DOCSLIB.ORG

Alpa Sidhu , Justin R. Miller , Ashootosh Tripathi , Danielle M. Garshott , Amy L. Brownell , Daniel J. Chiego , Carl Arevang

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Alpa Sidhu , Justin R. Miller , Ashootosh Tripathi , Danielle M. Garshott , Amy L. Brownell , Daniel J. Chiego , Carl Arevang Alpa Sidhu€‡, Justin R. Miller€‡, Ashootosh Tripathi¶, Danielle M. Garshott€, Amy L. Brownell€, Daniel J. Chiego∑, Carl Arevang¶, Qinghua Zeng€, Leah C. Jackson€, Shelby A. Bechler€, Michael U. Calla- ghan€, George H. YooÖ, Seema Sethiñ, Ho-Sheng LinÖ, Joseph H. Callaghan§, Giselle Tamayo- CastilloØ, David H. Sherman¶, *, Randal J. KaufmanΩ, * and Andrew M. Fribley€,Ö, ≠,* € Carmen and Ann Adams Department of Pediatrics, Wayne State University School of Medicine, Detroit, MI 48201 ¶ Life Sciences Institute and Departments of Medicinal Chemistry, Chemistry, Microbiology & Immunology, University of Michigan, Ann Arbor, MI 48109 ∑ Cariology, Restorative Sciences and Endodontics, University of Michigan School of Dentistry, Ann Arbor, MI 48109 Ö Department of Otolaryngology, Wayne State University and Karmanos Cancer Institute, Detroit, MI 48201 ñ Department of Pathology, Wayne State University and Karmanos Cancer Institute, Detroit, MI 48201 § School of Business Administration, Oakland University, Rochester, MI 48309 ØInstituto Nacional de Biodiversidad, 3100-Heredia, CIPRONA-Escuela de Química, Universidad de Costa Rica Ω Degenerative Disease Research Program, Center for Cancer Research, Sanford|Burnham Medical Research Institute, La Jolla, CA 92037 ≠ Developmental Therapeutics Program, Barbara Ann Karmanos Cancer Institute, Detroit, MI 48201 ‡ These authors contributed equally Contents: Page: Experimental Procedures 2 - 3 Figure S1. SEM RT-qPCR, Leukemia proliferation, and Leukemia Casp3/7-glo 4 Table S1. UPR Gene Array. 5-7 Table S2. DNA Damage Gene Array. 8-10 Table S3. Apoptosis Gene Array. 11-13 Figure S2. Comparison of two borrelidin samples purchased from Sigma. 14 Figure S3. RT-qPCR analysis of OSCC cell lines reveals expression of cell UPR genes in 15 response to borrelidin. Figure S4. RT-qPCR analysis of OSCC cell lines reveals expression of cell death genes in 16 response to borrelidin. Figure S5. ATF4 MEF Proliferation and RT-qPCR. 17 Figure S6. HRESIMS spectrum for borrelidin CR1 2. 18 13 Figure S7. C NMR spectrum of borrelidin CR1 2 recorded at 600 MHz (in CDCl3). 19 1 Figure S8. H NMR spectrum of borrelidin CR1 2 recorded at 600 MHz (in CDCl3). 20 Table S4. NMR spectroscopic data for borrelidin CR1 2 and CR2 3 in CDCl3 and CD3OD 21 at 600 MHz. Figure S9. gCOSY spectrum of borrelidin CR1 2 recorded at 600 MHz (in CDCl3). 22 1 Figure S10. HMBCAD spectrum of borrelidin CR1 2 recorded at 600 MHz (in CDCl3). 23 Figure S11. HSQCAD spectrum of borrelidin CR1 2 recorded at 600 MHz (in CDCl3). 24 Figure S12. Planar structure of borrelidin CR1 2; showing COSY correlation with bold bonds 25 and HMBC correlations with arrow in borrelidin CR1 2. Figure S13. HRESIMS spectrum for borrelidin CR2 3. 26 1 Figure S14. H NMR spectrum of borrelidin CR2 3 recorded at 600 MHz (in CD3OD). 27 Figure S15. gCOSY spectrum of borrelidin CR2 3 recorded at 600 MHz (in CD3OD). 28 Figure S16. HMBCAD spectrum of borrelidin CR2 3 recorded at 600 MHz (in CD3OD). 29 Figure S17. HSQCAD spectrum of borrelidin CR2 3 recorded at 600 MHz (in CD3OD). 