Traditional Diet of the Kiwirrkurra Community Living In

Traditional Diet of the Kiwirrkurra Community Living in

the Gibson Desert:

Chemical Composition and Functional Characterisation of

Identified Foods.

Submitted by:

Matthew Roland Flavel, BAnVBioSc (Hons)

A thesis submitted in total fulfilment

of the requirements for the degree of

Doctor of Philosophy

School of Life Sciences

College of Science, Health and Engineering

La Trobe University

Australia

January 2018 Acknowledgements:

I would like to acknowledge the Kiwirrkurra people and Tjamu Tjamu Aboriginal Corporation for their interest, support and participation throughout this project. I am especially grateful to those who specifically assisted with collection and identification of traditional foods and shared stories and knowledge. I would also like to acknowledge the Wurundjeri people who are the traditional custodians of the land the La Trobe

University, Bundoora campus is built on and where I have completed all of my university studies to date.

Special thanks to Dr Markandeya Jois who has been my undergraduate lecturer, Honours supervisor, PhD supervisor and mentor in the philosophy and practice of science. His constant stream of ideas, coupled with a deep appreciation for biology and passion for spirited debate has been vital in forging this thesis and my skills as a scientist.

Thanks is due to an enormous network of mentors and collaborators who have supported me throughout my candidature. Whilst there is not space to acknowledge all who have helped, certain people need to be mentioned. Dr Alan Yen suggested I study the traditional foods found around Kiwirrkurra and was vital in making this idea a reality. Thanks also to my co-supervisor Dr Adam Mechler and his students for assistance developing the liposome culturing methodology and the use of his laboratory. The chair of my

RPP panel Dr Ashley Franks and Elizabeth Mathews for assistance with bacteriological aspect of this work. Professor Weisan Chen and Dr Damien Zanker for assistance assessing the function of particles in axenic media on C. elegans feeding. Dr Daniel Dias and Dr Devin Benheim for assistance with GC-MS analysis. Thanks also to Kate Crossing and Dr Boyd Wright for making the field work component of this thesis a fun and successful experience. Thanks to Dr Jing-Dong Jackie Han, Dr Bo Xian and all members of the PICB, at the Shanghai Institute of Biological Sciences for ongoing collaboration and hospitality whilst I was a visiting student. Thanks also to the other members of the Jois lab who have shared this journey with me and particularly Dr Surafel Tegegne who I have worked closely with along the way.

Thanks to Mum, Dad and my family for providing the genes and environment for a healthy and happy life.

Thanks also to my wife Shanyn for her patience, support and good humour throughout all my studies, but particularly during my candidature.

TABLE OF CONTENTS

Acknowledgements……………………………………………………………………………....……i List of Tables……………………………………………………………………………………...... vi List of Figures……………………………………………………………………………………..….vi Abbreviations and Symbols………………………………………………………………………….ix Thesis Summary………..………………………………………………………………………...... xi Statement of authorship…………………………………………………………………………….xii Audience advice……………………………………………………………….……………………..xii Chapter 1: Literature Review………………………………………………………………………...1

Health gap in Australian Indigenous people………………………………………………..1 Evolutionary Discordance…………………………………………………………………....4 Analysis of the traditional diet of Indigenous Australians………………………………....6 Nutrient composition of Australian foods……...... 8 Meat…………………………………………………….……………………………10 Insects…………………………………………………….………………………….13 Plants……………………………………………………….………………………..16 Antioxidants and lifestyle diseases………………………………………………………....23 In vitro studies……………………………………………………………………………….26 Fruits……………………………………………………….………………………..26 Herbs……………………………………………………….………………………..27 Western Diet……………………………………………………….………………………...29 Genetic predisposition……………………………………………….……………………...31 Current diet of Indigenous Australians…………………………….……………………...33 Clinical trials………………………………………………………….……………………..37 Model Organisms…………………………………………………….……………………...39 Caenorhabditis elegans……………………………………….……………………..40 Research direction…………………………………………………….…………………….47 Chapter 2. The bush coconut (scale insect gall) as food at Kiwirrkurra, Western Australia..….48 Abstract……………………………………………………………………………..………..48 Introduction ………………………………………………………………..………………..48 Materials and Methods……………………………………………………..……………….52

Study Location…………………………………………………………………….52 Nutrient Analysis………………………………………………………………….55 Results………………………………………………………………………………………56 Classification and Size…………………………………………………………….56 Nutrient Analysis………………………………………………………..………...57 Discussion……………………………………………………………………………...…...59 Chapter 3: Identifying and collection of foods found in the Gibson Desert, Western Australia that are of dietary significance to the Kiwirrkurra people..………………..62 Introduction………………………………………………………………………………...62 Materials and Methods…………………………………………………………………….62 Plant and Insect Material…………………………………………………………62 Results and Discussion…………………………....………………………………….…….63 Food Collection Observations…………....………………………………….…....63 Food Behaviour General Observations...……………………………….….…….74 Chapter 4: Identifying compounds and quantifying antioxidant capacity in traditional foods……………………………………………………………………....77 Introduction……………………………………………………………….……………….77

Materials and Methods……………………….…………………………………….…...... 778

Plant and insect material…………………………………………………….…...78 Bush food metabolite extraction…………………………………………………79 Polar metabolite derivatization………………………………………………….80 GC-MS Instrument Conditions………………………………………………….80 Data Processing and Statistical Analysis………………………………………..81 Antioxidant Assay………………………………………………………………...81 Results and Discussion…………………………………………………………………….82 In vitro Antioxidant Activity……………………………………………………..82 GC-MS analysis…………………………………………………………………..84 Acylureas………………………………………………………………....86 Amines……………………………………………………………………87 Amino Acids……………………………………………………………...88 Cyclic Polyols…………………………………………………………….90 Dicarboxylic Acids………………………………………………...……..92

iii

Fatty Acids………………………………………………………………...93 Fatty Alcohols……………………………………………………………..95 Flavonoids…………………………………………………………………96 Glycosides………………………………………………………………….96 Imidazopyrimidines……………………………………………………….98 Monocarboxylic Acids…………………………………………………….98 Pyridinecarboxylic acids………………………………………………….99 Sugars………………………………………………………………………99 Sugar Acids…………………………………………………………….....100 Sugar Alcohols………………………………………………………..…..101 Steroids……………………………………………………………………101 Triterpenoid………………………………………………………………103 Tricarboxylic acids……………………………………………………….104 Conclusions…………………………………………………………………………………104 Chapter 5. Development of a novel Caenorhabditis elegans model for nutrition studies………107 Abstract……………………………………………………………………………………..107 Introduction………………………………………………………………………………..,107 Materials and Methods…………………………………………………………………….109 C. elegans strains and conditions for growth rate experiments………………..109 Media preparation………………………………………………………………...110 Solubilization of particulate fraction in milk……………………………………111 DNA Extraction and Qualitative Polymerase Chain Reaction…………………112 Qualitative analysis of Bacterial DNA in sample………………………………..112 Quantification of bacterial DNA using real-time quantitative PCR (qPCR).....113 FACS analysis for particle detection……………………………………………..114 Liposome preparation and encapsulation of media……………………………..114 Lifestage Scoring…………………………………………………………………..115 Statistical Analysis………………………………………………………………...115 Results and Discussion…………………………………………………………….116 Chapter 6. Use of a novel C. elegans model to assess bioactivity of Solanum chippendalei……132 Introduction………………………………………………………………………………...129 Materials and Methods…………………………………………………………………….134

Plant extract preparation………………………………………………………....134 C. elegans maintenance conditions and growth rate assay conditions…………134 Lifespan assay……………………………………………………………………..135 Media Preparation………………………………………………………………...136 Pumping rate………………………………………………………………………136 Statistical analysis…………………………………………………………………137 Results and Discussion…………………………………………………………………...... 137 C. elegans growth rate…………………………………………………………….137 C. elegans lifespan…………………………………………………………………140 C. elegans feeding behaviour…………………………………………………….. 144

Chapter 7: General Discussion…………….……...………………………………………………147

References…………………………………….……………………………………………………..153

Appendix A Publications during PhD candidature ……………………….……………………..169

Appendix B: Signed Research agreement with Tjamu Tjamu Aboriginal

Corporation…………………………………………………………….…………………..170

Appendix C Ngaanyatjarra council: Permit to enter a reserve……….…………………..179

Appendix D GC-MS chromatograms ……………...... …………….…………………..181

Appendix E Compounds identified by GC-MS in 9 traditional bushfoods.…………..186

Appendix F life stages at 24-hour intervals in tested dietary conditions……………....195

Appendix G Statistical significance of each relative condition in the chapter 5 equivalent growth rate experiments...... 198

LIST OF TABLES

Table 1.1 Edible native plant foods with Vitamin C content greater than

Oranges (Citrus sinensis)………………………………………………………………..22

Table 1.2 Summary of C. elegans lifespan trials on various food extracts……….…..41

Table 2.1 Diameter and weight of bush coconuts collected…….……………………..57

Table 2.2 Calculated values for percentage dry matter (DM) of components of bush coconuts………………………………………………………...…58

Table 2.3 Crude protein and gross energy values of bush coconuts…………………..58

Table 4.1 Antioxidant values (ABTS) for nine Indigenous foods …………………….84

Table 4.2 Semi-quantitative analysis of relative composition of metabolites………...85

Table 5.1 qPCR results for UHT milk samples……………………………………….118

Table 5.2 Number of particles detected in tested media per ml……………………...125

Table 6.1 Mean length of C. elegans exposed to a variety of dietary conditions and concentrations of S. chippendalei extracts……………………………..139

Table 6.2 Mean, Median and Max lifespan for S. chippendalei extract……………....144

LIST OF FIGURES

Figure 2.1 Study location………………………………………………………………..53

Figure 2.2 Bush coconuts collected in Kiwirrkurra……………...………….…………54

Figure 2.3 Cross section of bush coconut, ID number 17…………………………..….55

Figure 3.1 Scientific name: Solanum chippendalei Pintupi names: ngaru,

pintalypa, pura Common name: Tanami Apple, Bush Tomato…………………..….64

Figure 3.2 S. chippendalei A. Whole fruit B. Cross section with inedible

seeds intact. C. Inedible seeds removed, typical portion eaten shown………….…..65

Figure 3.3 Scientific name: Solanum cleistogranum Pintupi name: wirriny-wirrinypa, ttapakara……………………………………………………….….65

Figure 3.4 Scientific name: Solanum centrale Pintupi name: kampurrarrpa

, kanytjilyi, katarapalpa, kintinyka. Common name: Desert raisin, Bush tomato.…66

Figure 3.5 Scientific name: Acacia colei Pintupi name: kuna-kuna

Common name: Cole’s wattle seeds…………………………………………………....67

Figure 3.6 Scientific Name: Acacia tetragonophylla Pintupi name: wakalpuka

Common name: Dead finish………………………………………………………….…..67

Figure 3.7 Scientific name: Carrisa lanceolata Pintupi name: nganangu,

ngamunypurru Common name: Conkerberry, conkleberry………………...... 68

Figure 3.8 Scientific name: Cyperus bulbosa Pintupi name: alka,

kinyuwurru, tjanmata, yalka Common name: Bush Onion…………………..……….68

Figure 3.9 Scientific name: Eragrostis erodopida Pintupi name: nantjuri, wangunu Common name: Woollybutt grass………………………………....69

Figure 3.10 Eragrostis erodopida seed preparation…………………..…………………70

Figure 3.11 Scientific name: Endoxyla leucomochla, Pintupi name: Maku,

vii

Common name: Witchetty grub………………………………….…………………..….70

Figure 3.12 C. opaca gall containing female and male C. pomiformis insect.

Pintupi names: tjuta, pini tjuta, or tinimiit.

Common names: Bush Coconut, Bloodwood Apple……..………………………………71

Figure 3.13 C. opaca tree with intact galls………………………………………………..72

Figure 3.14 Firestick farming practice……………………………………………………73

Figure 4.1 Number of metabolites detected within selected classifications………….…87

Figure 4.2 Numbers of selected acid classses and sugar

metabolite species detected……………………………..……..…………………..………89

Figure 4.3 Number of Fatty-acid metabolites detected..…………………………..…..…94

Figure 4.4 Number of selected alcohol metabolites detected...……………………..……95

Figure 5.1. Effect of milk separation on growth rate……….…...……………………...116

Figure 5.2 Mean bacterial copy numbers in UHT samples detected by qPCR...... 119

Figure 5.3 Effect of particulate matter on development…………….………..…...... 121

Figure 5.4 Effect of filtration of AXM and CeMM media on

C. elegans growth rate…………………………………………………………...….……123

Figure 5.5 FACS detection of particles in various media conditions………...…...... 125

Figure 5.6 Growth rate (length μm) of C. elegans measured at 24 hours whilst exposed to various media conditions……………………………..……………...128

Figure 6.1 Lifespan at varying concentrations of nutrient

viii

and S. chippendalei extract……………………………………………………………140

Figure 6.2 Pumping rate across 6 different dietary and treatment conditions…….145

ABBREVIATIONS AND SYMBOLS

ACE: Angiotensin-1 converting enzyme

ACOSS: Australian Council of Social Service

AXM: Axenic Medium

BMI: Body Mass Index

BSTFA: N,O-bis-(trimethylsilyl)trifluoroacetamide

CeHR: C. elegans Health and Reproduction Medium

CeMM: C. elegans Maintenance Medium

DNA: Deoxyribonucleic Acid dNTPs: Deoxynucleotide triphosphates

DM: Dry Matter

DMPC: 1,2-dimyristoyl-sn-glycero-3-phosphocholine

DPPH: 1,1-Diphenyl-2-picryl-hydrazyl

PCR: Polymerase Chain Reaction qPCR: Quantitative Polymerase Chain Reaction gDNA: Genomic Deoxyribonucleic Acid

GC-MS: Gas Chromatography- Mass Spectrometry

FACS: Fluorescence-Activated Cell Sorting

FNIGC: First Nations Information Governance Centre

FRAP: Ferric reducing activity of plasma

HDL: High-Density lipoprotein

LDL: Low-Density lipoprotein

NGM: Nematode Growth Medium

M: Molarity

PCL: Photochemiluminescence

PUFA: Polyunsaturated Fatty Acid rRNA: Ribosomal ribonucleic acid

RNA: Ribonucleic Acid

RPM: Revolutions Per Minute

SD: Standard Deviation

TEAC: Trolox equivalent antioxidant capacity

TMS: Trimethylsilyl

TNF-α: Tumour Necrosis Factor alpha

UHT: Ultra-Heat Treated

WHO: World Health Organisation

THESIS SUMMARY

Indigenous Australians are at greater risk of developing metabolic disease such as obesity and type-2 diabetes compared to other inhabitants of Australia. Evolutionary discordance caused by a severe environmental change has been suggested as a potential explanation for this phenomenon. The Indigenous population of Australia has experienced drastic environmental change following British settlement and an increase in metabolic disease has since been observed. This thesis seeks to identify key foods of the traditional nutritional environment prior to British settlement and characterise the biochemical composition and action of these nutrient sources. This is intended to provide a resource of the nature of the environment prior to introduction of the Western diet to this environment. The pre-colonisation environment is where Indigenous Australians have evolved to thrive, therefore changes to this environment are targets for disease development. This thesis also describes a new methodology for the rapid analysis of the biological function of these foods using the model organism

Caenorhabditis elegans (C. elegans). Using this methodology the traditional bushfood

Solanum chippendalei was demonstrated to increase the lifespan of C. elegans significantly.

This indicates potential health benefits may be associated with traditional food sources and justifies further research into this area.

STATEMENT OF AUTHORSHIP

Except where reference is made in the text, this thesis contains no material published elsewhere or extracted in whole or in part from a thesis submitted for the award of any other degree or diploma. No other person’s work has been used without due acknowledgement in the main text of the thesis. The thesis has not been submitted for the award of any degree or diploma in any other tertiary institution.

Signed:

17th of January, 2018

AUDIENCE ADVICE

Aboriginal and Torres Strait Islander readers are advised that the following thesis may contain images and names of people who have died.

xii

Chapter 1: Literature Review

Health gap in Australian Indigenous people

Global obesity has tripled since 1975 and now affects close to 2 billion people (WHO 2017).

These 2 billion people are consequently at a drastically increased risk of developing associated disorders including; metabolic syndrome, type 2 diabetes, hypertension, coronary artery disease, stroke, cancer or osteoarthritis amongst other effects (Kopelman 2007). These disorders are some of the leading causes of death worldwide. Therefore, increasing the risks of contracting these disorders is a very serious issue.

Obesity and some of its associated disorders such as type 2 diabetes are at risk of being considered diseases of affluence. Because obesity is characterised as an excess of body fat, it could be assumed that the body fat has arisen due to excess consumption. It would therefore be plausible that disorders relating to excess consumption would be most prevalent in the populations that can afford to consume the most and then decline to be almost non-existent in the poorest populations. However, the data does not entirely support this hypothesis. There are high incidences of type 2 diabetes in developing countries and developed countries alike

(Hossain, Kawar et al. 2007). As some of the data presented throughout this review demonstrates, there are well-documented instances of lower socio-economic groups having a higher incidence of type 2 diabetes compared to the rest of the population of that country.

This increased disease burden at a lower-socio economic level is particularly apparent in

Indigenous groups within these countries.

The Indigenous population of many countries throughout the world experience a higher incidence of type 2 diabetes and obesity when compared to the other residents of that particular country. In Australia, the most recent statistics indicate that 66% of Aboriginal and

Torres Strait Islander people are considered overweight or obese, which is defined as a BMI

1 of 25 kg/m2 or more (Australian Bureau of Statistics 2014). This has increased from a 1994 study where the average ranged from 40-45% that were observed to be overweight or obese

(Mackerras and Cunningham 1996). Early BMI recordings of Indigenous Australians, without influence of western culture have been observed to range from 13.2 to 19.5 kg/m2

(Elphinstone 1966). Considering it is estimated that Indigenous Australians have occupied the land for at least 50,000 years, a pronounced physiological change has occurred in a relatively small time and is therefore cause for urgent investigation to the mechanisms involved in this change (Rasmussen, Guo et al. 2011, Hamm, Mitchell et al. 2016).

Type 2 diabetes is also 3 times more prevalent in the Indigenous populations of Australia, compared with the non-Indigenous population (Australian Bureau of Statistics 2014).

Indigenous Australians are also 1.5 times more likely to be obese than non-Indigenous

Australians (Australian Bureau of Statistics 2014). This disparity between Indigenous and non-Indigenous is observed not just in adults, but also in children. A 2007 paper reported that type-2 diabetes was diagnosed in Indigenous children at an incidence rate ratio of 6.1 when compared to non-Indigenous children in New South Wales (Craig, Femia et al. 2007).

If obesity and type 2 diabetes was truly a disease indicative of affluence, these statistics would likely be reversed. In 2012, the gross median wage of an Indigenous Australian adult was $465, $404 less than a non-Indigenous Australian (Australian Government 2014). This median income is only $38.70 above the Australian poverty line (Acoss 2016). Ultimately, this results in a mean lifespan for Indigenous males of 57 years, and 64 for females (Altman

2001). Which is in stark contrast to the non-Indigenous lifespan of 75 years for males and 81 for females (Altman 2001). It must be acknowledged that a low socio-economic status does introduce further factors such as a lack of access to healthcare and education, that may be influencing the progression of these lifestyle diseases. However, what is clearly seen is that

2 the incidence of obesity and associated diseases such as type 2 diabetes in Australia’s

Indigenous population is increasing, in the absence of affluence.

This trend is reflected in Indigenous populations beyond Australia. In Canada, the incidence of diabetes for Indigenous people is 20.7 % compared to 6.2 % for non-Indigenous people

(FNIGC 2012). A review article which collated studies of mortality as a result of diabetes and compared Indigenous inhabitants of the United States of America, Canada, New Zealand and Australia to the non-Indigenous inhabitants of the respective countries found increased mortality in the Indigenous population for all countries studied (Naqshbandi, Harris et al.

2008). The rate of mortality due to diabetes was still higher in the Australian Indigenous people compared to any other country studied (Naqshbandi, Harris et al. 2008).

However, there are some examples where the Indigenous population of the country in question has a lower incidence of type 2 diabetes compared to migrants. This has been observed in Tanzania and South Africa (Motala, Omar et al. 2003). This lower incidence does not appear to result from a genetic protection of people from type 2 diabetes that applies irrespective of surrounding environments. This is because people of African heritage were observed to have a higher incidence of diabetes when they migrate to the Caribbean, Europe or the United States of America compared with people who remain in their country of origin

(Cooper, Rotimi et al. 1997). This increased prevalence of obesity and diabetes in recently migrated individuals is not only limited to populations of African descent and is observed in recently migrated Hispanic populations (Markides and Coreil 1986), Indian populations

(Ebrahim, Kinra et al. 2010) and Japanese migrants (Kawate, Yamakido et al. 1979) amongst others. This indicates that susceptibility to obesity or diabetes must be assessed in context of the surrounding environment of an individual.

It may be possible to subdue the damaging effects of migration if the migrants are able to preserve the environment from which they have migrated. However, this is not necessarily a positive for the native population of that area, as this situation is dependent on the native environment changing. There have been relatively recent examples of populations remaining in their native area, but the surrounding environment changing much faster than usual. In an

Australian context, this profound change to the environment came with the arrival of the

English First Fleet in 1788. The full spectrum of changes these ships brought to Australia is beyond the scope of this thesis. However, one of the key changes this arrival introduced was a different approach to food and consequently a change to the diet of Indigenous Australians.

It is this change to diet that will be the predominant focus of this thesis.

Evolutionary Discordance

A hypothesis known as evolutionary discordance has been suggested to explain the increased prevalence of disease in changing environments (Cordain, Eaton et al. 2005). An environmental change after a long period of stability causes a discordance between the genome that has evolved in adapting to the old environment and the new environment. This is because a genotype that has evolved in a specific environment will possess fitness advantages specific to that environment. If that genotype moves to a different environment, that genotype may still have fitness advantages, but may just as plausibly be neutral or disadvantaged to certain selective pressures inherent in the new environment. The disadvantaged genotypes in the new environment are therefore more vulnerable to disease. Because an environment can be changed much quicker and easier than a genotype, a change to the environment can have important biological implications. The 10,000 years since the introduction of agriculture is viewed as relatively brief in evolutionary time. (Eaton, Konner et al. 1988). Western cultures

4 that have had 10,000 years to adapt, are currently battling diseases that have been linked to this environment change such as obesity, type 2 diabetes and cardiovascular disease (Cordain,

Eaton et al. 2005). Some Australian Indigenous communities have made this transition to a fully developed agricultural system within a single generation. Therefore, such drastic changes to an environment, especially after long periods of relative stability should be viewed with particular interest.

Prior to the arrival of the first fleet Indigenous Australians lived off the land as hunter- gatherer communities. This lifestyle still relied heavily on managing the land in ways that are analogous to western farming methods. Practices such as the maintenance of eel aquaculture systems (Builth, Kershaw et al. 2008), the use of fire-stick farming (Jones 1969), or the growth of fruit trees from discarded seeds at regularly visited camp sites (O'Dea, Jewell et al.

1991) are examples of anthropogenic food systems developed by Indigenous Australians.

Yet these practices are very different to the agricultural practices introduced by the British.

The farming practices that were introduced by the British colonisation of Australia also produce very different foods nutritionally. It is these foods that form the basis of the western diet and will be discussed in more detail throughout this review. For this reason, it is important to explore what is already known of the prevalent dietary practices that were common throughout the long history prior to the introduction of the western diet to Australia.

This understanding of what was common before will provide a foundation for understanding what changes were introduced by the western diet. This thesis will use these differences between lifestyles as targets of environmental change to be explored in order to understand their underlying effect. This is intended to provide valuable insight into the epidemiology of nutrition related diseases such as obesity, type 2 diabetes and their ultimate effect on lifespan.

This theme will be particularly explored in relation to the development of nutrition related diseases in Australian Indigenous people and research into the genetic basis that has been

5 argued to make this population more susceptible to the development of obesity and type 2 diabetes. However, it is hoped that these insights may have a broad application to the prevention of nutrition related disorders, irrespective of cultural background. Nutrition related disorders such as obesity and type 2 diabetes are widespread globally and appear to be closely related to environmental factors. The Indigenous population of Australia have experienced very recent and drastic changes to their environment. Understanding the mechanism and effect of these changes may assist in preventing and treating these disorders in general. The environmental factors contributing to the increase in disease burden are extensive and includes; diet, exercise, genetic and socio-economic considerations amongst others. This thesis will focus specifically on the role of dietary change in this discussion.

Literature that has attempted to record information regarding the traditional diet of

Indigenous Australians or understand any health related effects of a diet consisting of these foods will also be reviewed.

Analysis of the traditional diet of Indigenous Australians.

Australia is a large land mass, containing a range of climate conditions and environments.

Therefore, the kinds of foods that can be hunted or gathered are very much dependant on factors such as region and will change considerably in response to factors such as fire or season. Therefore, generalisations regarding diet across the entire continent or throughout all time are difficult. However, some important themes are consistent in a variety of contexts.

To complicate the studies of diet further, records of the dietary practices of some of these regions have now been lost. It has been speculated that most of the early records of traditional foods used by Indigenous Australians focus on those foods that are hunted and gathered by male members of Indigenous communities (Yen 2015). This is thought to be

6 because the British settlers who were observing and recording the collection of food were men and their bias influenced what was observed (Yen 2015). Therefore, the records contain less information regarding the foods collected by women such as insects and plants in comparison to large vertebrates that would typically be hunted by the men in the community

(Yen, Bilney et al. 2016).

A separate issue to the recording of these traditional food practices centres on the expropriation inherent in colonialism. The areas with very little amount of recorded information regarding traditional food practices are often found around the first areas of

Australia to be converted to farmland by English settlers (O'Dea, Jewell et al. 1991). This transition to farmland had a dual effect on the diet of Indigenous Australians. Firstly, it introduced new foods and agricultural practices to the area. Secondly, this transition disrupted the family structures that were critical in passing on the knowledge surrounding the collection and preparation of the food that was available in these areas (Holt 2001). This disruption was caused by a wide variety of factors. However, there are some clearly significant factors such as the reduction of the Indigenous population of Australia by roughly 95% between 1788 and

1840 and practices such as the separation of families due to the removal of children from

Indigenous families to be fostered into colonial homes beginning in 1914 (Petchkovsky, San

Roque et al. 2004). This process has been further exacerbated by the urbanisation of many

Indigenous communities, which has restricted access to traditional food and preferences a typical western diet, high in refined carbohydrate and fat (O'Dea, Traianedes et al. 1988,

Foley 2005). This highlights the importance of preserving the knowledge of these traditional practices before it is too late. Conversely, there are regions where traditional food is still incorporated into the diet. This means there is a unique opportunity to study these traditional food practices at an important junction in history, whilst they are being challenged for survival. Understanding and applying the traditional knowledge to current issues of nutrition

7 are important steps to ensure the security of this valuable resource into the future.

Fortunately, there has already been detailed work recording and analysing the diet of

Indigenous Australians, both pre and post influence of the western diet. These studies will form the basis of this section of the review.

Nutrient composition of Australian foods.

The most comprehensive record of the nutritional composition of Australian Aboriginal foods was compiled and first published in 1993 (Miller, James et al. 1993). This book was the result of a very large-scale project to collect and analyse as many Indigenous foods as possible and make this data available for use in understanding the diets of Indigenous people and the nutritional composition of Australia’s wild food. Samples were analysed for macronutrient profile, but also reported information on other nutrient properties such as fibre, vitamins and minerals. However, none of the foods analysed have a complete set of data for all nutrient properties tested. Overall, roughly 500 different food sources were analysed, which the authors note does not represent all foods eaten by Australian Indigenous communities throughout history, or even at the time of publication. This alone is an interesting observation that indicates the vast variety of nutrient sources that are utilized in traditional diets. This is in stark contrast to the lack of variety of food provided to the first Indigenous people who began working for British settlers. These rations varied in exact composition but were based around combinations of flour, sugar, tea, jam and meat (Foley 2005). Food variety can be an indirect indicator of quality of nutrition (Hodgson, Hsu‐Hage et al. 1994). This is because eating a narrow variety of foods can lead to deficiencies in nutrients that are in low concentration or absent from those foods and even cause an excess of nutrients that are in high concentration in those foods. It is not a direct measure of the nutrient quality of foods

8 because all essential nutrients could theoretically be present in the food sources consumed.

However, it becomes more unlikely that a nutrient will be excluded from a diet as the variety of foods eaten increases. Consequently, eating a variety of foods is adopted into many dietary recommendations (Truswell 1987).

Overall, the publication from Miller, James et al. (1993) is a very useful resource. Due to the difficulty of locating, collecting and transporting some of these foods, a data set of 500 foods is an exceptional result. There are some minor issues with the methodology used by the authors that limits the way this data can be applied. One clear issue is their use of Atwater factors to approximate energy density of the samples. Atwater factors have been suggested to overestimate energy values and therefore more direct measures of energy density such as bomb-calorimetry would be preferable (Zou, Moughan et al. 2007). A secondary issue with studying the nutrient profile of these wild foods, is the taxonomy used to identify them. The confusion has been able to develop due to the range of languages used to identify these food sources, coupled with the incorrect or overly general usage of common and scientific names attributed to these organisms (Yen, Bilney et al. 2016). This has resulted in a lack of clarity surrounding the nutrient properties reported by Miller, James et al. (1993). It is now unclear in some instances exactly what species they have analysed. There are examples of species that have since been redefined or split from one species into numerous species (Semple,

Gullan et al. 2015, Yen, Bilney et al. 2016). In some instances, the data reported by Miller,

James et al. (1993) does not differentiate the analysis of the food sources into the individual components of the foods that are consumed. This is particularly problematic for calculating nutrient intake if the food contains edible components that are preferenced or ignored in comparison to other components of that food. Lastly, whilst the range of food sources analysed is very diverse the detail of information on each food type is simplistic. Whilst macronutrients, vitamins and minerals have irrefutable importance in any general discussion

9 surrounding nutrition, there are other factors that have import implications for lifestyle diseases such as obesity and type 2 diabetes. Foods containing components such as phytochemicals and antioxidants have been suggested to have a protective effect against obesity and type 2 diabetes. Analysis of some of the key literature involved in this debate will be discussed in further detail later in this review. However, Miller, James et al. (1993) did analyse the vitamin C content of some of the foods collected. Vitamin C has a long association with discussions around health and is a known antioxidant (Padayatty, Katz et al.

