Cell Hybridization and the 24 Homan Gene Maps
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN. -
Magnesium Plays a Salient Role in the Cells
341 Journal of Clinical and Biomedical Sciences Journal homepage: www.jcbsonline.ac.in Review Article Magnesium Plays a Salient Role in the Cells R Deepti1*, G Nalini2 Department of Biochemistry, Sri Muthukumaran Medical college Hospital and Research Institute, Chennai, Tamilnadu, India. Department of Biochemistry, Sri Ramachandra Medical college and Research Institute, Chennai, Tamilnadu, India. Received: 17th October-2014 Accepted: 11th December-2014 Published: 31st –December 2014. Abstract Magnesium is an important macromineral. Major amount of magnesium is present in the bones. Magnesium ab- sorption takes place at the small intestine and magnesium levels are maintained by the kidneys. Magnesium is a fundamen- tal mineral in the mammalian cells. Magnesium acts as a co-factor for many enzymes, especially enzymes involved in carbo- hydrate and lipid metabolism. Magnesium is necessary for muscle contraction by acting as a calcium antagonist, cellular proliferation, apoptosis, immune response, etc. Now a days hypomagnesemia is very commonly seen condition associated with predominant diseases like diabetes, hypertension, cardiovascular diseases, obesity, etc. Several authors have reported that low serum magnesium levels, insulin resistance and hyperlipidemia are interrelated. Hypomagnesemia may play an causative role in the development of diabetes, oxidative stress, thrombosis, atherosclerosis, etc. Hence magnesium impor- tances should be highlighted in the research field. Keywords: hypomagnesemia, hyperlipidemia and atherosclerosis. Introduction Magnesium Homeostasis Magnesium is the fourth most abundant cation and Recommended daily allowance (RDA) for magne- the second most abundant intracellular cation next to potas- sium is 400 mg for men and 300 mg for female. Major sium in the human body.(1,2) sources for magnesium are cereals, beans, leafy vegetables and fish. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
Liver Glucose Metabolism in Humans
Biosci. Rep. (2016) / 36 / art:e00416 / doi 10.1042/BSR20160385 Liver glucose metabolism in humans Mar´ıa M. Adeva-Andany*1, Noemi Perez-Felpete*,´ Carlos Fernandez-Fern´ andez*,´ Cristobal´ Donapetry-Garc´ıa* and Cristina Pazos-Garc´ıa* *Nephrology Division, Hospital General Juan Cardona, c/ Pardo Bazan´ s/n, 15406 Ferrol, Spain Synopsis Information about normal hepatic glucose metabolism may help to understand pathogenic mechanisms underlying obesity and diabetes mellitus. In addition, liver glucose metabolism is involved in glycosylation reactions and con- nected with fatty acid metabolism. The liver receives dietary carbohydrates directly from the intestine via the portal vein. Glucokinase phosphorylates glucose to glucose 6-phosphate inside the hepatocyte, ensuring that an adequate flow of glucose enters the cell to be metabolized. Glucose 6-phosphate may proceed to several metabolic path- ways. During the post-prandial period, most glucose 6-phosphate is used to synthesize glycogen via the formation of glucose 1-phosphate and UDP–glucose. Minor amounts of UDP–glucose are used to form UDP–glucuronate and UDP– galactose, which are donors of monosaccharide units used in glycosylation. A second pathway of glucose 6-phosphate metabolism is the formation of fructose 6-phosphate, which may either start the hexosamine pathway to produce UDP-N-acetylglucosamine or follow the glycolytic pathway to generate pyruvate and then acetyl-CoA. Acetyl-CoA may enter the tricarboxylic acid (TCA) cycle to be oxidized or may be exported to the cytosol to synthesize fatty acids, when excess glucose is present within the hepatocyte. Finally, glucose 6-phosphate may produce NADPH and ribose 5-phosphate through the pentose phosphate pathway. -
The Cgmp-Dependent Protein Kinase 2 Contributes to Cone Photoreceptor Degeneration in the Cnga3-Deficient Mouse Model of Achroma
