Human H2AFB3 (NM 080720) Cdna/ORF Clone

Total Page：16

File Type：pdf, Size：1020Kb

Human H2AFB3 (NM_080720) cDNA/ORF clone Catalog Number: 718687-4 General Information 3.Close the tube and incubate for 10 minutes at room temperature. Gene Name: 4.Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is H2A histone family member B3 less than 5000×g. 5.Store the plasmid at -20 ℃. Official Symbol: H2AFB3 The plasmid is ready for: Organism: Homo sapiens Restriction enzyme digestion; PCR amplification; RefSeq: NM_080720 E. coli transformation; DNA sequencing Description E.coli strains for transformation (recommended but not limited): Sequence Description: Most commercially available competent cells are Identical with the Gene Bank Ref. ID sequence. appropriate for the plasmid, e.g. TOP10, DH5α and TOP10F´. Vector: pGEM-T Restriction Sites: Vector Information Shipping carrier: The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of Each tube contains approximately 5 μg - 10 μg of the plasmid in E. coli, and the ori site which is the lyophilized plasmid. bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding Storage: sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this The lyophilized plasmid can be stored at ambient vector including JM109, DH5α and TOP10. temperature for three months. Physical Map of pGEM-T: Quality control: The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list: T7:TAATACGACTCACTATAGGG M13 rev:CAGGAAACAGCTATGAC Plasmid Resuspension protocol 1.Centrifuge at 5,000×g for 5 min. 2.Carefully open the tube and add 20 μl of sterile water to dissolve the DNA. 1 / 2 Human H2AFB3 (NM_080720) cDNA/ORF clone Catalog Number: 718687-4 Vector Name pGEM-T Vector Size 3000 bp Vector Type Cloning Vector Expression Method - Promoter lac Antibiotic Resistance Ampicillin Selection In Mammalian Cells - Protein Tag None 2 / 2.

Copy Link

Recommended publications

An Alu Element-Based Model of Human Genome Instability George Wyndham Cook, Jr
Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2013 An Alu element-based model of human genome instability George Wyndham Cook, Jr. Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation Cook, Jr., George Wyndham, "An Alu element-based model of human genome instability" (2013). LSU Doctoral Dissertations. 2090. https://digitalcommons.lsu.edu/gradschool_dissertations/2090 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. AN ALU ELEMENT-BASED MODEL OF HUMAN GENOME INSTABILITY A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Biological Sciences by George Wyndham Cook, Jr. B.S., University of Arkansas, 1975 May 2013 TABLE OF CONTENTS LIST OF TABLES ...................................................................................................... iii LIST OF FIGURES .................................................................................................... iv LIST OF ABBREVIATIONS ......................................................................................
[Show full text]
H2A.B Facilitates Transcription Elongation at Methylated Cpg Loci
Downloaded from genome.cshlp.org on October 27, 2017 - Published by Cold Spring Harbor Laboratory Press Research H2A.B facilitates transcription elongation at methylated CpG loci Yibin Chen,1 Qiang Chen,1 Richard C. McEachin,2 James D. Cavalcoli,2 and Xiaochun Yu1,3 1Division of Molecular Medicine and Genetics, Department of Internal Medicine, 2Department of Computational Medicine and Bioinformatics, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA H2A.B is a unique histone H2A variant that only exists in mammals. Here we found that H2A.B is ubiquitously expressed in major organs. Genome-wide analysis of H2A.B in mouse ES cells shows that H2A.B is associated with methylated DNA in gene body regions. Moreover, H2A.B-enriched gene loci are actively transcribed. One typical example is that H2A.B is enriched in a set of differentially methylated regions at imprinted loci and facilitates transcription elongation. These results suggest that H2A.B positively regulates transcription elongation by overcoming DNA methylation in the tran- scribed region. It provides a novel mechanism by which transcription is regulated at DNA hypermethylated regions. [Supplemental material is available for this article.] Histones are nuclear proteins in eukaryotes that package genomic 2004; Eirin-Lopez et al. 2008; Ishibashi et al. 2010; Soboleva et al. DNA into structural units called nucleosomes (Andrews and Luger 2012; Tolstorukov et al. 2012). 2011). A nucleosome consists of a histone octamer with two copies Although H2A.B has been well characterized in vitro, the each of four core histones that are wrapped with ;146 bp of function and localization of H2A.B in the genome are still unclear.