2003). Vitamin C content is suggested to have a beneficial effect on type 2 diabetes that may be mediated by this antioxidant effect (Ting, Timimi et al. 1996, Harding, Wareham et al.

2008). The Miller, James et al. (1993) data does add to the understanding of the intake of antioxidants in traditional diet. However, there are a vast array of food components beyond vitamin C with suggested antioxidant effects and potential health benefits. In addition, vitamin C content is not reported for all food samples in the data set of Miller, James et al.

(1993). Therefore, an approach to classifying the composition of food that identifies a much broader range of components would be useful. Beyond the publication of Miller, James et al.

(1993) there have been other detailed studies analysing the nutrient composition and potential health effect of these foods which are common in the traditional diet of Indigenous

Australians.

Meat

A range of animal species were hunted across Australia as a source of nutrition for

Indigenous Australians. A 1986 study analysed the fat content and fatty acid composition of some important food species across Australia (Naughton, O'Dea et al. 1986). Thirty-four animals were analysed in total and collected across the diverse environments including The

Kimberleys, Central Australia and South East Australia. This included mammals, birds, reptiles, fish, crustaceans, molluscs and one insect species. The major finding of this study was that all animals analysed were low in fat, returning values less than 2.6% wet weight.

This paper also identifies a key difference between the fat distribution of these wild animals and domesticated animals. The fat content of the animals analysed was not detected in high concentrations within muscle tissue, or under the skin, which is characteristic of domesticated species (Naughton, O'Dea et al. 1986). The different fat deposition profiles in these species compared to domestic would therefore influence the intake of fat, based on what parts of the animal are consumed. Furthermore, a high percentage of the fat content detected consisted of polyunsaturated fatty acids (PUFA). This finding of high PUFA composition is relevant to this discussion as diets rich in PUFA have been correlated with health benefits predominantly related to cardiovascular health (Nettleton and Katz 2005). However, other benefits such as reduction of inflammatory diseases, asthma, cystic fibrosis and arthritis have been suggested, but there is still not a clear consensus on whether these claims are fully supported by the evidence (Ruxton, Reed et al. 2004). Gradually, studies have given greater attention to the ratio between n-3 polyunsaturated fatty acid and n-6 polyunsaturated fatty acids, rather than just the crude PUFA levels for health benefits (Marventano, Kolacz et al. 2015). The

Naughton et al. (1986) study did analyse levels of both n-3 and n-6 PUFA and is therefore still a relevant resource for the impact of PUFA levels on traditional diets on health. This also highlights the importance of considering nutritional factors beyond macronutrient profile when addressing issues of health in Indigenous diets. A subsequent study published by the same authors of the 1986 study (plus one additional author) specifically analysed fat composition of fish and cephalopods (Dunstan, Sinclair et al. 1988). Fish species are generally accepted to have a high content of polyunsaturated fat, so this data does not reflect a significant progression to the field. However, due to the detail of analysis performed and

11 comparison of a large number of species studied this is still a useful resource for understanding the composition of traditional diets.

There is clinical evidence in Indigenous Australians for the differing health effects of consuming wild bush meats compared with domesticated meats (Burke, Zhao et al. 2007).

This study assessed the risk factors for development of diabetes and the severity of any resulting hospitalisation. It was found that consumption of processed meats more than 4 times a month was a risk factor for the development of diabetes and longer hospitalizations once diabetes had developed compared with diabetics that did not consume processed meats

(Burke, Zhao et al. 2007). Eating bush meats was found to decrease the risk of developing diabetes and if hospitalization occurred, it would be for a shorter duration. A similar effect was observed when fat was trimmed from other store bought meats however.

Due to the lower fat content and distribution typical of wild meats it is difficult to decipher if this reduced risk associated with eating bush meat is caused by a reduction of fat intake in general, or a consequence of potential protective components such as PUFAs. There is also a possibility that this correlation between bush meat intake and decreased risk of diabetes may be caused by indirect behaviours associated with bush food intake. An example of indirect behaviours associated with consumption of bush foods would be the effect of the exercise required to catch wild meat, compared to buying it at the supermarket. Another example would be the consumption of wild plants or insects eaten whilst out hunting, that may be contributing protective properties against diabetes and obesity. These explanations all rely on the person consuming the meat to also be the one who hunted it, which would not always be the case. However, the findings of (Burke, Zhao et al. 2007) do not control for these discrepancies. In addition, environmental factors such as water quality, ambient temperature and humidity may also have impacted this result.

Insects

One major difference in animal product consumption between traditional Indigenous diets and the Western diet is difference in attitudes towards insect consumption. Insects are consumed by 3,000 different ethnic groups around the world (MacEvilly 2000) and

Indigenous Australian’s groups are counted in this number. There are at least 60 different species of edible insects in Australia which form an important component of traditional diets

(Jongema 2012). Modern western countries, especially with strong heritage from the United

States of America or Britain, do not commonly consume insects. Some Western countries have also legislated against food products containing insects, or to limit permissible levels

(Yen 2010). This aversion to consumption of insects is thought to be linked to a cultural view in western societies that insects are not a hygienic food source (DeFoliart 1999). An example highlighting this perspective is that both insects and bacteria share the commonly used and colloquial term “bug” to describe these distinct groups. This comparison is indicative of the

Western perspective that insects are associated with disease, rather than nutrition.

However, in traditional Australian Aboriginal diets, insects make a significant contribution.

The role and nutritional contribution of insects varies seasonally, geographically and between communities. However, some notable roles of entomophagy include assistance weaning babies from breast milk with the help of witchetty grubs (Tindale 1953), an additional source of water for desert communities (Miller, James et al. 1993) and having an important role in traditional ceremonies (Bodenheimer 1951). The contribution of animal protein to the diet in some Indigenous communities has been estimated between 5-10% annually (Yen 2010).

Overall, the importance of insects to the traditional diet of Indigenous Australian’s is in stark contrast to the attitudes towards entomophagy adopted by Western cultures and diets.

Despite the lack of insects incorporated into Western diets, there have been properties already identified in Australian insects that are relevant to broader nutritional discussions. One observation was made in the (Naughton, O'Dea et al. 1986) paper discussed earlier regarding the fatty acid composition of a commonly eaten insect referred to as a witchetty grub. The authors detected almost no levels of polyunsaturated fatty acids, but suggested that the levels of oleic acid were similar to those detected in olive oil (Naughton, O'Dea et al. 1986). Given the importance of witchetty grub in traditional diets, this comparison to olive oil draws parallels to diets that rely heavily on olive oil such as the Mediterranean diet. The

Mediterranean diet has been associated with a reduction of risk factors associated with cardiovascular disease, including a reduction in waist circumference, triglyceride content, blood pressure and blood glucose levels and an increase in high-density lipoprotein cholesterol (HDL) levels (Kastorini, Milionis et al. 2011). These risk reductions associated with the Mediterranean diet are directly related to the diseases that are observed to increase in

Indigenous Australian populations following introduction to the Western diet. Therefore, it is worthwhile to investigate the literature to assess if there is any evidence of detected witchetty grub components having a protective effect against diseases such as obesity and diabetes.

Unfortunately, Naughton, O'Dea et al. (1986) make the claim that witchetty grubs are similar to the composition of olive oil without providing a reference value for oleic acid detected in olive oil. Mono-unsaturated fatty acids such as oleic acid were found to contribute 67.1% of the fat content with poly-unsaturated fatty acids contributing 0.4% in witchetty grubs

(Naughton, O'Dea et al. 1986). This comparison of oleic acid composition does appear justified, as an analysis of fatty acid profiles in olive oil found that oleic acid contributes

71.6% of total fatty acids (Kamal-Eldin and Andersson 1997). This is a significant finding as oleic acid content has been suggested as a major factor responsible for the reduction in obesity, blood pressure and metabolic syndrome associated with olive oil intake (Terés,

Barceló-Coblijn et al. 2008, Bermudez, Lopez et al. 2011, Gillingham, Harris-Janz et al.

2011). This finding of high oleic acid content in witchetty grubs highlights a potential target for a compound present in the traditional diet of Indigenous Australians that could have a protective effect against chronic disease. If witchetty grubs and other similar insects are removed from the diet with a transition to Western diet, these protective compounds may be lost. Oleic acid is a single compound and may not represent the full range of protective compounds that witchetty grubs and the broad spectrum of traditional foods may be contributing to overall defence from chronic disease. Miller, James et al. (1993) analysed the

Vitamin C content of witchetty grub (Cossidae sp.) detected to range from 3 to of 6mg/ 100g and below detected values in one sample. Vitamin C would be a potential candidate for a protective compound against chronic disease, as it would indicate the food might have capabilities as an antioxidant. This puts the vitamin C content of witchetty grubs in a similar range to blueberries (Prior, Cao et al. 1998). This high vitamin C content of Australian insects is not limited only to Witchetty Grubs. The abdomen of Bogong Moths (Agrotis infusa) were detected to have 11mg/ 100g and Bloodwood Gall/ Bush Coconut (Cystococcus sp.) ranging from 2 to 7 mg/100g of Vitamin C. Vitamin C is only one compound, but provides an example of the complexity of nutrients that insects would contribute to the traditional beyond macronutrients such as protein, carbohydrates and fats. The daily fruit and vegetable intake of

Indigenous people over the age of 15 has been observed as inadequate in 57% of the population (Australian Bureau of Statistics 2014). This inadequate fruit and vegetable intake, coupled with a reduction or total avoidance of insect consumption that is associated with a western diet will result in the intake of compounds such as vitamin C falling below adequate levels. Vitamin C content in the traditional diet will be discussed in more detail later in this review. The data recorded so far is limited in scope, because it gives an overly simplistic view of the nutrient composition of Indigenous foods such as insects and other wild meat

15 sources. For the components that are tested such as macronutrients, fatty acids, some vitamins and minerals it is very useful, as concentrations of these variables are reported across a large variety of samples. However, an untargeted and broad approach to traditional foods would be useful to uncover the complete complexity of these foods. An understanding of the full range of components that make up these foods would be a useful contribution to the field. This is because it would then be possible to identify compounds unique to the traditional diet as potential protective compounds from nutrition related disorders. In addition to unique compounds, this approach could identify compounds that are common in both traditional and western diets with potentially protective characteristics such as, but not limited to oleic acid and vitamin C.

Plants

Plants make an important nutrient contribution to the traditional Indigenous diet. However, estimates of plant intake in these communities have varied widely. One observer estimated plant intake of a community in the Western Desert to be around 50% (Gould 1969). Whereas, another community was as high as 70%-80 of total diet (Meggitt 1957). Plant intake is intertwined with meat intake due to the availability of plants while hunting. As large quantities of plants are thought to be consumed while hunting (Latz 1995). There is even one observation of a kangaroo hunt being abandoned due to a find of ripe fruit (Latz 1995). Plants are sometimes used as tools to assist in hunting, contributing poisons or snares to the resources of the hunter (Latz 1995). However, a detailed analysis of plant uses that are not directly related to food intake, goes beyond the scope of this review. Any observations about percentage of plant contribution to diet would be heavily influenced by seasonality factors that change the availability of plants, but also other food sources such as game, insects etc. It

16 has been estimated that there are more than a 1,000 edible plants available in Australia

(Brand-Miller and Holt 1998), with around 140 plant species still being used as food source in Central Australia (Latz 1995). Over 800 different plant species with edible components have been analysed for nutrient content (Miller, James et al. 1993, Brand-Miller and Holt

1998). Similar to other food products discussed earlier in this review, this analysis describes the profile of macronutrients, some vitamins and minerals. A small number of individual samples analysed also restricts this methodology, which is mainly a consequence of the difficulty of sample collection. In addition, analysis expressed on wet weight basis is inconvenient for comparison between foods. The analysis also includes components of plants that are not usually eaten, which is mixed with edible portions. This complicates the use of these tables for nutritional discussion, as it is difficult to decipher what the nutrient contribution of these foods would be. There has been a wider range of biochemical analysis of plant foods, in comparison to meat products with some topics of nutrition explored in both plant and meat foods.

Similar to the work of (Naughton, O'Dea et al. 1986) on fatty acids found in meat, the fatty acid profile and lipid content of plants has also been studied. The fatty acid profile and lipid content of 20 edible Australian Acacia seeds were analysed (Brown, Cherikoff et al. 1987).

Acacia seeds are recognised as an important supplement to Indigenous traditional diets, particularly in desert climates (Meggitt 1957, O’Connell, Latz et al. 1983, Latz 1995).

Brown et al. (1987) found a broad range of fatty acid profiles across the 20 species sampled.

The average lipid content of these seeds was 11%, with linoleic, oleic and palmitic acids the major fatty acids detected. The highest oleic acid content detected was in Acacia tetragonophylla with 56.5% of total lipid content. This was lower than the values discussed earlier for both witchetty grub and olive oil, however is still a reasonably high percentage.

Total lipid levels detected were consistent with other data from Miller, James et al. (1993).

For example Acacia acradenia was detected by Brown et al. at 8% of dry weight, compared to the Miller et al. value of 7.6% of wet weight, 22% compared to 21.6 % for Acacia adsurgens and further comparisons possible throughout Acacia species present in the two data sets. This data is therefore relevant to health issues that may be ameliorated by fatty acids such as oleic acid. However, research into nutritional components of plants with potential health benefits goes beyond fatty acid profile.

One area of interest that has gained attention is an apparent low glycaemic index of traditional foods. A study by Thorburn, Brand et al. (1987a) measured the digestion and absorption of 20 Australian bushfoods and compared it to 10 traditional bush foods of the

Pacific Island and 7 foods common to the Western diet such as bread, rice, corn and pasta.

Digestion of all the Australian bush foods was slower than the Western foods. A selection of these Australian bush foods was compared against potatoes for insulin response. Plants

Dioscorea bulbifera (Cheeky yam), Acacia aneura (Mulga seed) and Castanospermum austral (Black bean) and the wild honey commonly referred to as Honey Bag were all observed to return significantly smaller areas under a plasma insulin curve than potatoes. This study analysed the digestion, plasma insulin and glucose responses in Caucasian subjects.

This experimental design is useful for baseline data, however a comparison of the insulin responses of Indigenous and non-Indigenous Australians would have been helpful. A comparison of Indigenous Australians to Caucasians would allow for an understanding of whether there are hereditary differences in the digestion, insulin and glucose response between these two groups for both traditional bush foods and western foods. The authors speculate that Indigenous Australians may have evolved to deal with slower release carbohydrates without testing the actual responses of Indigenous Australians to these foods.

The authors go on to speculate that this difference in response would be an example of the

‘thrifty gene’ hypothesis in action. This literature review will cover the ‘thrifty gene’

18 hypothesis in more detail later in the course of discussion. Beyond the ‘thrifty gene’ hypothesis the authors suggested a higher concentration of amylose and lower concentration of amylopectin in bush foods to be the main cause of the improved glucose metabolism. This is yet another example of the importance of not just the macronutrient profile of Australian bushfoods, but also measuring the complexity and bioactivity of other nutritional components.

A separate paper also published in 1987, sharing some of the authors with the Thorburn,

1987a, paper studied this difference in glycaemic response between Caucasians and

Indigenous Australians to bush potato (Ipomoea costata) and a domestic potato variety

(Solanum tuberosum) (Thorburn, Brand et al. 1987b). The two foods had similar macronutrient profile with the exception of sugar content 3.4g/ 100g in the bush potato (I. costata) compared to 0.4g/ 100g in the domestic potato (S. tuberosum). Both Indigenous and

Non-Indigenous participants had similar responses to the bush potato for blood glucose and insulin concentrations. However, Indigenous Australians were found to have 2.5 times higher areas below the curve for both insulin and glucose levels. This is a very interesting result as it does add evidence to the potential difference in metabolism of Western foods for Indigenous

Australians. However, this study does still suffer from a small sample size. The eight

Indigenous Australians tested were all males from the same community in Derby, Western

Australia. The Caucasian sample group included three women and four males without an area of recruitment specified. Recruitment of a range of eligible participants is difficult due to a variety of factors including logistical, ethical and cultural concerns. However, due to the small sample size it is difficult to decipher if the different metabolism correlated with

Indigenous decent is indicative of Indigenous people in general or due to other factors such as sex, or region. Unlike the earlier discussed paper by Thorburn, Brand et al. (1987a), the study of Thorburn, Brand et al. (1987b) only assessed the effect of one traditional food type

19 and one western food type. This did provide a good comparison due to the similar macronutrient profile between the two potato varieties. However, it would have been interesting to see if there was a difference in the response between Indigenous and non-

Indigenous groups across a range of bushfoods. I. costata was a good choice for the purposes of this experiment as it had the most similar starch absorption of any of the bushfoods tested by Thorburn, Brand et al. (1987a) and macronutrient profile and still produced a different effect in Indigenous Australians. Other bushfoods tested by Thorburn, Brand et al. (1987a) had a significant reduction in Caucasian glucose and insulin levels. These would be useful targets of preventing obesity and diabetes in the high-risk Indigenous population. Given that

Thorburn, Brand et al. (1987b) found that there is a metabolic difference between an

Indigenous population and Caucasian participants, it is possible that the Caucasian tested bush foods would not have the same response in the Indigenous participants. However, the response of both Indigenous and non- Indigenous groups was similar to I. costata. Therefore, the response to bush foods between the two cohorts could plausibly be the same. Without thorough data to support this hypothesis, it is difficult to make generalisations about the effect of bush foods in a public health context. Regardless, this finding is still an interesting observation. Information that is more detailed is required to understand the implications this finding may be having on the incidence of obesity and diabetes in Indigenous Australians.

The plant intake of Indigenous Australians has also been suggested to lower the risk of diabetes by helping to meet requirements supplying nutrient rich food at a lower energy density. One study correlated high levels of magnesium and creatinine in urine with a reduced risk of Metabolic Syndrome (Hamada, Taguchi et al. 2011). This increased detection magnesium biomarkers in urine is hypothesized to be correlated with an increased intake of vegetables and seafood that would be typical of a hunter-gatherer lifestyle. However, it is not known from this study whether magnesium has an active role in reducing risk of Metabolic

Syndrome, or is only indicative of a diet that is rich in plants and other foods. A diet rich in plants may also contain beneficial compounds such as fibre, antioxidants and phytochemicals which could theoretically be the mechanism driving the protection from metabolic syndrome.

Some studies have focused specifically on these protective compounds in plants.

Of all the potentially protective compounds present in Indigenous edible plants, the most complete data set has been compiled for vitamin C. As discussed earlier in this review, vitamin C is an antioxidant, with suggested health benefits particularly for chronic and inflammatory disease. It is also widely distributed in plants and therefore likely to be consumed in considerable quantities in a diet with a high intake of plant foods. Miller, James et al. (1993) reported vitamin C content for a number of the plant foods they have included in their tables of composition. However, this measurement is still missing in many of the plant and other food sources included in this book.

Perhaps the most famous example of vitamin C content is Terminalia ferdinandiana, commonly known as Kakadu Plum or Billy Goat Plum which was detected as having 50 times the vitamin C content of oranges (Brand, Cherikoff et al. 1982). It was even suggested to be the fruit with the highest vitamin C content in the world (Brand, Cherikoff et al. 1982).

This finding of a high concentration of a desired nutrient has caught the attention of the food industry as a target for further development (Chaliha, Williams et al. 2017). This Vitamin C concentration greater than orange is not isolated to the Kakadu plum either. According to the

50mg/ 100g reference value used by Brand, Cherikoff et al. (1982) as a reference value for oranges, many other Indigenous plant foods have been detected with equal or greater concentration of Vitamin C. Indigenous plant foods with a vitamin C content value greater than oranges (50mg/100g) in native Australian bushfoods are shown in Table 1.

Table 1.1 Edible native plant foods with vitamin C content greater than oranges (citrus sinensis) (50 mg/100g). Data adapted from (Miller, James et al. 1993).

Common name (Scientific name) Maximum Detected Vitamin C

Content mg/100g

Kakadu plum Terminalia ferdinandiana 5320

Terminalia carpentariae 1995

Terminalia latipes 1800

Sandpaper Fig (Ficus opposite) 918

Long Yam (Dioscorea transversa) 728

Rose Hips (Rosa cania) 468

Physalis emblica 316

Cashew Fruit (Anacardium occidentale) 265

Cheeky Yam (Dioscorea bulbifera), 233

Tanjong Tree (Mimusops elengi) 223

Wild Olives (Terminalia aff. latipes) 146

Morinda Americana 123

Cynanchum pedunculatum 119

Sea Lemon (Ximenia citrifolia) 108

Wild Orange (Capparis mitchelli) 98

Native Onion (Cyperus bulbosa), 97

Great Morinda Cheese Fruit (Morinda citrifolia) 90

Polynesia Arrowroot (Tacca leontopetaloides), 78

Wild Cherry (Antidesma bunis) 69

Bush Tomato (Solanum chippendalei) 59

Bush Plum (Santalum lanceolatum) 54

Green Plum (Buchanania obovate) 53

Vitamin C is not a difficult nutrient to obtain from non-Indigenous sources. However, its presence in a concentration so many times greater than a Western diet food item is indicative of the difference in nutritional environment post British settlement. Vitamin C is only one of a wide variety of compounds with potential health benefits mediated by antioxidant effects.

Some of these compounds have been identified and studied, particularly in native fruits and will form the basis of the next section of this review.

Antioxidants and lifestyle diseases.

Obesity is a condition that is associated with chronic inflammation and increased oxidative stress (Xu, Barnes et al. 2003, Furukawa, Fujita et al. 2017). There is a growing body of evidence that a disruption of oxidative stress and inflammatory pathways with specific diet or exercise regimes may result in a reduced risk of obesity and diabetes (Maritim, Sanders et al.

2003, Roussel, Hininger et al. 2009, Teixeira-Lemos, Reis et al. 2011). Traditional diets would be expected to be rich in antioxidants due to high plant intake and have an increased level of exercise due to the difficulty of hunting and gathering food, compared with buying it at a shop or having it delivered. An example of antioxidant content analysis, vitamin C, has already been addressed in this review. However, further studies have been performed addressing the antioxidant capabilities and mechanisms of native Australian fruits in detail.

The first study to directly address the antioxidant capacity of Australian food plants was published in 2006 (Netzel, Netzel et al. 2006). This study analysed the antioxidant capacity of 7 different fruits Muntries (Kunzea pomifera), Tasmanisan pepper berry (Tasmanian

23 lanceolata), Illawarra plum (Podocarpus elatus), Burdekin plum (Pleiogynium timorense),

Cedar Bay Cherry (Eugenia carissoides), Davidson’s Plum (Davidsonia pruriens) and

Molucca raspberry (Rubus moluccanus). These values were then compared to results measured in blueberry (Vaccinum spp.), which is widely seen as a powerful antioxidant fruit and is referred to as a “superfood” on occasion, due to potential health effects (Hancock,

McDougall et al. 2007). Three of the native Australian Fruits (Kunzea pomifera, Tasmanian lanceolata and Pleiogynium timorense) had a higher radical scavenging activity than blueberry (Netzel, Netzel et al. 2006). This analysis was based on DPPH assay, a common measure of plant antioxidant capabilities. A separate assay for antioxidant capability, FRAP assay detected 5 fruits with higher reducing capability than blueberry, Podocarpus elatus and

Eugenia carissoides in addition to the 3 returning higher DPPH values. This reducing value was 5.4 times higher in Pleiogynium timorense, than in blueberry. Further analysis was performed to identify compounds responsible for these high antioxidant-scavenging values.

Total phenolics were higher than blueberry in all foods that returned higher reducing capacity via FRAP assay. The high reducing capacity of the traditional foods therefore appeared to be mediated to some extent by the phenolic content of the foods. The ascorbic acid (vitamin C) content was also measured, but only detected in two traditional Australian foods. This highest ascorbic acid and total phenolics value was detected in Pleiogynium timorense, which was also the food with the highest antioxidant values for both DPPH and FRAP assay. This suggests the extremely high antioxidant values of this food may be mediated by a combination of phenolics and ascorbic acid. Due to the correlation between total phenolic content and antioxidant performance, the authors attempted to identify specific phenolic compounds and determine their overall concentration in the fruits. They did not seek to identify all phenolic species or identify other anti—nutritional compounds, but instead targeted anthocyanins, a grouping of phenolic species classed under flavonoids. A range of

24 anthocyanins were detected across the native Australian fruits and at levels up to 180% the concentration of blueberries and 98% the concentration of strawberries (Fragaria ananassa).

This paper provided a useful analysis of some of the biochemical properties of native

Australian fruits compared with more domesticated species such as blueberry. These values may also have been underestimated due to the extraction method used. A recent paper analysed the antioxidant scavenging, vitamin C content, flavonoids, anthocyanins and proanthocyanidins of Davidson’s plum (Davidsonia pruriens) (Chuen, Vuong et al. 2016).

Vitamin C content, Flavonoids and Antioxidant scavenging were all higher with an ethanol extraction compared to a methanol, water and acetone extraction. Netzel, Netzel et al. (2006) used a methanol extraction method on Davidson’s plum and all the other native fruits they analysed. Methanol did extract a greater concentration of anthocyanins and proanthocyanins.

The biochemical data is interesting, however it does not provide any understanding of the bioactivity or bioavailability of the compounds detected. Therefore, these results can only contribute a theoretical perspective to the ongoing discussion surrounding Indigenous health and traditional food. Other papers following a similar approach to native Australian foods and sharing many of the authors of this paper continued to be published and are discussed in this review.

The same authors published a subsequent and very similar article within 12 months of the first which analysed 12 fruits rather than 7 (Netzel, Netzel et al. 2007). The subsequent paper included the same 7 fruits and from the first paper and potentially much of the same data.

This is seen with the exact same values for total phenolics reported for the duplicated fruits.

To these 7 fruits, 5 more were analysed including; Riberries (Syzgium luehmannii), Brush cherry (Syzgium australe), Finger Limes (Microcitrus australasica), in both yellow and red varieties, and Kakadu Plum (Terminalia ferdinandiana). As much of the data is reused, this paper does not add a great deal to the one reviewed earlier. However, different methods for

25 analysing antioxidants are used including TEAC and PCL. The highest antioxidant activity was reported in one of the fruits not analysed in the first paper, Terminalia ferdinandiana.

This fruit was discussed earlier in this review, due to the suggestion it contains the highest natural vitamin C content in the world (Brand, Cherikoff et al. 1982). This is the likely explanation of this fruit retuning the highest antioxidant scavenging in this study. T. ferdinandiana was detected to have the highest vitamin C content of all fruits tested in this study, but was surpassed in total phenolics by other native fruits tested. Regardless, total phenolic levels in Terminalia ferdinandiana was 3.2 times higher than what was detected in blueberries. Therefore, a combination of ascorbic acid and phenolics is likely to contribute to the total antioxidant effect of Terminalia ferdinandiana. Other potentially beneficial compounds such as ellagic acid have been detected in T. ferdinandiana, along with potentially damaging compounds such as oxalic acid (Williams, Edwards et al. 2016). A greater range of anthocyanins were detected across these set of fruits also in the study by

Netzel, Netzel et al. (2007). As this study is very similar in design to the preceding study, it suffers from similar issues, including a lack of understanding about the bioavailability or bioactivity of these compounds. There have been attempts to understand the bioactivity of compounds found in Australian foods using in vitro methods. These studies will form the focus of the next section of this review.

In vitro studies

Fruits

A number of the fruits identified by these early biochemical assays have been followed up with further biochemical analysis, coupled with in vitro screening to assess bioactivity

(Konczak, Zabaras et al. 2008, Tan, Hou et al. 2011a, Tan, Konczak et al. 2011b, Tan,

Konczak et al. 2011c, Tan, Konczak et al. 2011d, Symonds, Konczak et al. 2013). These studies primarily used cell culture to screen for anti-cancer or antibacterial properties of the native fruits. Free radicals and oxidative stress have been implicated in the development and treatment of cancer. This topic has been discussed in detail previously and goes beyond the scope of this review (Dreher and Junod 1996, Sosa, Moliné et al. 2013). Because various native fruits were detected to have strong antioxidant properties, it is plausible that they could have anticancer properties. The results of all of these studies show some degree of anti-cancer activity in a cell culture setting. Whilst, this is a very interesting and potentially helpful observation, it does not contribute significantly to the bioactivity or bioavailability of these antioxidants in the context of nutrition and metabolic disease. This is because they are added directly to the cells in culture, rather than being eaten by an organism. The results of these studies suggest that the compounds do have biological function and have a potential role in an antioxidant defence against disease. Clinical trials would be ideal for studying the biological activity of these extracts, however would pose an immense challenge financially, logistically and ethically. This is likely the reason for choosing to focus analysis on cell culture lines. Cell culture would not be as well suited as whole animal models such as mice

(Mus musculus) or roundworms (Caenorhabditis elegans) to examine the long term effect of antioxidants and other nutritional factors. A more detailed analysis of animal models, especially C. elegans for nutritional study will be included in this literature review and throughout this thesis in general.

Herbs

Beyond fruits, native herbs and spices have been analysed for biochemical properties and antioxidant capacity (Konczak, Zabaras et al. 2010). Sharing many of the same authors as

27 some of the papers already discussed in this section, the experimental design of this paper also shares many common features. The herbs and spices analysed in this study included

Tasmannia pepper (Tasmannia lanceolata), Lemon myrtle (Backhousia citriodora), Anise myrtle (Syzygium anisatum), Wattle seeds (Acacia sp.) and Bush tomato (Solanum centrale) which is included as a spice by the authors, despite classification as a fruit being more appropriate. High antioxidant scavenging values were returned for Tasmannia pepper leaf,

Lemon myrtle and anise myrtle. Relatively lower levels of antioxidant capacity were detected in Bush tomato (S. centrale), Tasmannia pepper berry and Acacia seeds. These high antioxidant values returned despite Vitamin C being detected in low levels, or not at all. This analysis gave justification for bioactivity screening experiments that target mechanisms involved with metabolic syndrome.

