Quick Reference Guide Trianing and Support ADVANTAGE 1
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Chapter Download
www.igi-global.com/ondemand ® InfoSci-ONDemand Chapter Download ® Purchase individual research articles, book chapters, and InfoSci-ONDemand teaching cases from IGI Global’s entire selection. Download Premium Research Papers www.igi-global.com/ondemand This publication is protected by copyright law of the United States of America codifi ed in Title 17 of the U.S. Code, which is party to both the Universal Copyright Convention and the Berne Copyright Convention. The entire content is copyrighted by IGI Global. All rights reserved. No part of this publication may be reproduced, posted online, stored, translated or distributed in any form or by any means without written permission from the publisher. IGI PUBLISHING ITB14169 701 E. Chocolate Avenue, Suite 200, Hershey PA 17033-1240, USA Tel: 717/533-8845; Fax 717/533-8661; URL-http://www.igi-pub.com 6 MertenThis paper appears in the publication, Information and Communication Technologies in Support of the Tourism Industry edited by W. Pease, M. Rowe and M. Cooper © 2007, IGI Global Chapter.IV The.Transformation.of.the. Distribution.Process.in.the. Airline.Industry.Empowered. by.Information.and. Communication.Technology Patrick S. Merten, International Institute of Management in Technology, Switzerland Abstract This chapter reviews the historical evolution of the airline market and its first-gen- eration airline reservation and distribution systems. The development and diffusion of computer reservation systems (CRS) and global distribution systems (GDS) is discussed extensively in order to provide a comprehensive overview of the state of business in the 2000s. Based on this evaluation, the influence of modern information and communication technology (ICT) on the airline distribution system environ- ment is discussed. -
Federal Hansard Acronyms List Remember: Ctrl+F for Quick Searches
Federal Hansard Acronyms List Remember: Ctrl+F for quick searches A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A 2.5G [the first packet overlays on 2G networks] 2G second generation [the first generation of digital cellular networks, as opposed to analog] 3G third generation [next generation of cellular networks] 3GPP 3G Partnership Project [global standards body to oversee 3G] 4D meat from dead, dying, diseased or disabled animals 4GL fourth-generation language [computers] A&C automation and control A&D admission and disposition; alcohol and drugs A&E accident and emergency A&RMC formerly Austin & Repatriation Medical Centre [now Austin Health] AA anti-aircraft; Alcoholics Anonymous; Athletics Australia AAA Agriculture Advancing Australia; Australian Automobile Association; Australian Archaeological Association; Australian Airports Association AAAA Aerial Agricultural Association of Australia AAAE Australian Association of Automotive Electricians AAAGP Australian Association of Academic General Practice AAALAC Association for the Assessment and Accreditation of Laboratory Animal Care International AAB Australian Associated Brewers AAC Aboriginal advisory committee; Australian Arabic Council; AARNet Advisory Committee AACAP ATSIC-Army Community Assistance Program AACC Aboriginal Affairs Coordinating Committee [WA]; Australian Association of Career Counsellors AACM Australian Association for Computational Mechanics AACS Australian Associations of Christian Schools [note: Associations—plural] AACV Australian Association of Cattle Veterinarians AAD Australian Antarctic Division [Department of the Environment and Heritage] AADCP ASEAN-Australia Development Cooperation Program [taking over AAECP] AADS advanced air defence simulator AADT average annual daily traffic AaE Australian air Express Pty Ltd AAEC Antarctic Animal Ethics Committee AAECP ASEAN-Australia Economic Cooperation Program [finishes in 2005] AAFCANS Army and Air Force Canteen Service [now known as Frontline Defence Services] AAGP Australian Association of Group Psychotherapists Inc. -
Genetic Databases
Stefano Lonardi March, 2000 Compression of Biological Sequences by Greedy Off-line Textual Substitution Alberto Apostolico Stefano Lonardi Purdue University Università di Padova Genetic Databases § Massive § Growing exponentially Example: GenBank contains approximately 4,654,000,000 bases in 5,355,000 sequence records as of December 1999 Data Compression Conference 2000 1 Stefano Lonardi March, 2000 DNA Sequence Records Composed by annotations (in English) and DNA bases (on the alphabet {A,C,G,T,U,M,R,W,S,Y,K,V,H,D,B,X,N}) >RTS2 RTS2 upstream sequence, from -200 to -1 TCTGTTATAGTACATATTATAGTACACCAATGTAAATCTGGTCCGGGTTACACAACACTT TGTCCTGTACTTTGAAAACTGGAAAAACTCCGCTAGTTGAAATTAATATCAAATGGAAAA GTCAGTATCATCATTCTTTTCTTGACAAGTCCTAAAAAGAGCGAAAACACAGGGTTGTTT GATTGTAGAAAATCACAGCG >MEK1 MEK1 upstream sequence, from -200 to -1 TTCCAATCATAAAGCATACCGTGGTYATTTAGCCGGGGAAAAGAAGAATGATGGCGGCTA AATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGAGAGGTTTGACTAATTTTTTA CTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTTTATTAAGGACCAAATATACA ACAGAAAGAAGAAGAGCGGA >NDJ1 NDJ1 upstream sequence, from -200 to -1 ATAAAATCACTAAGACTAGCAACCACGTTTTGTTTTGTAGTTGAGAGTAATAGTTACAAA TGGAAGATATATATCCGTTTCGTACTCAGTGACGTACCGGGCGTAGAAGTTGGGCGGCTA TTTGACAGATATATCAAAAATATTGTCATGAACTATACCATATACAACTTAGGATAAAA ATACAGGTAGAAAAACTATA Problem Textual compression of DNA data is difficult, i.e., “standard” methods do not seem to exploit the redundancies (if any) inherent to DNA sequences cfr. C.Nevill-Manning, I.H.Witten, “Protein is incompressible”, DCC99 Data Compression Conference 2000 2 Stefano Lonardi March, 2000 -