[Show full text]
Systematic Quantitative Analysis of H2A And
El Kennani et al. Epigenetics & Chromatin (2018) 11:2 https://doi.org/10.1186/s13072-017-0172-y Epigenetics & Chromatin METHODOLOGY Open Access Systematic quantitative analysis of H2A and H2B variants by targeted proteomics Sara El Kennani1, Annie Adrait1, Olga Permiakova1, Anne‑Marie Hesse1, Côme Ialy‑Radio2, Myriam Ferro1, Virginie Brun1, Julie Cocquet2, Jérôme Govin1* and Delphine Pfieger1,3* Abstract Background: Histones organize DNA into chromatin through a variety of processes. Among them, a vast diversity of histone variants can be incorporated into chromatin and fnely modulate its organization and functionality. Classically, the study of histone variants has largely relied on antibody-based assays. However, antibodies have a limited ef‑ ciency to discriminate between highly similar histone variants. Results: In this study, we established a mass spectrometry-based analysis to address this challenge. We developed a targeted proteomics method, using selected reaction monitoring or parallel reaction monitoring, to quantify a maxi‑ mum number of histone variants in a single multiplexed assay, even when histones are present in a crude extract. This strategy was developed on H2A and H2B variants, using 55 peptides corresponding to 25 diferent histone sequences, among which a few difer by a single amino acid. The methodology was then applied to mouse testis extracts in which almost all histone variants are expressed. It confrmed the abundance profles of several testis-specifc histones during successive stages of spermatogenesis and the existence of predicted H2A.L.1 isoforms. This methodology was also used to explore the over-expression pattern of H2A.L.1 isoforms in a mouse model of male infertility.
[Show full text]
Chew Et Al-2021-Nature Communi
Short H2A histone variants are expressed in cancer Guo-Liang Chew, Marie Bleakley, Robert Bradley, Harmit Malik, Steven Henikoff, Antoine Molaro, Jay Sarthy To cite this version: Guo-Liang Chew, Marie Bleakley, Robert Bradley, Harmit Malik, Steven Henikoff, et al.. Short H2A histone variants are expressed in cancer. Nature Communications, Nature Publishing Group, 2021, 12 (1), pp.490. 10.1038/s41467-020-20707-x. hal-03118929 HAL Id: hal-03118929 https://hal.archives-ouvertes.fr/hal-03118929 Submitted on 22 Jan 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ARTICLE https://doi.org/10.1038/s41467-020-20707-x OPEN Short H2A histone variants are expressed in cancer Guo-Liang Chew 1, Marie Bleakley2, Robert K. Bradley 3,4,5, Harmit S. Malik4,6, Steven Henikoff 4,6, ✉ ✉ Antoine Molaro 4,7 & Jay Sarthy 4 Short H2A (sH2A) histone variants are primarily expressed in the testes of placental mammals. Their incorporation into chromatin is associated with nucleosome destabilization and modulation of alternate splicing. Here, we show that sH2As innately possess features similar to recurrent oncohistone mutations associated with nucleosome instability. Through 1234567890():,; analyses of existing cancer genomics datasets, we ﬁnd aberrant sH2A upregulation in a broad array of cancers, which manifest splicing patterns consistent with global nucleosome destabilization.
