16 from Mycobacterium merinum and CYP153A34 from Polaromonas sp. strain JS666 has been reported. CYP153A16 produced C8–C12 α,ω-diols while CYP153A34 produced C8–C9 α,ω-diols. However, the overall yield of α,ω-diols from 1 mM substrate is only 3–12% [14]. Only one study has reported the use of renewable medium-chain fatty alcohols for the production of α,ω3-diols

Catalysts 2018, 8, 4; doi:10.3390/catal8010004 www.mdpi.com/journal/catalysts CatalystsCatalysts 2018, 8, 4 22 ofof 1111

for the production of α,ω3‐diols in E. coli by employing engineered P450BM3 [9]. Microbial synthesis inof E.medium coli by‐ employingto long‐chain engineered α,ω‐diols P450BM3 suffers major [9]. Microbial challenges synthesis such as of low medium- product to yields, long-chain low αproductivities,,ω-diols suffers and major narrow challenges substrate such as lowrange product of yields,enzymes low productivities,used [9,13,15]. and Although narrow substrate some rangepreparative of enzymes‐scale usedreactions [9,13 ,15have]. Although been reported some preparative-scale [13], novel approaches reactions are have highly been reporteddesirable [13 to], novelovercome approaches bottlenecks are highlyin microbial desirable synthesis to overcome of α,ω‐diols. bottlenecks In this light, in microbial here we synthesis report highly of α, ωefficient-diols. Inand this sequential light, here biocatalytic we report conversion highly efficient of free and fatty sequential acids (FFAs) biocatalytic to medium conversion‐ to long of‐chain free fatty α,ω‐diols. acids (FFAs)Vegetable to medium- oil derivatives to long-chain (e.g.,α,ω FFAs)-diols. are important renewable resources [1,2]. Unfortunately, limitedVegetable attention oil has derivativesbeen paid to (e.g., synthesize FFAs) diols are from important FFAs that renewable can serve as resources good starting [1,2]. Unfortunately,materials for green limited processes, attention including has been the paid production to synthesize of α, diolsω‐diols from [13,15]. FFAs We that describe can serve herein as good the startingproduction materials of medium for green‐ to processes, long‐chain including α,ω‐diols the from production FFAs using of α,ω CYP153A-diols [13 ,15monooxygenase,]. We describe hereincarboxylic the production acid reductase of medium- (CAR) and to long-chain E. coli endogenousα,ω-diols aldehyde from FFAs reductases using CYP153A (ALRs) monooxygenase, (Figure 1). First, carboxylichydroxylation acid reductaseof FFAs (CAR)was carried and E. colioutendogenous using CYP153A33 aldehyde reductasesfrom Marinobacter (ALRs) (Figure aquaeolei1). First,(MaqCYP153A33), hydroxylation a promising of FFAs was biocatalyst carried due out to using its exceptional CYP153A33 regioselectivity from Marinobacter (>95%) aquaeolei for the (MaqCYP153A33),ω‐position [16]. Next, a promising a catalytically biocatalyst efficient due carboxylic to its exceptional acid reductase regioselectivity (CAR) from (>95%) Mycobacterium for the ωmarinum-position (MmCAR) [16]. Next, [17] a catalytically recently reported efficient was carboxylic used for acid selective reductase reduction (CAR) from of carboxylicMycobacterium acid marinumfunctional(MmCAR) group of [17 ω‐] recentlyhydroxy reported FFAs wasto corresponding used for selective aldehydes. reduction ofIt carboxylicexhibited acidhigh functional catalytic groupefficiency of ω (kcat/Km)-hydroxy FFAs against to corresponding benzoic acid and aldehydes. the C6–C It16 exhibited fatty acids high [17]. catalytic However, efficiency microbial (kcat/Km) hosts againstsuch as benzoicE. coli genome acid and encoded the C6–C for16 44fatty endogenous acids [17]. aldehyde However, reductases microbial (ALRs), hosts such and as amongE. coli genomethem 13 encodedare highly for active 44 endogenous that converted aldehyde aldehydes reductases to alcohols (ALRs), ranging and among from C them2 to C 1318 are[18,19]. highly To active efficiently that convertedconvert ω‐ aldehydeshydroxy fatty to alcohols aldehydes ranging to α from,ω‐diols, C2 to E. C coli18 [ 18cells,19 ].as To a efficientlysource of endogenous convert ω-hydroxy ALRs were fatty aldehydesused. to α,ω-diols, E. coli cells as a source of endogenous ALRs were used.

8 16 FigureFigure 1.1. SchematicSchematic diagramdiagram showingshowing the the biosynthesis biosynthesis of of medium- medium‐ toto long-chain long‐chainα α,ω,ω‐-diolsdiols (C (C8–C–C16) fromfrom free free fatty fatty acids acids (FFAs). (FFAs).ω-OHFAs, ω‐OHFAs,ω-hydroxy ω‐hydroxy fatty acids; fattyω -OHFAlds,acids; ω‐OHFAlds,ω-hydroxy ω‐ fattyhydroxy aldehydes. fatty aldehydes. 2. Results and Discussion 2. Results and Discussion 2.1. Establishment of MmCAR Reaction System 2.1. Establishment of MmCAR Reaction System CARs need to undergo posttranslational activation via phosphopantetheinylation using phosphopantetheinylCARs need to transferaseundergo posttranslational (PPTase) [17,20–22 ].activation Therefore, via MmCAR phosphopantetheinylation was co-expressed (Figure using S1) withphosphopantetheinyl surfactin phosphopantetheinyl transferase (PPTase) transferase [17,20–22]. (Sfp), Therefore, a PPTase MmCAR from Bacillus was co subtilis.‐expressedSDS-PAGE (Figure analysisS1) with surfactin conﬁrmed phosphopantetheinyl the production of MmCARtransferase and (Sfp), Sfp a PPTase recombinant from Bacillus proteins subtilis. in soluble SDS‐PAGE form ◦ (Figureanalysis S2). confirmed Whole-cell the production (0.3 gCDW of/mL) MmCAR reaction and Sfp was recombinant carried out proteins at 30 Cin andsoluble 200 form rpm (Figure using MmCARS2). Whole with‐cell or (0.3 without gCDW/mL) co-expressing reaction was Sfp carried cells in out potassium at 30 °C and phosphate 200 rpm buffer using (100 MmCAR mM, pHwith 7.5) or inwithout the presence co‐expressing of 1% (Sfpw/ vcells) glucose in potassium and 10 mMphosphate MgCl2 buffer. Co-expressed (100 mM, cellspH 7.5) produced in the presence 9.2 mM ofof benzyl1% (w/v alcohol.) glucose However, and 10 mM cells MgCl only expressing2. Co‐expressed MmCAR cells synthesizedproduced 9.2 0.5 mM mM of of benzyl benzyl alcohol. alcohol (FigureHowever, S3). cells In both only cases, expressing only negligible MmCAR amountsynthesized of benzylaldehyde 0.5 mM of benzyl was alcohol detected (Figure (data notS3). shown). In both Thiscases, result only clearly negligible suggested amount that of Sfpbenzylaldehyde had a pivotal rolewas indetected the activation (data not of MmCARshown). This and thatresult activities clearly suggested that Sfp had a pivotal role in the activation of MmCAR and that activities of endogenous ALRs were sufficiently high enough to produce alcohols (Figure S4). MmCAR‐Sfp co‐expressed cells