30 Experimental Procedures Borrelidin isolation and purification. The parent borrelidin 1 that we identified is commercially available so a detailed structural 20 characterization was not pursued. Borrelidin 1: Isolated as white amorphous solid: [α] D -10.3 (c 0.20, MeOH); IR (film) 3324, -1 2952, 2214, 1699, 1602, 1456, 1377, 1143 cm ; UVmax (λ212 (log ε 3.24), 254 (log ε 2.93), and 280 (log ε 2.51). Borrelidin CR1 2: 20 -1 Isolated as white amorphous solid: [α] D -10.1 (c 0.20, MeOH); IR (film) 3321, 2941, 2215, 1702, 1602, 1456, 1365, 1141 cm ; UVmax (λ) 212 (log ε 3.24), 254 (log ε 2.93), and 280 (log ε 2.51). 2 was determined to have a molecular formula of C28H44N2O5 as suggested by HRESIMS based on [M+Na]+ ion peak at m/z 511.1148 (Figure S6). The 13C and 1H NMR spectra revealed that the molecule was polyketidic in nature; subsequent dereplication revealed it to be a natural product precedent of a known synthetic 13 antibacterial molecule (Figures S7 – 8). The C NMR spectrum recorded in CDCl3 indicated the presence of at least three oxygen- ated methines with chemical shifts at δ 69.5, 73.02 and 76.5 (Table S4). The 13C NMR spectra also indicated two carbonyls (δ 172.5, 178.9) and five signals between δ 118.5- 143.9 indicating the presence of two or three double bonds. These initial NMR analyses accounted for only five of the eight suggested degrees of unsaturation from the molecular formula indicating that the mol- ecule might be macrocyclic. The connectivity from C-1 to C-11 was confirmed by an array of extensive 2D NMR spectra (COSY and HMBC) to construe an 11-carbon aliphatic straight chain starting from a characteristic carbonyl carbon at δC 172.5 (Figures S9- 1 11). Another set of COSY rallying was observed between H-13 to H-17 with the H chemical shifts at C-13 (δH 6.82 (d), δC 143.9), C-14 (δH 6.37 (dd), δC 126.8) and C-15 (δH 6.23 (ddd), δC 138.8) revealing conjugated double bonds with C-13 connected to C-11 via a quaternary carbon at C-12 (δC 118.5). HMBC correlations were observed from H-11 and H-13 to a quaternary carbon C-22 with δC 120.5 suggesting the presence of an isonitrile group. In addition, the pendant attachment of a cyclopentane ring at C-17 was 1 constructed using COSY correlations from H-1’ to H-5’ (Figure S12). The H chemical shift at C-5’ (δH 2.39, δC 49.4) along with an HMBC correlation to δC 178.1 suggested an adjacent carbonyl group completing the connection of the carbonyl to cyclopentane ring. All of these conclusively accounted for the eight degrees of unsaturation initially suggested. Furthermore, the presence of an amine group next to C-6’ fulfilled the requirement of the molecular formula to provide the planar structure of 2. Borrelidin CR2 3: 20 -1 Isolated as white amorphous solid: [α] D -9.8 (c 0.20, MeOH); IR (film) 3300, 2823, 1675, 1423, 1325, 1140 cm ; UVmax (λ) 212 (log ε 3.11), and 280 (log ε 2.28). Cell lines, tumor sections and reagents. Dr. Thomas Carey at the University of Michigan provided sequence validated human OSCC cell lines UMSCC1, UMSCC14A, and UMSCC23. The epidermoid carcinoma cell line A-253 (HTB-41) was from ATCC (Manassas, VA). A549 BAX-/-/-/-, BAK-/- lung adenocarcinoma cells (CLLS1015) were from Sigma-Aldrich (St. Louis, MO). All cell lines were cultured in DMEM with pen-strep and 10% FBS. A549 cells were additionally supplemented with MEM non- essential amino acids Life