ARC-LEAP User Instructions for The
ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. Glen Weisbrod Teresa Lynch Margaret Collins January, 2004 ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. 2 Oliver Street, 9th Floor, Boston, MA 02109 Telephone 617.338.6775 Fax 617.338.1174 e-mail [email protected] Website www.edrgroup.com January, 2004 ARC-LEAP User Instructions PREFACE LEAP is a software tool that was designed and developed by Economic Development Research Group, Inc. (www.edrgroup.com) to assist practitioners in evaluating local economic development needs and opportunities. ARC-LEAP is a version of this tool developed specifically for the Appalachian Regional Commission (ARC) and it’s Local Development Districts (LDDs). Development of this user guide was funded by ARC as a companion to the ARC-LEAP analysis system. This document presents user instructions and technical documentation for ARC-LEAP. It is organized into three parts: I. overview of the ARC-LEAP tool II. instructions for users to obtain input information and run the analysis model III. interpretation of output tables . A separate Handbook document provides more detailed discussion of the economic development assessment process, including analysis of local economic performance, diagnosis of local strengths and weaknesses, and application of business opportunity information for developing an economic development strategy. Economic Development Research Group i ARC-LEAP User Instructions I. OVERVIEW The ARC-LEAP model serves to three related purposes, each aimed at helping practitioners identify target industries for economic development. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
IATA Catalog of Standards, Manuals and Guidelines
Version 2.0 – December 2018 IATA Catalog of Standards, Manuals and Guidelines Cargo, Safety And Operations, Passenger, Finance And Statistics IATA offers the air transport industry a comprehensive suite of products on a multitude of topics. Ranging from regulations and standards to guidance material, these publications are designed to promote safety and optimize efficient operations. IATA Catalog of Standards, Manuals and Guidelines 1 Contents Cargo Passenger Cargo Agency Conference Resolution Manual (CACRM) 2 A4A/IATA Reservations Interline Message Cargo Claims and Loss Prevention Handbook (CCHB) 2 Procedures (AIRIMP) 10 CargoLink 2 Airline Coding Directory (ACD) 10 Cargo Services Conference Resolution Manual (CSCRM) 2 City Code Directory (CCD) 10 Cargo Tariff Coordinating Conferences Mileage Manual (MPM) 10 Resolutions Manual 2 Multilateral Interline Traffic Agreements (MITA) Cargo-XML Toolkit 2 and Bilateral Interline E-Ticketing Agreements (BIETA) 10 Dangerous Goods Regulations (DGR) 3 Passenger Fare Construction Toolkit (PFCT) 10 Infectious Substances Shipping Guidelines (ISSG) 3 Passenger Services Conference Resolutions Manual (PSCRM) 11 IATA Cargo Handling Manual 3 Passenger Tariff Coordinating Lithium Battery Shipping Guidelines (LBSG) 3 Conference Composite and Worldwide Live Animals Regulations (LAR) 4 Resolution Manual - The Composite Manual 11 Perishable Cargo Regulations (PCR) 4 Reservations Handbook (RHB) 11 Temperature Control Regulations (TCR) 4 Standard Schedules Information Manual (SSIM) 11 The Air Cargo Tariff and Rules -
Countries Entry Instructions 1- MIDDLE EAST: No
Countries entry instructions 1- MIDDLE EAST: No. Country Instructions & Restrictions 1 EGYPT Till 30/06/2020, All international flights to / from Egypt are suspended Health Regulations to enter Egypt: Passengers should wear face masks during the flight. A Health Declaration form should be available on all the international flights. A Health Declaration form should be filled by the Passengers before boarding the flight (at the departure airport) and to be delivered to The Quarantine Authorities upon arrival. Airline must provide the Health Declaration form at the departure airports and insure that the passengers have filled and signed it before boarding the flight (on the international flights) Passengers travelling to Egypt should be screened at the airport of departure. Passengers who are suffering from a temperature (Equal / above) 38C or those who are suffering from one of the respiratory symptoms (cough / sneezing / shortness of breath …etc.) are not allowed to board the aircraft. Aircraft disinfection form should be delivered to The Quarantine Authorities upon arrival for the international flights. The disinfection of the Aircraft and the disinfection of aircraft air conditions filters should be done according to WHO guidelines and the aircraft manufacturer, Aircraft will not be allowed to take off again till obtaining a sanitary quarantine approval from the Egyptian Quarantine Authorities. In case of any of the respiratory symptoms appear on a passenger during the flight, all necessary precautions must be taken if possible by (separate the suspected passenger in an area far from the rest of the passengers / assign one of the cabin crew members to serve the sick passenger / provide a bathroom for the sick passenger only). -
Contactless Solutions Are Key to Promoting a Safe, Secure, Touchless and Seamless Passenger Experience
WELCOME YOUR WEBINAR WILL START SHORTLY Thank you to our sponsor for this webinar During the webinar Your microphone will be muted during the webinar. If you have questions, please use the Q&A panel. All questions are moderated by our legal team. You also have a chat panel. SPECIAL SERIES: RESHAPING THE PASSENGER EXPERIENCE Competition Law Guidelines This webinar is being conducted in full compliance with antitrust and competition law. • Any discussion regarding matters such as fares, charges, division or sharing of traffic, or revenues or concerning any other competitively sensitive topics outside the scope of the agenda is strictly prohibited. • IATA will not answer questions pertaining to individual policies or commercial decisions and/or being subject to bilateral commercial discussions between airlines and their suppliers or customers. Speakers Suresh M Khadakbhavi Jasper Quak Assistant Vice President Managing Director Innovation Lab, Bangalore BAGTAG International Airport Ltd Kelly-Anne Frenette Andrew Price Alan Hayden-Murray Senior Manager Head, Global Head, Airport Passenger Process Baggage Operations Passenger and Security Products A quick question for our audience: Contactless solutions are key to promoting a safe, secure, touchless and seamless passenger experience Biometrics More personal control 8 7/3/2020 A vision for an end-to-end biometric passenger journey A collaborative identity > Pax data is collected, admissibility is validated, and identity is confirmed. management solution spanning across all stakeholders using -
Official Service Contractor for The2018 International Bluegrass Music Association
International Bluegrass Musical Association OFFICIAL SERVICE September 26 - 29, 2018 CONTRACTOR Raleigh Convention Center Hall C Raleigh, NC Information and Order Forms Table of Contents General Information General Information................................................................2, 3 Payment Policy & Credit Card Authorization.........................4 Third Party Billing & Credit Card Charge Authorization..5,6 Color Chart for Drape, Table Skirts and Carpet...................7 Decorating Services Custom Booth Packages...........................................................8 Furnishing Rentals.......................................................................9 Mailing Address: Custom Signs and Graphics...................................................10 P. O. Box 49837 Greensboro, NC 27419 Labor Cleaning Service.........................................................................11 Street Address: Installation and Dismantle Labor............................................12 121 North Chimney Rock Road Exhibitor Appointed Contractor.........................................13,14 Greensboro, NC 27409 Material Handling Phone: (336) 315-5225 Material Handling General Information............................15,16 Fax: (336) 315-5220 Material Handling Rate Schedule and Order Form.......17,18 Shipping Labels........................................................................19 2 General 2 Information HOLLINS Exposition Services is pleased to have been selected as the Official Service Contractor for the2018 International -
Galileo Formats
Galileo Formats October 1998 edition Chapters INDEX Introduction Booking File Air Transportation Fares Cars Hotels LeisureShopper Document Production Queues Client File/TravelScreen Travel Information Miscellaneous SECURITY Sign On H/SON SON/Z217 or Sign on at own office SON/ followed by Z and a 1 to 3 character I.D.; the I.D. can be SON/ZHA initials, a number or a combination of both SON/ZGL4HA Sign on at branch agency SON/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SON/Z7XX1/UMP Sign on at 4 character PCC branch agency SON/ followed by Z, own pseudo city code, second delimiter and 1 to 3 character I.D. SB Change to work area B SA/TA Change to work area A; different duty code TA (Training) SAI/ZHA Sign back into all work areas at own office SAI/ZGL4HA Sign back into all work areas at branch agency; SAI/ followed by Z, own pseudo city code and a 1 to 3 character I.D. Sign Off SAO Temporary sign out; incomplete Booking Files must be ignored or completed SOF Sign off; incomplete Booking Files must be ignored or completed SOF/ZHA Sign off override (at own office); incomplete transactions are not protected SOF/ZGL4HA Sign off override (at branch agency); incomplete transactions are not protected; SOF/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SECURITY Security Profile STD/ZHA Display security profile, for sign on HA; once displayed, password may be changed SDA List security profiles created by user (second level authoriser and above) SDA/ZXXØ List security profiles associated with agency XXØ (second level authoriser and above) STD/ZXX1UMP or Display profile STD/ followed by Z, own pseudo city code, second delimiter if pseudo STD/Z7XX1/UMP city code is 4 characters and 1 to 3 character I.D. -
IATA Travel Pass Q&A Questions Type General Timelines & Pilots Privacy
IATA Travel Pass Q&A Questions Type General Timelines & Pilots Privacy Other providers Costs Lab verification Digital Identity / IATA Contactless Travel App Vaccinations Fraud Governments General Questions Q. What is IATA Travel Pass? IATA Travel Pass is a mobile application that helps travelers to store and manage their verified certifications for COVID-19 tests or COVID-19 vaccinations. This will be important for governments which are likely to require either verified testing or vaccination proof as a condition of international travel during and after the COVID-19 pandemic. The IATA Travel Pass will be more secure and efficient than current paper processes used to manage health requirements (the International Certificate of Vaccination or Prophylaxis, for example). This will be important given the potentially enormous scale of testing or vaccine verifications that will need to be securely managed. Q. How does IATA Travel Pass work? IATA Travel Pass will help people to travel with ease while meeting any government requirements for COVID-19 tests or vaccinations. The IATA Travel Pass has four open and interoperable modules which together create the end-to-end solution. IATA Travel Pass incorporates: 1. Global registry of health requirements – enables passengers to find accurate information on travel, testing and vaccination requirements for their journey. 2. Global registry of testing / vaccination centers – enables passengers to find testing centers and labs at their departure location which meet the standards for testing and vaccination requirements of their destination. 3. Lab App – enables authorized labs and test centers to securely share certified test and vaccination certificates with passengers. 4. Contactless Travel App - enables passengers to (1) create a ‘digital passport’, (2) receive test and vaccination certificates and verify that they are sufficient for their itinerary, and (3) share test or vaccination certificates with airlines and authorities to facilitate travel. -
APCS Consulting
CAPSCA Global Symposium Can Timatic help during the EVD Outbreak? ICAO Headquarters, Montreal, Canada 28-30 April 2015 Agenda Who is IATA? What is Timatic? What are the sources of information? What happened during the EVD outbreak? How to better cooperate? Can Timatic help during the EVD Outbreak? 2 30 April 2015 Who is IATA? IATA - International Air Transport Association IATA is the global trade association for the airline industry present in 130 countries Founded in 1945 with now 250 members comprising 84% of total air traffic IATA’s mission is to represent, lead and serve the industry IATA delivers standards and solutions to ensure a safe, secure and efficient air transport- Can Timatic help during the EVD Outbreak? 4 30 April 2015 Countries becoming ‘middle’ (red) or ‘high’ (blue) income ASIA, LATAM and Africa will become an important source of fast growth for air transport Source:Name IATA/Tourism of Project Economics ‘Air Passenger Forecasts’ 5 30 April 2015 IATA Economics www.iata.org/pax-forecast Outlook for worldwide O-D passenger trips, million Demand for air 9,000 8,000 Liberal policies travel will double scenario 2014-2034 7,000 Current 1.8-2.8x growth over 20 years policies 6,000 2.3-5 billion additional O-D 5,000 passenger trips Closing borders 4,000 scenario 3,000 2,000 2014 2019 2024 2029 2034 Can Timatic help during the EVD Outbreak? 6 30 April 2015 What is Timatic? Airlines are legally responsible to ensure that each passenger has sufficient travel documents for their destination and any transit points on their itinerary! ICAO Annex 9 Facilitation Can Timatic help during the EVD Outbreak? 8 30 April 2015 Timatic is the immigration regulations database for more than 50 years Passport Visa Health Customs Currencies Airport Taxes Every nationality to every airport - Destination and transit regulations Can Timatic help during the EVD Outbreak? 9 30 April 2015 Travel plan & Booking What do I need for my international trip? 1.