Catalysts 2018, 8, 4 3 of 11

Catalysts 2018, 8, 4 3 of 11 of endogenous ALRs were sufficiently high enough to produce alcohols (Figure S4). MmCAR-Sfp wereco-expressed then studied cells further were then using studied various further FFAs. Whole using‐cell various (0.3 g FFAs.CDW/mL) Whole-cell reactions were (0.3 gperformedCDW/mL) usingreactions 10 mM were octanoic performed acid using (C8), 10 decanoic mM octanoic acid (C acid10), (Cdodecanoic8), decanoic acid acid (C (C12),10 tetradecanoic), dodecanoic acid (C1214),), andtetradecanoic hexadecanoic acid (C acid14), and (C16 hexadecanoic). The amount acid (Cof16 ).produced The amount 1‐octanol, of produced 1‐decanol, 1-octanol, 1‐dodecanol, 1-decanol, 1-dodecanol,1‐tetradecanol, 1-tetradecanol, and 1‐hexadecanol and 1-hexadecanolwas 1.8, 9.8, 9.9, was 1.6, 1.8, and 9.8, 0.6 9.9, mM, 1.6, respectively and 0.6 mM, (Figure respectively S5). GC (Figureanalysis S5).revealed GC that analysis there was revealed no accumulation that there of was aldehydes no accumulation during the reaction of aldehydes process, during implying the thatreaction endogenous process, implyingALRs were that sufficient endogenous enough ALRs to werereduce sufficient aldehydes enough to alcohols. to reduce This aldehydes can be explainedto alcohols. by This the can reduction be explained of carboxylic by the reduction acid functional of carboxylic groups acid of functional FFAs to groupstheir aldehyde of FFAs counterpartsto their aldehyde and counterpartsconcomitant andreduction concomitant of these reduction aldehydes of theseto alcohols aldehydes by ALRs to alcohols (Figure by S4). ALRs To (Figureconfirm S4). ALR To‐mediated confirm ALR-mediated reduction of reductionaldehydes, of aldehydes,a separate areaction separate was reaction carried was out carried using out E. using coli E.BW25113 coli BW25113 (∆fadD, (∆ fadD,DE3) DE3)host cells. host cells.Complete Complete conversion conversion of 10 of mM 10 mM dodecanal dodecanal and and benzaldehyde benzaldehyde to 1to‐dodecanol 1-dodecanol and and benzyl benzyl alcohol, alcohol, respectively, respectively, was was achieved achieved in in 6 6 h, h, implying implying that that endogenous endogenous ALRs from E. coli BW25113 (∆fadD, DE3) host cells had catalytic efficiency efficiency (Figure S6). These results were consistent with those of Akhtar etet al.al. (2013) showingshowing thatthat alcoholsalcohols (C(C88–C1818)) could could be be produced over a short time period (5 h) using MmCAR when natural oils were usedused asas sourcessources ofof FFAsFFAs [[17].17].

2.2. Production of αα,ωω‐-DiolsDiols from ω‐ω-OHFAsOHFAs After successful in vivo synthesis of various alcohols by MmCAR, further biocatalytic reactions were performed using using various various ω‐ωOHFAs-OHFAs (C (C8–C8–C16)16 in) order in order to achieve to achieve the thefinal ﬁnal goal goal of this of study this study (i.e., (i.e.,biosynthesis biosynthesis of medium of medium-‐ to long to‐chain long-chain α,ω‐diols).α,ω Reaction-diols). Reactionconditions conditions were the same were as the those same used as forthose MmCAR used for‐catalyzed MmCAR-catalyzed biotransformation biotransformation of FFAs to of fatty FFAs alcohols. to fatty alcohols.Initial specific Initial α speciﬁc,ω‐diol biotransformationα,ω-diol biotransformation rates were rates 0.26, were 0.29, 0.26, 0.28 0.29, and 0.28 0.04 and mM/g 0.04 mM/gCDW/hCDW for ω‐/h forhydroxyω-hydroxy octanoic octanoic acid (acidω‐OHOA), (ω-OHOA), ω‐hydroxyω-hydroxy deacanoic deacanoic acid acid(ω‐OHDA), (ω-OHDA), ω‐hydroxydodecanoicω-hydroxydodecanoic acid acid(ω‐OHDDA), (ω-OHDDA), and ω‐andhydroxyω-hydroxy hexadecanoic hexadecanoic acid acid (ω‐ (OHHDA),ω-OHHDA), respectively respectively (Figure (Figure 2).2). Although Although the the initial initial whole-cellwhole‐cell reaction rate rate for for ω‐ωOHDAs-OHDAs (C (C1010) was) was marginally marginally higher, higher, the the optimum optimum productivity productivity was was observed observed for thefor theproduction production of 1,12 of 1,12-dodecanediol‐dodecanediol from from ω‐OHDDAω-OHDDA in 24 in h 24reaction h reaction (Figure (Figure 2). The2). highest The highest yield yieldachieved achieved (9.7 mM) (9.7 mM)from from 10 mM 10 mM of corresponding of corresponding substrates substrates was was found found for for the the production production of 1,12-dodecanediol,1,12‐dodecanediol, whereas onlyonly 3.013.01 mMmM ofof 1,16-hexadecanediol1,16‐hexadecanediol waswas producedproduced (Figure(Figure2 2).).

Figure 2.2. InIn vivo vivoproduction production of αof,ω α-diols,ω‐diols using usingE. coli E.BW25113 coli BW25113 (∆fadD, (∆ DE3)fadD, cells DE3) expressing cells expressing MmCAR MmCAR and Sfp. Reaction Conditions: Substrate, 10 mM ω‐OHFAs (C8–C16); Volume, 10 mL in and Sfp. Reaction Conditions: Substrate, 10 mM ω-OHFAs (C8–C16); Volume, 10 mL in 100 mL ﬂask; Temp,100 mL 30 flask;◦C; Buffer, Temp, 100 30 mM°C; Buffer, potassium 100 phosphatemM potassium buffer phosphate (pH: 7.5) with buffer 1% (pH: glucose 7.5) (withw/v) 1% and glucose 10 mM (w/v) and 10 mM MgCl2; Cell OD600, 30. MgCl2; Cell OD600, 30.

Among renewable FFAs, dodecanoic acid is one of the cheapest and the most abundant Among renewable FFAs, dodecanoic acid is one of the cheapest and the most abundant substrates while 1,12‐dodecanediol is an industrially important monomer for the production of substrates while 1,12-dodecanediol is an industrially important monomer for the production polyesters, polyurethanes, polycarbonates, and epoxy resins [13]. Interestingly, the productivity of 1,12‐dodecanediol in the present study was comparatively higher than that of other α,ω‐diols. Therefore, further optimization using ω‐OHDDA as a substrate was requisite.