Of the herbs and spices analysed in the (Konczak, Zabaras et al. 2010) study, three plants were selected for further investigation for protective properties specifically relating to metabolic syndrome (Sakulnarmrat and Konczak 2012). These plants included Tasmannia pepper leaf (T. lanceolata), anise myrtle (S. anisatum) and lemon myrtle (B. citriodora). A commercially available Bay Leaf (Laurus nobilis) sample was also analysed as a reference sample. Typical analysis of antioxidant capacity, identification and quantifying of relevant compounds in these plants was performed. In addition, extracts from these plants were screened for activity targeting enzymatic pathways relevant to metabolic syndrome. The enzymes targeted included α-glucosidase, pancreatic lipase and angiotensin-1 converting enzyme (ACE). Of the native plants tested, Lemon Myrtle was the most effective α- glucosidase inhibitor. However, all native plants were more effective inhibitors of α- glucosidase than bay leaf. A similar effect was observed with all native plants performing as more effective lipase inhibitors than bay leaf. Out of all the native plant samples, Tasmannia pepper leaf returned the most efficient lipase inhibition value. Tasmannia pepper leaf was

28 also the most efficient ACE- inhibitor with a value of 29.6 ± 4.2 % inhibition. With the exception of lemon myrtle all native plants returned higher percentages of inhibition than bay leaf. Whilst some of these samples returned higher levels of inhibition than bay leaf, these are still relatively low levels of inhibition compared to other herbs and spices. ACE- Inhibition activity of Herbs and spices has been recorded as high as 99% and 98% for Amla

(Phyllanthus emblica) and Oregano (Origanum vulgare) respectively (Radcliffe 2012). It does however demonstrate that native plants may have some protective characteristics from metabolic syndrome. Because the problem of metabolic syndrome in Indigenous communities is currently so severe, the possibility that food plants that were traditionally consumed may have a protective effect is very intriguing. Whilst these plants are edible, they are found in different regions of Australia and therefore are not representative of food items that would have been included in the traditional diet of any one group of Aboriginals. It would be interesting to look at the bioactivity of a range of plants found together and therefore contributing together to the diet of a community.

This broad overview of some of the research and knowledge surrounding traditional dietary practices and some of the potential health benefits provides a useful framework to assess current dietary practices amongst Indigenous Australians. It is hoped that this juxtaposition between the past and present will help identify changes in dietary practices that may contribute to the development of lifestyle diseases such as obesity, type 2 diabetes and metabolic syndrome.

Western Diet

The transition of cultures from hunter gather lifestyle to an agricultural lifestyle is a significant period in human history that continues to influence modern civilization. The first

29 agricultural revolution that originated in Europe 10,000 years ago forms the foundation of the

Western Diet. Hunter-gather diets typically rely on an incredible variety foods to overcome the natural course of ever-changing food availability. In contrast, agriculture focuses on the domestication of a narrow group of food sources, selected and cultivated to provide high yield throughout a range of conditions. Agriculture has led to a greater volume of food, which is relatively easier to access compared to hunting and gathering. This has had a significant influence on population sizes, development of cities and human health. The sources of nutrition favoured by agricultural development includes some foods consumed either in small quantities, or not at all by hunter-gather communities. These groups inherent in agricultural societies include an increased reliance on cereal grains such as wheat, refining of sugars, refining of vegetable oils, added salt, fermentation of drinks to a high alcohol concentration and feeding of dairy products beyond infancy (Cordain, Eaton et al. 2005). The hunter gather foods that were incorporated into agriculture, such as animal meat and plants were also altered by domestication to be very different in nutrient content and distribution, compared to wild varieties (Naughton, O'Dea et al. 1986, Latz 1995). These foods brought about by the agricultural revolution are reflected in the staples of the modern western diet. Overall, these foods collectively have been associated with a diet with a calorie count coming from different sugars, fats and proteins to what was typical in traditional diets. This perspective of the western diet focuses on what is added to the diet following transition to agriculture.

Increasingly, these additional or new dietary components have been linked to a range of diseases (Hu, Manson et al. 2001, Liu 2002, Gross, Li et al. 2004, Siri-Tarino, Sun et al.

2010). However, this perspective risks focusing on the damage of what has been added to the diet, without assessing what may have been beneficial or protective in the previous hunter- gather diets and subsequently removed. Whilst the mechanisms linking the Western diet with

30 disease are still being researched and debated, the effects correlated with a transition to the

Western Diet can be easily observed.

Indigenous Australians provide an interesting case study of an ancient culture that has until very recently been hunting and gathering food. This was until a collision with extremely developed agriculture adjusted food practices. The apparent change to nutrition related disease burden correlated with this event has already been discussed in this review. However, this abrupt change to the food system of a different culture has biological implications both genetic and behavioural that must be considered. Analysis of the research addressing genetic predisposition to obesity and the current state of food practices amongst Aboriginals will form the main focus of the following section of this review.

Genetic predisposition

One hypothesis of why hunter gather societies have an apparent increased susceptibility to nutrition related disorders is that they have evolved a genetic predisposition to these disorders. The hypothesis is that traits, such as those aiding in the efficiency of energy storage may be beneficial in an environment where times of feast and famine are common, where food has a low energy density and is difficult to obtain. If food were scarce, those with a genotype coding for the best ability to store energy would be at an advantage to survive

(Neel 1962). A hunter-gather lifestyle, at times would be an example of an environment matching this description and ideally suited to a genotype that has adapted to this environment. However, these same traits would plausibly be at a disadvantage when high- energy food is relatively easy to obtain and over storage of energy is a risk factor for disease.

A post-agricultural society that has adopted a Western-Diet would therefore be an example of this kind of environment. This “thrifty genotype” hypothesis has become a popular

31 explanation of the increased incidence of type 2 diabetes in hunter-gather populations, following a change to their food systems (Neel 1962).

The thrifty-gene hypothesis has also attracted criticism as it may not fully explain the complexity of the development of diseases such as type 2 diabetes. One criticism identifies that the “thrifty gene” hypothesis does not account for varying rates of diabetes within a population (Speakman 2008). The author of this criticism instead suggests that lack of selective pressure against type 2 diabetes, in addition to genetic drift is responsible to susceptibility of a population to diabetes (Speakman 2008). Because this hypothesis is a direct alternative to the “thrifty genotype” hypothesis and focuses on the role of genetic drift, it is referred to as the “drifty genotype” hypothesis.

A distinct, yet related hypothesis is that susceptibility to diabetes can be increased if nutrition in early life is insufficient (Hales and Barker 1992). This is known as the “thrifty phenotype” and is driven by the preferential usage of energy to develop organs such as the brain, to the detriment of organs such as the pancreas. The developmental changes that are dictated by nutrition in early life have been hypothesised to have a role in the development of diseases such as diabetes due to irregular organ function, following improper development progression at an early age.

A separate criticism of the “thrifty genotype” is that this hypothesis, if applied incorrectly may encourage a racist indifference of non-Indigenous researchers to the prevalence of diabetes in Indigenous groups (McDermott 1998). It has been argued that grouping of genetic susceptibility should only be done on the criteria of gene expression, not racial background.

The early attempts to stop the development of Kuru in the Fore tribes of Papua New Guinea is used as an example of the dangers of assessing a disease that is widespread in a racial group as automatically caused by a racially-linked genetic disposition to the disease

(McDermott 1998). Epidemiologists made the initial and incorrect conclusion that Kuru was prevalent due to a genetic predisposition in Papua New Guineans. Therefore, they failed to notice the social factor spreading the disease, which was cannibalism amongst the tribe. An attitude towards genetic predisposition that centres on race, has the associated risk that research into preventative measures and cures will be abandoned because the disease is predetermined. This does not rule out the possibility that type 2 diabetes and obesity are in fact driven by a genetic predisposition in Indigenous Australians. However, it does highlight the importance of assessing the full range of factors that may be increasing the susceptibility of a group of people to a disease. In addition, if one of those factors appears to be genetic, the responsible genes should be identified, studied and understood. As genetic technology improves, genetic susceptibilities may become a target for treatment. Fortunately, in the case of Indigenous Australians there has been an effort to identify genes that may be responsible for an increased susceptibility to lifestyle diseases such as obesity and type 2 diabetes.

A genome wide scan was conducted on a community of Indigenous Australians with known prevalence of type 2 diabetes (Busfield, Duffy et al. 2002). The authors reported chromosomal regions with strong linkage to type 2 diabetes. These chromosomal regions were different to candidate regions of susceptibility identified in similar studies performed on other populations (Busfield, Duffy et al. 2002). These observations are interesting because it suggests that there is unlikely to be a single “thrifty genotype.” It is still possible that type 2 diabetes could have a genetic predisposition. However, this finding highlights the importance of not studying the genotype in isolation, but in full context of the environment where it finds itself.

Current diet of Indigenous Australians

Because there has not been a clear genetic mechanism described that is responsible for the increased prevalence of lifestyle diseases in Indigenous Australians, the current nutritional environment must be considered. It is difficult to make widespread generalisations about dietary choices across any entire group of people due to the variety of challenges and situations faced by individuals. However, there are some key papers highlighting important issues and patterns in dietary behaviours. These are therefore relevant to any discussion surrounding the increased risk of diabetes and obesity currently observed.

Early nutrition has the potential to affect the onset of obesity and diabetes in later life (Hales and Barker 1992). Therefore, it is relevant to understand some of the more recent observations of childhood nutrition in Indigenous communities. A useful study for this discussion interviewed 274 Aboriginal mothers about the nutrition of their babies (Eades,

Read et al. 2010). The results of this study indicated comparable rates of breastfeeding to the general population of Australia. However, by 12 months of age 56.2% of babies had been given Coca Cola, 68% lemonade, 69.8% fruit juice, 62.1% had eaten weetbix cereal and 78% had eaten fried chips. It is unclear whether these statistics are indicative of the nutrition supplied to Australian children in general or restricted to the community tested. However, considering it has been identified that insects such as witchetty grubs were traditionally used as a food for weaning and to substitute breastmilk in Aboriginal communities, the nutrient delivered to babies has certainly changed (Tindale 1953). It is not mentioned in the article by

Eades, Read et al. (2010) whether witchetty grubs had this role traditionally in the community studied. However, it does mention that they are found in the surrounding area to the study and that it was usual for food to be pre-chewed by elder members of the family and then fed to weaning babies. Therefore, the nutrient contribution would directly reflect a traditional diet.

The study would have benefited from some follow up data, to assess how these dietary choices affected the development of disease at a later stage of life.

A more long-term, 3 year study was later carried out assessing the general factors affecting food choices in an Aboriginal community (Brimblecombe, Maypilama et al. 2014). The community studied was situated in remote Northern Territory, 500km from Darwin. The study consisted of a general interview of 46 adults in a group discussion, from which 12 adults were interviewed individually. This resulted in a qualitative data set that consisted of stories and answers to questions. This did demonstrate some interesting attitudes to food.

Stories explained the transition from when diet consisted completely of traditional foods, to an intermediate stage when traditional food was used to supplement insufficient rations supplied by British settlers and then ultimately current dietary practices that incorporate takeaway food. Some of the stories suggested that the younger generation is losing the taste for traditional bush foods and is beginning to prefer the foods available in the general store.

The experimental design is problematic as the semi-structured nature of the interviews opens the study to issues such as leading questions and confirmation bias for the answers the researchers want to hear. The stories are useful, however it would have been helpful to pair them with quantitative data such as fully structured surveys, food diaries or biochemical analysis of the study participants and/or their food. A subsequent study used data on store purchases in remote Indigenous communities to make estimates of nutrient intake and compare these values to what would be expected from self-reported values (McMahon,

Wycherley et al. 2017). The key finding of this study was that foods high in sugar, cereal grains, dairy and fats were under reported in comparison to what the store records indicated.

Whereas, foods such as meat and vegetables were over reported. This is a common issue with self-reporting studies, not limited to Indigenous Australian communities. This highlights the

35 issue associated with relying on self-reporting data to understand the nutrition of a community.

There have been other attempts to gain a quantitative understanding of food behaviours, particularly of Indigenous communities living in remote parts of Australia. Many remote towns of Australia rely on a single general store for the purchase of groceries. This provided a useful resource for the study of community nutrition. A particular study used this opportunity to understand the food behaviours of the surrounding community (Scelza, Bird et al. 2014). The receipts of the general store were collected over a 40-day timeframe. However, the shops are not the only source of food in some communities. Many families supplement the store bought food by hunting and gathering from the surrounding area. For this reason at least one household was interviewed for 54 days (including the 40-days where receipts were collected) to check if they had hunted the previous day. The interview was intended to provide insight into what species were targeted and how much prey was caught and eaten.

The receipts from the general store indicated that the most money was spent on the preserved food category including flour, sugar, snacks, tea and canned goods. This was followed by soft drinks meat and tobacco with similar percentage spent on these products. The lowest amount spent was on fresh fruit, vegetables and water. The issue with using these values for understanding feeding behaviours is that the categories may have vastly different monetary values. For example, the relative higher percentage spent on tobacco does not indicate that an insufficient amount of vegetables are consumed. The interviews which collected hunting data, could have asked more in depth questions about the kinds of foods people were buying from the stores on those days. The presented hunting data that included general energy contribution of hunted foods and the kinds of animals caught is a useful contribution to the understanding of how some Indigenous households meet nutrition requirements. It would have been helpful for the data presented about what is bought from the store to be similar to

36 what is presented for the food hunted from the surrounding area. In addition, it would have been useful to get an understanding of what plant and insect foods were eaten or gathered during the hunt, rather than focusing on vertebrate sources of meat. The focus of the study was aimed more at understanding the cultural significance of certain foods and if hunting practices is related to the stocking levels of the store. Therefore, it is reasonable that the study did not analyse these variables.

A recent study was designed specifically to investigate the rates of traditional food consumption in Indigenous communities (Ferguson, Brown et al. 2017). This study interviewed 73 people across 20 separate communities and found 89% of participants consumed traditional food in the 2 weeks leading up to the interview. This number suggests that traditional food consumption is still very common in some communities in Australia.

This study did also indicate that there is significant pressure on food supply, with 76% participants reported experiencing food insecurity. The strength of this study is that it analyses all traditional food groups including plants and insects, not just vertebrate meat.

Despite the data coming from 20 separate communities, the data set is restricted. 97% of the participants were female and 69% were over the age of 35. Studying 20 communities does add a variety of perspectives to the data set, however only a very small number from each community was interviewed. Therefore, it is again difficult to know whether these behaviours represent the communities in general. The authors do acknowledge that the study was only exploratory and aware of its limitations.

These studies into food choices are useful indicators of the state of nutrition in some of the communities at a high risk of lifestyle disorders. The data reviewed to this point of the review is largely a description of the composition of the traditional diet, compared with the Western diet. However, there have been studies that have assessed the health implications of a change from one lifestyle to the other. Whilst many cultures have moved from a traditional diet to

Western diet, these studies follow a change back to tradition. These clinical trials form the next section of this review.

Clinical trials

Clinical trials addressing the health effects of a traditional Indigenous diet, compared to

Western diets have not been common. One major reason for this is that any trial that is proposed needs to overcome serious logistical issues. These issues include the difficulty in collecting samples or conducting analysis in very remote locations, attention to cultural sensitivities, communicating across language barriers and all of this in addition to the usual challenges relating to participant recruitment, human ethics applications and regulations compliance. One landmark study successfully conducted a clinical trial with 14 Indigenous participants living in an urban environment, 10 diagnosed with diabetes and 4 were not diagnosed with diabetes (O'dea 1984). These participants spent 7 weeks transitioning to a traditional hunter-gather lifestyle, with their values for metabolic markers associated with diabetes tracked before and after the trial. There were 4 major findings of this trial including a reduction in fasting glucose levels, improvement to insulin sensitivity, reduction in body weight and a change in cholesterol profile for both diabetics and non-diabetic participants.

The authors hypothesize that this improvement is due to a multifactorial combination of low fat diet and increased exercise collectively associated with weight loss. The authors do acknowledge that the data that relates to exercise levels is inadequate to understand the effect of exercise as it is only a qualitative scale. Technology has advanced since the time this study was conducted, which means tracking activity and exercise levels would now be relatively simple. However, the authors could have overcome this challenge by having some participants mimic the exercise levels of their urban lifestyle, while eating food that was

38 hunted and gathered for them. This would add extra logistical strain to an already complex trial however, so it is understandable that this control was omitted. An alternative would be to mimic the exercise levels of the traditional lifestyle cohort, whilst remaining on a Western diet. The variety of foods eaten over the experiment appears more narrow than would be expected, compared to the variety of plants and insects that are characteristic of traditional

Indigenous diets. Whilst, there was a variety of meat sources, the only plant sources were yams and figs. It is therefore difficult to understand if requirements were met for nutritional factors beyond total energy. A subsequent study from this project analysed levels of micronutrients such as vitamin C in the blood of these participants(O'Dea, Naughton et al.

1987). The authors hypothesised that animal liver would have been a major source of vitamin

C, that would have prevented the development of scurvy in Indigenous Australians. This review has already discussed the high levels of vitamin C detected in many of the edible native plants and insects found in Australia. Native plants and insects are high in vitamin C and would also contribute significantly in protection from disease. The perspective of

(O'Dea, Naughton et al. 1987) may be accurate for the traditional diet of the community selected, however. This community may have relied on a narrow selection of staple foods traditionally. However, this is not representative of traditional Aboriginal food behaviours in general.

Research into traditional diet has studied environmental factors such as food composition and potential genes of susceptibility, but there has been little opportunity to study how environmental factors and genes contribute to health. The clinical trial discussed above, measured the effects of an environmental change, however the underlying mechanisms for these changes could only be inferred by speculation. Model organisms are ideally suited to these kinds of fundamental questions. However, as will be discussed in the next section of this review, there are some issues with the model systems currently available.

Model Organisms

Cell culture has been used to understand the bioactivity of some plants used in the traditional

Indigenous diet. These papers have already been discussed in this review and focus more on their anticancer properties, rather than as a protective source of nutrient. Cell culture has been used to study the antioxidant effect of other foods in relation to diabetes and obesity (Liu and

Finley 2005). However, cell culture lacks the complexity and pathways of a whole organism.

Model organisms have been used to been used to screen for health benefits of foods that are not native to Australia. Mouse models have been a common tool in this debate and provided some useful data indicating potentially beneficial effects of antioxidants (Tappel, Fletcher et al. 1973, Kaplan, Hayek et al. 2001, Frei and Higdon 2003, Prior, Wu et al. 2008) and also evidence that they may not have any benefit (Lipman, Bronson et al. 1998). However, these experiments are extremely expensive and time-consuming. Due to the remote locations across

Australia where many of the plants and insects of interest are found, a mouse screening trial would be very difficult to supply. Fortunately, there are much smaller model organisms, that require much less food, such as the 1mm roundworm Caenorhabditis elegans (C. elegans). In the laboratory they are typically fed OP50 strain Escherichia coli bacteria. These worms are already used to study the interaction between environmental factors such as nutrition, genes and disease. However, C. elegans have many other benefits beyond their size that will be discussed.

Caenorhabditis elegans

Caenorhabditis elegans is a dynamic model organism used across diverse fields such as genetics, neurobiology, biochemistry, physiology and space exploration. Its importance

40 demonstrated by major roles in the awarding of six Nobel Prizes (Brenner 1974, Ellis and

Horvitz 1986, Chalfie, Tu et al. 1994, Fire, Xu et al. 1998). They are made up of only 924 somatic cells, yet 60-80% of their genes are thought to have human homologues (Harris,

Chen et al. 2004). These homologues have implications for a range of human diseases relating to metabolism such as obesity and diabetes, in addition to neurobiology and genetic disorders (Kaletta and Hengartner 2006). They have a very short life span, living on average for 3 weeks of adulthood, which makes them ideal for high-throughput screening. These characteristics make C. elegans a useful model for studying the health benefits of foods and have already been adopted for this purpose by many studies already.

C. elegans have been used as a model organism in a variety of studies screening for bioactivity in plants and their edible products such as fruits. Much of this bioactivity interest to date has focused on the efficacy of plant extracts in killing C. elegans, indicating anthelminthic effects that could be applied to pathogenic nematodes (Simpkin and Coles

1981, McGaw, Jäger et al. 2000, Katiki, Ferreira et al. 2011, Katiki, Ferreira et al. 2013,

Kumarasingha, Palombo et al. 2014). However, other studies have focused on effective ways of keeping worms alive, using food extracts. For example a study using whole-apple extracts found a dose-dependent increase to maximum lifespan of 39% and a mean lifespan 139% of control at the highest dose of 10mg/ml (Vayndorf, Lee et al. 2013). This extension to lifespan was also associated with increase in stress resistance, for stresses such as heat, UV, pathogens and oxidative stress. The observations of lifespan increase following treatment with food extract is common and findings for key trials, that used comparable methods are summarised in table 1.2. The table focuses mainly on studies that used a broad approach to the chemical composition of a food, rather than screening a single active ingredient that is thought to be abundant in groups of food.

Table 1.2 Summary of C. elegans lifespan trials on various food extracts.

Food Type Dosages tested Mean lifespan (days) Reference

(Wild type)

Whole Apple 0 mg/ml 17.23±0.30 (Vayndorf,

Malus sp. 2.5 mg/ ml 20.46±17 Lee et al.

5mg/ ml 21.38±0.35 2013)

10mg/ml 24.05±0.53

Blueberry 0mg/ml 16.1±0.26 (Wilson,

Vaccinium 0.2 mg/ml 18.7±.0.26 Shukitt‐Ha

corybosum le et al.

2006)

Royal Jelly 0 mg/ml 28.9±0.6 (Honda,

0.001 mg/ml 29.5±0.7 Fujita et

0.01 mg/ml 30.9±0.5 al. 2011)

0.1 mg/ml 27.5±0.5

Green Tea 0 μM 12.4±0.5 (Brown,

Camellia sinensis Epigallocatchin gallate 13.0±1.6 Evans et

(EGCG) 25 μM al. 2006)

α- Lipoic Acid 24 μM 15.4±1.0

Angelica giggas 0.1 mg/ml 20.0 (Yu,

Astragalus 0.1 mg/ml 20.9 Dosanjh et

membranaceus al. 2010)

Angelica 0.1 mg/ml 21.0

pubescens

Atracylodes 0.1 mg/ml 19.7

japonica

Angelica sinensis 0.1 mg/ml 19.2

Boswellia carterii 0.1 mg/ml 20.9

Cinnamomum 0.1 mg/ml 22.1

cassia

Cnidium offinate 0.1 mg/ml 19.8

Corydalis 0.1 mg/ml 17.7

yanhusuo

Glycyrrhiza 0.1 mg/ml 20.7

uralensis

Notopterygium 0.1 mg/ml 20.2

incicisum

Paeonia 0.1 mg/ml 19.4

lactiflora

Lingustium 0.1 mg/ml 17.0

chuanxiong

Panax ginseng 0.1 mg/ml 21.5

Poria cocos 0.1 mg/ml 19.8

Rehmannia 0.1 mg/ml 20.9

glutinosa

Salvia 0.1 mg/ml 21.2

miltiorrhiza

Control 0 mg/ml 19.5

Curcumin 0 μM 8.4 ± 0.3 (22°C) (Liao, Yu

Curcuma longa 20 μM 11.7 ± 0.4 (22°C) et al.

200 μM 20.3 ±0.4 (22°C) 2011)

Mulberry Leaf 0 mg/ml 17.54±0.48 (Zheng,

Morus alba L 0.025 mg/ml 21.67±0.35 Liao et al.

(Extracted 2014)

polyphenols)

Cranberry 0mg/ml 12 (Guha,

Vaccinium 10/mg/ml 15.9 Cao et al.

macrocarpon 2013)

Natto (Soybean 0 mg/ml 22.5± 0.59 (Ibe,

and Bacillus 0.5 mg/ml 24.7±0.54 Kumada et subtilis product) 1.0 mg/ml 26.2±0.48 al. 2013)

Green Coffee 0 mg/ml 13±0.4 (Amigoni,

Extract 1mg/ml 19±0.5 Stuknytė

et al.

2017)

All of these studies demonstrated lifespan extension of a food extract for at least one concentration. An interesting observation is the variability of control values between studies.

The issue of reproducibility has been dealt with in detail recently (Lithgow, Driscoll et al.

2017). Despite the variability in control results between these studies, there is a methodological flaw that they all have in common. All of them use bacteria as their food source with the extract added to the agar or liquid that these bacteria are cultured. This

44 introduces a range of problems to the experimental design. Firstly, it is difficult to observe if the extract is having an antibacterial effect, therefore killing the food source. This could cause a dietary restriction effect in the worm and therefore a likely lifespan extension would occur due to lack of food rather than the direct action of the extract (Greer and Brunet 2009). In addition, bacteria have recently been demonstrated to metabolise drug treatments, altering the efficacy and chemical composition of the treatment delivered to the worm (García-González,

Ritter et al. 2017, Scott, Quintaneiro et al. 2017). One alternative is to kill the bacteria prior to feeding to worms, to avoid the affect of metabolically active bacteria. However, this also has been associated with a dietary restrictive state (Greer and Brunet 2009). All of these bacterial based options also have a limited application for nutrition studies, because there is limited restricted over the nutrient composition of the food given to worms. The main way that the nutrient composition can be altered in bacterial studies is to add a nutrient of interest in chosen concentrations, in addition to the bacterial food source. This does not allow the study of removal of nutrients to be performed very thoroughly. One option is to use a bacterial strain which does not produce a certain nutrient or produces it in lower levels and compare performance to a strain that produces higher levels of the nutrient. One example of this is the use of Comamonas aquatica which produces high levels of vitamin B12, compared to E. coli which does not produce high levels of vitamin B12 (Watson, MacNeil et al. 2014). This is a useful approach, however the difference between these two bacterial species is unlikely to be limited to dietary factors and therefore confounding variables may be encountered. In addition, dietary factors of interest must have a bacterial strain with specific characteristics well suited to targeting a specific research question. There are bacteria free methods, known as axenic or defined media that have been designed to allow nutrition research questions to be explored via the easy manipulation of C. elegans diet. However, these methods also have some shortcomings.

Axenic media, is named due to the absence of life in the food source fed to C. elegans. In principal, it is an ideal method for studying nutrition related questions. When the complete composition of the medium is controlled and known, it is referred to as “defined media.” This allows complete control of the nutrients provided to worms and removal of a metabolically active and disruptive organism such as E. coli from the medium. However, despite a variety of protocols for preparation these media also have negatives that have prevented the widespread use of these media. However, these axenic methods are associated with a caloric restriction state as indicated by slower life stage progression, increased lifespan, metabolic changes and an altered phenotype reflecting an undernourished organism (Vanfleteren 1974;

Croll et al. 1977; Lu and Goetsch 1993; Szewczyk 2003a; Szewczyk (Lenaerts, Walker et al.

2008). Some of these media also require supplementation with milk or have undefined components (Clegg, Lapenotiere et al. 2002, Lenaerts, Walker et al. 2008). This addition of undefined components to the medium, diminishes one of the key benefits of controlling the nutrient composition of the media. There is one media for C. elegans that is completely defined known as CeMM or Caenorhabditis elegans Maintenance Medium. This is the most useful for nutrition experiments as it allows full control over the nutrient composition of the food source for worms. However, it is still associated with a dietary restricted state

(Szewczyk, Udranszky et al. 2006). All of these media are typically delivered as liquids to the worms. This is a strange method of delivery as the feeding behaviour of C. elegans with bacteria is characterised by an active uptake of bacterial particles, with excess liquid blocked from entering the worm and expelled to the surrounding environment (Avery and Shtonda

2003, Fang-Yen, Avery et al. 2009, Avery and You 2012). These liquid based nutrient media would therefore by unlikely to enter the worm. This is a potential mechanism for the dietary restriction observed in worms cultured in axenic media. For useful studies into the effect of food extracts on C. elegans to be conducted, the mechanism of food delivery in axenic media

46 would need to be understood in greater detail. From this understanding, a medium that is free from bacteria, chemically defined and efficiently delivered inside of worms would be necessary. This medium would also have applications in the wider C. elegans field such as for drug discovery and toxicology testing.

Research direction

From the review of the literature, four key issues need addressing.

1. Indigenous foods need to be analysed for nutrient composition with a consistent

definition of their biological classification and traditional use. The second chapter of

this thesis will deal directly with an example of a food source that has faced this

confusion historically and provide new data rectifying this.

2. Food sources need to be analysed in broad detail to understand the range of nutrients

contributing to the diet. Chapter 3 will describe the identification and collection of

some relevant and common traditional foods with the help of people of the

Kiwirrkurra community. Chapter 4 will describe the analysis of these collected foods

for antioxidant capacity and description of metabolite profile, using Gas

Chromatography-Mass Spectrometry (GC-MS).

3. Current Screening methods are inadequate to study the bioactivity of food

compounds. Chapter 5 will explore the mechanisms that have allowed past methods to

function and a new methodology will be presented using this new understanding.

4. Chapter 6 will use this new methodology to explore the bioactivity of a traditional

native food Solanum chippendalei.

Chapter 2. The bush coconut (scale insect gall) as food at Kiwirrkurra, Western

Australia*

*This chapter has been published in part in the Journal of Insects as Food and Feed under the title, “The bush coconut (scale insect gall) as food at Kiwirrkurra, Western Australia” (2016)

A. Yen, M. Flavel, C. Bilney, L. Brown, S. Butler, K. Crossing, M. Jois,Y. Napaltjarri, Y.

Napaltjarri, P. West, B. Wright.

Abstract

This chapter seeks to rectify some of the confusion about the nutrient composition of the traditional food source known as bush coconut or bloodwood apple. The bush coconut is used as a source of food by several Australian Aboriginal communities. It is actually a scale insect gall. Originally, all bush coconut insects were given the same species name, but now there are at least three species in Australia. The bloodwood trees at Kiwirrkurra (Western Australia),

Corymbia opaca, had bush coconuts built by the scale insect Cystococcus pomiformis. The use of the coconut is described by some Aboriginal women from Kiwirrkurra. The nutritional value of the bush coconuts from Kiwirrkurra is determined; this is important information because the species tested is known while the species identification of galls in earlier publications is now uncertain due to taxonomic changes.