Technologies (Grand Island, NY) and murine embryonic fibroblast medium was supplemented with es- sential and non-essential amino acids. Commercially obtained borrelidin (B3061) was from Sigma-Aldrich. Immunohistochemistry. Formalin fixed paraffin embedded human head and neck surgical specimens were obtained from Karmanos Cancer Institute (KCI), Detroit, MI with approval from the KCI Protocol Review and Monitoring Committee and the Wayne State University Institutional Review Board. Written informed consent from the donor or the next of kin was obtained for the use of these samples in research. Monoclonal anti-GRP78/BiP (#3177) from Cell Signaling (Beverly, MA) was diluted 1:250 and incubated overnight on tissue sections at 4°C; bound antibodies were detected with the ImmPACT NovaRED peroxidase sub- strate kit from Vector Laboratories (Burlingame, CA). PCR Quantitative real time reverse-transcription PCR (qRT-PCR) and conventional reverse-transcription PCR (RT-PCR) were performed with cDNA prepared with Cells to CT™ from Life Technologies (Carlsbad, CA), as previously described 1. Semi- quantitative RT-PCR analysis of spliced and un-spliced XBP1 was performed with a single human-specific primer pair ACA CGC TTG GGA ATG GAC AC (forward) and CCA TGG GAA GAT GTT CTG GG (reverse); amplicons were electrophoresed on a 2 0.8% agarose gel. 18s ribosomal subunit RNA was used as internal control, fold changes calculated using the delta delta CT method. Quantitative reverse transcription real-time PCR was performed with the following Taqman primer/probe sets from Life Technologies (Grand Island, NY): Human: CHOP/DDIT3 (Hs01090850_m1), 18s (Hs99999901_s1), GADD34 (Hs00169585_m1), ATF3 (Hs00910173_m1), ATF4 (Hs00909569_g1), BiP/GRP78 (Hs99999174_m1), DR5 (Hs00366278_m1), TRB3 (Hs00221754_m1), XBP1s (spliced) (Hs03929085_g1), BIM (Hs00708019_s1), NOXA (Hs00560402_m1), PUMA (Hs00248075_m1), GADD45α (Hs00169255_m1), CEBPβ (Hs00270923_s1), and IRE1α (Hs00176385_m1); Mouse: Noxa (Mm00451763_m1), Puma (Mm00519268_m1), Dr5 (Mm00457866_m1), Trb3 (Mm00454879_m1), and Gadd45β (Mm00435123_m1). Viability and Caspase Assays. Presto Blue Cell Viability Reagent (A21361) from Life Technologies or the luminescent Cell Titer- Glo Cell Viability Assay (G7570) from Promega (Madison, WI) were used according to the manufacturers’ protocols; two-way ANOVA analysis was used to appreciate differences in proliferation. Caspase activation was measured with the luminescent Caspase-Glo 3/7 Assay from Promega. 5000 – 10,000 cells/well were added to 96 well tissue-culture plates the day before treat- ment, as indicated. All experiments were performed at least three times with biologic (triplicate) replicates. DNA Laddering. Genomic DNA was harvested from borrelidin and vehicle treated cells by incubating cell pellets in DNA lysis buffer containing 100 µg/ml proteinase K as previously described 25. Briefly, DNA was extracted two times with Phe- nol:Chloroform:Isoamyl Alcohol and two times with chloroform alone. Precipitated DNA was washed with 70% ethanol, re- suspended in TE supplemented with 0.25 mg/ml RNAse A, and 5µg was electrophoretically resolved on a 1.5% agarose gel. 3 Figure S1. SEM RT-qPCR, Leukemia proliferation, and Leukemia Casp3/7-glo. A. Veh. Tm 0.15625 0.3125 1.25 2.5 5µM 200 150 100 Fold (mRNA) Fold 50 0 CHOP XBP GADD34 ATF4 DR5 NOXA PUMA GADD45A BIM UPR Cell Death B.