Catalysts 2018, 8, 4 4 of 11 of polyesters, polyurethanes, polycarbonates, and epoxy resins [13]. Interestingly, the productivity Catalystsof 1,12-dodecanediol 2018, 8, 4 in the present study was comparatively higher than that of other α,ω-diols.4 of 11 Therefore, further optimization using ω-OHDDA as a substrate was requisite. 2.3. Enhancement of 1,12‐Dodecanediol Production 2.3. Enhancement of 1,12-Dodecanediol Production 2.3.1. pH Optimization 2.3.1. pH Optimization To examine the effect of pH on bioconversion of ω‐OHDDA to 1,12‐dodecanediol using MmCAR,To examine whole the‐cell effect reaction of pH was on bioconversionperformed at of threeω-OHDDA different to 1,12-dodecanediolpH (6.5, 7.5 and using8.5). Substrate MmCAR, concentrationwhole-cell reaction was increased was performed to 30 atmM. three Optimum different activity pH (6.5, was 7.5 and measured 8.5). Substrate at pH 7.5, concentration with 19.5 mM was productincreased formed to 30 mM. in 24 Optimum h, whereas activity only was7.4 and measured 9.7 mM at pHof products 7.5, with were 19.5 mM synthesized product formedat pH 6.5 in 24and h, 8.5,whereas respectively only 7.4 and(Figure 9.7 mM S7). of Higher products concentration were synthesized of ω‐ atOHDDA pH 6.5 and (beyond 8.5, respectively 30 mM) resulted (Figure S7).in decreasedHigher concentration productivity. of Thisω-OHDDA might be (beyond due to the 30 mM) toxic resultedeffects of in higher decreased concentrations productivity. of ω‐ ThisOHDDA might tobe living due to cells the toxicby [23]. effects of higher concentrations of ω-OHDDA to living cells by [23].

2.3.2. Cofactor Cofactor Regeneration Regeneration Regenerations of of nicotinamide cofactors cofactors (NADPH) (NADPH) and and adenosine adenosine triphosphate triphosphate (ATP) (ATP) are are very importantimportant inin CAR CAR reactions reactions to restoreto restore consumed consumed cofactors. cofactors. For regeneration For regeneration of ATP, severalof ATP, enzymatic several enzymaticreactions have reactions been reported have includingbeen reported PPK2 which including mainly catalyzesPPK2 which polyphosphate-dependent mainly catalyzes polyphosphatephosphorylation‐dependent [21]. Whole-cell phosphorylation reaction [21]. was Whole performed‐cell reaction in the abovewas performed mentioned in conditionsthe above mentionedemploying conditionsArthrobacter employing aurescens PPK2Arthrobacter co-expressing aurescens MmCAR PPK2 co‐ andexpressing Sfp with MmCAR an additional and Sfp use with of an2 mM additional polyP [ 21use]. Inof 242 mM h of polyP reaction, [21]. produced In 24 h amountof reaction, of 1,12-dodecanediol produced amount was of 1,12 22.5‐dodecanediol mM (4.6 g/L) was(Figure 22.53). mM (4.6 g/L) (Figure 3).

Figure 3.3. InIn vivo vivoproduction production of αof,ω α-diols,ω‐diols using usingE. coli E.BW25113 coli BW25113 (∆fadD, (∆ DE3)fadD, cells DE3) expressing cells expressing MmCAR MmCARand Sfp. Reactionand Sfp. conditions:Reaction conditions: Substrate, Substrate, 30 mM ω -OHDDA;30 mM ω‐ Volume,OHDDA; 10 Volume, mL in 100 10 mL mL ﬂask; in 100 Temp, mL flask;◦ Temp, 30 °C; Buffer, 100 mM potassium phosphate buffer (pH: 7.5) with 1% glucose (w/v) and 30 C; Buffer, 100 mM potassium phosphate buffer (pH: 7.5) with 1% glucose (w/v) and 10 mM MgCl2; 10 mM MgCl2; Cell OD600, 30. Cell OD600, 30.

For regeneration of NADPH in MmCAR‐catalyzed reactions, a Bacillus subtilis glucose For regeneration of NADPH in MmCAR-catalyzed reactions, a Bacillus subtilis glucose dehydrogenase (GDH) was co‐expressed to ensure constant supply of cofactors the whole‐cell dehydrogenase (GDH) was co-expressed to ensure constant supply of cofactors the whole-cell biotransformation processes [24]. After 24 h of reaction, 24.7 mM (5.0 g/L) of 1,12‐dodecanediol was biotransformation processes [24]. After 24 h of reaction, 24.7 mM (5.0 g/L) of 1,12-dodecanediol produced from 30 mM substrate, higher than the yield of MmCAR‐PPK2 system (Figure 3). The was produced from 30 mM substrate, higher than the yield of MmCAR-PPK2 system (Figure3). production of 1,12‐dodecanediol showed a substantial improvement (66‐fold) compared to that The production of 1,12-dodecanediol showed a substantial improvement (66-fold) compared to reported by Fujii et al. (2006) who demonstrated 79 mg/L product from 1‐dodecanol using E. coli that reported by Fujii et al. (2006) who demonstrated 79 mg/L product from 1-dodecanol using expressing CYP153A from Acinetobacter sp. OC4 [10]. Results of these experiments clearly E. coli expressing CYP153A from Acinetobacter sp. OC4 [10]. Results of these experiments clearly demonstrated that the carboxylic acid functional group of ω‐OHFAs was reduced to the aldehyde demonstrated that the carboxylic acid functional group of ω-OHFAs was reduced to the aldehyde functional group by whole‐cell catalysts expressing CAR, Sfp and GDH where the aldehyde functional group was further reduced to the alcoholic functional group by E. coli endogenous ALRs.

Catalysts 2018, 8, 4 5 of 11 functionalCatalysts 2018 group, 8, 4 by whole-cell catalysts expressing CAR, Sfp and GDH where the aldehyde functional5 of 11 group was further reduced to the alcoholic functional group by E. coli endogenous ALRs.