[Show full text]
Istanbul Üniversitesi Sağlik Bilimleri Enstitüsü
T.C. İSTANBUL ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ ( YÜKSEK LİSANS TEZİ ) MKA/MR OLGULARINDA GENETİK ETİYOLOJİNİN ARRAY-CGH TEKNİĞİ İLE ARAŞTIRILMASI MARYAM BARGHI MASTAN ABAD PROF. DR. BEYHAN TÜYSÜZ GENETİK ANABİLİM DALI GENETİK PROGRAMI İSTANBUL-2018 BEYAN Bu tez çalışmasının kendi çalışmam olduğunu, tezin planlanmasından yazımına kadar bütün safhalarda etik dışı davranışımın olmadığını, bu tezdeki bütün bilgileri akademik ve etik kurallar içinde elde ettiğimi, bu tez çalışmayla elde edilmeyen bütün bilgi ve yorumlara kaynak gösterdiğimi ve bu kaynakları da kaynaklar listesine aldığımı, yine bu tezin çalışılması ve yazımı sırasında patent ve telif haklarını ihlal edici bir davranışımın olmadığı beyan ederim. MARYAM BARGHI MASTAN ABAD ii İTHAF Sevgili Aileme… iii TEŞEKKÜR Yüksek lisans eğitimim boyunca engin bilgi ve tecrübelerinden yararlandığım, desteğini her zaman yanımda hissettiğim, tez çalışmamın her satırında emeği olan sevgili danışman hocam sayın Prof. Dr. Beyhan TÜYSÜZ’e; Yol gösterici ve anlayışlı tavrıyla her zaman destek olan, bilgi ve tecrübelerini esirgemeyen sevgili hocam sayın Doç. Dr. Birsen KARAMAN’a; Tez çalışmalarım boyunca birlikte çalışma fırsatı yakaladığım, bilgi ve tecrübelerinden yararlandığım, desteğini her zaman hissettiğim sayın Dr. Dilek ULUDAĞ’a; Eğitimim boyunca hiçbir konuda yardımlarını esirgemeyen, her zaman destekleyen, her birinin ayrı ayrı emeği olan tüm Çocuk Genetik Anabilim Dalı çalışanlarına ve arkadaşlarıma, Desteklerini hiçbir zaman esirgemeyen ve her an yanımda olan sevgili aileme sonsuz
[Show full text]
H2A.B Is a Cancer/Testis Factor Involved in Activation of Ribosome Biogenesis in Hodgkin Lymphoma
bioRxiv preprint doi: https://doi.org/10.1101/2021.01.19.427265; this version posted January 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. H2A.B is a cancer/testis factor involved in activation of ribosome biogenesis in Hodgkin Lymphoma Xuanzhao Jiang1, Jiayu Wen1, Elizabeth Paver2, Wu, Yu-Huan1,3, Gege Sun1,4, Amanda Bullman5, Jane E. Dahlstrom5,6, David J. Tremethick1* and Tatiana A. Soboleva1* 1The John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia. 2 Department of Tissue Pathology and Diagnostic Oncology, Royal Prince Alfred Hospital, Sydney, Australia. 3 Current address: IQVIA Solutions Taiwan Ltd. 105, Taiwan, Taipei City, Songshan District, Section 3, Minsheng East Road, 13, Taipei City, Taiwan. 4 Current address: Department of Applied Biology and Chemical Technology and State Key Laboratory of Chemical Biology and Drug Discovery, Hong Kong Polytechnic University, Hong Kong SAR, China. 5 Department of Anatomical Pathology, ACT Pathology, The Canberra Hospital, Canberra, ACT, Australia. 6 Australian National University Medical School, The Australian National University, Canberra, ACT, Australia. *Corresponding co-authors [email protected] [email protected] Running title: H2A.B enhances Pol I and II transcription Key words: histone variants, H2A.B, chromatin, transcription, RNA Polymerase 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.19.427265; this version posted January 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved.