International Journal of Molecular Sciences Article The cGMP-Dependent Protein Kinase 2 Contributes to Cone Photoreceptor Degeneration in the Cnga3-Deficient Mouse Model of Achromatopsia Mirja Koch 1, Constanze Scheel 1, Hongwei Ma 2, Fan Yang 2, Michael Stadlmeier 3,† , Andrea F. Glück 3, Elisa Murenu 1,4, Franziska R. Traube 3 , Thomas Carell 3, Martin Biel 1, Xi-Qin Ding 2 and Stylianos Michalakis 1,4,* 1 Department of Pharmacy—Center for Drug Research, Ludwig-Maximilians-University, 81377 Munich, Germany; [email protected] (M.K.); [email protected] (C.S.); [email protected] (E.M.); [email protected] (M.B.) 2 Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104, USA; [email protected] (H.M.); [email protected] (F.Y.); [email protected] (X.-Q.D.) 3 Department of Chemistry, Ludwig-Maximilians-University, 81377 Munich, Germany; [email protected] (M.S.); [email protected] (A.F.G.); [email protected] (F.R.T.); [email protected] (T.C.) 4 Department of Ophthalmology, Ludwig-Maximilians-University, 80336 Munich, Germany * Correspondence: [email protected] † Present affiliation: Lewis-Sigler Institute for Integrative Genomics, Princeton University, NJ 08544, USA. Abstract: Mutations in the CNGA3 gene, which encodes the A subunit of the cyclic guanosine monophosphate (cGMP)-gated cation channel in cone photoreceptor outer segments, cause total colour blindness, also referred to as achromatopsia. Cones lacking this channel protein are non- functional, accumulate high levels of the second messenger cGMP and degenerate over time after induction of ER stress. -
An Investigation Into the Genetic Architecture of Multiple System Atrophy and Familial Parkinson's Disease
An investigation into the genetic architecture of multiple system atrophy and familial Parkinson’s disease By Monica Federoff A thesis submitted to University College London for the degree of Doctor of Philosophy Laboratory of Neurogenetics, Department of Molecular Neuroscience, Institute of Neurology, University College London (UCL) 2 I, Monica Federoff, confirm that the work presented in this thesis is my own. Information derived from other sources and collaborative work have been indicated appropriately. Signature: Date: 09/06/2016 3 Acknowledgements: When I first joined the Laboratory of Neurogenetics (LNG), NIA, NIH as a summer intern in 2008, I had minimal experience working in a laboratory and was both excited and anxious at the prospect of it. From my very first day, Dr. Andrew Singleton was incredibly welcoming and introduced me to my first mentor, Dr. Javier Simon- Sanchez. Within just ten weeks working in the lab, both Dr. Singleton and Dr. Simon- Sanchez taught me the fundamental skills in an encouraging and supportive environment. I quickly got to know others in the lab, some of whom are still here today, and I sincerely appreciate their help with my assimilation into the LNG. After returning for an additional summer and one year as an IRTA postbac, I was honored to pursue a PhD in such an intellectually stimulating and comfortable environment. I am so grateful that Dr. Singleton has been such a wonderful mentor, as he is not only a brilliant scientist, but also extremely personable and approachable. If I inquire about meeting with him, he always manages to make time in his busy schedule and provides excellent guidance and mentorship. -
GANC (NM 001301409) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC335588 GANC (NM_001301409) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: GANC (NM_001301409) Human Untagged Clone Tag: Tag Free Symbol: GANC Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001301409, the custom clone sequence may differ by one or more nucleotides ATGGAAGCAGCAGTGAAAGAGGAAATAAGTCTTGAAGATGAAGCTGTAGATAAAAACATTTTCAGAGACT GTAACAAGATCGCATTTTACAGGCGTCAGAAACAGTGGCTTTCCAAGAAGTCCACCTATCAGGCATTATT GGATTCAGTCACAACAGATGAAGACAGCACCAGGTTCCAAATCATCAATGAAGCAAGTAAGGTTCCTCTC CTGGCTGAAATTTATGGTATAGAAGGAAACATTTTCAGGCTTAAAATTAATGAAGAGACTCCTCTAAAAC