2.4. Production of αα,,ωω‐-DiolsDiols from FFAs

2.4.1. Production of αα,ωω‐-DiolsDiols by One One-Pot,‐Pot, One One-Step‐Step Reaction ‘One-pot,‘One‐pot, oneone step’ step’ reaction reaction is desirableis desirable for cascadefor cascade reaction. reaction. To start To the start one-pot, the one one-step‐pot, one reaction,‐step E.reaction, coli cells E. coli expressing cells expressing MaqCYP153A33/CamAB MaqCYP153A33/CamAB for ω-hydroxylation for ω‐hydroxylation of DDA of DDA and E. and coli E.cells coli expressingcells expressing MmCAR-GDH/Sfp MmCAR‐GDH/Sfp were were grown grown separately. separately. After After the the expression, expression, both both types types ofof cells were harvested,harvested, and and the the cell cell pellets pellets were were washed, washed, and re-suspended and re‐suspended in 100 mM in potassium100 mM phosphatepotassium bufferphosphate with buffer 1% ( wwith/v) 1% glucose (w/v) glucose (pH: 7.5). (pH: A 7.5). total A total of 0.3 of gDCW/mL0.3 gDCW/mL of of whole-cell whole‐cell was was used used in the reaction with with 1:1 1:1 ratio. ratio. The The reaction reaction was was initiated initiated by by adding adding 10 10mM mM DDA DDA (stock (stock in DMSO, in DMSO, 5% ◦ 5%(v/v) ( vfinal/v) finalconcentration), concentration), and 10 and mM 10 MgCl mM2 MgCl. The 2reactants. The reactants were incubated were incubated at 30 °C atand 30 200C rpm. and 200After rpm. 15 h of After whole 15‐ hcell of reaction, whole-cell 6.8 reaction,mM 1‐dodecanol 6.8 mM and 1-dodecanol 1.0 mM 1,12 and‐dodecanediol 1.0 mM 1,12-dodecanediol was produced, wasrespectively produced, (Figure respectively 4). These (Figure 4findings). These findingssuggest suggestthat one that‐pot, one-pot, one‐ one-stepstep reaction reaction of of FFAsFFAs predominantly producedproduced fatty fatty alcohols alcohols rather rather than thanα,ω α-diols.,ω‐diols. This isThis because, is because, FFAs acted FFAs as commonacted as activecommon substrates active substrates for both MmCAR for both and MmCAR MaqCYP153A33 and MaqCYP153A33 enzymes where enzymes MmCAR where was MmCAR more active was thanmore MaqCYP153A33. active than MaqCYP153A33. Consequently, one-pot Consequently, reaction wasone not‐pot feasible reaction for thewas production not feasible of α ,ωfor-diols the fromproduction FFAs. Therefore,of α,ω‐diols next from we triedFFAs. sequential Therefore, reaction. next we In firsttried step, sequentialω-OHFAs reaction. were produced In first fromstep, FFAsω‐OHFAs by MaqCYP153A33/CamAB were produced from FFAs and by in secondMaqCYP153A33/CamAB step α,ω-diols were and synthesized in second from step α biotransformed,ω‐diols were ωsynthesized-OHFAs by from MmCAR/Sfp. biotransformed ω‐OHFAs by MmCAR/Sfp.

Figure 4.4. InIn vivo vivoproduction production of ofα α,ω,-diolsω‐diols by by one-pot, one‐pot, one-step one‐step reaction reaction using using two differenttwo different type of typeE. coli of BW25113E. coli BW25113 (∆fadD, (∆ DE3)fadD, cells DE3) coexpressing cells coexpressing MaqCYP153A33 MaqCYP153A33 with CamAB with andCamAB MmCAR-GDH and MmCAR with‐GDH Sfp, with Sfp, respectively. Reaction conditions: Substrate, 10 mM (DDA), 10 mM MgCl2, 10 mL in 100 mL respectively. Reaction conditions: Substrate, 10 mM (DDA), 10 mM MgCl2, 10 mL in 100 mL ﬂask, flask,◦ 30 °C, 15 OD600/mL of BW25113 (∆fadD, DE3) containing pCYP153A33, pCamAB, 15 OD600/mL 30 C, 15 OD600/mL of BW25113 (∆fadD, DE3) containing pCYP153A33, pCamAB, 15 OD600/mL of BW25113 (∆fadD, DE3) containing pCAR pCAR-GDH‐GDH and and pSFP, pSFP, 100 mM phosphate buffer (pH 7.5, 1% ((w/vv)) glucose. glucose. Values Values were were obtained by triplicate triplicate experiment with standard deviations within ≤≤10%.10%.

2.4.2. Production of αα,ωω‐-DiolsDiols Using Biotransformed ω‐ω-OHFAsOHFAs

Production of Various ω‐ω-OHFAsOHFAs (C(C88–C–C1616)) by CYP153A Monooxygenase Enzymes belonging belonging to to CYP153A CYP153A sub sub-family‐family of ofP450s P450s have have natural natural ability ability to ω‐ tohydroxylateω-hydroxylate fatty fattyacid acidsubstrates. substrates. CYP153As CYP153As are bacterial are bacterial class class I P450s I P450s that that require require two two redox redox partners partners for transportation of electrons from NAD(P)H toto P450’sP450’s activeactive sitesite [[14,16,25].14,16,25]. PutidaredoxinPutidaredoxin reductasereductase (CamA)(CamA) andand putidaredoxin putidaredoxin (CamB) (CamB) from fromPsedomonas Psedomonas putida putidaATCC ATCC 17453 are17453 well-known are well‐ redoxknown partners redox ofpartners CYP153As. of CYP153As. They are, They combined, are, combined, known known as “CamAB as “CamAB system” system” [14,25 [14,25].]. Enzymes Enzymes belonging belonging to to CYP153A monooxygenases are popularly known to catalyze ω‐hydroxylation towards saturated and unsaturated fatty acids. Among them, MaqCYP153A33 has a broad range of substrates with exceptional regioselectivity (>95%) for the ω‐position [14,16,25]. To study the utility of FFAs for the synthesis of diols, various FFAs (C8–C16) were utilized for the production of ω‐OHFAs using

Catalysts 2018, 8, 4 6 of 11

CYP153A monooxygenases are popularly known to catalyze ω-hydroxylation towards saturated and unsaturated fatty acids. Among them, MaqCYP153A33 has a broad range of substrates ω Catalystswith exceptional 2018, 8, 4 regioselectivity (>95%) for the -position [14,16,25]. To study the utility6 of of11 FFAs for the synthesis of diols, various FFAs (C8–C16) were utilized for the production of MaqCYP153A33ω-OHFAs using‐ MaqCYP153A33-CamABCamAB system. SDS‐PAGE system. analysis SDS-PAGE and CO analysis binding and spectrum CO binding in spectrumUV–visible in spectroscopyUV–visible spectroscopy corroborated corroborated the active the expression active expression of P450 of P450and andalso also confirmed conﬁrmed production production of MaqCYP153A33 with CamAB (Figure S8). The amount of active P450 waswas 7.27.2 nmol/mL.nmol/mL. This This result was correlated correlated with with the the earlier earlier findings ﬁndings of of Jung Jung et et al. al. (2016) (2016) [25]. [25 Whole]. Whole-cell‐cell reaction reaction was was carried carried out ◦ usingout using MaqCYP153A33 MaqCYP153A33-CamAB‐CamAB co‐expressed co-expressed cells cells (0.3 (0.3 gCDW/mL) gCDW/mL) at at30 30°C Cand and 200 200 rpm rpm in potassium phosphate buffer (100 mM,mM, pHpH 7.5)7.5) containingcontaining 1%1% (w(w//v)) glucose.glucose. Twenty Twenty-four‐four hour reactions of of MaqCYP153A33 MaqCYP153A33 resulted resulted in in the the production production of of 3.3 3.3 mM mM ω‐OHOA,ω-OHOA, 6.3 6.3mM mM ω‐OHDA,ω-OHDA, 8.2 mM8.2 mM ω‐OHDDA,ω-OHDDA, 4.7 4.7mM mM ω‐OHTDA,ω-OHTDA, and and 3.7 3.7 mM mM ω‐ωOHHDA-OHHDA from from 10 10 mM mM of of respective respective FFA FFA (Figure 55).).