Introduction

The term ‘bush coconut’ has been given to an insect gall from bloodwood eucalypts in several parts of Australia. It was given the coconut term because the inner lining of the gall has similar appearance to the flesh inside coconuts. It is also known as the bloodwood apple because the galls resemble an apple in shape. It is one of the lesser known insect foods utilised by Australian Aborigines and not mentioned in the early documents about Aboriginal insect foods (Campbell 1926, McKeown 1936, Tindale 1966). Bourne (1953) stated that the

‘bloodwood apple’ is a gall found on Eucalyptus corymbosa, and that it contains the parasite, a sweetish juice and a white and soft inner layer of the shell that is edible. Mature galls contain a 4 cm long grub attached to the inner wall at a thin attachment point with a small hole to the exterior. The inner lining is an edible coconut-like flesh up to 1 cm in depth; both the grub and flesh are eaten (Gullan and Cranston 2010). The correct identification of both the species of insect and plant involved in the formation of bush coconuts is a very important factor in any discussion relating to their nutritional properties. Information published on bush coconuts as food to date presents a very confusing picture. This is because some of it has been written by non-entomologists and the identity of the insect that forms the gall has been sometimes incorrectly cited. Froggatt (1893) first described it as Brachyscelis pomiformis from material collected in from north-western Australia. Froggatt (1893) noted that the

Aborigines there ate the large brachyscelid insect and the soft flesh when the gall was young; he also noted similar galls from Charters Tower in Queensland where the Aborigines also ate the contents. The species has been revised several times (Apiomorpha pomiformis,

Cystococcus pomiformis and Ascelis pomiformis) and these changes have seen the insect referred to under various other names: Apiomorpha gall (Peile 1980), brachyscelid gall

(Cleland 1966), and even incorrectly called a fly in the genus Fergusonina (Diptera) (Bin

Salleh 1997). Fuller (1899) described another species eaten by Aborigines in the Kimberleys and the Northern Territory, Cystococcus echiniformis. The correct taxonomic classification of the insect that forms these galls is that they are coccids in the genus Cystoccus (Hemiptera:

Eriococcidae) (Semple, Gullan et al. 2015). The bush coconuts are found on different species of bloodwood eucalypts (Corymbia species) across a large part of Australia, and the name C. pomiformis has generally been applied to it. Only recently, the genus was reviewed and the genus now has three species (Semple, Gullan et al. 2015). Analysis of the lifecycle and general biology of an insect food species is important to understand the availability and

49 formation of food products. In this case, the unique biology of C. pomiformis results in the development of the valuable food resource that is bush coconuts. The most vital characteristic of Cystococcus for bush coconut development is that they are gall formers. The females lack eyes, antennae, legs and an anus and spend their entire life within a gall except during dispersal from their mother gall (Semple, Gullan et al. 2015). Cystococcus exhibit an unusual life history termed sexual dichronism (Gullan and Cockburn 1986). The gall-forming female first lays a batch of eggs that develop into a male brood that feeds on the fleshy lining of the gall and develop through two nymphal and two pupal instars before moulting to winged adults. During the male pupal stages, the mother produces a batch of eggs that are females; these develop to the first instar either within the gall or inside the mother. When the mother dies, one or more females cling on to the abdomens of their winged males and disperse from the gall through the apical hole in the gall. The young female scale insect settles to feed on the bark of twigs or small branches of bloodwood species. Over several weeks, the female becomes embedded in a crater of plant tissue that eventually fully encloses her in a plant gall.

There is an opening in the apex of the gall that a mature male insect uses to mate with her

(Coleman N.C. 1972, Gullan and Cockburn 1986, Semple, Gullan et al. 2015). The number of males in each gall varies from 1,700-4,600, with slightly larger number of females. The life span of the gall is 18-26 weeks. There is an overlap in the ages of different galls, so they are available all year round, although larger numbers are found during the wet season

(Coleman N.C. 1972) The distribution of bush coconuts is determined by the location of their bloodwood host plants. These are common and widespread and are found in Western

Australia, the Northern Territory, Queensland and in New South Wales. Known host plant species are Corymbia chippendalei, Corymbia clarksoniana, Corymbia foelscheana,

Corymbia greeniana, Corymbia lenziana, Corymbia polycarpa, Corymbia ptychocarpa and

Corymbia terminalis (Semple, Gullan et al. 2015). The traditional use of bush coconuts has

50 been shown to vary due to a range of factors and between communities. Latz (1995) considers them a quite important part of traditional Aboriginal diet in Central Australia. They are eaten by Aborigines from many different language groups and consequently have

Aboriginal names in the following languages Alyawarr, Eastern Arrernte, Western Arrernte,

Pintupi, Pitjantjatjara, Warlpiri (Latz 1995), Anmatye (Green 2003), and Kaytetye (M.

Turpin, personal communication). Cane (1987) described the use of the bush coconut by the

Pintubi and Gugadja living in the Great Sandy Desert. He called the insects sought as ‘the wasp parasite and larvae inhabiting the coccid galls’ on the desert bloodwood (Eucalyptus aff. terminalis). The galls are collected during the cold season while still hosting the gall dwellers (Sweeney 1947, Peile 1980, Cane 1987). Sweeney (1947) stated that Walbiri eat the insects and the inside layers of the bloodwood apple. Green (2003) describes the use of bush coconuts by Anmatyerr women at the Laramba (Napperby) Community; they are collected, split open and the sweet grub inside is consumed. In Arnhem land, it is eaten by the

Mangarrayi (Wightman, Roberts et al. 1992), Rirratjingu (Yunupingu, Yunupingu-Marika et al. 1995), Warray (White, O'Brien et al. 2009), Jaminjung, Ngaliwurru and Nungali

(Marchant Jones, Bardbariya et al. 2011), Mangarrayi and Yangman (Roberts, E.B. et al.

2011), Dalabon (Bordulk, Dalak et al. 2012), and the Bilinarra, Gurindji and Malngin

Aborigines (Hector, Kalabidi et al. 2012). The ‘grub’ inside the gall is the main target, although the white flesh is sometimes eaten. If hard, they are softened by placing on hot ashes

(Hector, Kalabidi et al. 2012). Both insect and flesh are eaten in the west Kimberleys (Bin

Salleh 1997). It also occurs on bloodwood trees in the gulf plains of Queensland where it is called the kurrjambarra apple or gooji nut (Sam 2006). They are formed all year round and the flesh, the mother and the pink grubs are edible. Si and Turpin (2015) discuss how the gall and its different components are named and classified in different Aboriginal language groups. In Central Australia, the white lining of the gall eaten and classified as a plant food,

51 while the insect is classified as edible insect larvae (Kaytetye). The Kune word for the gall is dorddord and there is no distinct term for the insect contents of the gall, and dorddord is categorised as a plant food. The authors suggest that this is in keeping with the observation that insect foods are less frequently consumed in the northern Kune community than in desert communities. The clear liquid contained inside the mother is labelled with words for body fluids rather than with a more neutral substance like ‘water’: mpwe, ‘urine’ in Kaytetye

(Turpin and Ross 2012), and djikkano, ‘milk’ in Kune (Si and Turpin 2015). In Dalabon, a language spoken to the south-east of Kune territory, speakers do indeed call the edible insides of the gall ‘eggs’ (Dal: dabuno) possibly in recognition of their insect origins (Si and Turpin,

2015). Information about the nutritional value of bush coconuts is scarce and confounded by issues of classification and edible components analysed. This chapter reports nutritional proximate analysis values for a defined plant and insect species, in addition to analysis of the edible components separately.

Materials and Methods

Study location

Kiwirrkurra is considered one of the most remote Aboriginal communities in Australia. It is in the Gibson Desert in Western Australia, 1,200 km east of Port Hedland and 850 km west of Alice Springs. Aboriginal people from this Western Desert region were amongst the last

Aboriginal people in Australia to sustain hunter-gatherer lifestyle until many left in the 1960s and 1970s to settle elsewhere. Kiwirrkurra residents are Pintupi speakers. To facilitate their desire to return and live on their traditional land, an outstation was built in 1982 where

Kiwirrkurra now lies. After the first bore was drilled and equipped in 1984, residents came to

52 live permanently in Kiwirrkurra. There was at least one family group still living a traditional lifestyle in the area; in 1984, the ‘Pintupi 9’ met family members from Kiwirrkurra near Lake

Mackay, and agreed to come into the community. Three of those nine people still live in

Kiwirrkurra today. Many senior people in Kiwirrkurra today remember walking their country and living a traditional lifestyle as young people and are continuing to pass this knowledge on to younger people. A bush coconut collection was undertaken by Professor Alan Yen, on 8

September 2015 with traditional Aboriginal women from Kiwirrkurra. It was conducted on the Gary Junction Highway (22°49.03’S, 127°40.929’E).

Figure 2.1. Study location, marked on the map by symbol.

The Aboriginal women who provided information were Lorna Brown, Sally Butler, Yakari

Napaltjarri, Yalti Napaltjarri and Payu West while several others assisted with collecting. The collecting of insect foods is primarily the task of women and they can be helped by children.

37 galls were collected, weighed and measured (Figure 2.2, Table 2.1). Of the 37 galls nine were selected for rudimentary nutritional analysis.

Figure 2.2. Bush coconuts collected in kiwirrkurra.

Nutrient analysis

Gall numbers 6, 7, 10, 13, 17, 18, 26, 29 and 32 (Table 2.1) were therefore selected for analysis as a representative group of the collected sizes. The only condition for selection aside from size was that both male and female insects needed to be present within galls and that had no sign of rotting could be observed. Each gall was individually weighed before being opened with a chisel and separated into the following components; female insect, male insect, gall lining and gall shell (Figure 2.3).

Figure 2.3. Cross section of bush coconut, id number 17.

A. Bush coconut containing adult female, male juveniles, gall lining and gall shell. B. Same components as A, with adult female removed. C. Same components as B with male juveniles removed. D. Same components as C, with Gall lining removed.

Dry matter was determined by placing the separate components of each gall (total n=36) in a

70 °C drying oven. Samples were weighed each day and were removed from the oven once weight remained unchanged for 3 consecutive days. At this point, it was assumed that all moisture had been removed from the sample and the following assays could be performed on a dry weight basis. Dry matter was calculated as each samples dry weight as a percentage of the initial weight. Gross energy was determined by grinding and preparing dried samples for gross energy analysis for gall lining and both female and male insects using a Parr 6400

Bomb Calorimeter (Parr Instrument Company, Moline, IL, USA). Due to the minimum volume of sample required (~0.4 g), values for all individual components could not be determined. This required some components of similarly sized galls to be combined to produce meaningful results. Combined samples included female insects of galls 6 with 13, 7 with 17 and 10 with both 26 and 32. The female from gall 29 was withheld from gross energy testing to be analysed for nitrogen content. Crude protein analysis was conducted using a

Perkin Elmer 2400 CHNS analyser (Waltham, MA, USA). Measured nitrogen levels were then used to infer crude protein values by multiplying detected nitrogen values by the protein conversion factor of 6.25 (Finke, 2007; Maynard and Loosli, 1969; Yang et al., 2014).

Results

Classification and size

The bush coconuts were found on bloodwood, Corymbia opaca. The species at Kiwirrkurra was confirmed as C. pomiformis by Dr Lyn Cook. A total of 37 live bush coconuts were collected. The diameters ranged from 35.1-91.0 mm (average 56.1 mm) and weights ranged from 21.1-167.1 g (average 127.7 g) (Table 2.1).

Table 2.1. Diameter and weight of bush coconuts collected.

Nutrient analysis

The percentage dry matter and consequently the percentage dry matter of the gall components were found to vary considerably (Table 2.2).

Table 2.2. Calculated values for percentage dry matter (DM) of components of bush coconuts.

This was the case not just between the distinct components of the gall, but also within the same component. The ranges of percentage dry matter for female insects varied from 9.02 up to 34.38%. Males produced a larger range with detected values falling between 9.46 and

43.96%. The lining of the gall produced more consistent vales with a range spreading from

20.43 to 43.11%, but most values were detected between 20-30%. The shell of the gall returned the highest values with a range between 52.74 and 75.23%. As this component is not edible it was excluded from further analysis. Both male and female insects were found to have a high crude protein content, females ranging from 31.56 to 41.61 g/100 g and males from 26.54 to 44.33 g/100 g (Table 3).

Table 2.3. Crude protein and gross energy values of bush coconuts. All values are given as dry matter.

The lining of the gall had a much lower protein content ranging from a low of 5.97 g/100 g to a high of 19.84 g/100 g. The lining of the gall also returned much lower gross energy values with a range of 14.15 to 16.67 MJ/kg. This was in contrast to the higher gross energy of the insect components which ranged from 15.12 to 25.31 MJ/kg for females and 22.56 to 26.87

MJ/ kg for males.

Discussion

The results presented in this article offer several nuances relating to nutritional composition of bush coconuts/ bloodwood apples not available to previous data sets. The nutritional composition of bush coconuts/bloodwood apples was reported most comprehensively over 20 years ago (Miller, James et al. 1993). A species-specific approach to nutritional properties is required due to the recent description of a variety of gall forming Cystococcus species

(Semple, Gullan et al. 2015). One clear difference presented by this chapter is the nutrient composition of a single, accurately identified insect and plant species. The values presented by Miller et al. (1993) treat bloodwood apple and bush coconut as separate food sources.

There is no clear evidence supporting this distinction and its inclusion in their nutrient tables only creates confusion on which values to use as a reference. Furthermore, the galls analysed and identified as ‘bloodwood apple’ are attributed to a general Cystococcus sp. insect, without reference to the species of plant they are found on; the galls identified as ‘bush coconut’ are presented with no accompanying taxonomic information. This chapter provides nutrient data specifically for the C. pomiformis insect collected from C. opaca. The second key difference presented in this chapter is a distinction between the various edible components of the food. Miller et al. (1993) for both bloodwood apple and bush coconut only use a general label of ‘gall’ and ‘gall lining’ in their analysis. It can be assumed that ‘gall lining’ refers to either the white fleshy component of the gall or potentially a homogenate of all edible internal components of the gall parts analysed at once. It is unclear what their

59 distinction between ‘gall’ and ‘gall lining’ is attributed to. In reality, the various components of the gall are consumed at different rates due to personal and cultural preferences. This method of describing the nutrient values of individual gall components allows for a much more practical approach to reporting nutrient values for bush coconuts. The samples when analysed for energy composition ranged from 15.12 to 25.29 MJ/kg for female insects, 22.56 to 26.79 MJ/kg for male insects and 14.15-16.67 MJ/kg for the edible portion of the gall lining. To put these values into perspective the total energy of beef (all cuts, separable fat, raw) is 24.78 MJ/kg, which falls within the detected values for the insects found inside bush coconuts but not the gall lining (NUTTAB 2010). It is important to note that not all of the detected energy may be available for metabolism in humans, especially the chitin components of insects (Belluco, Losasso et al. 2013). For this reason, it may be valuable for future studies to compare the values of neutral detergent fibre and acid detergent fibre present to determine what percentage of the available energy in bush coconuts is digestible. Despite the inherent differences in the datasets, it is still valid to compare values. The energy values detected for bloodwood apple by Miller et al. (1993) were 22.4 and 31.5 MJ/kg, in addition to a single bush coconut gall with an energy of 63.6 MJ/kg. It is important to acknowledge that these values were derived using the Atwater system. It has been shown that the Atwater system utilised by Miller et al. (1993) has a tendency to overestimate energy values, particularly for fruit and vegetable food sources in comparison to the bomb calorimetric method used in these results to directly assess energy values (Zou, Moughan et al. 2007). The results presented in this chapter support the hypothesis of Zou et al. (2007) as the samples generally returned much lower energy density values, with the exception of the 22.4 MJ/kg value estimated by Miller et al. (1993). When analysed for protein female insects ranged from

31.56 to 41.61 g/100 g, male insects 26.54 to 44.33 g/100 g and the gall lining from 5.97 to

19.84 g/100 g. To compare again to beef (all cuts, separable fat, raw) crude protein values

12.1 g/100 g is a reliable reference value (NUTTAB 2010). This value is lower than the crude protein values for both male and female insects and within the range for the gall lining. This strengthens the case that bush coconuts provide a good source of protein to the diet. The analysis of crude protein relied upon the multiplication of detected nitrogen factors by 6.25, which could overestimate values if non-digestible components of the bush coconuts contain nitrogen. However, it has been demonstrated that this method is an acceptable estimate of crude protein in insects (Finke 2007, Yang, Liu et al. 2014). Whilst crude protein values are typically high in insects, it is important to consider that their amino acid content could vary from what is most useful for human nutrition (DeFoliart, Finke et al. 1982, Landry, Defoliart et al. 1986, Bukkens 1997). Future studies would benefit from also quantifying the amino acids profiles of bush coconuts to further understand the digestibility and quality of the protein present. The protein values detected by Miller et al. (1993) ranged from 1.3-11.5 g/100 g for bloodwood apples. These values are more consistent with the values reported in this chapter regarding the gall lining of these samples, rather than the insect components. This again demonstrates the importance of the separate edible components of bush coconuts being analysed individually. It should also be noted that moisture content of the female insects in this study were detected to range from 65.62 to 90.98 g/100 g. This evidence supports the important role this food serves as a source of water in desert regions of Australia. As already discussed, further work is required to understand the quality of the crude protein by analysing the amino acid ratios, in addition to analysis of what percentage of the total energy is digestible. The data presented in this chapter provides an important reference for energy, protein and moisture content of bush coconuts collected around Kiwirrkurra. It would be useful for this approach of tailoring analysis of macronutrients to precise taxonomic classifications, geographical areas and separate edible portions of foods to be adopted when studying the nutrient contribution to diet of a particular food.

Chapter 3: Identifying and collection of foods found in the Gibson Desert, Western

Australia that are of dietary significance to the Kiwirrkurra people.

Introduction

The food available to the people of Kiwirrkurra is a blend of traditional foods that can be collected in the surrounding country and foods typical of the Western Diet delivered to the general store. This provides a very interesting nutritional environment for study. This chapter will describe qualitative observations and details of this environment made while identifying and collecting traditional foods. It is not the intention of this chapter to take measurements or produce a statistical data set. The remote location of this community makes it difficult for many people to experience and understand the food available in this area. Therefore, the presentation of photos and personal observations of the collection process forms the majority of the results in this chapter.

Materials and Methods

Plant and Insect Material

All plant and insect samples were collected in the Kiwirrkurra Indigenous Protected Area, located in the Gibson Desert, Western Australia on a field work expedition in June, 2016.

Research was conducted in concordance with the signed agreement with the Tjamu Tjamu

Aboriginal Corporation and Ngaanyatjarra Reserve Entry permits to comply with Section 31 of the Aboriginal Affairs Planning Authority Act, 1972, and of the regulations made under the Act, (Appendix B, Appendix C). Kiwirrkurra was accessed via Alice Springs in the

Northern Territory following a 10-hour off-road drive to reach Kiwirrkurra. The samples were collected as part of a community camping trip organised to assist in the project. Samples were collected along the track that leads from Kiwirrkurra to Marruwa. The track moves along the west bank of Lake Mackay, before turning further West. Aboriginal members of the

Kiwirrkurra community identified edible plants and described their uses and any steps required for preparation prior to eating. This information was provided by Walampiri

Tjapaltjarri, Sally Butler, Josephine Nangala, Yalti Napaltjarri, Payu West and Noelia

Yukultji. These plant samples were then identified by Dr Boyd Wright a botanist at

University of New England and Northern Territory herbarium. Dr Boyd Wright also assisted with translation when necessary from the Pintupi language. Kiwirrkurra project leader Kate

Crossing from Central Desert Title Services assisted with community liaison, organisation and facilitation of bush food collection.

Results and Discussion

Food collection observations

Nine Plants and one insect were collected in sufficient quantities and of a quality that could be analysed in chapter four of this thesis. These included; Acacia colei, Acacia tetragonophylla Carrisa lanceolata, Cyperus bulbosa, Erogrostis erodopida, Solanum centrale, Solanum chippendalei and Solanum cleistogranum. Other plants were collected such as Acacia aneura fruit or mulga apples. However, these samples were not collected in large enough quantities or were not ripe and were excluded from analysis, as they would never be consumed at that developmental stage. Galls from Corymbia opaca were also collected, some were used as food by members of the group and a selection were not split to preserve the insect and plant contents of the gall for analysis. However, once the selection of

64 galls that were put aside were eventually split it became apparent that the female insect had already left the gall and therefore no component of the gall would be consumed after this event. It was therefore excluded from further analysis. A Pisolithus mushroom was collected, but disintegrated before analysis due to the extremely soft nature of the internal flesh. It was said that these used to be eaten a long time ago, but are not a common food now.

Figure 3.1 Scientific name: Solanum chippendalei. Pintupi names: ngaru, pintalypa, pura

Common name: Tanami Apple, Bush tomato.

Figure 3.2 S. chippendalei A. Whole fruit B. Cross section with inedible seeds intact. C.

Inedible seeds removed, typical portion eaten shown.

Figure 3.3: Scientific name: Solanum cleistogranum. Pintupi name: wirriny-wirrinypa, ttapakara

Figure 3.4: Scientific name: Solanum centrale Pintupi name: kampurrarrpa, kanytjilyi, katarapalpa, kintinyka. Common name: Desert raisin, also referred to as bush tomato.)

The plant genus Solanum has at least 18 separate species native to this part of Australia (Latz

1995). Nine of these are inedible and often poisonous and therefore they are not eaten. Four are soft and edible. One example of this kind of Solanum species is Solanum cleistogamum

(Figure 3.3). Two Solanum species have edible fruit and seeds. Solanum centrale is an example of this kind of Solanum (Figure 3.4). Two species require the removal of seeds that are thought to have poisonous properties. Solanum chippendalei is an example of these

(Figure 3.1). GC-MS analysis on the seeds removed from these plants did detect the presence of glycosides, which could be a potential source of poison (Data not shown). However, the glycoside was not classified specifically enough to definitively say these seeds are poisonous and that it is due to glycosidic action. Therefore, a representative from each of the Solanum groups that require minimal processing before eating were collected and analysed further in chapter 4. Edible Solanum fruits can also preserved by drying or roasting.

There is one more species of Solanum, S. coactiliferum, which requires further processing, and washing of bitter juice and grinding into a paste before eating but was not found on this trip (Latz 1995).

Figure 3.5 Scientific name: Acacia colei, Pintupi name: kuna-kuna Common name: Cole’s wattle seeds

Figure 3.6 Scientific Name: Acacia tetragonophylla Pintupi name: wakalpuka Common name: Dead finish Wattle

Figure 3.7 Scientific name: Carrisa lanceolata, Pintupi name: nganangu, ngamunypurru

Common name: Conkerberry, conkleberry.

Dark fruits from Carrisa lanceolata were collected for sampling (Figure 3.7). Green fruits were avoided as are unripe and not commonly consumed. Some of the purple colour faded by the time these fruits could be stored in -80°C. It is difficult to understand what chemical changes are associated with this colour change and therefore final analysis may not represent the action of these fruits eaten fresh off the tree.

Figure 3.8 Scientific name: Cyperus bulbosa,Pintupi name: alka, kinyuwurru, tjanmata, yalka Common name: Bush Onion. A. Husk on B. Husk off

The bulbs of Cyperus bulbosa can be eaten raw, once removed from the husk and were analysed in chapter 4 in this form (Figure 3.8). However, they are often roasted first and are often a staple item in diets (Latz 1995).

Figure 3.9 Scientific name: Eragrostis erodopida Pintupi name: nantjuri, wangunu

Common name: Woollybutt grass. Pictured Yalti Napaltjarri, Noelia Yukultji and Payu West.

Eragrostis eropidoda grasses were collected and stored for further processing later that night

(Figure 9). The grass portion underwent initial burning on an ants nest which burnt away some of the grass and opened seed pods (Figure 3.10 ii). Burnt grass was then rubbed between hands to expose the seed further (Figure 3.10 iii). The remaining plant material was lifted into the air allowing the lighter material to be blown by the wind into a collection tray and heavier material would drop to the ground (Figure 3.10 iv). During this step, seeds that do not land in the collection try are collected by ants and the seeds returned to the ant nest by the ants. Seeds were then further separated from chaff by yandying the seed in a coolamon

70 that was cut and fashioned from the bark of a nearby tree (Figure 3.10 v). The seeds would likely be further processed into a sort of bread or damper, but were analysed as seeds.

Figure 3.10 Eragrostis erodopida seed preparation. i. Piling of Eragrostis erodopida ii.

Burning of the grass to open seed pods and roast seeds iii. Rubbing grass to release seeds from open seed pods iv. Separating lighter material by wind. v. yandying seeds in coolamon.

Pictured Josephine Nangala.

Figure 3.11 Scientific name: Endoxyla leucomochla, Pintupi name: Maku, Common name:

Witchetty grub.

Endoxyla leucomochla or witchetty grub are usually cooked in hot coals before being eaten.

However, if they are damaged during the removal from a root or tree trunk they are eaten raw straight away. The witchetty grub in Figure 3.11 was removed from the root of a witchetty bush Acacia kempeana. Witchetty grubs removed from the trunk of trees usually require cutting into the tree before witchetty grubs are removed using a hook like tool.

Figure 3.12 C. opaca gall containing female and male C. pomiformis insect. Pintupi names: tjuta, pini tjuta, or tinimiit. Tinimiit appears derived from English translation “tin of meat.”

Common names: Bush Coconut, Bloodwood Apple.

Figure 3.13 C. opaca tree with intact galls

Figure (3.12) shows a freshly broken open C. opaca gall revealing 1 female insect and many male insects. The gall pictured was used for food and unfortunately the galls selected for analysis no longer contained insects and a black ashy residue remained and was not analysed.

Figure 3.14. Firestick farming practice.

Figure 14 shows fire started intentionally. This is an example of traditional firestick farming practice. The area shown has become over run with grasses, not specifically useful for food production. These grasses have become overly abundant and burning initiates an increase to diversity following the fire. Species such as S. centrale require fire to thrive and become abundant in an area (Latz 1995). Fire reintroduces diversity to the area and allows a range of foods important for Indigenous diet to thrive. Indigenous rangers are now used to help in conservation efforts in the Kiwirrkurra Indigenous Protected Area by managing burning

(figure 3.14) and conservation of vulnerable species such as the Bilby (Macrotis lagotis) via hunting of introduced bilby predators such as wild cats and maintenance of habitat and monitoring systems. Bilbies may once have been a food item, as were many vertebrates but are no longer eaten. The burning of areas such as these are also useful for hunting the sand

74 goanna (Varanus gouldii) that may live below habitat such as this. The burning clears land that can be used for hunting while food plants are still growing.

Food Behaviour General Observations

The collection of bush foods such as plants and insects, took place alongside hunts for game such as Sand Goannas (Varanus gouldii), Bush Turkeys/Australian bustard (Ardeotis australis) and wild cats (Felis catus). No animal products were collected for analysis due to animal ethics restrictions. However, many sand goanna were caught and eaten throughout the course of the trip by Indigenous participants on the trip. It was not uncommon for a hunter to return to the car after an hour hunting with 3 or more sand goanna. These would be roasted on hot coals, usually in a dug out pit. Raw meat is not bought back to camp and must be first cooked. One cat was caught and eaten after a lengthy session of tracking. It is thought that cats introduced by British setters came into contact with Indigenous people living around

Kiwirrkurra, long before any human settlers did. Cats are therefore incorporated into

Indigenous culture and have their own dreaming stories, similar to the stories of native

Australian animals of the area. The intestines are removed and the cat is cooked whole in the hot coals. Hair is singed and removed with a knife. Blood and fluids that can be collected are drunk and thought to be “good medicine.” The cooked meat is then shared and consumed in the following days. Cat still makes a common contribution to the diet and are a popular hunting target as a cash bounty is provided for cats tails. This conservation effort is in order to protect native animals such as the bilby. The bounty is claimed with the tail, which allows the rest of the cat to be used as a source of nutrition. A Western Brown snake (Pseudonaja nuchalis) was also killed due to close proximity to a monitored bilby den and people gathering bushfoods. This was not kept for eating and likely has never been used for food.

The snake was referred to as a “cheeky one,” which seems to be related to the venomous traits this snake possesses. A marsupial mole (Notoryctes caurinus) was trapped, but released.

This is unlikely a common food source as they are rarely seen, with some Indigenous members never having seen one of these species previously or only on a few occasions.

Interest in traditional foods is relatively high in the people of Kiwirrkurra. There is a general belief in the community that they are healthy or healthier than foods found in the general store. The one general store is a community hub that becomes very busy during the limited opening hours. The opening of the general store is a genuine event and most of the community will be in attendance to stock up on supplies and spend time with friends and family. The general store receives deliveries once a fortnight, which influences the supply of fresh food. The general store has put certain procedures in place to try to encourage healthy eating in the community. For example they do not allow the purchase of foods deemed unhealthy, such as chocolate bars in the morning. Alcohol is prohibited by law in Kiwirrkurra and surrounding areas. However, members of the community can travel to places such as

Alice Springs, in the Northern Territory and consume alcohol. The food available in the general store is supplemented to some degree by traditional food items available in the surrounding areas. Interest in traditional practices appear to have increased as a result of this bush food project and other scientists interested in traditional food practice. Foods based on seeds such as the damper prepared from wanganu (Eragrostis erodopida) are not commonly prepared. However, outside interest in the broad range of bush foods available, appears to have renewed excitement in some of these less common traditional practices.

A common saying around Kiwirrkurra is that, “We had bush medicine for all bush problems.”

This can be taken to mean, that the community had developed treatments for the diseases and ailments that were typical in their traditional environment. However, what can be done when the problem does not originate from the bush? Diseases of Western influence are

76 becoming increasingly prevalent in the modern day. Members of the community have been diagnosed with diabetes and are now on medication. Sugar and salt can also be observed to be added to meals and cups of tea in alarming quantities. This increased consumption of refined sugars and salts is typically blamed for the increase in disease burden. However, very little attention has been paid to the decrease in consumption of the compounds that are stripped away by refinement. Food is a complex chemical matrix, with the identity and function of many components remaining unknown. The effects caused by the extensive removal of many of these chemical components to produce refined nutrient sources is equally unknown. These refined foods lack the complexity of the wild foods that came before.