[Show full text]
The Human Canonical Core Histone Catalogue David Miguel Susano Pinto*, Andrew Flaus*,†
bioRxiv preprint doi: https://doi.org/10.1101/720235; this version posted July 30, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. The Human Canonical Core Histone Catalogue David Miguel Susano Pinto*, Andrew Flaus*,† Abstract Core histone proteins H2A, H2B, H3, and H4 are encoded by a large family of genes dis- tributed across the human genome. Canonical core histones contribute the majority of proteins to bulk chromatin packaging, and are encoded in 4 clusters by 65 coding genes comprising 17 for H2A, 18 for H2B, 15 for H3, and 15 for H4, along with at least 17 total pseudogenes. The canonical core histone genes display coding variation that gives rise to 11 H2A, 15 H2B, 4 H3, and 2 H4 unique protein isoforms. Although histone proteins are highly conserved overall, these isoforms represent a surprising and seldom recognised variation with amino acid identity as low as 77 % between canonical histone proteins of the same type. The gene sequence and protein isoform diversity also exceeds com- monly used subtype designations such as H2A.1 and H3.1, and exists in parallel with the well-known specialisation of variant histone proteins. RNA sequencing of histone transcripts shows evidence for diﬀerential expression of histone genes but the functional signiﬁcance of this variation has not yet been investigated. To assist understanding of the implications of histone gene and protein diversity we have catalogued the entire human canonical core histone gene and protein complement.
[Show full text]
Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham a Thesis Submitted in Conformity
Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto © Copyright by Edward James Higginbotham 2020 i Abstract Characterizing Genomic Duplication in Autism Spectrum Disorder Edward James Higginbotham Master of Science Graduate Department of Molecular Genetics University of Toronto 2020 Duplication, the gain of additional copies of genomic material relative to its ancestral diploid state is yet to achieve full appreciation for its role in human traits and disease. Challenges include accurately genotyping, annotating, and characterizing the properties of duplications, and resolving duplication mechanisms. Whole genome sequencing, in principle, should enable accurate detection of duplications in a single experiment. This thesis makes use of the technology to catalogue disease relevant duplications in the genomes of 2,739 individuals with Autism Spectrum Disorder (ASD) who enrolled in the Autism Speaks MSSNG Project. Fine-mapping the breakpoint junctions of 259 ASD-relevant duplications identified 34 (13.1%) variants with complex genomic structures as well as tandem (193/259, 74.5%) and NAHR- mediated (6/259, 2.3%) duplications. As whole genome sequencing-based studies expand in scale and reach, a continued focus on generating high-quality, standardized duplication data will be prerequisite to addressing their associated biological mechanisms. ii Acknowledgements I thank Dr. Stephen Scherer for his leadership par excellence, his generosity, and for giving me a chance. I am grateful for his investment and the opportunities afforded me, from which I have learned and benefited. I would next thank Drs.
[Show full text]
1 Gene Editing of the Multi
bioRxiv preprint doi: https://doi.org/10.1101/233379; this version posted December 13, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Gene editing of the multi-copy H2A.B gene family by a single pair of TALENS Nur Diana Anuar1, Matt Field 1, 2, 6, Sebastian Kurscheid1, 6, Lei Zhang3, Edward Rebar3, Philip Gregory3,4, Josephine Bowles5, Peter Koopman5, David J. Tremethick#1 and Tatiana Soboleva#1 1The John Curtin School of Medical Research, The Australian National University, Canberra, ACT 2601, Australia. 2Current address: James Cook University, PO BoX 6811, Cairns, QLD 4870, Australia 3Sangamo Therapeutics, 501 Canal Blvd, Richmond, CA 94804, USA. 4Current address: bluebird bio, 60 Binney St, Cambridge, MA 02142, USA. 5Institute for Molecular Bioscience, The University of Queensland, Brisbane QLD 4072, Australia 6Contributed equally # Corresponding authors: Tatiana Soboleva, Tel: +61 2 6125 4391; Fax: +61 2 6125 2499; Email: [email protected] David Tremethick, Tel: +61 2 6125 2326; Fax: +61 2 6125 2499; Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/233379; this version posted December 13, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. In view of the controversy related to the generation of off-target mutations by gene editing approaches, we tested the specificity of TALENs by disrupting a multi-copy gene family using only one pair of TALENS.
