OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC335588

GANC (NM_001301409) Human Untagged Clone Product data:

Product Type: Expression Plasmids Product Name: GANC (NM_001301409) Human Untagged Clone Tag: Tag Free Symbol: GANC Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001301409, the custom clone sequence may differ by one or more nucleotides

ATGGAAGCAGCAGTGAAAGAGGAAATAAGTCTTGAAGATGAAGCTGTAGATAAAAACATTTTCAGAGACT GTAACAAGATCGCATTTTACAGGCGTCAGAAACAGTGGCTTTCCAAGAAGTCCACCTATCAGGCATTATT GGATTCAGTCACAACAGATGAAGACAGCACCAGGTTCCAAATCATCAATGAAGCAAGTAAGGTTCCTCTC CTGGCTGAAATTTATGGTATAGAAGGAAACATTTTCAGGCTTAAAATTAATGAAGAGACTCCTCTAAAAC CCAGATTTGAAGTTCCGGATGTCCTCACAAGCAAGCCAAGCACTGTAAGGCTGATTTCATGCTCTGGGGA CACAGGCAGTCTGATATTGGCAGATGGAAAAGGAGACCTGAAGTGCCATATCACAGCAAACCCATTCAAG GTAGACTTGGTGTCTGAAGAAGAGGTTGTGATTAGCATAAATTCCCTGGGCCAATTATACTTTGAGCATC TACAGATTCTTCACAAACAAAGAGCTGCTAAAGAAAATGAGGAGGAGACATCAGTGGACACCTCTCAGGA AAATCAAGAAGATCTGGGCCTGTGGGAAGAGAAATTTGGAAAATTTGTGGATATCAAAGCTAATGGCCCT TCTTCTATTGGTTTGGATTTCTCCTTGCATGGATTTGAGCATCTTTATGGGATCCCACAACATGCAGAAT CACACCAACTTAAAAATACTGGTGATGGAGATGCTTACCGTCTTTATAACCTGGATGTCTATGGATACCA AATATATGATAAAATGGGCATTTATGGTTCAGTACCTTATCTCCTGGCCCACAAACTGGGCAGAACTATA GGTATTTTCTGGCTGAATGCCTCGGAAACACTGGTGGAGATCAATACAGAGCCTGCAGTAGAGTACACAC TGACCCAGATGGGCCCAGTTGCTGCTAAACAAAAGGTCAGATCTCGCACTCATGTGCACTGGATGTCAGA GAGTGGCATCATTGATGTTTTTCTGCTGACAGGACCTACACCTTCTGATGTCTTCAAACAGTACTCACAC CTTACAGACATTGGAGAAAAATAG

Restriction Sites: SgfI-MluI ACCN: NM_001301409 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 GANC (NM_001301409) Human Untagged Clone – SC335588

RefSeq: NM_001301409.1, NP_001288338.1

RefSeq Size: 2533 bp RefSeq ORF: 1074 bp Locus ID: 2595 UniProt ID: H3BN99 Families: Druggable Genome Protein Pathways: Galactose metabolism, Metabolic pathways, Starch and sucrose metabolism Summary: Glycosyl hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl family 31. This hydrolyses terminal, non- reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2) lacks several exons in the 3' coding region, and contains an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter, and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2