Perhaps this simplicity is a contributor to the problem, rather than excess consumption alone.

If there truly was “bush medicine” present in the traditional food of Indigenous Australian’s, it is not surprising that the disease burden of food related diseases has increased. This is especially true following the simplification of the Indigenous diet due to westernization.

Perhaps bush medicine is simply a placebo, however the best peer-reviewed solutions for obesity and diabetes have not yet been able to restore Indigenous Australians to their pre- settlement, metabolic phenotype. Therefore, the full profile of dietary changes post- settlement needs to be understood. This includes what has increased, decreased and remained similar. A greater understanding of the broad complexity of traditional diets will assist in this line of reasoning. Therefore, this addition of new data regarding the composition and biological activity of foods eaten traditionally is a central aim of this thesis.

Chapter 4: Identifying compounds and quantifying antioxidant capacity in traditional foods.

Introduction

The concept of there being “Bush medicine for all bush problems” adds an interesting perspective to the discussion around the prevalence of obesity and type 2 diabetes in

Indigenous Australians. If these diseases truly were not present before European settlement, perhaps there is “bush medicine” that helps to protect against these diseases. It could be argued that these chronic diseases are only seen in these communities now, because malnutrition is less common and the threat of many large predators of humans has disappeared. This would result in people living longer and developing different diseases. This

78 would be true if these diseases were only affecting older people. However, these diseases are diagnosed in Indigenous children at greater rates than non-Indigenous children (Craig, Femia et al. 2007). Because of the strong link between diseases and food, there needs to be detailed investigation of what has changed in the nutritional environment.

Previously, research into Indigenous foods has focused on detailing macronutrients such as protein, fat and carbohydrate in addition to some vitamins and minerals (Miller, James et al.

1993). Some research has sought to understand not only the quantity of macronutrients, but also the specific identity and function of these macronutrients. This has included quantifying the fatty acids contributing to the fat content (Naughton, O'Dea et al. 1986, Brown, Cherikoff et al. 1987, Dunstan, Sinclair et al. 1988), in addition to measuring the glycaemic index of the carbohydrates (Thorburn, Brand et al. 1987a, Thorburn, Brand et al. 1987b). This information has produced a valuable foundation for understanding the nutrient contribution provided by traditional foods. This includes how much energy a certain food contributes and how it is able to prevent acute nutritional deficiencies. Diseases such as scurvy develop quickly in response to a deficiency in vitamin C and can be treated in similar speed by the addition of foods rich in vitamin C to the diet. However, diseases such as obesity and type 2 diabetes have been suggested to be a result of chronic inadequate nutrition. Therefore, the compounds contributing to this slowly progressing disease are difficult to study. Antioxidant compounds and in particular phytochemical compounds have been suggested to have a protective effect against chronic disease (Visioli, Borsani et al. 2000, Liu 2003, Pandey and Rizvi 2009,

González-Castejón and Rodriguez-Casado 2011, Williams, Edwards et al. 2013). There has been some interest in studying these compounds in Australian native foods (Netzel, Netzel et al. 2006, Netzel, Netzel et al. 2007, Konczak, Zabaras et al. 2008, Konczak, Zabaras et al.

2010, Tan, Konczak et al. 2011, Tan, Konczak et al. 2011, Tan, Konczak et al. 2011,

Sakulnarmrat and Konczak 2012, Symonds, Konczak et al. 2013). However, these foods are

79 not all consumed by a single community, but are of commercial appeal. Whilst antioxidant values are reported in these papers, the full spectrum of compounds present in the food that may have health benefits are not reported. The data presented in this chapter describes the antioxidant capacity and extensive list of metabolites identified by Gas Chromotogrophy-

Mass Spectrometry (GC-MS) for nine important foods of the Kiwirrkurra people. Using the antioxidant capacity values in conjunction with the compounds identified, speculation can be made regarding what, if any impact these bush foods may have on problems, both from and beyond the bush.

Materials and Methods

Plant and insect material

Plants and insects were collected as described in chapter 2. The plants selected for further analysis included; Solanum chippendalei, Solanum cleistogranum, Acacia colei, Acacia tetragonophylla. Solanum centrale, Carrisa lanceolata, Cyperus bulbosa and Erogrostis erodopida. One insect species was collected for analysis, Endoxyla leucomochla commonly known as witchetty grub. All plants were analysed on a “as eaten”’ basis. Erogrostis eripoda therefore was cleaned using traditional methods and the general process has been summarised in chapter 3 of this thesis. Acacia sp. seeds would also usually be used in a bread-like damper but were analysed as seeds. C. bulbosa was removed from external husk as would be done before eating. S. chippendalei had inedible black seeds removed before analysis. In general, only small quantities of each sample could be collected as much of the foods were consumed by members of the group during collection. A small portion could therefore be salvaged for analysis. Plant samples were placed in 50 ml tubes and stored initially at -20°C, defrosted during transport and placed in a -80°C freezer as soon as possible. No further processing of foods before testing was performed before extraction.

Bush food metabolite extraction

Bush food samples were homogenized using a mortar and pestle containing liquid nitrogen.

Approximately 60 mg of homogenized bush food was measured and added to a 2ml

Eppendorf tube. 1:3:1 (CHCl3:MeOH:H20) (500 μL) was then added. The sample mixture was vortexed for 30 seconds and then incubated for 15 minutes at 70°C at 150 rpm. The supernatant was then transferred to a new Eppendorf tube. To the original Eppendorf tube

500 μL of 1:3:1 (CHCl3: MeOH: H20) was added, vortexed and then centrifuged at 13,000 rpm for 15 minutes. The supernatant was then transferred to the Eppendorf tube already containing the supernatant collected earlier. 10μL, 50 μL, and 100 μL aliquots of each sample were transferred into glass inserts and dried in vacuo for subsequent TMS (trimethylsilyl) polar metabolite derivatisation.

Polar metabolite derivatization

All samples were re-dissolved in 10 µL of 30 mg /mL methoxyamine hydrochloride in pyridine and derivatized at 37◦C for 120 minutes with mixing at 500 rpm. The samples were incubated for 30 minutes with mixing at 500 rpm after addition of both 20 µL N,O-bis-

(trimethylsilyl)trifluoroacetamide (BSTFA) and 1 µL retention time standard mixture

[0.029% (v/v) n-dodecane, n-pentadecane, n-nonadecane, n-docosane, n-octacosane, n- dotriacontane, n-hexatriacontane dissolved in pyridine]. Each derivatized sample was allowed to rest for 60 min prior to injection.

GC-MS Instrument Conditions

Samples (1 µL) were then injected into a GC–MS system in split (1:20 split ratio) or splitless mode, comprised of a Gerstel PAL3 Autosampler, a 7890B Agilent gas chromatograph and a

5977B Agilent quadrupole MS (Agilent, Santa Clara, USA). The Mass Spectrometer was adjusted according to the manufacturer’s recommendations using tris-(perfluorobutyl)-amine

(CF43). A J&W Scientific VF-5MS column (30 m long with 10 m guard column, 0.25 mm inner diameter, 0.25 µm film thickness) was used. The injection temperature was set at

250◦C; the Mass Spectrometer transfer line at 290◦C, the ion source adjusted to 250 ◦C and the quadrupole at 150 ◦C. Helium (UHP 5.0) was used as the carrier gas at a flow rate of 1.0 mL / minute. The following temperature program was used; injection at 70◦C, hold for 1 minute, followed by a 7◦C/ minute oven temperature, ramp to 325◦C and a final 6 minute heating at

325◦C. Mass spectra were recorded at 2 scans/s with an 50–600 m/z scanning range.

Data Processing and Statistical Analysis

Both chromatograms and mass spectra were processed using the Agilent MassHunter

Workstation Software, Quantitative Analysis, Version B.07.01/Build 7.1.524.0. Mass spectra of eluting compounds were identified using the commercial mass spectra library NIST 08

(http://www.nist.gov), the public domain mass spectra library of Max-Planck- Institute for

Plant Physiology, Golm, Germany (http://csbdb.mpimp-golm.mpg.de/csbdb/dbma/msri.html) and the in-house mass spectral library. All matching mass spectra were additionally verified by determination of the retention time by analysis of authentic standard substances. Analytes that were detected in all samples were compared as a percentage of their combined peak areas. If a specific metabolite had multiple TMS derivatives, the metabolite with the greater

82 detector response and better peak shape within the dynamic range of the instrument was selected.

Antioxidant Assay

Antioxidant activity of the various bushfoods was measured using ABTS method. ABTS kit

(Zenbio) was used which to assess the efficiency of each bushfood in inhibiting the oxidization of 2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) by ferryl myoglobin. 1.5 mM Trolox standard tube was spun down after thawing. 80μl of Assay Buffer was then pippetted into the 1.5 mM Trolox standard tube provided and mixed by vortexing.

This produced a diluted stock Trolox standard of 300 μM. 50 μl of assay buffer was then pippeted into 6 tubes Eppendorf tubes. Using the diluted stock Trolox solution, a serial dilution was preparedard. A myoglobin stock solution was prepared and 25μl of the stock solution was added to the 2.475 ml Dilution Buffer bottle and gently invert. The working solution was then placed on ice. 10 μl of samples or Trolox standards were added to individual wells of the assay plate. 10μl of assay buffer was then added to individual wells as a negative control. 20 μl of the myoglobin working solution was then added to each of the wells containing standards and samples. The assay was begun by adding 100 μl of the ABTS solution per well and placed on plate shaker at 20 °C. The reaction to proceeded for 5 minutes and stopped the by addition of 50 μl of Stop Solution per well. Absorbance was measured using a plate reader at a wavelength of 405 nm. Standard curve was created from

Trolox standards and each samples µM TE/g of starting material was determined. Each sample was run in triplicate and an average was taken of all three with error expressed as standard deviation.

Results and Discussion

In vitro Antioxidant Activity

The highest antioxidant activity was returned for Solanum chippendalei, with a value of

1106.072 µM TE (Trolox equivalents) per gram of dry matter. It is difficult to compare these values to the values detected by (Netzel, Netzel et al. 2006, Konczak, Zabaras et al. 2008) as they analysed on a wet weight basis and using other antioxidant assays such as ORAC.

ORAC assays have been demonstrated to suffer from interference of a variety of acids including amino and uronic acids (Chen, Zhang et al. 2004). The GC-MS analysis of the bushfood samples identified a large diversity of the acid species thought to interfere with antioxidant analysis. This is one of the reasons an ABTS methodology was adopted for the analysis of antioxidant capacity in this study, rather than replicating previous work done on

Australian food antioxidant capacity. However, similar to the work of (Netzel, Netzel et al.

2006, Konczak, Zabaras et al. 2008) a methanol based extraction method was used in order for similar classes of compounds to be extracted. However, expression of results as dry matter was justified to compare the antioxidants of other published results that reported on a dry matter basis for common fruits (Namiesnik, Vearasilp et al. 2013). Blueberry has been a useful comparison as a reference fruit value for the comparative antioxidant values of

Australian native foods (Netzel, Netzel et al. 2006, Netzel, Netzel et al. 2007, Konczak,

Zabaras et al. 2008). A dry matter value of 199.41 ± 18.6 has been reported for the ABTS of blueberry (Namiesnik, Vearasilp et al. 2013). Therefore, S. chippendalei, S. cleistogranum, A. colei all returned higher ABTS values and E. leucomochla or witchetty grub returned very similar values. S. chippendalei therefore returned a trolox equivalent more than 5.5 times that of blueberry. Kakadu Plum (Terminalia ferdinandiana) was reported to be 3.2 times higher in antioxidant capacity than blueberry previously and was thought to have the highest antioxidant capacity of any Australian fruit (Netzel, Netzel et al. 2007). As discussed it is

difficult to compare these results due to methodology differences, beyond stating they are

both highly efficient antioxidant scavenging food sources. Kakadu plum (Terminalia

ferdinandiana) has a very high vitamin C content compared to S. chippendalei, with values

5320mg/100g for T. ferdinandiana compared to 54mg/100g for S. chippendalei (Miller,

James et al. 1993). Whilst S. chippendalei is still a good source of vitamin C, the high

antioxidant activity suggest there are other components contributing to the antioxidant

capacity. GC-MS is ideally suited to this task and will be discussed in further detail

throughout this thesis. S. centrale was the only Solanum species from this data set that has

previously been analysed for antioxidant activity. It also returned the lowest Trolox

equivalence values out of the Solanum species that were analysed in this thesis. S. centrale

has entered the Australian market as a commercial product, included in gourmet sausages,

sauces and herb spice mixtures. These results indicate that other Solanum species such as S.

chippendalei and S. cleistogranum may be good candidates for feasibility studies for further

commercialisation. Cyperus bulcosa returned a value with an error that included negative

values. C. lanceolata was observed to have an antioxidant capacity similar to cranberries with

a value of 55.850 ±2.87 compared to 72.76 ± 6.5 for cranberry (Namiesnik, Vearasilp et al.

2013).

Table 4.1 Antioxidant values (ABTS) for nine Indigenous foods. Values with matching

Solanum Solanum Acacia Endoxyla Solanum Carrisa Cyperus Eragrostis Acacia chippendalie cleistogranum colei leucomochla centrale lanceolata bulbosa erodopida tetragonophylla

Trolox equivalents 1106.072 431.758 214.319 152.603 100.691 55.850 29.738 23.944 4.728 ±1.55 (µM TE/g ±85.00 ±180.07 ±4.2 ±16.47 ±7.39 ±2.87b ±34.53ab ±14.80a DM)

85 superscripts do not differ significantly (>0.05).

GC-MS analysis

GC-MS analysis identified 204 separate metabolites across the 9 foods analysed (Appendix

E). Beyond these 204 compounds identified there were many unknowns that did not match entries into either library. Identifying these unknowns would be a potential avenue for further investigation. However, the two libraries these spectra were compared to cover a comprehensive list of compounds that are relevant for the majority of health research to date.

Therefore, unknown compounds are not listed in figures or appendix, in the interest of space and maintaining the focus of the thesis. The GC-MS spectra can be analysed against more detailed libraries as they become available in order identify these unknown compounds.

Known contaminants associated with GC-MS analysis were also detected and removed from results figures and tables. Many samples had compounds that were unique to that food source, in comparison to the other food types collected. Compounds of relevance as protective to health will be discussed in detail. Because of the size of the data set it is not possible to give a detailed review of the potential actions of all compounds identified.

Therefore, only some compound classes with specific relevance to the health themes of this thesis will be discussed. The complete list of compounds is included as a set of reference data

(Appendix E).

Table 4.2. Semi-quantitative analysis of relative composition of metabolites. Results are expressed as a percentage of total combined peak area for each compound common to all foods.

n- Malic Citric Quinic Nicotinic DL- DL- Octadecanoic Acid Acid Acid Acid Serine Threonine Acid

Solanum 28.77% 1.46% 30.64% 0.08% 37.85% 0.37% 0.82% chippendalei

Cyperus 29.91% 1.38% 38.22% 0.36% 11.05% 17.33% 1.75% bulbosa

Solanum 10.74% 0.10% 0.21% 0.07% 88.43% 0.15% 0.29% cleistogranum

Acacia colei 2.55% 21.27% 0.07% 1.36% 0.97% 0.03% 73.75%

Eragrostis 20.26% 11.73% 4.38% 10.93% 44.89% 7.53% 0.28% erodopida

Carissa 0.10% 4.56% 3.62% 0.04% 0.12% 91.49% 0.07% lanceolata

Acacia 6.17% 10.89% 1.04% 8.31% 56.32% 7.74% 9.54% tetragonophylla

Endoxyla 0.09% 11.30% 0.03% 0.15% 83.38% 4.50% 0.55% leucomochla

Solanum 0.07% 8.35% 0.41% 0.38% 88.82% 0.24% 1.72% centrale

Acylureas

Allantoin was the only acylurea identified in the sample set and was unique to A. tetragonophylla seeds. The production of this compound is associated with the plant stress response for factors such as drought, salinity and temperature (Takagi, Ishiga et al. 2016).

This compound has been suggested to have anti-inflammatory properties (Lee, Lee et al.

2010), in addition to impeding the development of ulcers (Garnick, Singh et al. 1998). There is some debate regarding whether allantoin possesses any antioxidant activity, with some studies reporting no anti-oxidant activity in vitro (Wang, Kong et al. 2012), whilst others have reported allantoin to have an antioxidant effect both as a free-radical scavenger and modulator of antioxidant enzymes (Gus' kov, Shkurat et al. 2001, Gus' kov, Kletskii et al.

2002). A. tetragonophylla produced the lowest antioxidant scavenging results in our study

(Table 1). We have not quantitatively measured the concentration of allantoin in this sample.

Therefore, our evidence does not contribute significantly to the debate surrounding allantoin as an antioxidant, beyond simply that its presence was not associated with high antioxidant scavenging.

6 5 4 3 2 1 0

Solanum chippendalei Solanum centrale Endoxyla leucomochla Acacia colei Carrisa lanceolata Acacia tetragonophylla Solanum cleistogranum Eragrostis erodopida Cyperus bulbosa

Figure 4.1: Number of metabolites detected within selected classifications.

Allantoin has also been identified as being potentially nematicidal (Barbosa, Barcelos et al.

1999). It would therefore be important to consider the detection of Allantoin in any sample that was used for screening with C. elegans. A study designed to investigate the potential

88 nematicidal effects of these plants would still be beneficial, however goes beyond the scope of this thesis. It would be interesting to assess whether components present in food such as allantoin have a role managing parasitic nematodes in particular and the findings of such a study could have agricultural or pathological applications.

Amines

Two compounds classed as amines were detected across three food samples (Figure 4.1,

Appendix E,). One of these amines, Putrescine is a biomarker for plant stress, particularly osmotic stress (Flores and Galston 1982) and result from the degradation of amino acids. The presence of this compound may indicate plant stress, but may also be indicative of the plant or insect beginning to degrade prior to storage. Ideally, samples would have been added to liquid nitrogen as soon as they were collected. However, due to the remote nature of this study this would have been very difficult logistically. As the partnership between researchers and the community continues to develop, arrangements for onsite -80°C freezers would assist in controlling for this issue. Because quantities of putrescine are not known, it is unclear whether these levels of putrescine are indicative of decomposition or simply of stress.

The other amine detected, dopamine is a strong antioxidant and was only detected in witchetty grub E. leucomochla. The antioxidant scavenging of dopamine identified in banana

(Musa cavendishii) was detected as very similar to some of the strongest antioxidant compounds such as gallocatechin gallate and ascorbic acid (Kanazawa and Sakakibara 2000).

This is therefore a candidate metabolite for the antioxidant action of witchetty grub observed in table 4.1.

Amino Acids

Thirty-nine separate amino acids were identified across the bushfood samples (Figure 4.2).

No one bush food contained all amino acids. Serine and Threonine were the only amino acids detected in all bushfoods allowing for semi-quantitative comparison of relative composition of all foods was possible. The non-essential amino acid Serine was a large component of the combined peak area for many of the bush foods. Serine contributed more than 50% of the combined peak area of common compounds for S. cleistogranum. A. tetragonophylla, E. leucomochla and S. centale. Threonine was the major component of the common compounds in Carissa lanceolata (91.49%). Amino acid requirements and metabolism were not the focus of this study and have been discussed in detail previously (Bender 2012). However,

Levodopa was detected some bushfoods, which is of specific relevance to further experiments using worms to understand bioactivity.

Levodopa or L-Dopa is reported to have a toxic effect against C. elegans (Kawaii, Yoshizawa et al. 1993). Therefore, samples where this compound was identified were excluded from C. elegans lifespan analysis for the same reasons cited for allantoin. The plants containing this compound included S. centrale, E. leucomochla and C. bulbosa. Nemacidal compounds are commonly produced by plants to protect from nematode infestation. A further understanding of the toxicological action of metabolites delivered to C. elegans in liposomes will need to be carried out before these plant extracts are tested on C. elegans for longevity trials. The broad, untargeted GC-MS approach allows identification of plants containing these compounds, which can then lead into further analysis regarding concentration and biochemical action.

Solanum chippendalei Solanum centrale Endoxyla leucomochla Acacia colei Carrisa lanceolata Acacia tetragonophylla Solanum cleistogranum Eragrostis erodopida Cyperus bulbosa

Figure 4.2: Numbers of selected acid classses and sugar metabolite species detected.

Cyclic Polyols

The cyclic polyols detected include a range of metabolites relevant to human health (Figure

4.1, Appendix E). Ononitol was detected in 3 bushfood samples and is thought to was observed to have a protetive effect on the liver of rats mediated by an increase in anti-oxidant and hepatic glutathione enzyme, whilst decreasing levels of serum transaminase, lipid peroxidation and TNF-α (Dhanasekaran, Ignacimuthu et al. 2009). Pinitol was detected in 4 of the samples A. colei, C. lanceolata, A. tetragonophylla and S. cleisotgranum. This metabolite has been suggested to have strong antidiabetic properties, by affecting glucose uptake (Bates, Jones et al. 2000). However, a 4 week clinical trial where subjects ingested

91 pinitol failed to increase insulin sensitivity (Davis, Christiansen et al. 2000). A 4 week clinical trial adds interesting data, however the participants were already obese and type 2 diabetic. Therefore, 4 weeks may not be enough to reverse the progression of the disease.

Furthermore, pinitol may act as a prevention of the onset of diabetes, but not necessarily reverse a developed disease.

The identification of pinitol in four staple foods of Indigenous Australians is a significant finding. Pinitol is not unique to native Australian plants and has been isolated from foods that can be purchased from the average supermarket such as soybean (Kim, Kim et al. 2005).

However, because soybeans are available does not mean they are consumed in volumes that would reflect the consumption of pinitol in native Australian foods. Further work is needed to understand the concentration of pinitol in each of these foods. However, the identification of this potentially antidiabetic compound in a broad variety of commonly consumed foods in a traditional Indigenous diet is an important consideration for discussions around Aboriginal health. Pinitol is therefore a useful compound to target in further research addressing nutrients that are lost in the reduction of food variety inherent in the western diet. Sequoyitol was only detected in S. centrale and has also been suggested to have anti-diabetic properties

(Shen, Shao et al. 2012) and prevent associated kidney disease (Li, Liu et al. 2014) in rodent experiments.

Shikimic acid was detected in 3 of the bush foods and is a phenolic compound with a key role in antioxidant defense and in the synthesis of essential amino acids (Ghasemzadeh and

Ghasemzadeh 2011).

Quinic acid which is part of the shikimic acid pathway was detected in all bushfood samples and contributed the highest percentage of total peak area in Solanum chippendale (30.64%) and Cyperus bulbosa (38.22%). This metabolite also has an important role in the antioxidant

92 defence. It is not an antioxidant itself, but is integral in the synthesis of tryptophan and nicotinamide in the gastrointestinal tract, leading to increased DNA repair enhancement and

NF-kB inhibition (Pero, Lund et al. 2009).

Quebrachitol was also detected in two of the samples which has been studied for anti-diabetic properties and as an alternate sweetener (McCance and Lawrence 1933). It was found to taste sweet and was not metabolised as a sugar, did not lead to glycogen deposition on the liver and did not form lactic acid (McCance and Lawrence 1933). However, the dosage used resulted in diarrhoea and hypoglycaemia in some of the studies participants. These negatives demonstrate the importance of not treating these compounds as a miracle cures, just because there are interesting biological correlations. The risks and benefits need to be considered together. There is renewed interest in quebrachitol as an antidiabetic compound however. In rodent model trials there is a mechanistic link between quebrachitol and reduced feed intake, weight gain, blood glucose and insulin receptors in the liver (Xue, Miao et al. 2015).

Quebrachitol is being studied particularly as a starting compound for further drug development (Wang, Zhang et al. 2017). However, the role as a nutrient in the traditional diet needs further exploration.

Cyclic polyols appear to be present in a broad range of native plants and an insect species.

Because of many of the compounds in this class have been suggested to impact energy metabolism and even be antidiabetic, further research in this area is justified. All cyclic polyols detected in these native food sources have been implicated in discussion around obesity and type 2 diabetes. The next step will be to measure the concentration of these cyclic polyols in a variety of traditional food sources. A comparison of the concentration of these components in a traditional diet and what is typically consumed in a Western diet would be an interesting. However, due to the variability inherent in traditional dietary practices to

93 overcome seasonal availability of foods a direct comparison would be difficult. Therefore the presence of this compound is a useful result.

Dicarboxylic Acids

Malic Acid is a dicarboxylic acid that was found in all bushfood samples (Appendix E,

Figure 4.2). S. chippendalei and C. bulbosa had the largest contribution of Malic Acid to total peak area with values of 28.77% and 29.91% respectively (Table 4.2). Malic acid also has antioxidant properties and is a potential contributor to the antioxidant capacity of these plants (Brittain 2001). Malic acid is a very common compound in a range of vegetables and is included as a flavouring in sweet foods and drinks (Goldberg and Rokem 2009). Whilst it is potentially contributing to the antioxidant capacity of each bushfood, it is a common metabolite in the western diet.

Oxalic acid was detected in six of the plant samples (Appendix E). Oxalic has been detected in Australian plants consumed as part of the Indigenous diet previously, such as in the

Kakadu Plum, T. ferdinandiana (Williams, Edwards et al. 2016). The presence of oxalic acid was correlated with native fruits by Williams, Edwards et al. (2016). In these food sources oxalic acid was detected in fruit (S. chippendalei, S. cleistogranum, C. lanceolata ), but also in seeds (A. teragonophylla, E. eradopida) and a bulb (C. bulbosa). Consuming oxalic acid can have an effect on the formation of kidney stones (Noonan and Savage 1999). However, oxalic acid is a common metabolite found in plants. Without data on the concentration of this metabolite in each sample, it is difficult to assess the risk of oxalic acid consumption in these foods. The untargeted approach adopted by this study is useful as a reference for further study into kidney stone formation. If an investigation into issues such as kidney stones in

Indigenous people is warranted the data the data provided will help identify potential contributing foods. The major contributing factor of oxalic acids to the western diet is tea,

94 which is very commonly consumed. Therefore, oxalic acid is not a compound that is contributed specifically by bushfoods included in a traditional Indigenous diet. Whilst there are negative effects associated with oxalic acid it is also observed to have a powerful antioxidant effect (Kayashima and Katayama 2002).

Fatty Acids

The bushfood samples were detected to be rich in fatty acids, with 18 different fatty acid species detected (Appendix E, Figure 4.3). These species included a Branched Fatty Acid, (2- methyl Butanedioic acid), Fatty Acid Esters, a methyl- branched fatty acid (2,3-

Dimethylsuccinic Acid), Medium Chain Fatty Acids, Short Chain Fatty Acids, Saturated

Fatty Acids Unsaturated Fatty Acids.

The link between fatty acid consumption and health has been an area of detailed research and spirited debate (Simopoulos 1999, Connor 2000, Vannice and Rasmussen 2014). It is also been an area of interest in native Australian plants, particularly in Acacia seeds and animal products (Naughton, O'Dea et al. 1986, Brown, Cherikoff et al. 1987).

This study was designed to be a broad, untargeted identification of the spectrum of compounds present in traditional Australian foods, rather than a quantification of fatty acid concentrations used in previous studies (Naughton, O'Dea et al. 1986, Brown, Cherikoff et al.

1987). It is therefore difficult to compare these results to past studies. However, oleic acid which was identified as a compound of interest in these studies was detected in 6 of the bushfoods samples including; S. centrale, E. leucomochla, A. colei, C. lanceolata, A. tertragonophylla and C. bulbosa.

Solanum chippendalei Solanum centrale Endoxyla leucomochla Acacia colei Carrisa lanceolata Acacia tetragonophylla Solanum cleistogranum Eragrostis erodopida Cyperus bulbosa

Figure 4.3 Number of Fatty-acid metabolites detected.

Stearic acid was detected in all samples and accounted for the highest percentage of common peak areas in A. colei (73.75%). High circulating stearic acid has been suggested to be a biomarker for type 2 diabetes risk (Wenjie, Wu et al. 2015). The mechanism of this increased circulation is not fully understood and therefore it is not clear whether stearic acid is only correlated with diabetes not causing it.

Fatty Alcohols

C. lanceolata was detected to contain a range of fatty alcohols including Hexacosanol,

Octasanol, Tetracosanol. These fatty alcohols are also the predominant species detected in olive oil and have been discussed as protective compounds in the Mediterranean diet (La

Lastra, Barranco et al. 2001).

There is evidence in rodent models that hexacosanol has a protective effect of some of the damaging effects of diabetes (Shinbori, Saito et al. 2006) However, the diabetic traits such as weight, glucose levels and insulin levels was not affected. Octasanol has been suggested to have a LDH cholesterol lowering effect, whilst increasing HDL cholesterol (Taylor, Rapport et al. 2003). It is also used as an athletic supplement to improve stamina and as an alternate aspirin (Taylor, Rapport et al. 2003). Tetracosanol has been suggested to improve insulin sensitivity by up regulating the activity of insulin receptor kinase (Hsu, Shih et al. 2015).

0 Fatty Alcohol Primary Alcohol Secondary Alcohol Sugar Alcohol

Solanum chippendalei Solanum centrale Endoxyla leucomochla Acacia colei Carrisa lanceolata Acacia tetragonophylla Solanum cleistogranum Eragrostis erodopida Cyperus bulbosa

Figure 4.4 Number of selected alcohol metabolites detected

Flavonoids

The flavonoid catechine was found in all bushfood samples except for S. centrale (Appendix

E). This metabolite is one of the most researched antioxidant compounds. Much of the research into catechine has been as an active constituent in green tea (Dulloo, Duret et al.

1999). In addition to antioxidant capacity catechine has been associated with dietary induced

97 thermogenesis, improved fat oxidation, alter cholesterol levels and generally assist in fat loss

(Dulloo, Duret et al. 1999, Maki, Reeves et al. 2009). These biological functions of catechine have been associated with improvements to obesity and diabetes status, heart disease, cancer and infection defences (Mitscher, Jung et al. 1997, Babu, Pon et al. 2008, Suzuki, Miyoshi et al. 2012). Whilst it is common in tea it can also be derived from wine, chocolate and fruits such as apples and pears (Donovan, Bell et al. 1999, Ilja, Jacobs et al. 2001). Therefore, this is not a compound absent from the Western diet. However, it is a compound associated with health benefits and it is found in a variety of sources in the traditional diet of Indigenous

Australians.

