DOCSLIB.ORG

University of Florida Thesis Or Dissertation Formatting

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Florida Thesis Or Dissertation Formatting RNA-SEQ REVEALS NOVEL GENES AND PATHWAYS INVOLVED IN BOVINE MAMMARY INVOLUTION DURING THE DRY PERIOD AND UNDER ENVIRONMENTAL HEAT STRESS By BETHANY M. DADO SENN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2018 © 2018 Bethany M. Dado Senn To my family, the true dairy enthusiasts ACKNOWLEDGMENTS To my advisor, mentor, and friend Dr. Jimena Laporta, I am humbled and grateful to have served as your graduate student as you provided invaluable advice and kindness throughout my projects. Your open-door policy has facilitated my growth both personally and professionally. Thank you for the opportunity to research lactation physiology, volunteer and teach, and pursue a degree at the University of Florida. I extend my appreciation to my committee members Dr. Geoffrey Dahl and Dr. Pete Hansen for utilizing their many years of experience to provide useful critiques and additional insight into my analysis and interpretations. Thank you to Dr. Hansen for the use of Ingenuity Pathway Analysis® and to Dr. Dahl for his heat stress expertise. I thank the faculty and staff in the Department of Animal Sciences at the University of Florida, especially Dr. Francisco Peñagaricano for his vital RNA- sequencing and statistical contribution to my thesis project. Further thanks to Dr. Corwin Nelson, Dr. Stephanie Wohlgemuth, and Dr. John Bromfield for use of lab space and research support. Special appreciation goes to Joyce Hayen, Pam Krueger, and Renee Parks-James and the UF Dairy Unit staff. I also express appreciation to the Animal Molecular and Cellular Biology program, the Brélan E. Moritz family, and the National Dairy Shrine for funding a portion of my education. I am grateful for my supportive laboratory community for their assistance with projects and papers, not to mention the memories and laughter accumulated from long nights in the lab. Special thanks to Dr. Amy Skibiel for being an incredible role model and mentoring me through assays, presentations, and paper writing, Catalina Mejia Bonilla for being my first UF friend and research confidante, Marcela Marérro-Perez and Sena Field for bringing joy into research, Thiago Fabris for his guidance on-farm, and 4 Debora da Silva, Carolina Collazos, Fabiana Corra, and Therus Brown for their assistance with various aspects of my research projects including sample collection, analysis, and presentation practice. Thanks to my undergraduate role models Dr. Laura Hernandez, Dr. Hasan Khatib, Dr. Marina Danes, Dr. Michel Wattiaux, Ryan Pralle, Nicole Gross, and Patti Hurtgen for helping me find academic direction and pointing me to UF. Thank you to my friends near and far—Jessi and Cody Getschel, Saager Paliwal, Eleanor Miller, Katey Scholz, Mykayla Getschel, Alexus and Josh Berndt, Mackenzie Dickson, and the Flores, Tyler, Sy, and Guernsey families—for listening to my crazy lab stories, offering solutions to my dilemmas, and being truly genuine friends throughout the journey. I would like to give special thanks to my loving family. Thank you to my parents, Rick and Gwen Dado, for serving as excellent examples of academics and dairy producers. To my siblings Ethan, Trent, and Meikah Dado, thank you for praying for me and setting the bar high for success. I thank my extended families, specially my Grandma Thelma Betzold, Grandpa Gary Dado, and Grandma Arlene Dado, and my in- laws Jim, Deb, and Ted Senn and Jeremy and Tracy Keifenheim for the many phone calls inquiring about my research. And to my husband, Travis Senn: thank you for moving across the country for me, challenging me academically and spiritually, and providing for our beautiful future. I look forward to all our adventures to come. Finally, I give thanks to my Heavenly Father who has granted me strength and patience for the journey and the talents and resources to serve others through this degree. To God be the Glory. 5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF OBJECTS ....................................................................................................... 10 LIST OF ABBREVIATIONS ........................................................................................... 11 ABSTRACT ................................................................................................................... 13 CHAPTER 1 LITERATURE REVIEW .......................................................................................... 15 The Bovine Mammary Gland Dry Period ................................................................ 15 Physiology of the Dry Period ............................................................................ 16 Molecular Regulators of Mammary Involution and Redevelopment ................. 18 Heat Stress in Dairy Cattle ...................................................................................... 21 Heat Stress During the Dry Period ................................................................... 25 Mammary Gene Expression under Heat Stress ............................................... 27 RNA-Sequencing Technology ................................................................................. 30 Transcriptome Analysis Technology Comparisons ........................................... 32 RNA-Sequencing Application in Bovine Research ........................................... 