CCAGATTTGAAGTTCCGGATGTCCTCACAAGCAAGCCAAGCACTGTAAGGCTGATTTCATGCTCTGGGGA CACAGGCAGTCTGATATTGGCAGATGGAAAAGGAGACCTGAAGTGCCATATCACAGCAAACCCATTCAAG GTAGACTTGGTGTCTGAAGAAGAGGTTGTGATTAGCATAAATTCCCTGGGCCAATTATACTTTGAGCATC TACAGATTCTTCACAAACAAAGAGCTGCTAAAGAAAATGAGGAGGAGACATCAGTGGACACCTCTCAGGA AAATCAAGAAGATCTGGGCCTGTGGGAAGAGAAATTTGGAAAATTTGTGGATATCAAAGCTAATGGCCCT TCTTCTATTGGTTTGGATTTCTCCTTGCATGGATTTGAGCATCTTTATGGGATCCCACAACATGCAGAAT CACACCAACTTAAAAATACTGGTGATGGAGATGCTTACCGTCTTTATAACCTGGATGTCTATGGATACCA AATATATGATAAAATGGGCATTTATGGTTCAGTACCTTATCTCCTGGCCCACAAACTGGGCAGAACTATA GGTATTTTCTGGCTGAATGCCTCGGAAACACTGGTGGAGATCAATACAGAGCCTGCAGTAGAGTACACAC TGACCCAGATGGGCCCAGTTGCTGCTAAACAAAAGGTCAGATCTCGCACTCATGTGCACTGGATGTCAGA -
Acetic Acid (Activator-3) Is a Potent Activator of AMPK
www.nature.com/scientificreports OPEN 2-[2-(4-(trifuoromethyl) phenylamino)thiazol-4-yl]acetic acid (Activator-3) is a potent Received: 29 June 2017 Accepted: 6 June 2018 activator of AMPK Published: xx xx xxxx Navneet Bung1, Sobhitha Surepalli2, Sriram Seshadri3, Sweta Patel3, Saranya Peddasomayajula2, Lalith Kumar Kummari 2,5,6, Sireesh T. Kumar4, Phanithi Prakash Babu4, Kishore V. L. Parsa2, Rajamohan Reddy Poondra2, Gopalakrishnan Bulusu1,2 & Parimal Misra2 AMPK is considered as a potential high value target for metabolic disorders. Here, we present the molecular modeling, in vitro and in vivo characterization of Activator-3, 2-[2-(4-(trifuoromethyl) phenylamino)thiazol-4-yl]acetic acid, an AMP mimetic and a potent pan-AMPK activator. Activator-3 and AMP likely share common activation mode for AMPK activation. Activator-3 enhanced AMPK phosphorylation by upstream kinase LKB1 and protected AMPK complex against dephosphorylation by PP2C. Molecular modeling analyses followed by in vitro mutant AMPK enzyme assays demonstrate that Activator-3 interacts with R70 and R152 of the CBS1 domain on AMPK γ subunit near AMP binding site. Activator-3 and C2, a recently described AMPK mimetic, bind diferently in the γ subunit of AMPK. Activator-3 unlike C2 does not show cooperativity of AMPK activity in the presence of physiological concentration of ATP (2 mM). Activator-3 displays good pharmacokinetic profle in rat blood plasma with minimal brain penetration property. Oral treatment of High Sucrose Diet (HSD) fed diabetic rats with 10 mg/kg dose of Activator-3 once in a day for 30 days signifcantly enhanced glucose utilization, improved lipid profles and reduced body weight, demonstrating that Activator-3 is a potent AMPK activator that can alleviate the negative metabolic impact of high sucrose diet in rat model. -
Inhibitors of Pyruvate Carboxylase Tonya N
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by epublications@Marquette Marquette University e-Publications@Marquette Biological Sciences Faculty Research and Biological Sciences, Department of Publications 1-1-2010 Inhibitors of Pyruvate Carboxylase Tonya N. Zeczycki University of Wisconsin - Madison Martin St. Maurice Marquette University, [email protected] Paul V. Attwood University of Western Australia Published version. The Open Enzyme Inhibition Journal, Vol. 3 (2010): 8-26. DOI. © 2010 Bentham Open. Used with permission. This is an open access article licensed under the terms of the Creative Commons Attribution Non- Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) 8 The Open Enzyme Inhibition Journal, 2010, 3, 8-26 Open Access Inhibitors of Pyruvate Carboxylase Tonya N. Zeczycki1, Martin St. Maurice2 and Paul V. Attwood3,* 1Department of Biochemistry, University of Wisconsin, Madison, WI 53726, USA 2Department of Biological Sciences, Marquette University, P.O. Box 1881, Milwaukee, WI 53201-1881, USA 3School of Biomedical, Biomolecular and Chemical Sciences, University of Western Australia, Crawley, WA6009, Australia Abstract: This review aims to discuss the varied types of inhibitors of biotin-dependent carboxylases, with an emphasis on the inhibitors of pyruvate carboxylase. Some of these inhibitors are physiologically relevant, in that they provide ways of regulating the cellular activities of the enzymes e.g. aspartate and prohibitin inhibition of pyruvate carboxylase. Most of the inhibitors that will be discussed have been used to probe various aspects of the structure and function of these enzymes. They target particular parts of the structure e.g. avidin – biotin, FTP – ATP binding site, oxamate – pyruvate binding site, phosphonoacetate – binding site of the putative carboxyphosphate intermediate. -