Other flavonoids such as salicylic, 4-hydroxybenzoic acid, caffeic acid and ferrulic acid were detected in the bushfood samples (Appendix E). These metabolites are both phenolic compounds that have been associated with anti-cancer and LDL cholesterol altering effects due varying degrees of antioxidant activity (Graf 1992, Decker 1995, Meyer, Donovan et al.

1998, Sroka and Cisowski 2003, Merkl, HRádkoVá et al. 2010). Further studies understanding the precise intake of metabolites such as catechine will increase clarity around this issue. The data presented in this thesis identifies catechine as a beneficial compound not previously identified in the traditional diet of Indigenous Australians.

Glycosides

The glycoside Hydroquinone-beta-D-glucopyranoside, also known as Arbutin was a unique compound identified in the high antioxidant capacity fruit of S. chippendalei. Using the same methodology as this thesis ABTS•+ assay, Arbutin has been observed to display strong antioxidant scavenging (Takebayashi, Ishii et al. 2010). Other assays of antioxidant scavenging of Arbutin were suggested to underestimate the activity of this antioxidant. This

98 result was supported by a corresponding strong antioxidant effect in cell culture systems

(Takebayashi, Ishii et al. 2010). This forms some of the rationalization for choosing an ABTS

•+ assay to determine antioxidants across bushfood samples. The antioxidant capability of

Arbutin has predominantly been explored as an additive to skin care products (Zhu and Gao

2008). However, there is a very limited number of studies exploring the effects of arbutin in the diet and therefore on obesity and diabetes. In a rodent screening assay, studying the effect of glycosides on blood glucose levels, arbutin was found to decrease peak blood glucose level by 40-52% (Takii, Matsumoto et al. 1997). This was not due to a decrease in gastric emptying as this was not significantly different in any of the glycosides tested. The mechanism of this reduction was not described by the authors, but suggested to be related to phosphoinositide metabolism (Takii, Matsumoto et al. 1997). It has since been observed that arbutin is a potent α- amylase and α- glucosidase inhibitor that has a significant effect on lipid peroxidation (Yousefi, Mahjoub et al. 2013, Khadir, Pouramir et al. 2015). Arbutin has been identified in a variety of herbs, flowers and some pear cultivars (Schieber, Keller et al. 2001,

Cui, Nakamura et al. 2005, Rychlinska and Nowak 2012). It is therefore a metabolite only found in a select group of foods. This is further demonstrated in the data set presented in this thesis as it is only present in a single sample, even though both closely related plant species to

S. chippendalei and very distinct species were analysed. This provides justification of further analysis on S. chippendalei and the bioactivity of this unique compound in the context of a whole food.

Imidazopyrimidines

The imidazopyramidine uric acid was detected in 5 samples (Appendix E). This is an interesting example where antioxidant capacity alone is not indicative of protection from

99 disease. Uric acid has been demonstrated as key contributor in some antioxidant defence pathways (Ames, Cathcart et al. 1981). However, a study targeting the interaction between uric acid and type 2 diabetes found high levels of serum uric acid to be a risk factor for type-

2 diabetes (Dehghan, Van Hoek et al. 2008). There is an ongoing debate assessing whether there is a causal relationship between uric acid and diabetes, or if uric acid levels rise in the body due to diabetes. However, this further demonstrates the importance of studying these compounds in a broader biological context, rather than as isolated metabolites.

Monocarboxylic Acids

The monocarboxylic acids detected in a range of the samples are nutritionally relevant and also a potential source of antioxidants (Appendix E). Dehydroascorbic acid dimer (D) was another unique compound found in the high antioxidant-scavenging sample, S. chippendalei.

This is an oxidised form of vitamin C that is able to cross the blood brain barrier (Huang,

Agus et al. 2001). The non-oxidised version of vitamin C, ascorbic acid was also detected in

S. chippendalei. Measurement of vitamin C has been discussed in detail in the literature review section of this thesis. S. chippendalei is one of the foods detected to have a high content of vitamin C (Brand-Miller and Holt 1998). It is surprising that it was not detected in any food, especially the fruits and witchetty grubs, as they have been reported to contain relatively high concentrations of vitamin C (Brand-Miller and Holt 1998).

It has been suggested that dehydroascorbic acid uptake may be inhibited as a consequence of diabetes, which results in inflammation and an impaired antioxidant defence (Wilson 2002).

It is interesting that dehydroascorbic acid was a unique metabolite to the bush food samples.

However, dehydroascorbic acid has been identified in a range of foods and can also be synthesised in the body (Mills, Damron et al. 1949). Therefore, dehydroascorbic acid in S.

100 chippendalei is unlikely to contribute a protective effect, compared to other foods. However, the presence of this metabolite will contribute to the collective bioactivity of S. chippendalei.

Pyridinecarboxylic acids

Nicotinic acid also known as Niacin or vitamin B3 was detected in all bushfood samples. It contributed the highest percentage of total peak area in E. erodipida (10.93%) and A. tetragoniphylla (8.31%). Niacin is an essential nutrient, with pellagra the resulting disease from vitamin B3 deficiency. Niacin has been targeted as a potential dietary option of altering

LDL cholesterol levels in the body (MacKay, Hathcock et al. 2012). Therefore, it does have a variety of protective effects. However, it is a common component of most diets and is unlikely to be a major contributor to the obesity and type 2 diabetes issue. A cross-sectional study addressing niacin intake in obese and diabetic patients would be a useful way to confirm or disprove this speculation.

Sugars

27 different carbohydrate sugar metabolites were identified in the bush food samples

(Appendix E, Figure 4.2). These foods were expected to be rich in sugar metabolites as known carbohydrate sources such as fruits were included in the analysis. However, it is interesting to note the diversity of the sugar species identified. Fructose has been identified as a major contributor to the obesity and diabetes pandemic (Coulston, Hollenbeck et al. 1987,

Johnson, Segal et al. 2007). Whilst these sugars were commonly identified across the bushfood samples, they were always identified with a variety of other sugars. Therefore, the sweetness is derived from a number of sugar metabolites rather than one or two. In addition, in all examples where fructose was identified, antioxidant components were also detected.

Fructose has been associated with inducing oxidative stress, which has been suggested to be a

101 mechanistic factor in diseases such as type 2 diabetes (Tappy, Lê et al. 2010, Hokayem,

Blond et al. 2013). The refining of food typical of the Western diet inadvertently removes these antioxidants along with the unwanted parts of the plants, to produce refined sugars. The interaction between the sugars detected and the corresponding antioxidants detected in each food source therefore needs further attention.

Sugar Acids

20 distinct sugar acid metabolites were detected across the range of samples (Figure 4.2,

Appendix E). There is evidence in rodent models that sugar acids that were detected such as

2,4,5-Trihydroxypentanoic acid and 3,4-dihydroxybutanoic acid (Tartaric) have a role in sending satiety signals to the brain (Plata-Salamán, Oomura et al. 1986, Oomura 1988).

Tartaric acid and gluconic acid have been demonstrated to be dietary sources of sugar acids that have significant antioxidant capacity (Meyer, Donovan et al. 1998, Gheldof, Wang et al.

2002).

Sugar Alcohols

Sugar alcohols have a been a topic of interest for nutrition research, largely due to their partial absorption (Wolever, Piekarz et al. 2002). They are often used to replace sugars in food products, however gastrointestinal issues have been associated with their use (Koutsou,

Storey et al. 1996). It is unclear whether the concentration of these sugar alcohols is at a level that would cause any of these symptoms. However, they are likely to be contributing to the overall sweetness of the food, without reliance on fructose. There has been speculation that the increase in sugar alcohols as a result of their role as a sugar substitute is a factor in the increase of obesity and diabetes (Payne, Chassard et al. 2012). The hypothesis of Payne,

102

Chassard et al. (2012) is that the gut microbiota is struggling to adapt to these “new” substrates, such as sugar alcohols. The detection of these sugar alcohols in what can be considered ancient foods, that have been consumed in communities with no record of diabetes symptoms is evidence against this hypothesis. However, without knowledge of the difference in concentration between the diets this hypothesis cannot be disproven. Diabetes in

Indigenous Australians is increasing, yet substrates like xylitol can not be considered new in their diet. However, the concentration in the diet may have changed. The authors do not limit the responsibility of increased disease load to sugar alcohols. They also include fructose and artificial sweeteners as potential substrates that are altering the microbiome.

Steroids

Many of the steroid metabolites detected across the bushfood sample have been suggested to have protective effects. The phytosterols identified such as beta-Sitosterol, Campesterol,

Fucosterol, Stigmasterol, in addition to tocopherols alpha, beta and gamma have important nutritional roles. Beta-Sitosterol has been suggested to improve immune function, protect against colon cancer, lower cholesterol and restrict hair loss amongst other suggested effects

(Nair, Turjman et al. 1984, Bouic, Etsebeth et al. 1996, Saeidnia, Manayi et al. 2014).

Berries, nuts, olive oil, vegetables and cereals are common sources of beta-Sitosterol

(Weihrauch and Gardner 1978). In the bush food samples it was identified in C. lanceolata,

S. cleistogranum, E. erodopida (Appendix E).

Campesterol was identified in C. lanceolata, S. cleistogranum and C. bulbosa. Campesterol is more readily absorbed than sitosterol, but significantly lower than cholesterol (Heinemann,

Axtmann et al. 1993). Sterol efficiency has been studied as a potential mediator of obesity.

In a study of lean and obese individuals, there was significantly lower serum campesterol and

103 sitosterol concentrations in obese subjects compared to lean subjects (Miettinen and Gylling

2000). However, there was not a significant difference in cholesterol between these groups. It is not clear from this result if the higher levels of phytosterols in lean participants gave a protective effect against obesity or if the lower levels in obese participants was caused by a different metabolism of these sterols.

Sitosterol and Campesterol are the predominant phytoserols found in plants, however

Fucosterol was identified in S. chippendalei, C. lanceolata and S. cleistogranum.

Stigmasterol was found in C. lanceolata, A. tetragonophylla, S. cleistogranum and C. bulbosa. (Kritchevsky and Chen 2005) and the phytosterol 2-4-Methylenecycloartanol. Was unique to C. lanceolata. C. lanceolata was therefore rich in phytosterols, which is to be expected as berries have previously been observed to have a high pytosterol content

(Weihrauch and Gardner 1978).

Three classes of tocopherol, alpha, beta and gamma were detected across the bushfood samples. Tocopherol is more commonly known as Vitamin E and is a well-researched antioxidant (Buettner 1993). Alpha-Tocopherol was detected in A. colei, beta-tocopherol in

A. tertragonophylla 6 and gamma-tocopherol in E. erodopida and C. bulbosa. Therefore, seeds of the Indigenous diet appear to be rich in tocopherol species, as all seed samples were detected to contain at least one species of tocopherol. Alpha-tocopherol was unique to A. colei and is therefore a plausible candidate for the relatively high antioxidant scavenging of this Acacia species. There is a large amount of evidence for the variety protective effects of tocopherols, however there is also reported protective effects against the type 2 diabetes and obesity (Gazis, White et al. 1999, Strauss 1999, Ihara, Yamada et al. 2000, Palm, Cederberg et al. 2003)

104

Triterpenoid

Oleanolic acid and ursolic acid were unique compounds to C. lanceolata (Appendix E).

These are important dietary metabolites, that have received a great deal of research into its dietary role in health. One study identified these compounds as high antioxidant scavenging associated with disruption of severe hypotension, significant reduction of LDL cholesterol and decrease of blood glucose levels (Somova, Nadar et al. 2003). Other studies have suggested it has acts to improve immune function, in addition to anticancer and anti-HIV properties (Kashiwada, Wang et al. 1998, Li, Guo et al. 2002, Raphael and Kuttan 2003).

Beta-Amyrin was detected in C. lanceolata, but also in E. leucomochla (Appendix E). This compound is the precursor to oleanolic acid and has been suggested to also have action against obesity, hyperglycaemia and depression (Aragão, Carneiro et al. 2006, Aragao,

Pinheiro et al. 2008, Santos, Frota et al. 2012).

Tricarboxylic acids

Citric acid was a tricarboxylic acid detected in all of the bushfood samples. This metabolite made the largest contribution to total peak area in A. colei (21.27%), E. erodopida (11.73%),

E. leucomochla (11.30%) and A. teragonophylla (10.89%). Citric acid is an antioxidant and major acid in fruits such as pomegranate, oranges and tomatoes (Kader, Stevens et al. 1977,

Gil, Tomás-Barberán et al. 2000, Kelebek, Selli et al. 2009). It is a common dietary component, however there is evidence that it also provides a protective effect against obesity and diabetes (Hraš, Hadolin et al. 2000, Muroyama, Murosaki et al. 2003).

Conclusions

105

The investigation into the composition of Indigenous dietary items has delivered three key developments. Firstly, confusion resulting from imprecise taxonomy and food component anlysis has been resolved for the macronutrient profile of a staple food of the Kiwirrkurra people, commonly known as Bush Coconut. Secondly, a broad overview of observations on the dietary practices of the Kiwirrkurra people has been recorded. Finally, in a collaborative effort between multiple Universities, Non-profit organisations and the Kiwirrkurra people, 9 key bush foods have been identified, collected, analysed for antioxidant capacity and a comprehensive list of the metabolites present in these foods has been catalogued.

These metabolites provide targets of further investigation. Whilst, all metabolites discussed have dietary sources described earlier than this study, the variety of compounds present in these Indigenous food sources is significant. The data demonstrates that traditional diets were rich in a large set of compounds that are suggested to have far-reaching health effects.

This experimental design relied on the comparison of metabolites with known bioactivity from research on other more common food types. Therefore, it is unlikely that new bioactive compounds will be identified using this experimental design. Perhaps some of the unknown metabolites that did not match any metabolites from the reference libraries may have this function. However, this justifies future reassessment of the GC-MS spectra against newer and more comprehensive reference libraries. However, the two libraries used to identify the metabolites provides a sufficient understanding of the metabolite profile of these foods.

Different to past studies on Australian native foods that have targeted small groups of compounds for quantification of concentrations, this study provided information on the total diversity of compounds. Now that the presence of a large variety of compounds has been detected, these more targeted approaches would be warranted. However, the compounds of mixed action are present in these foods and consumed together, not as individual compounds.

Therefore, analysis of the biological action of these foods, as a complex source of compounds

106 is an essential next step for the field. There are many options to assess this such as using these foods in clinical trials or on rodent models. However, these experiments are very expensive and require a large volume of food sample to be feasible. Given that collection of these samples, especially in large quantities puts an extreme strain on resources and time.

Many of the effects of compounds described are thought to be a result of long-term consumption, this adds a further complication to these kinds of studies as the required duration would not be feasible. This is in addition to normal considerations for clinical or rodent trials such as; human and animal ethics, participant recruitment and data collection.

Models such as Caenorhabditis elegans (C. elegans) that are well suited to assessing long- term effects of a particular food. This is mainly due to their short lifespan, allowing understanding of the biological effect of a treatment in less than a month. The major issue with using C. elegans for nutritional studies, is that their principal source of nutrition in the lab is bacteria. This introduces a range of issues that will be explored in greater detail in the following chapter. However, the key issues are that it is difficult to alter the nutritional composition of a bacteria-based diet and any intervention may have unintended effects on the bacterial source or be metabolised to a different compound by the bacteria. Bacteria-free diets have been tested and referred to as axenic media. However, they allow for more control of the nutritional environment and remove the metabolically active bacteria from the experiment.

However, some of the protocols rely on undefined and complex nutrition sources such as milk. Milk is a very complete food nutritionally. Therefore, addition into a medium introduces similar problems to bacterial media as the nutrient profile of the medium is again difficult to control. All axenic media are typically liquid based and therefore should not be able to provide nutrition to the worms. These issues need to be addressed before any meaningful screening of foods can be completed using C. elegans.

107

The next chapter describes the process of addressing these issues, which resulted in the development of a new axenic media system, ideally suited to the screening of nutritional compounds for bioactivity. This system was then used to screen S. chippendalei in chapter 6.

The current chapter found this traditional bushfood to have the highest antioxidant capacity and it also contained compounds of interest that were unique to this food source, compared to the other foods analysed.

Chapter 5. Development of a novel Caenorhabditis elegans model for nutrition studies*.

This chapter has been published in G3 with the title, “Growth of Caenorhabditis elegans in

Defined Media Is Dependent on Presence of Particulate Matter” (2017). Matthew R Flavel,

Adam Mechler, Mahdi Shahmiri, Elizabeth R Mathews, Ashley E Franks, Weisan Chen,

Damien Zanker, Bo Xian, Shan Gao, Jing Luo, Surafel Tegegne, Christian Doneski,

Markandeya Jois

Abstract:

Caenorhabditis elegans are typically cultured in a monoxenic medium consisting of live bacteria. However, this introduces a secondary organism to experiments and restricts the manipulation of the nutritional environment. Due to the intricate link between genes and environment, greater control and understanding of nutritional factors are required to push the field into new areas. For decades, attempts to develop a chemically defined, axenic medium as an alternative for culturing C. elegans have been made. However, the mechanism by which the filter feeder C. elegans obtain nutrients from these liquid media is not known. Using a fluorescence-activated cell sorting based approach, this chapter demonstrates growth in all past axenic C. elegans media to be dependent on the presence of previously unknown particles. This particle requirement of C. elegans led to development of liposome-based, nanoparticle culturing that allows full control of nutrients delivered to C. elegans.

108

Introduction:

C. elegans are typically cultured in the laboratory on a variety of bacterial strains, with

Escherichia coli OP50 strain the most common. Due to the intricate link between genes and environment, greater control and understanding of nutritional factors delivered to these nematodes is required to push the field into new areas. In addition, differences in bacterial metabolism can alter the response of C. elegans to drug treatments(García-González, Ritter et al. 2017, Scott, Quintaneiro et al. 2017). Therefore, inclusion of bacteria into the experimental system may introduce an unwanted variable into applications such as drug screening and toxicology. Attempts to develop a bacteria free and chemically defined culture medium, have been made (Dougherty, Hansen et al. 1959, Vanfleteren 1974, Croll, Smith et al. 1977, Lu and Goetsch 1993, Clegg, Lapenotiere et al. 2002, Houthoofd, Braeckman et al.

2002, Szewczyk, Sunga et al. 2003, Szewczyk, Kozak et al. 2003, Szewczyk, Udranszky et al. 2006, Nass and Hamza 2007, Lenaerts, Walker et al. 2008). However, these axenic methods are associated with a caloric restriction state as indicated by slower life stage progression, increased lifespan, metabolic changes and an altered phenotype reflecting an undernourished organism (Vanfleteren 1974, Croll, Smith et al. 1977, Lu and Goetsch 1993,

Szewczyk, Kozak et al. 2003, Szewczyk, Udranszky et al. 2006). These media can be prepared as solid our liquid media. However, the majority of axenic experiments are carried out in liquid medium. This is an interesting phenomenon as the feeding behaviour and physiology of C. elegans suggests a liquid diet would be an inefficient delivery method of nutrient to the worms. Theoretically, no exclusively liquid diet should be able to provide nutrients to C. elegans, as they are filter feeders that actively eject liquid and particles smaller than bacteria, whilst trapping larger particles for ingestion (Fang-Yen, Avery et al. 2009).

One of the axenic media options available is a semi-defined medium often referred to as

109

AXM. This preparation consists of soy peptone, yeast extract and haemoglobin (Houthoofd,

Braeckman et al. 2002). This medium known to induce a caloric restriction state, despite a high concentration of calories being present in the medium (Houthoofd, Braeckman et al.

2002, Lenaerts, Walker et al. 2008, Greer and Brunet 2009). This also limits research to topics concerning dietary restriction and the semi-defined nature of the medium restricts the understanding and manipulation of the nutrient concentrations delivered to the worm.

Some media require milk supplementation such as Caenorhabditis elegans Habituation and

Reproduction (CeHR) medium, but are included without understanding its role in nematode nutrition (Clegg, Lapenotiere et al. 2002). In this protocol milk makes up 20% of the final volume of the medium, therefore the inclusion of may introduce a unique set of issues to researchers, especially those interested in nutrition. The nutritional composition of milk varies due to a range of factors and is a complex and poorly understood matrix (Haug,

Høstmark et al. 2007). Due to the inclusion of milk or milk components, the medium could be considered as semi-defined, as the precise concentrations of nutrients is unknown.

Whilst CeHR axenic medium includes a large volume of milk supplementation, there are milk- free alternatives already available. One example is a defined medium known as C. elegans Maintenance Medium. However, worms in this medium are slow to develop and lay eggs, taking 7 days to reach 1 mm and 9 days to lay eggs (Szewczyk, Sunga et al. 2003).

Whilst slow, this development that occurs in the absence of milk supplementation provides an interesting opportunity to explore whether there was a common factor in both these medium that was required to support growth.

These limitations have prohibited widespread uptake of axenic media for C. elegans experiments. It has been hypothesized the dietary restriction may be due to a component or a growth factor present in bacteria, but lacking in the axenic medium recipes (Vanfleteren

1974, Lu and Goetsch 1993, Lenaerts, Walker et al. 2008). Therefore, a central aim of the

110 investigation was to further the understanding the critical factors involved in successful axenic C. elegans culture, in order to overcome some of the limitations that have restricted the application of these methodologies.

Materials and Methods

C. elegans strains and conditions for growth rate experiments.

Wild-type Bristol N2 (Caenorhabditis Genetics Centre) were used in all experiments. All experiments were conducted at 20 °C and kept away from light to prevent photodegradation of light sensitive components present in media. Prior to growth rate assays, worms were cultured on standard NGM media, with a living OP50 E.coli as food source. Synchronised eggs from these colonies were hatched in M9 buffer solution and added to differing media conditions at L1 lifestage. A single worm was randomly selected and added to each well of a

96 well-plate, preloaded with 150 μl of culture media as treatment. 25 worms per treatment were measured at 24-hour intervals and results presented are averages, with standard deviation. Images were analysed using FIJI (Image J) software with length measurements being derived by the sum-total of a number of segmented lines of known length, down the centre of the worm. OP50 E.coli were prepared at 1x and 5x concentrations in S-medium as positive controls to approximate bacterial cells per ml of 9 x 108 and 4.5 x 109 respectively.

Animals were excluded from analysis if fungal or bacterial contamination was detected.

Media preparation

A variety of axenic media preparations were used. The majority of these media were based

111 predominantly on CeHR media, however in many cases moderations to the original protocol

(Clegg, Lapenotiere et al. 2002) have been made. To clarify these modifications “CeHR +

Milk” is referred to this media follows the usual published protocols to prepare CeHR media.

In preparations referred to as “CeHR + Milk Particulate Matter”, the milk was centrifuged at

10,000g for 30 minutes to ensure distinct separation between pellet and supernatant. The remaining pellet of milk was resuspended to the initial volume of whole milk with M9 buffer and added to the CeHR media, making up 20% of the final volume of media. Growth rate was also measured in worms grown exclusively in buffer resuspended milk pellet (referred to in results as “Milk Particulate matter”). Media referred to as “CeHR no milk” followed the usual protocols for CeHR preparation, however at the stage of the protocol where milk is usually added it was replaced with the same volume of deionised water. This made up 20% of final volume in order to approximate the same concentration of solutes in the usual CeHR preparation, whilst removing the effect of the milk. Growth rate in M9 was also included as a negative control, because there is no nutrient included in the mix and L1 arrest is expected, except in the event of contamination. CeMM media was prepared by Cell Guidance Systems,

Cambridge UK, following the usual protocol (Szewczyk, Kozak et al. 2003) AXM media was prepared in our laboratory, following the usual protocol (Lenaerts, Walker et al. 2008). All references to filtration was conducted using a 0.22 μm Stericup Vacuum filter unit

(Millipore).

Solubilization of particulate fraction in milk

UHT Skim milk was centrifuged at 10,000g for 30 minutes. The supernatant was discarded, leaving only the milk pellet. High concentration urea (8M) was slowly added and mixed with the pellet until the sample had changed from an opaque white colour to a relatively

112 translucent mixture and the volume of added urea recorded. This mixture was again diluted back to the original volume of milk using M9 buffer and then added to the CeHR mixture. It was assumed that the solubilised protein would still be available to the worm, however they would be in solution rather than as particles. We chose to include a control against the effect of urea at a concentration of 46 mM. For this control, we prepared CeHR + Milk Particulate Matter medium as described in the previous section, but added urea for a final concentration of

46mM included in the media. As 8 M urea, applied directly to the milk pellet was required to solubilise the proteins in the treatment media it was assumed that in this control, protein particles would not be in solution and remain as formed particles.

DNA Extraction and Qualitative Polymerase Chain Reaction

50 ml replicates of UHT milk samples were centrifuged at 10,000 g for 30 minutes. The supernatant was discarded, leaving only the milk pellet. Milk pellet was weighed into replicates of 0.34g mean weight.. MoBio PowerSoil DNA 517 Isolation Kit (Qiagen) was utilised to extract gDNA following the manufactures instructions. Extractions were performed in triplicate and total gDNA concentration was assessed using Implen Nanophotometer P330.

Qualitative analysis of Bacterial DNA in sample

The intergenic spacer region between the bacterial 16S and 23S rRNA subunits was amplified as a qualitative assessment of bacterial gDNA presence in the UHT milk. The forward primer 16S-1392F 5’FAM-GYACACACCGCCCGT3’ and reverse primer 23S-

125R5’GGGTTBCCC CATTCRG3’ often utilized for automated method of ribosomal

113 intergenic spacer analysis were used for amplification (Weisburg, Barns et al. 1991). PCR reactions were performed using TopTaq® reagents (Qiagen) and contained 2 μl TopTaq®

10x buffer, 4 μl Q solution, 1.2 μl MgCl2, 1 μl dNTPs (10 mM), 1 μl of 10μM forward and reverse primers, 0.1 μl TopTaq® DNA polymerase, 8.7 μl sterile MilliQ water (sddH2O) and

1 μl of sample DNA template per 20 μl reaction. Reactions were performed using T-

Professional TRIO Thermalcycler (Biometra) with an Initial denaturation 94°C for 180 seconds, 35 cycles of denaturation 95°C for 60s, annealing 52°C for 60s, extension 72°C for

90 seconds and a final extension of 72°C for 360 seconds (Kovacs, Yacoby et al. 2010). Once completed, PCR products were visualised on a 2% agarose electrophoresis gel. Wastewater samples, normalized to 5ng/μl gDNA, acted as controls for DNA amplification.

Quantification of bacterial DNA using real-time quantitative PCR (qPCR)

Quantitative PCR (qPCR) was used to quantify the copy number of total bacterial gDNA present in three biological replicates of the UHT milk sample. The primer pair 1114F

5’CGGCAACGAGCGCAACCC3’ and 1275R 5’CCATTGTAGCACGTGTGTAGCC3’ were used to target the bacterial 16S rRNA gene as previously described (Denman and

McSweeney 2006). The qPCR was performed on the CFX Connect Real-Time PCR

Detection System (BioRad) and each sample was loaded in triplicate. Each 20 μl reaction contained 3.3 μl SsoAdvanced Universal SYBR® Green Super Mix, 0.27 μl of each 10 μM forward and reverse primer, 14.16 μl sterile MilliQ water (sddH2O) and 2 μl of sample gDNA. The PCR product

114 was run on 1.5% (w/v) agarose gel and purified using QIAquick® Gel Extraction Kit

(Qiagen).

Bacterial copy number was calculated for a 130bp amplicon using the 1114F and 1275R primer pair to amplify the 16S rRNA gene in purified E. coli strain DH5α. The standard curve was generated using 10-fold serial dilutions of purified product, in triplicate. The cycle settings for the qPCR were: 94°C for 180 seconds followed by 40 cycles of 94°C for 10 seconds and

60°C for 30 seconds.

FACS analysis for particle detection

20 μm aliquots of a variety of media preparations and conditions were analysed for the presence of particulate matter. These included CeHR supplemented with milk, CeHR filtered, CeMM,

CeMM filtered, CeMM filtered and then incubated at 20°C for 72 hours, AXM media, AXM media filtered and AXM media filtered and then incubated for 72 hours at 20°C. FACS analysis was performed on the CytoFLEX S FACS machine (Beckman Coulter), using 405nm violet laser side scatter channel to determine particle size. 1 μm, 0.5 μm and 0.05 μm Fluoresbrite

Carboxylate microspheres (Polysciences) were used as standards to determine size reference values to compare particles detected within samples.

115

Liposome preparation and encapsulation of media

1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) was purchased from Avanti Polar

Lipids (Alabaster, AL, USA). Lipids were dissolved in chloroform to form a stock solution and stored at -20°C. Aliquots were then measured at 20°C into glass test tubes and mixed with chloroform to produce a lipid concentration of 10 μM per tube. The chloroform was evaporated under a gentle stream of nitrogen gas upon continuous vortexing to form a thin film of lipid on the wall of the test tube. These lipid tubes were then dried overnight. To encapsulate the media in liposomes, 2 ml of medium was added to a tube of dry lipid. The tube was then incubated at 37°C for 30 minutes. This was followed by gentle vortexing to form liposomes. The 2ml of suspended liposome media was then dialysed against 1 litre of

M9 buffer. This ensured that the only nutrient source was contained within liposomes and not surrounding medium.

Life Stage Scoring

Each worm image captured was scored for life stage. A combination of factors were taken into consideration to determine life stage. These included sign of larval moults, development of morphological features such as gonads and vulva or appearance of eggs/offspring. 25 worms were scored per treatment and the life stage that represented the majority (>50%) of animals was reported. For reproductive assays days taken for an L1 to develop into an adult and lay its first egg was counted. Results are presented in Appendix F.

116

Statistical Analysis

Statistical analysis was performed on all dietary conditions with results presented in

Appendix G. Multivariate analysis was conducted using SPSS (IBM) software, with dietary condition as the fixed factor and mean lengths and growth rates at respective time intervals selected as dependent variables.