Figure 5. InIn vivo production of ω‐ω-OHFAsOHFAs using E. coli BW25113 (∆fadD,fadD, DE3) cells expressing MaqCYP153A33 and CamAB. Reaction conditions: Substrate, 10 mM FFAs (C8–C16); Volume, 50 mL MaqCYP153A33 and CamAB. Reaction conditions: Substrate, 10 mM FFAs (C8–C16); Volume, 50 mL inin 250 mL flask; ﬂask; Temp, 30 ◦°C;C; Buffer, 100 mM potassium phosphate buffer (pH: 7.5) with 1% glucose (w/v); and Cell OD600, 30. ω‐OHOA, ω‐hydroxy octanoic acid; ω‐OHDA, ω‐hydroxy decanoic acid; (w/v); and Cell OD600, 30. ω-OHOA, ω-hydroxy octanoic acid; ω-OHDA, ω-hydroxy decanoic acid; ω‐ω-OHDDA,OHDDA, ω‐ω-hydroxyhydroxy dodecanoic dodecanoic acid; ω‐ω-OHTDA,OHTDA, ω‐ω-hydroxyhydroxy tetradecanoic tetradecanoic acid; ω‐ω-OHHDA,OHHDA, ω‐ω-hydroxyhydroxy hexadecanoic hexadecanoic acid. acid. Control, Control, cells cells carrying carrying “empty” pET24ma and pETDuet pETDuet-1‐1 plasmids (without MaqCYP153A33 and and CamAB genes). Values Values were obtained by triplicate experiment with standardstandard deviations within ≤≤10%.10%.

Production of αα,,ωω‐-DiolsDiols Using Biotransformed ω‐ω-OHFAsOHFAs The production of ω‐ω-OHFAsOHFAs ranged ranged from from 3.3–8.2 mM. Therefore, 3 mM each of biotransformed and non‐purified ω‐OHFAs (C8–C16) from previous reactions were utilized for the production of and non-puriﬁed ω-OHFAs (C8–C16) from previous reactions were utilized for the production of 2+ α,,ω‐ω-diolsdiols inin MmCAR, MmCAR, and and MmCAR-GDH MmCAR‐GDH system. system. Other Other than Mg than2+ cofactors Mg cofactors for MmCAR, for whole-cellMmCAR, wholereaction‐cell conditions reaction conditions of both MaqCYP153A33 of both MaqCYP153A33 and MmCAR-ALRs and MmCAR were‐ALRs the samewere (seethe same the Materials (see the Materialsand Methods and for Methods details). Bioconversionfor details). ratesBioconversion of 1,8-octanediol, rates of 1,10-decanediol, 1,8‐octanediol, 1,12-dodecanediol, 1,10‐decanediol, 1,121,14-tetradecanediol,‐dodecanediol, 1,14 and‐tetradecanediol, 1,16-hexadecanediol and 1,16 were‐hexadecanediol 69%, 75%, 96%, were 60%, 69%, and 75%, 40%, 96%, respectively, 60%, and 40%,in MmCAR respectively, without in MmCAR GDH system without (Figure GDH6). system However, (Figure in MmCAR-GDH 6). However, in system, MmCAR these‐GDH conversion system, theserates wereconversion increased rates by were 15%, increased 12%, 4%, by 8%, 15%, and 12%, 10%, 4%, respectively 8%, and 10%, (Figure respectively6). (Figure 6). Finally, to check the utility of these sequential biocatalytic process, the production of 1,121,12-dodecanediol‐dodecanediol was was studied studied using using biotransformed biotransformed ω‐OHDDAω-OHDDA as a substrate as a substrate in all three in all systems three (Figuresystems 7). (Figure However,7). owing However, to lower owing productivity to lower productivityof ω‐OHDDA of (8.2ω mM)-OHDDA from MaqCYP153A33 (8.2 mM) from reactions,MaqCYP153A33 only 7 mM reactions, of biotransformed only 7 mM ω‐ ofOHDDA biotransformed was usedω-OHDDA for subsequent was used whole for‐cell subsequent reactions involving MmCARs. Nevertheless, the highest bioconversion rate (96%) was achieved in MmCAR‐GDH system after 15 h of reaction, with production yield of 1.4 g/L (Figure 7).

Catalysts 2018, 8, 4 7 of 11 whole-cell reactions involving MmCARs. Nevertheless, the highest bioconversion rate (96%) was achievedCatalysts 2018 in, MmCAR-GDH8, 4 system after 15 h of reaction, with production yield of 1.4 g/L (Figure7 of7). 11

Catalysts 2018, 8, 4 7 of 11

Figure 6. In vivo production of α,ω‐diols using E. coli BW25113 (∆fadD, DE3) cells expressing Figure 6. In vivo production of α,ω-diols using E. coli BW25113 (∆fadD, DE3) cells expressing MmCAR MmCAR and Sfp with/without GDH. Reaction conditions: Substrate, 3 mM biotransformed Figureand Sfp 6. with/without In vivo production GDH. Reaction of α,ω‐ conditions:diols using Substrate, E. coli BW25113 3 mM biotransformed (∆fadD, DE3)ω-OHFAs cells expressing (C8–C16); ω‐OHFAs (C8–C16); Reaction time, 24 h; Volume, 10 mL in 100◦ mL flask; Temp, 30 °C; Buffer, 100 mM MmCARReaction time,and 24Sfp h; Volume,with/without 10 mL inGDH. 100 mLReaction ﬂask; Temp, conditions: 30 C; Buffer,Substrate, 100 mM 3 mM potassium biotransformed phosphate potassium phosphate buffer (pH: 7.5) with 1% glucose (w/v) and 10 mM MgCl2; Cell OD600, 30. ω‐bufferOHFAs (pH: (C 7.5)8–C with16); Reaction 1% glucose time, (w 24/v h;) and Volume, 10 mM 10 MgCl mL in2; 100 Cell mL OD flask;600, 30. Temp, 30 °C; Buffer, 100 mM

potassium phosphate buffer (pH: 7.5) with 1% glucose (w/v) and 10 mM MgCl2; Cell OD600, 30.

Figure 7. In vivo production of α,ω‐diols using E. coli BW25113 (∆fadD, DE3) cells expressing MmCAR and Sfp. Reaction conditions: Substrate, 7 mM biotransformed ω‐OHDDA; Volume, 10 mL Figure 7. In vivo production of α,ω‐diols using E. coli BW25113 (∆fadD, DE3) cells expressing Figurein 100 mL 7. In flask; vivo Temp,production 30 °C; of Buffer,α,ω-diols 100 using mM potassiumE. coli BW25113 phosphate (∆fadD, buffer DE3) (pH: cells 7.5) expressing with 1% MmCAR glucose MmCAR and Sfp. Reaction conditions: Substrate, 7 mM biotransformed ω‐OHDDA; Volume, 10 mL and(w/v) Sfp. and 10 Reaction mM MgCl conditions:2; Cell OD Substrate,600, 30. Values 7 mM were biotransformed obtained by triplicateω-OHDDA; experiment Volume, with 10 standard mL in in 100 mL flask; Temp, 30◦ °C; Buffer, 100 mM potassium phosphate buffer (pH: 7.5) with 1% glucose 100deviations mL ﬂask; within Temp, ≤10%. 30 C; Buffer, 100 mM potassium phosphate buffer (pH: 7.5) with 1% glucose (w/v) and 10 mM MgCl2; Cell OD600, 30. Values were obtained by triplicate experiment with standard (w/v) and 10 mM MgCl2; Cell OD600, 30. Values were obtained by triplicate experiment with standard 3. Materialsdeviations and within Methods ≤≤10%.10%. 3. Materials and Methods 3.3.1. Materials Chemicals and Methods