Load more

Recommended publications
  • Glycoproteomics-Based Signatures for Tumor Subtyping and Clinical Outcome Prediction of High-Grade Serous Ovarian Cancer
    ARTICLE https://doi.org/10.1038/s41467-020-19976-3 OPEN Glycoproteomics-based signatures for tumor subtyping and clinical outcome prediction of high-grade serous ovarian cancer Jianbo Pan 1,2,3, Yingwei Hu1,3, Shisheng Sun 1,3, Lijun Chen1, Michael Schnaubelt1, David Clark1, ✉ Minghui Ao1, Zhen Zhang1, Daniel Chan1, Jiang Qian2 & Hui Zhang 1 1234567890():,; Inter-tumor heterogeneity is a result of genomic, transcriptional, translational, and post- translational molecular features. To investigate the roles of protein glycosylation in the heterogeneity of high-grade serous ovarian carcinoma (HGSC), we perform mass spectrometry-based glycoproteomic characterization of 119 TCGA HGSC tissues. Cluster analysis of intact glycoproteomic profiles delineates 3 major tumor clusters and 5 groups of intact glycopeptides. It also shows a strong relationship between N-glycan structures and tumor molecular subtypes, one example of which being the association of fucosylation with mesenchymal subtype. Further survival analysis reveals that intact glycopeptide signatures of mesenchymal subtype are associated with a poor clinical outcome of HGSC. In addition, we study the expression of mRNAs, proteins, glycosites, and intact glycopeptides, as well as the expression levels of glycosylation enzymes involved in glycoprotein biosynthesis pathways in each tumor. The results show that glycoprotein levels are mainly controlled by the expression of their individual proteins, and, furthermore, that the glycoprotein-modifying glycans cor- respond to the protein levels of glycosylation enzymes. The variation in glycan types further shows coordination to the tumor heterogeneity. Deeper understanding of the glycosylation process and glycosylation production in different subtypes of HGSC may provide important clues for precision medicine and tumor-targeted therapy.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • The Cgmp-Dependent Protein Kinase 2 Contributes to Cone Photoreceptor Degeneration in the Cnga3-Deficient Mouse Model of Achroma
    International Journal of Molecular Sciences Article The cGMP-Dependent Protein Kinase 2 Contributes to Cone Photoreceptor Degeneration in the Cnga3-Deficient Mouse Model of Achromatopsia Mirja Koch 1, Constanze Scheel 1, Hongwei Ma 2, Fan Yang 2, Michael Stadlmeier 3,† , Andrea F. Glück 3, Elisa Murenu 1,4, Franziska R. Traube 3 , Thomas Carell 3, Martin Biel 1, Xi-Qin Ding 2 and Stylianos Michalakis 1,4,* 1 Department of Pharmacy—Center for Drug Research, Ludwig-Maximilians-University, 81377 Munich, Germany; [email protected] (M.K.); [email protected] (C.S.); [email protected] (E.M.); [email protected] (M.B.) 2 Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104, USA; [email protected] (H.M.); [email protected] (F.Y.); [email protected] (X.-Q.D.) 3 Department of Chemistry, Ludwig-Maximilians-University, 81377 Munich, Germany; [email protected] (M.S.); [email protected] (A.F.G.); [email protected] (F.R.T.); [email protected] (T.C.) 4 Department of Ophthalmology, Ludwig-Maximilians-University, 80336 Munich, Germany * Correspondence: [email protected] † Present affiliation: Lewis-Sigler Institute for Integrative Genomics, Princeton University, NJ 08544, USA. Abstract: Mutations in the CNGA3 gene, which encodes the A subunit of the cyclic guanosine monophosphate (cGMP)-gated cation channel in cone photoreceptor outer segments, cause total colour blindness, also referred to as achromatopsia. Cones lacking this channel protein are non- functional, accumulate high levels of the second messenger cGMP and degenerate over time after induction of ER stress.
    [Show full text]
  • An Investigation Into the Genetic Architecture of Multiple System Atrophy and Familial Parkinson's Disease
    An investigation into the genetic architecture of multiple system atrophy and familial Parkinson’s disease By Monica Federoff A thesis submitted to University College London for the degree of Doctor of Philosophy Laboratory of Neurogenetics, Department of Molecular Neuroscience, Institute of Neurology, University College London (UCL) 2 I, Monica Federoff, confirm that the work presented in this thesis is my own. Information derived from other sources and collaborative work have been indicated appropriately. Signature: Date: 09/06/2016 3 Acknowledgements: When I first joined the Laboratory of Neurogenetics (LNG), NIA, NIH as a summer intern in 2008, I had minimal experience working in a laboratory and was both excited and anxious at the prospect of it. From my very first day, Dr. Andrew Singleton was incredibly welcoming and introduced me to my first mentor, Dr. Javier Simon- Sanchez. Within just ten weeks working in the lab, both Dr. Singleton and Dr. Simon- Sanchez taught me the fundamental skills in an encouraging and supportive environment. I quickly got to know others in the lab, some of whom are still here today, and I sincerely appreciate their help with my assimilation into the LNG. After returning for an additional summer and one year as an IRTA postbac, I was honored to pursue a PhD in such an intellectually stimulating and comfortable environment. I am so grateful that Dr. Singleton has been such a wonderful mentor, as he is not only a brilliant scientist, but also extremely personable and approachable. If I inquire about meeting with him, he always manages to make time in his busy schedule and provides excellent guidance and mentorship.