Results and Discussion

The dependence of milk supplementation in CeHR medium was a useful opportunity to explore the fundamental requirements of C. elegans feeding. It was hypothesized that milk’s function would be due to a single or combination of the following possibilities: 1. Ultra-Heat

Treated (UHT) skim milk may provide a source of bacterial contamination. 2. UHT skim milk may be a source of an otherwise excluded, but essential nutrient; or 3. UHT skim milk may provide a particulate, nutrient delivery vessel of media inside the worm. The hypothesis that milk provided an otherwise excluded, but essential nutrient to the medium was investigated by analysis of modified versions of CeHR medium. Initially, this involved separating suspended particulate matter from low fat, UHT milk by centrifugation and resuspending particulate matter in M9 buffer. This resuspended particulate matter was fed as a food source or used to supplement CeHR instead of whole milk.

117

Figure 5.1. Effect of milk separation on growth rate: Growth rate (length μm) of C. elegans measured at 24-hour intervals, whilst exposed to various dietary conditions. SD expressed as error bars. n=25 per treatment group, growth in S- Medium containing OP50 E. coli (9x 108 and 4.5 x 109 colonies per ml) included as positive control.

All conditions where milk particulate matter was present developed C. elegans to adulthood, including when only milk particulate matter was available to nematodes (Figure 5.1). CeHR supplemented with either milk, or milk particulate matter had the fastest growth rate

(Appendix G). Conditions where either milk or milk particulate matter was added to CeHR and not processed further were significantly different in total growth between 24 and 120 hours from all other related conditions (Appendix G). However, adding the milk pellet only was not significantly different to including skim milk without further processing. This suggests that the isolated particulate material performs a comparable function to whole milk.

This growth rate could be arrested by exposure to medium filtered at 0.22μm. Nematodes cultured in CeHR without any milk-based supplementation also entered L1 arrest, which is a life stage that is directly linked to nutrient availability (Baugh 2013). Both of these conditions

118 contain an abundance of nutrients, however were not significantly different in total growth from the M9 buffer control which was used as a negative control due to its lack of nutrient

(Table G). This suggests a lack of nutrient delivery may be the cause of the L1 arrest. These results demonstrate that the nematode requires a component within the UHT skim milk and/or milk particulate matter. This component may have a function to assist the worms to access the nutrients within CeHR growth medium such as particulate matter, or may be a particulate food source such as would be introduced by bacterial contamination.

The finding that feeding 0.22 μm filtered CeHR medium was capable of arresting growth at

L1 lifestage narrowed the search for essential components in the medium to those blocked by filters of this pore size (Table S1). Filtration at this pore size is routinely used to remove bacteria. One hypothesise was that UHT skim milk could cease to initiate worm development after filtration due to bacterial cell removal. The protocol states milk should be UHT; a process designed to kill all bacterial cells. However, it was unclear whether dead cells remained in the milk. Dead E.coli are acknowledged to initiate worm development, whilst reflecting a mild dietary restriction in comparison to live E. coli media (Greer and Brunet

2009).

Culturing of organisms found in milk only detects viable microorganisms but does not account for non-viable bacterial cells potentially acting as a nutrition source. Molecular techniques are a useful measure of intact bacterial cell, both live and dead by including milk in the medium. By detecting residual bacterial DNA in the milk an assessment of whether bacterial cells maybe be present as a food source. A limitation to using a molecular approach is that only nucleic acids are being detected and no information regarding if they are still contained within a cell is provided.

119

Regardless, an attempt was made to extract genomic DNA and amplify 155 the intergenic spacer region between the 16S and 23S rRNA genes by PCR as a qualitative analysis for bacterial presence in the sample. However, bacterial DNA failed to amplify from the milk samples in PCR and no bands were observed when the PCR product was run on 2% agarose.

To confirm this observation, qPCR was used to detect 16S rRNA copy number in the milk samples. Very low copy numbers were detected in the milk samples across all three biological replicates, the highest being 52.9 +/- 9.7% copies per mg of milk pellet (Table 5.1,

Figure 5.2). In addition, CeHR medium was streaked onto NGM agar and incubated for 48 hours at 37 °C without any bacterial growth observed.

Table 5.1. qPCR results for UHT milk samples

% of

original mg Mean of mean WEIGHT 100ul sample copy # per Sample starting copy # per std error (mg) used in in mg qty mg qPCR qPCR

reaction

Milk1 43.49268 300.0 0.04 12 3.62439 3.963829 0.4179648

Milk1 57.54138 300.0 0.04 12 4.7951146

Milk1 41.66379 300.0 0.04 12 3.4719824

Milk2 147.33938 340.0 0.04 13.6 10.833778 12.57818 1.4954029

Milk2 211.53851 340.0 0.04 13.6 15.554302

Milk2 154.31186 340.0 0.04 13.6 11.34646

Milk3 815.52187 370.0 0.04 14.8 55.102829 52.901549 5.1461264

Milk3 895.51858 370.0 0.04 14.8 60.508012

120

Milk3 637.78835 370.0 0.04 14.8 43.093808

Mean copy no. per mg sample mg per no. copy Mean 10

0 MK1 MK2 MK3 Samples

Figure 5.2 Mean bacterial copy numbers in UHT samples detected by qPCR.

From these results, it is reasonable to conclude that microorganisms are not acting as a major growth component of the UHT milk supplemented CeHR medium. The milk is unlikely to induce worm development due to bacterial contamination, as the presence of bacterial DNA does not guarantee that intact and edible bacterial cells are present. In the unlikely event that bacterial cells have survived the ultra-heat treatment process, the low copy number values detected indicates that there would not be sufficient cells present to rival the developmental performance of worms grown in a lawn of live OP50 bacteria.

The C. elegans dependence on particulate matter present on milk raised a question whether this was due to a nutritional or physical factor. Casein micelles were a useful target for this analysis as they are present in milk and could provide a protein source and/or a physical transport vessel for nutrients (Cheng, Lu et al. 1979, Enright, Bland et al. 1999, Brans,

Schroën et al. 2004). Casein micelles share a very similar range of sizes and morphology to bacteria, in addition to parallel behaviours such as aggregation (Enright, Bland et al. 1999).

121

To test whether the casein micelles were initiating worm development due to their inherent nutritional properties or by introducing particulate matter to the media, the milk pellet fraction was solubilised using 8 M urea. This maintained the nutritional composition of the pellet, whilst bringing all components into solution and removing particulate matter from the media.

Figure 5.3. Effect of particulate matter on development:

Solubilization of particulate fraction in milk arrests C. Elegans growth. Growth rate (length

μm) of C. elegans measured at 24 hour intervals, whilst exposed to CeHR media with added milk particulate matter that has either been solubilised with high concentration urea (8 M) and then diluted to 46 mM (solubilised media) or 46 mM urea added to CHR media + milk

122 pellet, leaving milk pellet particles present (control media). SD expressed as error bars. n=25 per treatment group, growth in S- Medium containing OP50 E. coli (9x 108 and 4.5 x 109 colonies per ml) included as positive control

The solubilisation treatment was shown to result in L1 arrest, as growth did not occur beyond the initial length of ~200 μm (Figure 5.3). The solubilized treatments total growth over the experiment was not significantly different from the M9 buffer negative control (Appndix G).

The control group containing equivalent urea quantities, but also particulate matter progressed through all life stages to adulthood. The removal of particulate matter is therefore the likely arrested development cause. Past studies in the related nematode Caenorhabditis briggsae have reported the requirement for growth factors to be in a precipitated form to function

(Vanfleteren 1974). These results provide evidence that it is the physical presence of particulate matter from milk, rather than a specific nutrient growth factor that is essential to

C. elegans growth in CeHR medium.

Axenic media options that do not require milk supplementation are available to C. elegans, such as Caenorhabditis elegans Maintenance Medium (CeMM) (Szewczyk, Kozak et al.

2003) and Axenic Medium (AXM) (Lenaerts, Walker et al. 2008) preparations. It was important to determine what effect if any particulate matter has in these media. AXM and

CeMM was analysed for developmental performance of worms fed with medium, which had been subjected to 0.22 μm filtration. The protocol for CeMM includes a final step 0.22μm filtration, however stipulates to do so at 30°C and with an hour of stirring (Szewczyk, Kozak et al. 2003). We hypothesized that this protocol of heating and stirring may help particles to dissolve into solution and pass through the filter, before returning to their precipitated

123 particulate form during the cooling process. To confirm our hypothesis, we followed the standard protocol, but filtered the medium an extra time immediately prior to use without heating and stirring. Both AXM and CeMM media using an unmodified protocol initiated normal worm development (Figure 5.4.).

Figure 5.4 Effect of filtration of AXM and CeMM media on C. elegans growth rate.

124

Growth rate (length μm) of C. elegans 604 measured at 24-hour intervals, whilst exposed to

AXM media, CeMM media, AXM media filtered or CeMM filtered. SD expressed as error bars. n=25 per treatment group, Growth in S- Medium containing OP50 E. coli (9 x 108 and

4.5 x 109 colonies per ml) included as positive controls in both figures.

However, filtering immediately before use reduced growth rate of worms fed both media types. Total growth between 24 hours and 120 hours was significantly less in both filtered conditions (Appendix G). Using these filtered conditions worms could be seen to be at L1 arrest or dauer life stages after 120 hours for AXM and L2 for CeMM (Appendix F).

To assess whether particles were present in all media and whether this could be correlated with worm development, Fluorescence activated flow cytometry (FACS) analysis for small particle detection. FACS analysis detected 8.5 x 106, 6 x 107 and 8 x 107 particles per ml of

CeHR, CeMM and AXM media respectively (Table 5.2).

The number of bacteria ingested by N2 wild type C. elegans, in lifestage L1-L4 has been estimated to be close to 105 per worm, per day (Gomez-Amaro, Valentine et al. 2015). All axenic media preparations contain enough particles to support the normal nematode feeding behaviour, if they recognize all particles as food. Media filtration reduced the particle number to near zero levels. CeMM filtered medium showed particle number increase following incubation, indicating that this medium is prone to precipitation of components over time.

Particles in media filtered at 0.22μm were detected at sizes closest to the 0.05μm bead standards (Figure 5.5 B, D, E, G, H). The small size and number of particles across these filtered treatments correlates with poor growth performance in C. elegans in these conditions

(Figure 5.1 & 5.3). This lack of growth indicates that smaller particles are not recognized as food and ejected with liquid (Fang-Yen, Avery et al. 2009, Kiyama, Miyahara et al. 2012).

125

Both CeMM and AXM showed a wider distribution of particle size than CeHR, with particles detected across the range of bead size standards. CeHR, CeMM and AXM all contain particles in high concentrations and of a size that C. elegans are demonstrated to uptake

(Avery 1993, Avery and Shtonda 2003, Fang-Yen, Avery et al. 2009, Avery and You 2012,

Kiyama, Miyahara et al. 2012).

Table 5.2. Number of particles detected in tested media per ml.

126

Figure 5.5. FACS detection of particles in various media conditions. i. Distribution of different particle sizes. Key: Purple indicates 1 μm, Green indicates 0.5 μm, Blue indicates

0.05 μm and Red indicates sample. A= CeHR, B=CeHR Filtered, C=CeMM, D=CeMM filtered, E=CeMM Filtered and incubated at 20°C, F=AXM, G= AXM Filtered, H=AXM

Filtered and incubated at 20°C. I= Liposomes packed with CeHR. J= Liposomes packed with

M9 buffer

127

These results indicate that worms require particles for successful nutrient uptake in axenic media. However, it is unclear what exact nutrients accompany these particles. With these results demonstrating the importance of particulate matter in C. elegans feeding it became apparent that a medium with defined particulate matter would be a useful development to the field. This led to the development of a protocol for the medium to be packaged inside artificial liposome nanoparticles.

The relatively non-discriminatory particle ingestion by C. elegans between the sizes 0.1 μm to 3 μm, especially when no other food source is offered was a useful behavioural observation that was used to design the nanoparticles (Avery and You 2012, Kiyama,

Miyahara et al. 2012). The liposomes prepared, whilst not being uniform in size were detected to have 3.2 x 108 particles per ml in this size range (Figure 3). In addition, the lipid bi-layer present in liposomes was selected to mimic the phospholipid bi-layer present in the plasma membrane of bacteria. An added advantage of this methodology is that the C. elegan’s environment can be composed of M9 buffer following dialysis of the liposome suspension. Previous axenic medium protocols required the worm to bathe in the same medium that they use for food, adding complication to maintainance of pH, osmolarity and preventing contamination. Growth of worms fed medium packed liposomes, suspended in

M9 buffer also indicates that the delivery of nutrient via the liposome is effective. This is because the outside environment of the liposome does not contain nutrient. This is an important consideration for any trial testing the bioactivity of compounds, as growth in this model indicates the compound of interest has also been delivered inside the animal.

Liposomes have been previously administered to C. elegans to deliver compounds for longevity testing, 247 but to our knowledge, this is the first protocol to successfully use them

128 as a food delivery method in the absence of bacteria (Shibamura, Ikeda et al. 2009). Worms exposed to liposomes containing CeHR (without milk supplementation) and suspended in M9 buffer produced significantly longer worms than E.coli treatments with bacterial concentrations of equivalent particle numbers and almost an order of magnitude greater

(Figure 5.6; Appendix G).

Figure 5.6. Growth rate (length μm) of C. elegans measured at 24 hours whilst exposed to various media conditions. CeHR, AXM and CeMM media were both filtered following the same protocol as used in Figure 5.1 and 5.4. However, each medium was then packed inside liposomes and suspended in M9 buffer. CeHR medium with milk and cholesterol removed were also packed within liposomes and suspended in M9 buffer. M9 Buffer or

CeHR without liposomes were included as negative controls. n=25 per treatment group,

Standard deviation presented as error bars. Growth in S-medium containing OP50 E. coli (9 x

129

108and 4.5 x 109 colonies per ml) in addition to CeHR prepared according to standard protocols included as positive controls.

E.coli treatments containing equivalent particle numbers returned significantly higher growth rates between 24 and 48 hours, however between the next interval of 48 and 72 hours growth rate was greater for liposomes containing liposomes (Appendix G). This growth rate recovery in the second interval was observed in all CeHR conditions that led to development. It is unclear why this recovery occurs and then exceeds total length. The need for acclimatization to axenic media has been described previously, with faster growth speeds approached in future generations cultured axenically (Samuel, Sinclair et al. 2014). One possible explanation for the longer worms is the differences in nutrient content between these dietary conditions. Differences in one macronutrient such as carbohydrate has been observed to affect worm length (Brooks, Liang et al. 2009, So, Miyahara et al. 2011). These previous studies exploring the effect of nutrition on worm size analysed the differences in nutrient between bacterial strains, whereas this investigation compares vastly different dietary profiles. Any discrepancies between the axenic diets and OP50 could reasonably result in significant growth rate differences. Liposomes now provide a tool to investigate the effect of various nutrients on growth rate, with greater control over nutrient delivery. However, until more is understood about the relationship of specific nutrients to body shape, total growth rate should not be taken in isolation as an indicator of preferable nutrition. However, the ability to initiate development using a medium that would otherwise result in L1 arrest such as CeHR without milk added is a significant finding. Worms fed liposome packed with M9 demonstrated L1 arrest, which suggests liposomes are not initiating development beyond acting as a mode of delivery (Appendix F & Appendix G).

130

Whilst the removal of particulate matter appeared to have a direct effect on worm development, it was still possible that an essential nutrient could be removed alongside the particulate matter. The evidence presented in Figure 5.3. suggests that the same nutrient, in a solubilized, rather than particulate form does not support development. However, this experimental design requires the inclusion of urea. The final concentration of urea in the

CeHR media used in the urea experiment was calculated as 46 mM. Whilst this concentration is well below that which C. elegans are reported to tolerate (up to 600 mM) (Estaban and

Choe 2014), the collateral effects urea may have on the other nutrients included in the medium is unknown. However, our novel liposome nutrient delivery method was a useful tool to assess whether the removal of particulate matter was responsible for the arrested development rather than the removal of an essential nutrient. The main advantage of this method was to exclude a potentially harmful variable such as urea. Filtration at 0.22μm of

AXM and CeMM medium at room temperature was shown to arrest or result in stunted development in Figure 5.4. These filtered media were then packaged within the liposome nanoparticle in an attempt to rescue development. The packaging of filtered CeMM medium in liposome increased growth rate significantly for the first 3 growth intervals compared to

CeMM prepared using the usual protocols and significantly increased on the CeMM filtered medium at all growth intervals (Figure 5.6; Appendix G). Filtered AXM, repackaged in liposomes increased growth speed significantly to both the usual protocol for AXM preparation and when filtered immediately prior to use (Figure 5.6; Appendix G). In addition, both medium achieved higher average length after 120 hours compared with any other treatments in this study, however this was only a significant difference for CeMM liposomes

(Appendix G). This is further evidence that liposome based nutrient delivery is more effective than the uncontrolled and unmonitored presence of particulate matter used previously in axenic medium. In addition, if an essential nutrient had been removed by filtration, this

131 developmental rescue and performance would not be possible unless the liposome’s chemical structure reintroduced that nutrient.

To assess the possibility that the liposome reintroduced an essential nutrient CeHR medium was prepared with an essential component missing and the developmental consequences were observed. Sterol is a lipid understood to be an essential nutrient for many nematodes include

C. elegans (Lu, Newton et al. 1977). In CeHR cholesterol serves as a defined source of lipids and was therefore a useful candidate for exclusion. As liposomes are a lipid-based structure themselves, it was conceivable that the liposomes could mimic the nutrient function of cholesterol. In addition, sterol is added after filtration in standard CeHR preparation protocol.

The protocol does not state the reason all components of CeHR medium are filtered at 0.22

μm except for cholesterol and milk. It could be hypothesized that filtration of the medium may remove cholesterol. Therefore, it is important to assess whether liposomes are mimicking the action of cholesterol in the liposome model. However, as demonstrated in

Figure 5.6, Appendix F and Appendix G the removal of cholesterol from the medium led to developmental arrest at L1 life stage and was not significantly different to worms cultured in the M9 buffer negative control. This demonstrates that liposomes in this context cannot perform the nutrient role of sterol but have the primary function of nutrient delivery. In addition, this demonstrates the potential applications of liposome delivered nutrients in furthering the understanding of the nutrient requirements of C. elegans.

The liposome-based nanoparticle food reported in this chapter allows researchers to use the powerful animal model C. elegans to further our understanding of nutrient-gene interactions by precise control of nutrients provided to the worm. In addition, drugs and supplements may also be packed into liposomes alongside the food source for pharmacological and toxicology

(LD50) studies. These results also call for a reassessment of past findings using a liquid based

132 diet, as these results indicate that a particle dependent mechanism has mediated the function of these media. This novel media is the ideal model to test for the bioactivity of bushfoods to improve health and longevity.

Chapter 6. Use of a novel C. elegans model to assess bioactivity of Solanum chippendalei.

Introduction

The novel liposome culturing system described in chapter 5 is the ideal methodology to investigate the role of the full spectrum of compounds found in food in the development of chronic disease. Historically, nutrition research has focused on the acute effect of a nutrients deficiency or surplus. The experimental design would usually be based upon the omission, reduction or over-supply of a nutrient and the consequences of this diet measured. This has been extremely useful for understanding the nutrient requirements of essential nutrients such as vitamins, amino acids etc. The short time required for a deficiency in these nutrients to be observable or cause disease makes research in any organism including humans relatively simple. However, no evidence of an equivalent acute response to a deficiency of antioxidants or similar compounds has been reported. Chronic diseases such as type- 2 diabetes, certain cancers and cardiovascular diseases typically develop over a lifetime and become particularily symptomatic later in life. Observation of a potentially protective component would therefore need to also over the duration of a lifetime. The lifespan of humans and even mice makes this process of observation extremely expensive for mice studies and practically impossible for human studies. Therefore, the short life span of C. elegans is an ideal model for this purpose.

Then liposome culturing system is contributes several advantages over traditional culturing methods for the study of food extracts. The removal of a second organism from the system is

133 particularly useful. Because the bacterial food source is usually metabolically active it is difficult to determine if an extract reaches the worm without being metabolised into a different compound (García-González, Ritter et al. 2017). This can be overcome with other axenic medium protocols or by killing the bacteria. However, these other methods do not guarantee that the extract has been ingested by the worms as the treatment is usually delivered in the liquid surrounding the food. This liquid is actively ejected by the worm to ingest particles and therefore the treatment may also be ejected with the other liquid particles are suspended in (Avery 1993, Avery and Shtonda 2003, Fang-Yen, Avery et al. 2009, Avery and You 2012). In the liposome culturing system uptake of the treatment can be easily confirmed if the worm is able to develop. If the worm is receiving nutrient in the medium, it will also be receiving the chosen treatment.

The direct control over nutrient composition allows for understanding the differing metabolic responses to compounds in a variety of nutritional environments. The traditional hunter gather lifestyle has been suggested to be characterised of times of high nutrient intake and times of low nutrient intake (Neel 1962). A defined medium allows for accurate modelling of these different states by the dilution or omission of certain nutrients. Bacterial based methods are only able to attempt this via dilution of bacterial food source or using a bacteria unable to produce certain nutrients to mimic these environments (Watson, MacNeil et al. 2014).

In the previous chapter, a range of traditional bushfoods were assessed for antioxidant capacity and a library of compounds for each was developed. Of these 9 bushfoods S. chippendalei was found to have a drastically higher antioxidant capacity than any other foods tested. In addition, compounds of interest metabolically such as arbutin (Hydroquinone

β-D-glucopyranoside) were found to be unique to S. chippendalei across the foods tested.

This provided a clear rationalization for the choice to screen S. chippendalei on the novel liposome screening model for nutrigenomics. The aim of this chapter was therefore to use the

134 developed culturing method to study the action of the identified compounds in S. chippendalei collectively.

Materials and Methods

Plant extract preparation

Plant extracts were prepared using the same protocol as described in chapter 4 of this thesis to ensure that the same compounds identified and assessed for antioxidant capacity would be present in this assay. S. chippendalei samples were split open with a knife and black inedible seeds were removed from inside the fruit. 5 separate S. chippendalei fruits were selected at random and homogenized using a mortar and pestle containing liquid nitrogen.

Approximately ~60 mg of homogenized sample was measured and added to a 2 ml

Eppendorf tube. 1:3:1 (CHCl3 :MeOH: H20) (500 μL) was then added. The sample mixture was vortexed for 30 seconds and then incubated for 15 minutes at 70°C at 150 rpm. The supernatant was then transferred to a new Eppendorf tube. To the original Eppendorf tube

500 μL of 1:3:1 (CHCl3:MeOH:H20) was added, vortexed and then centrifuged a13,000 rpm for 15 minutes. The supernatant was then transferred to the Eppendorf tube already containing the supernatant collected earlier.

C. elegans maintenance conditions and growth rate assay conditions.

Wild-type Bristol N2 (Caenorhabditis Genetics Centre) were used in all experiments. All experiments were conducted at 20 °C and kept away from light to prevent photodegradation of

135 light sensitive components present in media. Prior to trial worms were cultured on standard

NGM media, with a living OP50 E.coli as food source. Synchronised eggs from these colonies were hatched in M9 buffer solution and added to differing media conditions at L1 lifestage. A single worm was randomly selected and added to each well of a 96 well-plate, preloaded with 150 μl of CeHR (no milk) culture media packed in liposomes at either full concentration or at a 1:8 dilution of CeHR. Liposomes also contained S. chippendalei extracts at 0 mg/ml, 2.5mg/ml and 5 mg/ml in both diluted and undiluted dietary conditions. This resulted in 6 separate treatment groups. 25 worms per treatment were measured for length at

24-hour intervals and results presented are averages, with standard deviation. Images were analysed using FIJI (Image J) software with length measurements being derived by the sum- total of a number of segmented lines of known length, down the centre of the worm.

Lifespan assay

N2 wild type strain C. elegans were cultured in 50 ml cell culture flasks (Corning) containing

10ml of CeHR (no milk), packaged in liposomes at a worm density of approximately 1 worm per 10 μl. At L4 lifestage 50 individual worms per treatment (1, 1:8, 1 + 2.5mg/ml S. chippendalei, 1:8 + 2.5mg/ml, 1 + 5 mg/ml S. chippendalei, 1:8 mg/ml S. chippendalei) were transferred into wells of a 96-well plate containing 150 μl of each medium, at a FUDR (5- fluorodeoxyuridine) final concentration per well of 0.12 mM to prevent hatching of eggs produced by the worms. Worms were censored if contamination was detected in their well, or if bag phenotype where progeny can be viewed inside a worm was observed. A secondary plate containing 10 worms per treatment in individual wells was run in parallel. If a worm needed to be censored, one worm from the appropriate treatment was chosen at random to replace the censored worm in the trial. Worms were scored as alive or dead each day and

136 were scored as dead if unresponsive to prodding with pipette tip two days in a row. Each lifespan experiment was performed in triplicate and results pooled to give a final cohort of

150 worms per treatment. Results of these experiments are presented as an average over the

150 worms with standard deviation.

Media preparation

CeHR was prepared following the usual protocol described by Clegg, Lapenotiere et al.

(2002), with the milk component replaced in equal parts by distilled water to ensure concentrations of all other components remained the same. 1:8 dilution of this media was also prepared by diluting 1 part CeHR (no milk) with 8 parts water. To both these dietary conditions 2.5mg/ml and 5 mg/ml of S. chippendalei extract were added to the medium, in addition to a control of 0mg/ml in both the 1 and 1:8 dilution of CeHR (no milk). These media were then packed into liposomes. 1,2-dimyristoyl-sn-glycero-3-phosphocholine

(DMPC) was purchased from Avanti Polar Lipids (Alabaster, AL, USA). Lipids were dissolved in chloroform to form a stock solution and stored at -20°C. Aliquots were then measured at 20°C into glass test tubes and mixed with chloroform toproduce a lipid concentration of 10 μM per tube. The chloroform was evaporated under a gentle stream of nitrogen gas upon continuous vortexing to form a thin film of lipid on the wall of the test tube. These lipid tubes were then dried overnight. To encapsulate the media in liposomes, 2 ml of medium was added to a tube of dry lipid. The tube was then incubated at 37°C for 30 minutes. This was followed by gentle vortexing to form liposomes. The 2ml of suspended liposome media was then dialysed against 1 litre of M9 buffer. This ensured that the only nutrient source was contained within liposomes and not surrounding medium.

137

Pumping rate

Worms were observed with a Nikon Stereomicroscope (Nikon) at 40x magnification.

Number of pumps was counted over a 10 second interval for 10 adult worms in each treatment. A “pump’ was defined as a complete cycle of contraction and relaxation of the corpus and terminal bulb. These values were multiplied by 6 to estimate number of pumps per minute. Process was repeated every 2 hours over a 12-hour time period. Values were then averaged, with standard deviation.

Statistical Analysis

Statistical analysis was performed on all dietary and extract conditions for growth rate, life span and pumping rates. Multivariate analysis was conducted using SPSS (IBM) software, with dietary condition as the fixed factor and mean lengths for growth rate analysis, days lived for lifespan analysis and pumps per minute for pumping rate analysis at respective time intervals selected as dependent variables.

Results and Discussion

C. elegans growth rate

Growth rates of worms fed a with the complete medium and S. chippendalei extract were significantly increased at 5 mg/ml compared to both 0mg/ml and 2.5 mg/ml (Table 6.1).

However, by 48 hours both 0mg/ml and 2.5 mg/ml conditions in the complete liposome medium had caught up and were not significantly different. From this time point, onwards both conditions containing S. chippendalei were significantly smaller than the 0 mg/ml condition. All worms fed the complete concentration of medium growth began to plateau at

138

72 hours as maximal length was approached. At 72 hours, eggs could be seen to be forming and some L1 larvae had hatched at 96 hours

The effect of differing diets was significant at each time point measured (Table 6.1). Worms exposed to a 1:8 diet, irrespective of S. chippendalei concentration grew much slower than worms fed full concentration CeHR. This is an indication that dietary restriction may be occurring. However, this cannot be definitively classified as dietary restriction, as all components are diluted by the same amount. Therefore, the altered the development rate may be due to a single essential nutrient falling below required concentrations, rather than a restriction in calorie intake. However, this is an issue with all current methods for studying dietary restriction in C. elegans, as all methods rely on generalised dilution of food or equally general restriction of food uptake. The liposome medium described in this thesis offers a novel opportunity to restrict a specific nutrient or component. However, this work is beyond the scope of this thesis, but will be an important step to understanding nematode nutritional requirements. Worms in 1:8 dietary conditions did not reach sexual maturity during the 96- hour observation period of this experiment, which is further evidence that slowed development is due to dietary restriction. The effect of the extract on the worms under these diluted conditions was not significant at any concentration or time point measured.

However, the action of the extract did appear separate to the effect of dietary restriction on the worm. The effect of the treatment in addition to the diet was also highly significant at each time point measured (Table 6.1).

139

Table 6.1: Mean length of C. elegans exposed to a variety of dietary conditions and

concentrations of S. chippendalei extracts. (Complete= Full CeHR medium, Diluted= 1:8

dilution of nutrient medium prior to packing into liposomes, extract concentration expressed

as mg/ml) T= Treatment, D= Diet, SEM= Standard Error of Means).

0 mg/ml 0 2.5 2.5 5mg/ml 5mg/ml SEM Extract Diet T x Complete mg/ml mg/ml mg/ml Complete Diluted p value p D p (1) Diluted Complete Diluted (1) (1:8) value value (1:8) (1) (1:8)

24 256.38 259.360 260.075 253.938 284.821 240.168 3.044 0.153 0.00 0.000 hours

48 385.458 337.104 421.631 317.766 406.152 303.353 8.657 .227 0.00 0.002 hours

72 802.292 423.905 697.587 494.299 712.133 470.914 15.202 .328 0.00 0.000 hours

96 979.343 632.613 833.377 620.102 812.790 602.369 14.845 .000 0.00 0.000 hours

140

C. elegans lifespan

1 0 0

1 1 :8 1 + 2 .5 m g

1 :8 + 2 .5 m g

a v

i 1 + 5 m g

v r

u 5 0 1 :8 + 5 m g

e P

0 0 2 0 4 0 6 0 D a y s

141

Figure 6.1 Lifespan at varying concentrations of nutrient and S. chippendalei extract.