3.1. Chemicals All chemicals such as fatty acids, ω‐hydroxy fatty acids, dimethyl sulfoxide (DMSO), isopropyl‐thio‐β‐D‐galactopyranoside (IPTG), 5‐aminolevulinic acid (5‐ALA), All chemicals such as fatty acids, ω‐hydroxy fatty acids, dimethyl sulfoxide (DMSO), N,O‐AllBis(trimethylsilyl) chemicals such‐trifluoroacetamide as fatty acids, ω(BSTFA),-hydroxy and fatty sodium acids, polyphosphate dimethyl sulfoxide crystals (DMSO), were isopropyl‐thio‐β‐D‐galactopyranoside (IPTG), 5‐aminolevulinic acid (5‐ALA), isopropyl-thio-purchased fromβ- SigmaD-galactopyranoside‐Aldrich (St. Louis, (IPTG), MO, 5-aminolevulinic USA). Fatty alcohols, acid (5-ALA), and α,Nω‐,Odiols-Bis(trimethylsilyl)- were obtained N,O‐Bis(trimethylsilyl)‐trifluoroacetamide (BSTFA), and sodium polyphosphate crystals were triﬂuoroacetamidefrom Tokyo Chemical (BSTFA), Industry and sodium (Tokyo, polyphosphate Japan). Chloroform crystals werewas obtained purchased from from Junsei Sigma-Aldrich (Tokyo, purchased from Sigma‐Aldrich (St. Louis, MO, USA). Fatty alcohols, and α,ω‐diols were obtained (St.Japan). Louis, Bacteriological MO, USA). Fattyagar, alcohols,Luria bertani and (LB)α,ω-diols broth, were and terrific obtained broth from (TB) Tokyo media Chemical were purchased Industry from Tokyo Chemical Industry (Tokyo, Japan). Chloroform was obtained from Junsei (Tokyo, from BD Difco (Franklin Lakes, NJ, USA). All chemicals used in this study were of analytical grade. Japan). Bacteriological agar, Luria bertani (LB) broth, and terrific broth (TB) media were purchased from BD Difco (Franklin Lakes, NJ, USA). All chemicals used in this study were of analytical grade.

Catalysts 2018, 8, 4 8 of 11

(Tokyo, Japan). Chloroform was obtained from Junsei (Tokyo, Japan). Bacteriological agar, Luria bertani (LB) broth, and terriﬁc broth (TB) media were purchased from BD Difco (Franklin Lakes, NJ, USA). All chemicals used in this study were of analytical grade.

3.2. Plasmid Construction and Gene Manipulation All bacterial strains, plasmid vectors and custom designed oligonucleotides used in this study are listed in Table1. Genomic DNA of Mycobacterium marinum ATCC ® BAA535™ was obtained from American Type Culture Collection (ATCC). Gene encoding M. marinum carboxylic acid reductase (CAR, UniProt: B2HN69) was ampliﬁed from genomic DNA using a PCR thermocycler (Veriti® 96-Well Thermal Cycler; AB Applied Biosystems, Foster City, CA, USA) and cloned into pETDuet-1 ﬁrst multiple cloning site (MCS1). A phosphopantetheinyl transferase, Sfp (GI: P39135) from Bacillus subtilis and polyphosphate kinase 2, PPK2 (GI: ABM08865.1) from Arthrobacter aurescens genes were chemically synthesized and codon-optimized for E. coli. Synthesis and codon optimization were performed by Cosmo Genetech (Cosmo Genetech, Seoul, Korea). PPK2 and glucose dehydrogenase (GDH) gene of Bacillus subtilis were cloned into the second multiple cloning site (MCS2) of pETDuet-1 vector separately with CAR. Sfp was cloned into pET24ma vector. All DNA manipulations for cloning were performed following standard protocols [26]. E. coli DH5α was used for cloning purposes. All primers used in this study were purchased from Cosmo Genetech. They are listed in Table1.

Table 1. Plasmids and strains used in this study *.

Plasmids/Strains Description Reference Plasmids pET24ma P15A ori lacI T7 promoter, KmR [25] pCYP153A33 pET24ma encoding for MaqCYP153A33 [25] pETDuet-1 pBR322 ori lacI T7 promoter, AmpR Novagen pCamAB pETDuet-1 encoding for CamA and CamB [25] pMmCAR pETDuet-1 encoding for MmCAR This study pCAR-GDH pETDuet-1 encoding for MmCAR and GDH This study pCAR-PK2 pETDuet-1 encoding for MmCAR and PPK2 This study pSFP pET24ma encoding for Sfp This study E. coli strains F−, endA1, glnV44, thi-1, recA1, relA1, gyrA96 deoR, supE44, DH5α − − + − [27] Φ80dlacZ∆M15 ∆(lacZYA -argF)-U169, hsdR17(rK mK ), λ BW25113(DE3) rrnB3 ∆lacZ4787 hsdR514 ∆(araBAD)567 ∆(rhaBAD)568 rph-1 λ(DE3) [25] DL BW25113(DE3) ∆fadD [28] A33AB DL carrying pCYP153A33 and pCamAB [28] CAR DL carrying pCAR This study CS DL carrying pCAR and pSFP This study CSG DL carrying pCAR-GDH and pSFP This study CSK DL carrying pCAR-PK2 and pSFP This study PCR oligonucleotides Sequence (50-30) CAR_F (Bam HI) ATTAGGATCCCATGTCGCCAATCACGCGTG Cloned into pETDuet1 CAR_R (Hindd III) TAATAAGCTTGAGCAGGCCGAGTAGGCG SFP_F (Nde I) ATTACATATGAAAATCTACGGCATCTAC Cloned into pET24ma SFP_R (Xho I) TAATCTCGAGTTACAGCAGTTCTTCATA PPK2_F (Nde I) AAGGAGATATACATATGCCGATGGTTGCTGCAG Cloned into pETDuet1 PPK2_R (Kpn I) TTACCAGACTCGAGGGTACCTTAAGATTCAACAACCAGAGC GDH_F (NdeI) AAGGAGATATACATATGTATCCGGATTTAAAAGGA Cloned into pETDuet1 GDH_R (Kpn I) TTACCAGACTCGAGGGTACCTTAACCGCGGCCTGCCTGGAA * Restric sites were underlined.