34 Summary ................................................................................................................ 35 2 RNA-SEQ REVEALS NOVEL GENES AND PATHWAYS INVOLVED IN BOVINE MAMMARY INVOLUTION DURING THE DRY PERIOD AND UNDER ENVIRONMENTAL HEAT STRESS ....................................................................... 37 Abstract ................................................................................................................... 37 Introduction ............................................................................................................. 38 Materials and Methods............................................................................................ 40 Animals, Treatments, and Experimental Design ............................................... 40 Mammary Tissue Collection and RNA Extraction ............................................. 40 Library Generation and RNA Sequencing ........................................................ 41 Identification of Differentially Expressed Genes, Pathways, and Regulators ... 42 Results .................................................................................................................... 44 Physiological Parameters and Milk Yield .......................................................... 44 Ingenuity® Pathways Analysis (IPA®) Regulator and Network Analysis............ 47 Differentially Expressed Genes and Regulators Impacted by Heat Stress ....... 48 Discussion .............................................................................................................. 49 Conclusions ............................................................................................................ 59 6 3 GENERAL DISCUSSION AND SUMMARY ............................................................ 87 APPENDIX: TABLES IN LINKS .................................................................................... 92 LIST OF REFERENCES ............................................................................................... 93 BIOGRAPHICAL SKETCH .......................................................................................... 109 7 LIST OF TABLES Table page 2-1 Primer sequences for genes utilized for quantitative real-time PCR (qRT- PCR) validation of RNA-Seq results in bovine mammary tissue......................... 60 2-2 Top KEGG pathways and MeSH terms along with their corresponding DEGs in bovine mammary tissue during transition between lactation to involution. ...... 61 2-3 Top KEGG pathways and MeSH terms along with their corresponding DEGs inbovine mammary tissue during early involution. .............................................. 69 2-4 Differentially expressed genes (DEGs) in bovine mammary tissue during steady-state involution and redevelopment. ....................................................... 71 2-5 Differentially expressed genes (DEGs) in bovine mammary tissue between heat-stressed and cooled cows during the dry period. ....................................... 73 8 LIST OF FIGURES Figure page 2-1 Pictorial representation of experimental design. ................................................ 79 2-2 Volcano plot of DEGs in bovine mammary tissue during early involution (D3 vs. D-3 and D7 vs. D3). ...................................................................................... 80 2-3 Significantly enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and Medical Subject Headings (MeSH) terms in bovine mammary tissue during early involution (D3 vs. D-3 and D7 vs. D3). ................................. 81 2-4 Ingenuity® Pathway Analysis (IPA®) upstream regulators and summary network in bovine mammary tissue comparing D3 vs. D-3 relative to dry-off. .... 82 2-5 Ingenuity® Pathway Analysis (IPA®) upstream regulators
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • The Cgmp-Dependent Protein Kinase 2 Contributes to Cone Photoreceptor Degeneration in the Cnga3-Deficient Mouse Model of Achroma
    International Journal of Molecular Sciences Article The cGMP-Dependent Protein Kinase 2 Contributes to Cone Photoreceptor Degeneration in the Cnga3-Deficient Mouse Model of Achromatopsia Mirja Koch 1, Constanze Scheel 1, Hongwei Ma 2, Fan Yang 2, Michael Stadlmeier 3,† , Andrea F. Glück 3, Elisa Murenu 1,4, Franziska R. Traube 3 , Thomas Carell 3, Martin Biel 1, Xi-Qin Ding 2 and Stylianos Michalakis 1,4,* 1 Department of Pharmacy—Center for Drug Research, Ludwig-Maximilians-University, 81377 Munich, Germany; [email protected] (M.K.); [email protected] (C.S.); [email protected] (E.M.); [email protected] (M.B.) 2 Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104, USA; [email protected] (H.M.); [email protected] (F.Y.); [email protected] (X.-Q.D.) 3 Department of Chemistry, Ludwig-Maximilians-University, 81377 Munich, Germany; [email protected] (M.S.); [email protected] (A.F.G.); [email protected] (F.R.T.); [email protected] (T.C.) 4 Department of Ophthalmology, Ludwig-Maximilians-University, 80336 Munich, Germany * Correspondence: [email protected] † Present affiliation: Lewis-Sigler Institute for Integrative Genomics, Princeton University, NJ 08544, USA. Abstract: Mutations in the CNGA3 gene, which encodes the A subunit of the cyclic guanosine monophosphate (cGMP)-gated cation channel in cone photoreceptor outer segments, cause total colour blindness, also referred to as achromatopsia. Cones lacking this channel protein are non- functional, accumulate high levels of the second messenger cGMP and degenerate over time after induction of ER stress.