AMD) Transmitochondrial Cybrids Protected from Cellular Damage and Death by Human Retinal Progenitor Cells (Hrpcs
Hindawi Stem Cells International Volume 2021, Article ID 6655372, 15 pages https://doi.org/10.1155/2021/6655372 Research Article Age-Related Macular Degeneration (AMD) Transmitochondrial Cybrids Protected from Cellular Damage and Death by Human Retinal Progenitor Cells (hRPCs) Jeffrey J. Yu,1 Daniel B. Azzam ,1 Marilyn Chwa ,1 Kevin Schneider ,1 Jang-Hyeon Cho,1 Chinhui Hsiang,1 Henry Klassen,1 M. Cristina Kenney ,1,2 and Jing Yang 1 1Department of Ophthalmology, Gavin Herbert Eye Institute, University of California Irvine, Irvine, CA 92697, USA 2Department of Pathology and Laboratory Medicine, University of California Irvine, Irvine, CA 92697, USA Correspondence should be addressed to Jing Yang; [email protected] Jeffrey J. Yu and Daniel B. Azzam contributed equally to this work. Received 10 December 2020; Revised 20 January 2021; Accepted 25 January 2021; Published 9 February 2021 Academic Editor: Valeria Sorrenti Copyright © 2021 Jeffrey J. Yu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Purpose. One of the leading causes of irreversible blindness worldwide, age-related macular degeneration (AMD) is a progressive disorder leading to retinal degeneration. While several treatment options exist for the exudative form of AMD, there are currently no FDA-approved treatments for the more common nonexudative (atrophic) form. Mounting evidence suggests that mitochondrial damage and retinal pigment epithelium (RPE) cell death are linked to the pathogenesis of AMD. Human retinal progenitor cells (hRPCs) have been studied as a potential restorative therapy for degenerative conditions of the retina; however, the effects of hRPC treatment on retinal cell survival in AMD have not been elucidated. -
Coding RNA Genes
Review A guide to naming human non-coding RNA genes Ruth L Seal1,2,* , Ling-Ling Chen3, Sam Griffiths-Jones4, Todd M Lowe5, Michael B Mathews6, Dawn O’Reilly7, Andrew J Pierce8, Peter F Stadler9,10,11,12,13, Igor Ulitsky14 , Sandra L Wolin15 & Elspeth A Bruford1,2 Abstract working on non-coding RNA (ncRNA) nomenclature in the mid- 1980s with the approval of initial gene symbols for mitochondrial Research on non-coding RNA (ncRNA) is a rapidly expanding field. transfer RNA (tRNA) genes. Since then, we have worked closely Providing an official gene symbol and name to ncRNA genes brings with experts in the ncRNA field to develop symbols for many dif- order to otherwise potential chaos as it allows unambiguous ferent kinds of ncRNA genes. communication about each gene. The HUGO Gene Nomenclature The number of genes that the HGNC has named per ncRNA class Committee (HGNC, www.genenames.org) is the only group with is shown in Fig 1, and ranges in number from over 4,500 long the authority to approve symbols for human genes. The HGNC ncRNA (lncRNA) genes and over 1,900 microRNA genes, to just four works with specialist advisors for different classes of ncRNA to genes in the vault and Y RNA classes. Every gene symbol has a ensure that ncRNA nomenclature is accurate and informative, Symbol Report on our website, www.genenames.org, which where possible. Here, we review each major class of ncRNA that is displays the gene symbol, gene name, chromosomal location and currently annotated in the human genome and describe how each also includes links to key resources such as Ensembl (Zerbino et al, class is assigned a standardised nomenclature.