    [Show full text]
  • GANC (NM 001301409) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC335588 GANC (NM_001301409) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: GANC (NM_001301409) Human Untagged Clone Tag: Tag Free Symbol: GANC Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001301409, the custom clone sequence may differ by one or more nucleotides ATGGAAGCAGCAGTGAAAGAGGAAATAAGTCTTGAAGATGAAGCTGTAGATAAAAACATTTTCAGAGACT GTAACAAGATCGCATTTTACAGGCGTCAGAAACAGTGGCTTTCCAAGAAGTCCACCTATCAGGCATTATT GGATTCAGTCACAACAGATGAAGACAGCACCAGGTTCCAAATCATCAATGAAGCAAGTAAGGTTCCTCTC CTGGCTGAAATTTATGGTATAGAAGGAAACATTTTCAGGCTTAAAATTAATGAAGAGACTCCTCTAAAAC CCAGATTTGAAGTTCCGGATGTCCTCACAAGCAAGCCAAGCACTGTAAGGCTGATTTCATGCTCTGGGGA CACAGGCAGTCTGATATTGGCAGATGGAAAAGGAGACCTGAAGTGCCATATCACAGCAAACCCATTCAAG GTAGACTTGGTGTCTGAAGAAGAGGTTGTGATTAGCATAAATTCCCTGGGCCAATTATACTTTGAGCATC TACAGATTCTTCACAAACAAAGAGCTGCTAAAGAAAATGAGGAGGAGACATCAGTGGACACCTCTCAGGA AAATCAAGAAGATCTGGGCCTGTGGGAAGAGAAATTTGGAAAATTTGTGGATATCAAAGCTAATGGCCCT TCTTCTATTGGTTTGGATTTCTCCTTGCATGGATTTGAGCATCTTTATGGGATCCCACAACATGCAGAAT CACACCAACTTAAAAATACTGGTGATGGAGATGCTTACCGTCTTTATAACCTGGATGTCTATGGATACCA AATATATGATAAAATGGGCATTTATGGTTCAGTACCTTATCTCCTGGCCCACAAACTGGGCAGAACTATA GGTATTTTCTGGCTGAATGCCTCGGAAACACTGGTGGAGATCAATACAGAGCCTGCAGTAGAGTACACAC TGACCCAGATGGGCCCAGTTGCTGCTAAACAAAAGGTCAGATCTCGCACTCATGTGCACTGGATGTCAGA
    [Show full text]
  • Global Mapping of Herpesvirus-‐Host Protein Complexes Reveals a Novel Transcription
    Global mapping of herpesvirus-host protein complexes reveals a novel transcription strategy for late genes By Zoe Hartman Davis A dissertation submitted in partial satisfaction of the Requirements for the degree of Doctor of Philosophy in Infectious Disease and Immunity in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Britt A. Glaunsinger, Chair Professor Laurent Coscoy Professor Qiang Zhou Spring 2015 Abstract Global mapping of herpesvirus-host protein complexes reveals a novel transcription strategy for late genes By Zoe Hartman Davis Doctor of Philosophy in Infectious Diseases and Immunity University of California, Berkeley Professor Britt A. Glaunsinger, Chair Mapping host-pathogen interactions has proven instrumental for understanding how viruses manipulate host machinery and how numerous cellular processes are regulated. DNA viruses such as herpesviruses have relatively large coding capacity and thus can target an extensive network of cellular proteins. To identify the host proteins hijacked by this pathogen, we systematically affinity tagged and purified all 89 proteins of Kaposi’s sarcoma-associated herpesvirus (KSHV) from human cells. Mass spectrometry of this material identified over 500 high-confidence virus-host interactions. KSHV causes AIDS-associated cancers and its interaction network is enriched for proteins linked to cancer and overlaps with proteins that are also targeted by HIV-1. This work revealed many new interactions between viral and host proteins. I have focused on one interaction in particular, that of a previously uncharacterized KSHV protein, ORF24, with cellular RNA polymerase II (RNAP II). All DNA viruses encode a class of genes that are expressed only late in the infectious cycle, following replication of the viral genome.