3.3. Protein Expression and Biotransformation Previously reported E. coli BW25113 (DE3) ∆fadD strains [25] were utilized for biotransformation studies wherein fatty acid degrading β-oxidation pathway was blocked. Recombinant strains were obtained by introducing plasmid DNA into host strains via standard heat shock method of transformation. Transformants were selected based on their antibiotic resistance [26]. Cultivations were carried out at 37 ◦C. Fresh colonies from agar plates of E. coli BL21 (DE3) transformed Catalysts 2018, 8, 4 9 of 11 with each plasmid vector were cultured in 10 mL of Luria-Bertani (LB) medium containing 50 µg/mL of kanamycin (for pCYP153A33, and pSFP) and/or 100 µg/mL ampicillin (for pCamAB, pMmCAR, pCAR-PK2, and pCAR-GDH) at 37 ◦C overnight. These overnight pre-cultured cells were then inoculated into larger volume flasks for expression. They were cultured at 37 ◦C until cell concentration reached an optical density at 600 nm (OD600) of 0.6–0.8 for IPTG induction. MaqCYP153A33 and CamAB protein expression were carried out in 1 L of Terrific-Broth (TB) in a 3 L flask. The induction was performed by adding 0.01 mM IPTG, 0.5 mM 5-ALA as heme precursor, and 0.1 mM FeSO4 at 30 ◦C for 16 h. MmCAR with or without PPK2/GDH and SFP protein expression were carried out in 1 L of LB medium in 3 L flasks. Induction was performed by adding 0.1 mM IPTG at 20 ◦C for 16 h. After expression, cells were harvested by centrifugation (4000 rpm, 20 min, 4 ◦C), washed with PBS, and resuspended in 100 mM potassium phosphate buffer (pH 7.5) containing 1% (w/v) glucose. Whole-cell reaction (0.3 gCDW/mL) was initiated by adding respective substrates (stock in DMSO, 5% (v/v) final concentration or cell free reaction mixtures containing non-purified ω-OHFAs). These reactants were incubated at 30 ◦C and 200 rpm. For whole-cell reaction of MmCAR, 10 mM MgCl2 was added during the addition of substrates. Every 6th h, the pH of the reaction mixture was measured with a pH meter and adjusted to pH 7.5 with 5 M KOH. Then, 50 µL of 80% (w/v) glucose was added. To prepare the non-purified ω-OHFAs substrate for the sequential reaction of MmCAR, and ALRs, the whole-cell reactions of MaqCYP153A33 were stopped after 24 h, and acidified with 6 M HCl. The cells were removed by centrifugation at 16,000 rpm. The clear supernatant thus obtained was used for the further biotransformation without any purification step. The presented amount of produced ω-OHFAs in the reaction mixtures were determined by GC analysis (vide infra). The pH of the reaction mixture was readjusted to 7.5 for the next step bioconversion. Cells containing MmCAR reaction system were resuspended in the reaction mixture, and potassium phosphate buffer (100 mM, pH 7.5) was added again on the basis of ω-OHFAs concentration. To compensate the depleted glucose in earlier reaction, again 1% (w/v) glucose was added, and the whole-cell reaction was carried out as mentioned above.

3.4. Analysis of Compounds by Gas Chromatography Quantitative analysis was performed using a gas chromatography instrument (GC 2010 plus Series) with a flame ionization detector (GC/FID) fitted with an AOC-20i series auto sampler injector (Shimadzu Scientific Instruments, Kyoto 604-8511, Japan). Two microliters of the sample were injected by split mode (split ratio 20:1) and analyzed using a nonpolar capillary column (5% phenyl methyl siloxane capillary 30 m × 320 µm i.d., 0.25-µm film thickness, HP-5). Oven temperature program for fatty acid analysis was follows: 50 ◦C for 1 min, increase to 250 ◦C at 10 ◦C/min, and hold for 10 min. The inlet temperature was 250 ◦C while the detector temperature was 280 ◦C. The flow rate of the carrier gas (He) was at 1 mL/min. Flow rates of H2, air, and He in FID were 45 mL/min, 400 mL/min, and 20 mL/min, respectively. The initial oven temperature was 90 ◦C. It was then increased to 250 ◦C by 15 ◦C/min and held at this temperature for 5 min. Each peak was identified by comparing GC chromatogram with an authentic reference. Internal standards were added to the sample before extraction of the substrate.

4. Conclusions In summary, this work demonstrated the ﬁrst gram-scale bioconversion of FFAs to medium- to long-chain α,ω-diols as high-value building blocks for synthesis of polyamides, polyesters, and polyurethanes. The applicability of in vivo cofactor regeneration systems for cost-effective biocatalytic production of α,ω-diols was also demonstrated. This study suggests that further bioconversion of α,ω-diols to corresponding diamines and diacids is possible through green process [10,11,13]. Furthermore, optimization of the MaqCYP153A33 catalyzed reaction for ω-hydroxylation of FFAs could facilitate higher product titres from FFAs to α,ω-diols. Catalysts 2018, 8, 4 10 of 11

Supplementary Materials: The following are available online at www.mdpi.com/2073-4344/8/1/4/s1, Figure S1, Schematic representation of plasmid system used in this study; Figure S2, SDS PAGE analysis of recombinant E. coli expressing MmCAR (~128 kDa) and Sfp (~27.3 kDa); Figure S3, Effect of Sfp to make active MmCAR; Figure S4, Proposed reaction scheme for the biosynthesis of benzyl alcohol and fatty alcohols (C8–C16); Figure S5, In vivo production of fatty alcohol using E. coli BW25113 (∆fadD, DE3) cells expressing MmCAR, and Sfp; Figure S6, Production of alcohols by E. coli endogenous ALRs using E. coli BW25113 (∆fadD, DE3); Figure S7, Effect of pH for the optimum activity of CAR using E. coli BW25113 (∆fadD, DE3) cells expressing MmCAR, Sfp, and endogenous ALRs; Figure S8, (A) SDS PAGE analysis of recombinant E. coli expressing MaqCYP153A33 (~55.2 kDa), CamA (~47.8 kDa), and CamB (~11.6 kDa). (B) CO binding spectrum of active MaqCYP153A33. Table S1, Retention time of the substrates and products by Gas Chromatography. Acknowledgments: This work was partly supported by the Ministry of Trade, Industry and Energy of South Korea (MOTIE, Korea) under the Industrial Technology Innovation Program (No. 10062550), entitled “The production of nylon 12 monomer, ω-aminolaruic acid from plant oil by bioconversion” and partly by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and future Planning (2016R1A2B2014794). Author Contributions: Hyungdon Yun and Taeowan Chung designed experiments of the project; Md Murshidul Ahsan carried out research works as part of his PhD project; Hyungdon Yun supervised the whole studies reported in the manuscript; Md Murshidul Ahsan wrote the manuscript; Hyunwoo Jeon and Sihyong Sung assisted in experimental tools; Mahesh D. Patil revised this manuscript. Conflicts of Interest: The authors declare no financial or commercial conflict of interest related to this study.