[Show full text]
The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
[Show full text]
A Second Generation Human Haplotype Map of Over 3.1 Million Snps the International Hapmap Consortium1
doi: 10.1038/nature06258 SUPPLEMENTARY INFORMATION A second generation human haplotype map of over 3.1 million SNPs The International HapMap Consortium1 Supplementary material S1 The density of common SNPs in the Phase II HapMap and the assembled human genome S2 Analysis of data quality S2.1 Analysis of amplicon structure to genotyping error S2.2 Analysis of genotype discordance from overlap with Seattle SNPs S2.3 Analysis of genotype discordance from fosmid end sequences S2.4 Analysis of monomorphism/polymorphism discrepancies S2.5 Interchromosomal LD S3. Analysis of population stratification S4. Analysis of relatedness S5. Segmental analysis of relatedness S6. Analysis of homozygosity S7. Perlegen genotyping protocols Supplementary tables Legends to supplementary figures 1 See end of manuscript for Consortium details www.nature.com/nature 1 doi: 10.1038/nature06258 SUPPLEMENTARY INFORMATION Supplementary text 1. The density of common SNPs in the Phase II HapMap and the assembled human genome. To estimate the fraction of all common variants on the autosomes that have been successfully genotyped in the consensus Phase II HapMap we note that in YRI (release 21) there are 2,334,980 SNPs with MAF≥0.05. Across the autosomes, the completed reference sequence assembled in contigs is 2.68 billion bp. Assuming that the allele frequency distribution in the YRI is well approximated by that of a simple coalescent model and using an estimate of the population mutation rate of θ = 1.2 per kb for African populations1,2 the expected number of variants with MAF≥0.05 in a sample of 120 chromosomes is 114 = θ E(S MAF≥5% ) L ∑ /1 i i=6 where L is the total length of the sequence3.
[Show full text]
The Role of Lamin Associated Domains in Global Chromatin Organization and Nuclear Architecture
THE ROLE OF LAMIN ASSOCIATED DOMAINS IN GLOBAL CHROMATIN ORGANIZATION AND NUCLEAR ARCHITECTURE By Teresa Romeo Luperchio A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March 2016 © 2016 Teresa Romeo Luperchio All Rights Reserved ABSTRACT Nuclear structure and scaffolding have been implicated in expression and regulation of the genome (Elcock and Bridger 2010; Fedorova and Zink 2008; Ferrai et al. 2010; Li and Reinberg 2011; Austin and Bellini 2010). Discrete domains of chromatin exist within the nuclear volume, and are suggested to be organized by patterns of gene activity (Zhao, Bodnar, and Spector 2009). The nuclear periphery, which consists of the inner nuclear membrane and associated proteins, forms a sub- nuclear compartment that is mostly associated with transcriptionally repressed chromatin and low gene expression (Guelen et al. 2008). Previous studies from our lab and others have shown that repositioning genes to the nuclear periphery is sufficient to induce transcriptional repression (K L Reddy et al. 2008; Finlan et al. 2008). In addition, a number of studies have provided evidence that many tissue types, including muscle, brain and blood, use the nuclear periphery as a compartment during development to regulate expression of lineage specific genes (Meister et al. 2010; Szczerbal, Foster, and Bridger 2009; Yao et al. 2011; Kosak et al. 2002; Peric-Hupkes et al. 2010). These large regions of chromatin that come in molecular contact with the nuclear periphery are called Lamin Associated Domains (LADs). The studies described in this dissertation have furthered our understanding of maintenance and establishment of LADs as well as the relationship of LADs with the epigenome and other factors that influence three-dimensional chromatin structure.
[Show full text]