    [Show full text]
  • Genetic Complexity of Autosomal Dominant Polycystic Kidney and Liver Diseases
    BRIEF REVIEW www.jasn.org Genetic Complexity of Autosomal Dominant Polycystic Kidney and Liver Diseases Emilie Cornec-Le Gall,1,2 Vicente E. Torres,1 and Peter C. Harris1 1Division of Nephrology and Hypertension, Mayo Clinic, Rochester, Minnesota; and 2Department of Nephrology, University Hospital, European University of Brittany, and National Institute of Health and Medical Sciences, INSERM U1078, Brest, France ABSTRACT Data indicate significant phenotypic and genotypic overlap, plus a common patho- ADPLD (Table 1).15–20 The difference in genesis, between two groups of inherited disorders, autosomal dominant polycystic renal survival between PKD1 and PKD2 kidney diseases (ADPKD), a significant cause of ESRD, and autosomal dominant patients has been highlighted in multiple polycystic liver diseases (ADPLD), which result in significant PLD with minimal studies (Table 2).3,21 In addition, PKD1 PKD. Eight genes have been associated with ADPKD (PKD1 and PKD2), ADPLD patients have a larger height-adjusted total (PRKCSH, SEC63, LRP5, ALG8,andSEC61B), or both (GANAB). Although genetics kidney volume (HtTKV; an early measure is only infrequently used for diagnosing these diseases and prognosing the associ- of the severity of renal disease in ADPKD) ated outcomes, its value is beginning to be appreciated, and the genomics revolu- and lower eGFR than PKD2 patients.14,22 tion promises more reliable and less expensive molecular diagnostic tools for these A further difference is the number of kid- diseases. We therefore propose categorization of patients with a phenotypic and ney cysts, with fewer in PKD2 than PKD1 genotypic descriptor that will clarify etiology, provide prognostic information, and (Figure 1, A and C), although the rate of better describe atypical cases.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Newborn Screening for Pompe Disease
    Newborn Screening for Pompe Disease • Wuh-Liang Hwu, Yin-Hsiu Chien and Raymond Wang Newborn Screening for Pompe Disease Edited by Wuh-Liang Hwu, Yin-Hsiu Chien and Raymond Wang Printed Edition of the Special Issue Published in International Journal of Neonatal Screening www.mdpi.com/journal/IJNS Newborn Screening for Pompe Disease Newborn Screening for Pompe Disease Editors Wuh-Liang Hwu Yin-Hsiu Chien Raymond Wang MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade • Manchester • Tokyo • Cluj • Tianjin Editors Wuh-Liang Hwu Yin-Hsiu Chien Raymond Wang National Taiwan University National Taiwan University Children’s Hospital of Orange Hospital Hospital County Taiwan Taiwan USA Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal International Journal of Neonatal Screening (ISSN 2409-515X) (available at: https://www.mdpi.com/ journal/IJNS/special issues/pompe). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Volume Number, Page Range. ISBN 978-3-0365-0580-0 (Hbk) ISBN 978-3-0365-0581-7 (PDF) Cover image courtesy of the American Academy of Pediatrics. © 2021 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications.
    [Show full text]
  • Multiplexed Engineering Glycosyltransferase Genes in CHO Cells Via Targeted Integration for Producing Antibodies with Diverse Complex‑Type N‑Glycans Ngan T
    www.nature.com/scientificreports OPEN Multiplexed engineering glycosyltransferase genes in CHO cells via targeted integration for producing antibodies with diverse complex‑type N‑glycans Ngan T. B. Nguyen, Jianer Lin, Shi Jie Tay, Mariati, Jessna Yeo, Terry Nguyen‑Khuong & Yuansheng Yang* Therapeutic antibodies are decorated with complex‑type N‑glycans that signifcantly afect their biodistribution and bioactivity. The N‑glycan structures on antibodies are incompletely processed in wild‑type CHO cells due to their limited glycosylation capacity. To improve N‑glycan processing, glycosyltransferase genes have been traditionally overexpressed in CHO cells to engineer the cellular N‑glycosylation pathway by using random integration, which is often associated with large clonal variations in gene expression levels. In order to minimize the clonal variations, we used recombinase‑mediated‑cassette‑exchange (RMCE) technology to overexpress a panel of 42 human glycosyltransferase genes to screen their impact on antibody N‑linked glycosylation. The bottlenecks in the N‑glycosylation pathway were identifed and then released by overexpressing single or multiple critical genes. Overexpressing B4GalT1 gene alone in the CHO cells produced antibodies with more than 80% galactosylated bi‑antennary N‑glycans. Combinatorial overexpression of B4GalT1 and ST6Gal1 produced antibodies containing more than 70% sialylated bi‑antennary N‑glycans. In addition, antibodies with various tri‑antennary N‑glycans were obtained for the frst time by overexpressing MGAT5 alone or in combination with B4GalT1 and ST6Gal1. The various N‑glycan structures and the method for producing them in this work provide opportunities to study the glycan structure‑and‑function and develop novel recombinant antibodies for addressing diferent therapeutic applications.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]