    [Show full text]
  • An Investigation Into the Genetic Architecture of Multiple System Atrophy and Familial Parkinson's Disease
    An investigation into the genetic architecture of multiple system atrophy and familial Parkinson’s disease By Monica Federoff A thesis submitted to University College London for the degree of Doctor of Philosophy Laboratory of Neurogenetics, Department of Molecular Neuroscience, Institute of Neurology, University College London (UCL) 2 I, Monica Federoff, confirm that the work presented in this thesis is my own. Information derived from other sources and collaborative work have been indicated appropriately. Signature: Date: 09/06/2016 3 Acknowledgements: When I first joined the Laboratory of Neurogenetics (LNG), NIA, NIH as a summer intern in 2008, I had minimal experience working in a laboratory and was both excited and anxious at the prospect of it. From my very first day, Dr. Andrew Singleton was incredibly welcoming and introduced me to my first mentor, Dr. Javier Simon- Sanchez. Within just ten weeks working in the lab, both Dr. Singleton and Dr. Simon- Sanchez taught me the fundamental skills in an encouraging and supportive environment. I quickly got to know others in the lab, some of whom are still here today, and I sincerely appreciate their help with my assimilation into the LNG. After returning for an additional summer and one year as an IRTA postbac, I was honored to pursue a PhD in such an intellectually stimulating and comfortable environment. I am so grateful that Dr. Singleton has been such a wonderful mentor, as he is not only a brilliant scientist, but also extremely personable and approachable. If I inquire about meeting with him, he always manages to make time in his busy schedule and provides excellent guidance and mentorship.
    [Show full text]
  • GANC (NM 001301409) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC335588 GANC (NM_001301409) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: GANC (NM_001301409) Human Untagged Clone Tag: Tag Free Symbol: GANC Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001301409, the custom clone sequence may differ by one or more nucleotides ATGGAAGCAGCAGTGAAAGAGGAAATAAGTCTTGAAGATGAAGCTGTAGATAAAAACATTTTCAGAGACT GTAACAAGATCGCATTTTACAGGCGTCAGAAACAGTGGCTTTCCAAGAAGTCCACCTATCAGGCATTATT GGATTCAGTCACAACAGATGAAGACAGCACCAGGTTCCAAATCATCAATGAAGCAAGTAAGGTTCCTCTC CTGGCTGAAATTTATGGTATAGAAGGAAACATTTTCAGGCTTAAAATTAATGAAGAGACTCCTCTAAAAC CCAGATTTGAAGTTCCGGATGTCCTCACAAGCAAGCCAAGCACTGTAAGGCTGATTTCATGCTCTGGGGA CACAGGCAGTCTGATATTGGCAGATGGAAAAGGAGACCTGAAGTGCCATATCACAGCAAACCCATTCAAG GTAGACTTGGTGTCTGAAGAAGAGGTTGTGATTAGCATAAATTCCCTGGGCCAATTATACTTTGAGCATC TACAGATTCTTCACAAACAAAGAGCTGCTAAAGAAAATGAGGAGGAGACATCAGTGGACACCTCTCAGGA AAATCAAGAAGATCTGGGCCTGTGGGAAGAGAAATTTGGAAAATTTGTGGATATCAAAGCTAATGGCCCT TCTTCTATTGGTTTGGATTTCTCCTTGCATGGATTTGAGCATCTTTATGGGATCCCACAACATGCAGAAT CACACCAACTTAAAAATACTGGTGATGGAGATGCTTACCGTCTTTATAACCTGGATGTCTATGGATACCA AATATATGATAAAATGGGCATTTATGGTTCAGTACCTTATCTCCTGGCCCACAAACTGGGCAGAACTATA GGTATTTTCTGGCTGAATGCCTCGGAAACACTGGTGGAGATCAATACAGAGCCTGCAGTAGAGTACACAC TGACCCAGATGGGCCCAGTTGCTGCTAAACAAAAGGTCAGATCTCGCACTCATGTGCACTGGATGTCAGA
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Newborn Screening for Pompe Disease
    Newborn Screening for Pompe Disease • Wuh-Liang Hwu, Yin-Hsiu Chien and Raymond Wang Newborn Screening for Pompe Disease Edited by Wuh-Liang Hwu, Yin-Hsiu Chien and Raymond Wang Printed Edition of the Special Issue Published in International Journal of Neonatal Screening www.mdpi.com/journal/IJNS Newborn Screening for Pompe Disease Newborn Screening for Pompe Disease Editors Wuh-Liang Hwu Yin-Hsiu Chien Raymond Wang MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade • Manchester • Tokyo • Cluj • Tianjin Editors Wuh-Liang Hwu Yin-Hsiu Chien Raymond Wang National Taiwan University National Taiwan University Children’s Hospital of Orange Hospital Hospital County Taiwan Taiwan USA Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal International Journal of Neonatal Screening (ISSN 2409-515X) (available at: https://www.mdpi.com/ journal/IJNS/special issues/pompe). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Volume Number, Page Range. ISBN 978-3-0365-0580-0 (Hbk) ISBN 978-3-0365-0581-7 (PDF) Cover image courtesy of the American Academy of Pediatrics. © 2021 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications.