References

1. Kawaguchi, H.; Ogino, C.; Kondo, A. Microbial conversion of biomass into bio-based polymers. Bioresour. Technol. 2017, 245, 1664–1673. [CrossRef][PubMed] 2. Lligadas, G.; Ronda, J.C.; Galià, M.; Cádiz, V. Oleic and undecylenic acids as renewable feedstocks in the synthesis of polyols and polyurethanes. Polymers 2010, 2, 440–453. [CrossRef] 3. Gandini, A. Polymers from renewable resources: A challenge for the future of macromolecular materials. Macromolecules 2008, 41, 9491–9504. [CrossRef] 4. Lligadas, G.; Ronda, J.C.; Galià, M.; Cádiz, V. Renewable polymeric materials from vegetable oils: A perspective. Mater. Today 2013, 16, 337–343. [CrossRef] 5. Sharma, V.; Kundu, P.P. Condensation polymers from natural oils. Prog. Polym. Sci. 2008, 33, 1199–1215. [CrossRef] 6. Madhavan, A.; Sindhu, R.; Binod, P.; Sukumaran, R.K.; Pandey, A. Strategies for design of improved biocatalysts for industrial applications. Bioresour. Technol. 2017, 245, 1304–1313. [CrossRef][PubMed] 7. Wang, M.; Si, T.; Zhao, H. Biocatalyst development by directed evolution. Bioresour. Technol. 2012, 115, 117–125. [CrossRef][PubMed] 8. Jiang, Y.; Liu, W.; Zou, H.; Cheng, T.; Tian, N.; Xian, M. Microbial production of short chain diols. Microb. Cell Fact. 2014, 13, 165. [CrossRef][PubMed] 9. Zheng, Y.; Li, L.; Liu, Q.; Zhang, H.; Cao, Y.; Xian, M.; Liu, H. High-speciﬁcity synthesis of novel monomers by remodeled alcohol hydroxylase. BMC Biotechnol. 2016, 16, 61. [CrossRef][PubMed] 10. Fujii, T.; Narikawa, T.; Sumisa, F.; Arisawa, A.; Takeda, K.; Kato, J. Production of α,ω-alkanediols using Escherichia coli expressing a cytochrome P450 from Acinetobacter sp. OC4. Biosci. Biotechnol. Biochem. 2006, 70, 1379–1385. [CrossRef][PubMed] 11. Scheller, U.; Zimmer, T.; Becher, D.; Schauer, F.; Schunck, W.-H. Oxygenation cascade in conversion of n-alkanes to α, ω-dioic acids catalyzed by cytochrome P450 52A3. J. Biol. Chem. 1998, 273, 32528–32534. [CrossRef][PubMed] 12. Shiio, I.; Uchio, R. Microbial production of long-chain dicarboxylic acids from n-alkanes. Agric. Biol. Chem. 1971, 35, 2033–2042. [CrossRef] 13. Schaffer, S.; Haas, T. Biocatalytic and fermentative production of α,ω-bifunctional polymer precursors. Org. Process. Res. Dev. 2014, 18, 752–766. [CrossRef] 14. Scheps, D.; Honda Malca, S.; Hoffmann, H.; Nestl, B.M.; Hauer, B. Regioselective ω-hydroxylation of medium-chain n-alkanes and primary alcohols by CYP153 enzymes from Mycobacterium marinum and Polaromonas sp. strain JS666. Org. Biomol. Chem. 2011, 9, 6727–6733. [CrossRef][PubMed] Catalysts 2018, 8, 4 11 of 11

15. Sabra, W.; Groeger, C.; Zeng, A.-P. Microbial cell factories for diol production. In Bioreactor Engineering Research and Industrial Applications I: Cell Factories; Ye, Q., Bao, J., Zhong, J.-J., Eds.; Springer: Berlin/Heidelberg, Geramny, 2016; pp. 165–197. 16. Honda Malca, S.; Scheps, D.; Kuhnel, L.; Venegas-Venegas, E.; Seifert, A.; Nestl, B.M.; Hauer, B. Bacterial CYP153A monooxygenases for the synthesis of omega-hydroxylated fatty acids. Chem. Commun. 2012, 48, 5115–5117. [CrossRef][PubMed] 17. Akhtar, M.K.; Turner, N.J.; Jones, P.R. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities. Proc. Natl. Acad. Sci. USA 2013, 110, 87–92. [CrossRef] [PubMed] 18. Fatma, Z.; Jawed, K.; Mattam, A.J.; Yazdani, S.S. Identiﬁcation of long chain speciﬁc aldehyde reductase and its use in enhanced fatty alcohol production in E. coli. Metab. Eng. 2016, 37, 35–45. [CrossRef][PubMed] 19. Rodriguez, G.M.; Atsumi, S. Toward aldehyde and alkane production by removing aldehyde reductase activity in Escherichia coli. Metab. Eng. 2014, 25, 227–237. [CrossRef][PubMed] 20. Finnigan, W.; Thomas, A.; Cromar, H.; Gough, B.; Snajdrova, R.; Adams, J.P.; Littlechild, J.A.; Harmer, N.J. Characterization of carboxylic acid reductases as enzymes in the toolbox for synthetic chemistry. ChemCatChem 2017, 9, 1005–1017. [CrossRef][PubMed] 21. Khusnutdinova, A.N.; Flick, R.; Popovic, A.; Brown, G.; Tchigvintsev, A.; Nocek, B.; Correia, K.; Joo, J.C.; Mahadevan, R.; Yakunin, A.F. Exploring bacterial carboxylate reductases for the reduction of bifunctional carboxylic acids. Biotechnol. J. 2017.[CrossRef][PubMed] 22. Venkitasubramanian, P.; Daniels, L.; Rosazza, J.P. Reduction of carboxylic acids by Nocardia aldehyde oxidoreductase requires a phosphopantetheinylated enzyme. J. Biol. Chem. 2007, 282, 478–485. [CrossRef] [PubMed] 23. Lundemo, M.T.; Notonier, S.; Striedner, G.; Hauer, B.; Woodley, J.M. Process limitations of a whole-cell P450 catalyzed reaction using a CYP153A-CPR fusion construct expressed in Escherichia coli. Appl. Microbiol. Biotechnol. 2016, 100, 1197–1208. [CrossRef][PubMed] 24. Jeon, H.; Durairaj, P.; Lee, D.; Ahsan, M.M.; Yun, H. Improved nadph regeneration for fungal cytochrome P450 monooxygenase by co-expressing bacterial glucose dehydrogenase in resting-cell biotransformation of recombinant yeast. J. Microbiol. Biotechnol. 2016, 26, 2076–2086. [CrossRef][PubMed] 25. Jung, E.; Park, B.G.; Ahsan, M.M.; Kim, J.; Yun, H.; Choi, K.-Y.; Kim, B.-G. Production of ω-hydroxy palmitic acid using CYP153A35 and comparison of cytochrome P450 electron transfer system in vivo. Appl. Microbiol. Biotechnol. 2016, 100, 10375–10384. [CrossRef][PubMed] 26. Sambrook, J. Molecular Cloning: A Laboratory Manual/Joseph Sambrook, David W. Russell; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 2001. 27. Hanahan, D. Studies on transformation of escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [CrossRef] 28. Ahsan, M.M.; Jeon, H.; Nadarajan, S.P.; Chung, T.; Yoo, H.-W.; Kim, B.-G.; Patil, M.D.; Yun, H. Biosynthesis of the Nylon 12 monomer, ω-aminododecanoic acid with novel CYP153A, AlkJ, and ω-TA enzymes. Biotechnol. J. 2017.[CrossRef]

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).