    [Show full text]
  • Download Thesis
    This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ The Genetics and Spread of Amyotrophic Lateral Sclerosis Jones, Ashley Richard Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 07. Oct. 2021 THE GENETICS AND SPREAD OF AMYOTROPHIC LATERAL SCLEROSIS Ashley Richard Jones PhD in Clinical Neuroscience - 1 - Abstract Our knowledge of the genetic contribution to Amyotrophic Lateral Sclerosis (ALS) is rapidly growing, and there is increasing research into how ALS spreads through the motor system and beyond.
    [Show full text]
  • Multiplexed Engineering Glycosyltransferase Genes in CHO Cells Via Targeted Integration for Producing Antibodies with Diverse Complex‑Type N‑Glycans Ngan T
    www.nature.com/scientificreports OPEN Multiplexed engineering glycosyltransferase genes in CHO cells via targeted integration for producing antibodies with diverse complex‑type N‑glycans Ngan T. B. Nguyen, Jianer Lin, Shi Jie Tay, Mariati, Jessna Yeo, Terry Nguyen‑Khuong & Yuansheng Yang* Therapeutic antibodies are decorated with complex‑type N‑glycans that signifcantly afect their biodistribution and bioactivity. The N‑glycan structures on antibodies are incompletely processed in wild‑type CHO cells due to their limited glycosylation capacity. To improve N‑glycan processing, glycosyltransferase genes have been traditionally overexpressed in CHO cells to engineer the cellular N‑glycosylation pathway by using random integration, which is often associated with large clonal variations in gene expression levels. In order to minimize the clonal variations, we used recombinase‑mediated‑cassette‑exchange (RMCE) technology to overexpress a panel of 42 human glycosyltransferase genes to screen their impact on antibody N‑linked glycosylation. The bottlenecks in the N‑glycosylation pathway were identifed and then released by overexpressing single or multiple critical genes. Overexpressing B4GalT1 gene alone in the CHO cells produced antibodies with more than 80% galactosylated bi‑antennary N‑glycans. Combinatorial overexpression of B4GalT1 and ST6Gal1 produced antibodies containing more than 70% sialylated bi‑antennary N‑glycans. In addition, antibodies with various tri‑antennary N‑glycans were obtained for the frst time by overexpressing MGAT5 alone or in combination with B4GalT1 and ST6Gal1. The various N‑glycan structures and the method for producing them in this work provide opportunities to study the glycan structure‑and‑function and develop novel recombinant antibodies for addressing diferent therapeutic applications.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Regular Article
    From www.bloodjournal.org by guest on April 6, 2015. For personal use only. Regular Article IMMUNOBIOLOGY Hemophagocytic lymphohistiocytosis caused by dominant-negative mutations in STXBP2 that inhibit SNARE-mediated membrane fusion Waldo A. Spessott,1 Maria L. Sanmillan,1 Margaret E. McCormick,1 Nishant Patel,2 Joyce Villanueva,3 Kejian Zhang,4 Kim E. Nichols,5 and Claudio G. Giraudo1 1Department of Pathology and Laboratory Medicine, and 2Division of Oncology, Department of Pediatrics, The Children’s Hospital of Philadelphia, University of Pennsylvania, Philadelphia, PA; 3Division of Bone Marrow Transplant and Immune Deficiency, and 4Division of Human Genetics, Cincinnati Children’s Hospital Medical Center, Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH; and 5Division of Cancer Predisposition, Department of Oncology, St. Jude Children’s Research Hospital, Memphis, TN Key Points Familial hemophagocytic lymphohistiocytosis (F-HLH) and Griscelli syndrome type 2 (GS) are life-threatening immunodeficiencies characterized by impaired cytotoxic T lymphocyte • Monoallelic STXBP2 mutations (CTL) and natural killer (NK) cell lytic activity. In the majority of cases, these disorders are affecting codon 65 impair caused by biallelic inactivating germline mutations in genes such as RAB27A (GS) and PRF1, lymphocyte cytotoxicity and UNC13D, STX11,andSTXBP2 (F-HLH). Although monoallelic (ie, heterozygous) mutations contribute to hemophagocytic have been identified in certain patients, the clinical significance and molecular mechanisms lymphohistiocytosis. by which these mutations influence CTL and NK cell function remain poorly understood. • Munc18-2R65Q/W mutant Here, we characterize 2 novel monoallelic hemophagocytic lymphohistiocytosis (HLH)- associated mutations affecting codon 65 of STXPB2, the gene encoding Munc18-2, a member proteins function in a dominant- of the SEC/MUNC18 family.
    [Show full text]