Mean lifespan of C. elegans at full concentration of nutrient media was 16.42 ± 6.48, with a max of 33 (Figure 6.1). This was significantly different (p<0.05) compared with all other experimental conditions. This is a similar value to previous values reported for studies using live bacteria (Wilson, Shukitt‐Hale et al. 2006). However, these methods are very different and comparisons should predominately within a methodology type. A 1:8 dilution of this media extended lifespan to 23.41 ± 9.95. This in conjunction with the slowed growth rate is further evidence that this medium induces dietary restriction. A more detailed analysis of the dietary restrictive state, using analysis of fat content, gene expression and reproductive behaviour, similar to the methods of Szewczyk, Udranszky et al. (2006) in the related medium CeMM would provide useful information to the underlying performance of this culturing system. The underlying aim of this study was to understand the extent of biological activity of S. chippendalei, not to develop a greater understanding of dietary restriction pathways. Therefore, a comparative state of greater dietary restriction should be sufficient to make preliminary observations for this purpose.

All treatments with S. chippendalei extract added were observed to extend lifespan. The largest increase to lifespan was observed in 1:8 nutrient medium dilution with the highest concentration of extract (5mg/ml), with a mean lifespan of 29.42 ± 10.90 (Figure 6.1, Table

6.2) and maximum lifespan of 54 days. Full concentration of nutrient medium with 5 mg/ml

S. chippendalei had a similar extension to 1:8 dilution of nutrient medium at both 0 mg/ml and 2.5 mg/ml. The extension with S. chippendalei beyond what was achieved with by dilution of nutrient alone suggest that S. chippendalei extends lifespan independently of dietary restriction. This result of lifespan extension in both an environment of relatively high and low nutrition requires further understanding of the underlying mechanisms that may causing this extension.

142

One potential mechanism for this lifespan extension is the high antioxidant scavenging of S. chippendalei measured in chapter three of this thesis. Antioxidants have had mixed results for extending lifespan in C. elegans between and within a number of studies depending on the antioxidant used (Harrington and Harley 1988, Adachi and Ishii 2000, Ishii, Senoo-Matsuda et al. 2004, Wilson, Shukitt‐Hale et al. 2006, Schulz, Zarse et al. 2007). These studies were all performed with a bacterial food source, which makes comparison difficult, as this chapter reports the first lifespan values for the liposome based medium. The new liposome method provides an opportunity to reassess the conflicting findings of these studies, in the absence of metabolically active bacteria and with the ability to alter the concentration of individual nutrients.

Many of the previous studies used a single antioxidant compound rather than assessing the function of a food in its entirety (Harrington and Harley 1988, Adachi and Ishii 2000, Ishii,

Senoo-Matsuda et al. 2004, Schulz, Zarse et al. 2007). This suggests that the specific antioxidant compound may have an effect on the lifespan increase or decrease. Alternatively, the biological action of the food may be influenced by the complex interactions of all compounds present in the diet rather than a single compound of interest in isolation. Further studies targeting the resistance to oxidative stress following treatment with S. chippendalei extract would assist with understanding how this extract functions in the oxidant defence.

An alternate hypothesis is that the lifespan extension may be due to the action of specific compounds beyond their antioxidant capacity. Compounds that were unique to S. chippendalei compared to the other bushfoods would be useful targets to assess. One compound of interest that was detected in S. chippendalei would be arbutin. As already discussed this compound does act as an antioxidant, but has also been observed to have a significant impact on energy metabolism (Yousefi, Mahjoub et al. 2013, Khadir, Pouramir et al. 2015). Schulz, Zarse et al. (2007) reported a reduction of glucose metabolism by the

143 addition of 2-deoxy-D-glucose lead to an increase in lifespan. Compounds such as arbutin have been shown to affect glucose metabolism and therefore could be extending lifespan through similar pathways. Glucose is the major energy source in this medium and therefore this would be a plausible hypothesis for extension. These findings are extremely relevant to the issue of diabetes globally, but specifically in the context of Indigenous health. Similar to what was observed by Schulz, Zarse et al. (2007) where increased levels of metabolized glucose lead to a shorter lifespan, a similar phenomenon is observed in humans suffering from metabolic diseases such as type 2 diabetes. A lack of properly controlled glucose metabolism is a driving mechanism behind the current metabolic disease pandemic. Previous work on Australian bushfoods have reported that these foods are metabolised differently to

Western foods due to their low glycaemic index (Thorburn, Brand et al. 1987a). In addition to these results, this thesis reports the detection of a variety of compounds, including arbutin that have been observed to alter glucose metabolism, independent of glycaemic index.

Arbutin has recently been shown to extend lifespan by the greatest increment at a concentration of 5mM (Zhou, Fu et al. 2017). However, Zhou, Fu et al. (2017) did find that arbutin had an antibacterial effect on the OP50 E.coli used for food. Their solution for this was to feed the worms excess bacteria. Liposomes loaded with nutrients and the treatment would have been a preferable solution to this issue. However, the extension observed in this experiment in the absence of a bacterial food source, is preliminary evidence that the arbutin lifespan extension may not be related to its antibacterial effect. The authors concluded that the likely mechanism of lifespan extension of arbutin was the daf-16 pathway. Therefore, this would be a logical pathway to target when continuing research to understand potential mechanisms driving the lifespan extension following treatment with S. chippendalei extract.

It would be interesting to see how arbutin compound performed in a high glucose environment, compared to a low glucose environment, similar to the experiments of (Schulz,

144

Zarse et al. 2007). The 1:8 dilution conditions does represent a lower glucose environment, however it is a dilution of all nutrients to the same degree, not just glucose.

Table 6.2 Mean, Median and Max lifespan for S. chippendalei extract. Superscripts indicate significant difference (p< 0.05) to the conditions coded in first row of the table. Error is described as Standard Deviation (±).

1 + 2.5 1:8 + 2.5 1 + 5 1:8 + 5 1(a) 1:8(b) mg/ml(c) mg/ml(d) mg/ml (e) mg/ml (f)

Mean 16.42 ± 23.41 ± 18.7 ± 24.43 ± 24.52 ± 29.42 ±

Lifespan 6.48bcdef 9.95acef 7.64abdef 10.22acef 8 .96abdcf 10.90abcde

Median 15 22 17 23.5 24 30

Max 33 46 39 49 48 54

C. elegans feeding behaviour

Pumping rates were most significantly affected by dietary conditions (Figure 6.2). All 1:8 dilutions of the nutrient media were significantly higher (p< 0.05) to the media with a full concentration. This indicates that the lifespan extension was not due to a reduction in feeding behaviour, leading to dietary restriction. These increased pumping rates in the lower concentrations of nutrients are consistent with other studies were access to bacterial food is restricted and pumping rates remain significantly higher (Lee, Wilson et al. 2006). This indicates that the 1:8 dilutions are in a dietary restricted or deprived state. However, it is unclear whether this indicates that all nutrients are below required levels or whether certain essential nutrients are lacking. There was no significant difference in pumping rates because of treatment with S. chippendalei extract (Figure 6.2).

145

2 5 0 e

t b 2 0 0 u b

n b

i m

1 5 0 a r a

e a

s 1 0 0

m u

P 5 0

0 g g g g g g m m m m m m 0 0 5 5 5 . .5 + + + + 2 2 1 :8 1 :8 + + 1 1 1 :8 1

Figure 6.2: Pumping rate across 6 different dietary and treatment conditions. Expressed as average pumps per minute, expressed with standard deviation shown as error bars. Columns with matching lowercase letters (a, b) do not differ significantly (p <0.05).

This chapter demonstrates that the new model of screening compounds and foods has a broad application for understanding biological function. Further work is required in order to optimise this medium. A detailed understanding of the nutrient requirements of C. elegans still requires further work. Whilst chemically defined media have been available for altering the nutrient composition of the medium, the understanding of the requirement for particulate

146 matter has not been described previously. Whilst the lifespan extension result is interesting when compared to the same kind of media type, it is unclear how the nutrient composition is altering the metabolism of the worm. If an alteration to metabolism is occurring, beyond the action of the extract this will affect the interpretation of the results presented in this thesis.

Further work is required to determine the optimal density of liposomes in the medium for this methodology to become as popular bacterial based models. The liposome protocol used is limited in the ability to produce large batches of liposomes at different densities and therefore further development of these techniques is required. The current methodology has been sufficient for the initial proof of concept of this new culturing technique. The liposome field is continuing to grow and advance due to the useful applications they have in drug delivery. This will provide an avenue to continue to advance this methodology with improved liposome protocols. The results in this chapter have demonstrated that liposome based culturing of C. elegans can be an effective tool to explore the lifespan and effects of differing dietary and treatment conditions. Only results using wild-type C. elegans are reported in this thesis chapter. Now that the culturing system is demonstrated to produce meaningful results, future work will now be possible to screen a range of biological compounds, against a range of genotypic traits, in infinite nutritional contexts. The chemically defined particles will make it very easy for a variety of C. elegans strains to be used to assess the link between genes and nutrition environment. The work of Busfield, Duffy et al. (2002) identified broad genetic loci that may be responsible for the increased susceptibility of Indigenous Australians to diabetes.

These loci provide a library of genes to which C. elegans homologues can be found and altered to explore the action of these genotypes in a variety of nutritional environments. The methodology described in this thesis is a useful tool to synthesise the environments required to continued advancement in this area.

147

Chapter 7: General Discussion

The review of the literature identified key areas that required further investigation. This thesis has produced new data using methods spanning a wide range of scientific disciplines that significantly increase the knowledge in each of these key areas. This chapter will summarise the major findings of each chapter and suggest opportunities for continued research.

Chapter 2 analysed a number of bush coconut galls collected from Kiwirrkurra by Dr Alan

Yen. The major advancement described in this chapter is a data set containing information on energy and protein content of this traditional bushfood, with consideration for precise taxonomic classification of the plant and insect species and separation of the edible components of the food. This data is useful for understanding the nutrient contribution of this food as it is eaten. This data does not provide much insight into the role this food may have in the development or prevention of metabolic disease, beyond assisting with a more accurate estimation of energy and protein intake of people consuming bush coconut. Bush coconut consumption whilst being a standard practice in communities such as Kiwirrkurra is not possible in more urbanised communities and therefore has limited application. However, this work was important in making the following chapters possible by building stronger relationships with the Kiwirrkurra community. This relationship was essential for the successful identification, collection and analysis of a range of bushfoods from the

Kiwirrkurra area.

Bush coconut is an interesting food source for the Kiwirrkurra community and further research to continue to improve understanding about its chemical composition and biological function is warranted. Unfortunately, samples collected on a subsequent trip were unable to be analysed by GC-MS and for antioxidant capacity alongside the other plant and insect specimen due to lack of female insects present inside galls upon opening. This would be

148 valuable information in continuing to understand the rich diversity of biologically active compounds present in the traditional diet of the Kiwirrkurra community.

Chapter 3 of this thesis described the identification and collection of some important traditional bush foods and observations surrounding food behaviours. This data predominantly serves as a detailed methodology description for the following chapters and is not intended as a detailed nutritional survey. A structured nutritional study of the

Kiwirrkurra community including surveys, food journals and overall health indicators such as

BMI and blood glucose tolerance testing would be useful data, but goes beyond the scope of this thesis. This chapter can be used as a sociological resource describing broad community behaviours and attempts to improve overall nutrition such as the general store prohibition of purchase of selected “unhealthy” food items before certain times of the day. Further quantitative study is still required to assess the efficacy of these measures.

Chapter 4 described the antioxidant capacity and metabolite profile for nine important traditional bushfoods that have been used by Indigenous communities such as those inhabiting Kiwirrkurra. These ancient communities have used these plants and insects as staple foods for thousands of years. Therefore, these foods form the foundation of the nutritional environment prior to arrival of western settlers and are ideal targets for study into evolutionary discordance. This data set is also unique as it reports antioxidant capacity for a range of foods used by a single community, rather than a set of commercially available foods used sporadically by a wide variety of communities. This gives a better understanding of the diet diversity across a diet, rather than just within certain plants of interest.

The results of this analysis indicates foods eaten in the traditional Kiwirrkurra diet has a range of antioxidant capacities ranging from low antioxidant or even pro-oxidant foods such as C. bulbosa up to very high antioxidant scavenging foods such as S. chippendalei. These

149 foods also are composed of a complex combination of metabolites that have been implicated in promoting good metabolic health including pinitol and arbutin. These metabolites are also present in foods that are not typical of the hunter-gather diet, however these other sources could easily be omitted from an Aboriginal persons, post-colonial diet. Detailed further study would be required to determine the rate these compounds that are relevant to metabolic health are consumed by Indigenous Australians. In addition, the data presented in this thesis does not report concentration of these compounds, with the exception of the relative semi- quantification of metabolites that were common to all collected bush foods. Now that specific compounds have been identified in various bushfood samples, and some compounds correlated with metabolic health, further analysis quantifying the concentration of these metabolites in the sample would be useful. However, because of the seasonal changes to availability of certain foods this data would need to be treated carefully. For example, a food may have a very low concentration of a specific compound that provides a metabolic benefit at higher concentrations. However, if that food type was particularly abundant and sought after during a specific season, intake of that compound may still reach the required level for metabolic benefit. This would be due to the high intake of that food source. There is such limited information of the amount required or action of some these metabolites in a nutrition context, that translation to biological outcome becomes difficult to predict. Identification of a compound present in a variety of foods is therefore a valuable exercise alone.

The antioxidant capacity and identification of compounds are indicators of potential biological action. However, a methodology to observe biological function is required. As discussed throughout this thesis there are methods already available such as human clinical trials and rodent models. The high cost and time required to perform human or rodent research validates the requirement for a more efficient model for bioactivity screening. C. elegans is a useful model for elucidating mechanisms that may develop disease over a

150 lifetime. The short lifespan of C. elegans, whilst maintaining genetic homology with humans allows for this kind of research. However, issues with how C. elegans are cultured and fed have prohibited nutrition research using these worms to become common practice.

Chapter 5 describes the process of discovering that all previous attempts to culture C. elegans in the absence of bacteria have inadvertently led to worm development due to the presence of uncontrolled particulate matter. This discovery is a significant contribution to the wider C. elegans field as it describes the underlying mechanism driving feeding in these culture conditions. This has important implications for studies using these methods. For example, any treatment that is able to affect the number or composition of these particles may produce a treatment effect independent of the direct action of the compound to the worms biology.

This discovery led to the development of axenic medium with defined particulate matter. This provides an opportunity to study the bioactivity of food extracts without the influence of bacterial metabolism and in a defined nutritional environment. Delivering the nutrient inside of liposome nanoparticles helps to ensure worms ingest the nutrients. The M9 buffer these particles are suspended in also provides an environment that is more difficult for bacteria to thrive in, compared to nutrient media. This M9 buffer does not produce the same pH stresses as the typically acidic medium CeHR. The application of this new culturing system could potentially also be of significant use to fields such as pharmacology and toxicology.

Chapter 6 reported the use of the novel culturing system described in chapter 5 to assess the bioactivity of S. chippendalei. This food extract was chosen because of its high antioxidant capacity and detection of compounds of interest such as arbutin, which were unique within the bush food samples collected. The produced data serves a proof of concept suggesting that liposome based culturing can be applied to understanding long-term effects of the intake of food extracts. The nanoparticle culturing was capable of maintaining C. elegans for a comparable lifespan to that observed on a bacterial diet. The results of this trial indicated that

151

S. chippendalei is able to significantly extend the lifespan of C. elegans. Further targeting of pathways relevant to metabolic syndrome using a variety of genetic strains to understand the underlying mechanism of this lifespan extension. The developmental arrest associated with the removal of cholesterol in chapter 5 and the extension of lifespan observed in chapter 6 with the dilution of nutrient media causing dietary restriction indicates that liposome culturing is a useful model for nutritional studies. This new system of culturing C. elegans has the potential to redefine the nutrient requirements of C. elegans due to the improved understanding of how these worms gain nutrients from an axenic medium. Conversely, this is also a constraint of the methodology used in this study as the nutrient composition of the medium used is based on protocols such as CeHR developed prior to the understanding of the particle requirement for C. elegans. It is possible that the CeHR-based composition of the medium used represents optimal nutrition for the nematodes. However, only now are the tools well suited to answering this question. In addition, the current protocol for liposome preparation prevents liposome densities mirroring normal bacterial cell densities. The liposome field is continuing to advance which will allow the optimisation of the new culturing system to define ideal liposome sizes and densities for worm culturing.

Regardless of the shortcomings of the liposome based culturing system, it is a useful tool to compare the bioactivity of extracts if the same methodology is used for each extract. Whilst

S. chippendalei was selected to be screened in chapter 6, it is still reasonable for other extracts of traditional food sources to be screened using this methodology.

This thesis has increased the depth of knowledge surrounding some of the traditional foods used by the Kiwirrkurra people. Some of these findings will also be applicable to other community groups local to Kiwirrkurra and beyond. Whilst there is a large body of work still required to understand the complex interactions of food in these environments, this thesis has also delivered new tools to help speed up the process. The novel C. elegans liposome model

152 designed to assist in this pursuit requires further optimisation. However, these improvements will allow this model to be adapted for studies beyond fundamental nutrition to other applications that C. elegans are already being used for, such as; neurobiology, pharmacology and toxicology amongst others.

153

References

Acoss (2016). Poverty in Australia. Adachi, H. and N. Ishii (2000). "Effects of tocotrienols on life span and protein carbonylation in Caenorhabditis elegans." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 55(6): B280-B285. Altman, J. (2001). Indigenous Socioeconomic Indicators. C. f. A. E. P. Research. Ames, B. N., R. Cathcart, E. Schwiers and P. Hochstein (1981). "Uric acid provides an antioxidant defense in humans against oxidant-and radical-caused aging and cancer: a hypothesis." Proceedings of the National Academy of Sciences 78(11): 6858-6862. Amigoni, L., M. Stuknytė, C. Ciaramelli, C. Magoni, I. Bruni, I. De Noni, C. Airoldi, M. E. Regonesi and A. Palmioli (2017). "Green coffee extract enhances oxidative stress resistance and delays aging in Caenorhabditis elegans." Journal of Functional Foods 33: 297-306. Aragão, G., L. Carneiro, A. Junior, L. Vieira, P. Bandeira, T. Lemos and G. d. B. Viana (2006). "A possible mechanism for anxiolytic and antidepressant effects of alpha-and beta-amyrin from Protium heptaphyllum (Aubl.) March." Pharmacology Biochemistry and Behavior 85(4): 827-834. Aragao, G. F., M. C. C. Pinheiro, P. N. Bandeira, T. L. G. Lemos and G. S. d. B. Viana (2008). "Analgesic and anti-inflammatory activities of the isomeric mixture of alpha-and beta-amyrin from Protium heptaphyllum (Aubl.) march." Journal of herbal pharmacotherapy 7(2): 31-47. Avery, L. (1993). "Motor neuron M3 controls pharyngeal muscle relaxation timing in Caenorhabditis elegans." Journal of Experimental Biology 175(1): 283-297. Avery, L. and B. B. Shtonda (2003). "Food transport in the C. elegans pharynx." Journal of Experimental Biology 206(14): 2441-2457. Avery, L. and Y. You (2012). C. elegans feeding. WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook. 1.150. 1. Babu, A., V. Pon and D. Liu (2008). "Green tea catechins and cardiovascular health: an update." Current medicinal chemistry 15(18): 1840-1850. Barbosa, L. C., F. F. Barcelos, A. J. Demuner and M. A. Santos (1999). "Investigation-Research: Chemical Constituents from Mucuna aterrima with activity against Meloidogyne incognita and Heterodera glycines." Nematropica 29(1): 81-88. Bates, S. H., R. B. Jones and C. J. Bailey (2000). "Insulin‐like effect of pinitol." British journal of pharmacology 130(8): 1944-1948. Baugh, L. R. (2013). "To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest." Genetics 194(3): 539-555. Belluco, S., C. Losasso, M. Maggioletti, C. C. Alonzi, M. G. Paoletti and A. Ricci (2013). "Edible insects in a food safety and nutritional perspective: a critical review." Comprehensive Reviews in Food Science and Food Safety 12(3): 296-313. Bender, D. A. (2012). Amino acid metabolism, John Wiley & Sons. Bermudez, B., S. Lopez, A. Ortega, L. M Varela, Y. M Pacheco, R. Abia and F. JG Muriana (2011). "Oleic acid in olive oil: from a metabolic framework toward a clinical perspective." Current pharmaceutical design 17(8): 831-843. Bin Salleh, R. (1997). Mayi: some bush fruits of the West Kimberley, Magabala Books, Broome, Australia. Bodenheimer, F. S. (1951). Insects as human food. Insects as Human Food, Springer: 7-38. Bordulk, D., N. Dalak, M. Tukumba, L. Bennett, R. Tingey, M. Katherine, S. Cutfield, M. Pamkal and G. Wightman (2012). "Dalabon plants and animals." Northern Territory Government, Department of Land Resource Management, Palmerston, Australia. Bouic, P., S. Etsebeth, R. Liebenberg, C. Albrecht, K. Pegel and P. Van Jaarsveld (1996). "Beta- sitosterol and beta-sitosterol glucoside stimulate human peripheral blood lymphocyte proliferation: Implications for their use as an immunomodulatory vitamin combination." International journal of immunopharmacology 18(12): 693-700.

154

Brand-Miller, J. C. and S. H. Holt (1998). "Australian Aboriginal plant foods: a consideration of their nutritional composition and health implications." Nutrition Research Reviews 11(1): 5-23. Brand, J., V. Cherikoff, A. Lee and A. S. Truswell (1982). "An outstanding food source of vitamin C." The Lancet 320(8303): 873. Brans, G., C. Schroën, R. Van der Sman and R. Boom (2004). "Membrane fractionation of milk: state of the art and challenges." Journal of Membrane Science 243(1): 263-272. Brimblecombe, J., E. Maypilama, S. Colles, M. Scarlett, J. G. Dhurrkay, J. Ritchie and K. O’Dea (2014). "Factors influencing food choice in an Australian Aboriginal community." Qualitative Health Research 24(3): 387-400. Brittain, H. G. (2001). Malic Acid. Analytical Profiles of Drug Substances and Excipients. H. G. Brittain, Academic Press. 28: 153-195. Brooks, K. K., B. Liang and J. L. Watts (2009). "The influence of bacterial diet on fat storage in C. elegans." PloS one 4(10): e7545. Brown, A., V. Cherikoff and D. Roberts (1987). "Fatty acid composition of seeds from the AustralianAcacia species." Lipids 22(7): 490-494. Brown, M. K., J. L. Evans and Y. Luo (2006). "Beneficial effects of natural antioxidants EGCG and α- lipoic acid on life span and age-dependent behavioral declines in Caenorhabditis elegans." Pharmacology Biochemistry and Behavior 85(3): 620-628. Buettner, G. R. (1993). "The pecking order of free radicals and antioxidants: lipid peroxidation, α- tocopherol, and ascorbate." Archives of biochemistry and biophysics 300(2): 535-543. Builth, H., A. P. Kershaw, C. White, A. Roach, L. Hartney, M. McKenzie, T. Lewis and G. Jacobsen (2008). "Environmental and cultural change on the Mt Eccles lava-flow landscapes of southwest Victoria, Australia." The Holocene 18(3): 413-424. Bukkens, S. (1997). "The nutritional value of edible insects." Ecology of Food and Nutrition 36: 287- 319. Burke, V., Y. Zhao, A. H. Lee, E. Hunter, R. M. Spargo, M. Gracey, R. M. Smith, L. J. Beilin and I. B. Puddey (2007). "Predictors of type 2 diabetes and diabetes-related hospitalisation in an Australian Aboriginal cohort." Diabetes research and clinical practice 78(3): 360-368. Busfield, F., D. L. Duffy, J. B. Kesting, S. M. Walker, P. K. Lovelock, D. Good, H. Tate, D. Watego, M. Marczak and N. Hayman (2002). "A Genomewide search for type 2 diabetes–susceptibility genes in Indigenous Australians." The American Journal of Human Genetics 70(2): 349-357. Campbell, T. G. (1926). "Insect foods of the Aborigines. ." Australian Museum Magazine 2: 407-410. Cane, S. (1987). "Australian aboriginal subsistence in the western desert." Human Ecology 15(4): 391-434. Chaliha, M., D. Williams, H. Smyth and Y. Sultanbawa (2017). "Extraction and characterization of a novel Terminalia pectin." Food Science and Biotechnology: 1-7. Chen, H., M. Zhang and B. Xie (2004). "Quantification of uronic acids in tea polysaccharide conjugates and their antioxidant properties." Journal of agricultural and food chemistry 52(11): 3333-3336. Cheng, A., N. Lu, G. Briggs and E. Stokstad (1979). "Effect of Particulate Materials on Population Growth of the Free-Living Nematode Caenorhabditis briggsae 1 2." Proceedings of the Society for Experimental Biology and Medicine 160(2): 203-207. Chuen, T. L., Q. V. Vuong, S. Hirun, M. C. Bowyer, M. J. Predebon, C. D. Goldsmith, J. A. Sakoff and C. J. Scarlett (2016). "Antioxidant and anti-proliferative properties of Davidson’s plum (Davidsonia pruriens F. Muell) phenolic-enriched extracts as affected by different extraction solvents." Journal of Herbal Medicine 6(4): 187-192. Clegg, E. D., H. F. Lapenotiere, D. Y. French and M. Szilagyi (2002). Use of CeHR axenic medium for exposure and gene expression studies. East Coast Worm Meeting. Cleland, S. J. B. (1966). The ecology of the Aboriginal in South and Central Australia. Coleman N.C. (1972). "Life history of Asceles pomeformes - maker of the bloodwood apple. ." North Queensland Nauralist 39(2-4).

155

Connor, W. E. (2000). "Importance of n− 3 fatty acids in health and disease." The American journal of clinical nutrition 71(1): 171S-175S. Cooper, R. S., C. N. Rotimi, J. S. Kaufman, E. E. Owoaje, H. Fraser, T. Forrester, R. Wilks, L. K. Riste and J. K. Cruickshank (1997). "Prevalence of NIDDM among populations of the African diaspora." Diabetes Care 20(3): 343-348. Cordain, L., S. B. Eaton, A. Sebastian, N. Mann, S. Lindeberg, B. A. Watkins, J. H. O’Keefe and J. Brand- Miller (2005). "Origins and evolution of the Western diet: health implications for the 21st century." The American journal of clinical nutrition 81(2): 341-354. Coulston, A. M., C. B. Hollenbeck, A. L. Swislocki, Y. I. Chen and G. M. Reaven (1987). "Deleterious metabolic effects of high-carbohydrate, sucrose-containing diets in patients with non-insulin- dependent diabetes mellitus." The American journal of medicine 82(2): 213-220. Craig, M. E., G. Femia, V. Broyda, M. Lloyd and N. J. Howard (2007). "Type 2 diabetes in Indigenous and non-Indigenous children and adolescents in New South Wales." Medical Journal of Australia 186(10): 497. Croll, N. A., J. M. Smith and B. M. Zuckerman (1977). "The aging process of the nematode Caenorhabditis elegans in bacterial and axenic culture." Experimental aging research 3(3): 175-189. Cui, T., K. Nakamura, L. Ma, J.-Z. Li and H. Kayahara (2005). "Analyses of arbutin and chlorogenic acid, the major phenolic constituents in oriental pear." Journal of agricultural and food chemistry 53(10): 3882-3887. Davis, A., M. Christiansen, J. F. Horowitz, S. Klein, M. K. Hellerstein and R. E. Ostlund (2000). "Effect of pinitol treatment on insulin action in subjects with insulin resistance." Diabetes care 23(7): 1000- 1005. Decker, E. A. (1995). "The role of phenolics, conjugated linoleic acid, carnosine, and pyrroloquinoline quinone as nonessential dietary antioxidants." Nutrition Reviews 53(3): 49-58. DeFoliart, G., M. Finke and M. Sunde (1982). "Potential value of the Mormon cricket (Orthoptera: Tettigoniidae) harvested as a high-protein feed for poultry." Journal of Economic entomology 75(5): 848-852. DeFoliart, G. R. (1999). "Insects as food: why the western attitude is important." Annual review of entomology 44(1): 21-50. Dehghan, A., M. Van Hoek, E. J. Sijbrands, A. Hofman and J. C. Witteman (2008). "High serum uric acid as a novel risk factor for type 2 diabetes." Diabetes care 31(2): 361-362. Denman, S. E. and C. S. McSweeney (2006). "Development of a real‐time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen." FEMS microbiology ecology 58(3): 572-582. Dhanasekaran, M., S. Ignacimuthu and P. Agastian (2009). "Potential hepatoprotective activity of ononitol monohydrate isolated from Cassia tora L. on carbon tetrachloride induced hepatotoxicity in wistar rats." Phytomedicine 16(9): 891-895. Donovan, J. L., J. R. Bell, S. Kasim-Karakas, J. B. German, R. L. Walzem, R. J. Hansen and A. L. Waterhouse (1999). "Catechin is present as metabolites in human plasma after consumption of red wine." The Journal of nutrition 129(9): 1662-1668. Dougherty, E. C., E. L. Hansen, W. L. Nicholas, J. A. Mollett and E. A. Yarwood (1959). "Axenic cultivation of Caenorhabditis briggsae (Nematoda: Rhabditidae) with unsupplemented and supplemented chemically defined media." Annals of the New York Academy of Sciences 77(1): 176- 217. Dreher, D. and A. F. Junod (1996). "Role of oxygen free radicals in cancer development." European Journal of cancer 32(1): 30-38. Dulloo, A. G., C. Duret, D. Rohrer, L. Girardier, N. Mensi, M. Fathi, P. Chantre and J. Vandermander (1999). "Efficacy of a green tea extract rich in catechin polyphenols and caffeine in increasing 24-h energy expenditure and fat oxidation in humans." The American journal of clinical nutrition 70(6): 1040-1045.

156

Dunstan, G. A., A. J. Sinclair, K. O'Dea and J. M. Naughton (1988). "The lipid content and fatty acid composition of various marine species from southern Australian coastal waters." Comparative Biochemistry and Physiology Part B: Comparative Biochemistry 91(1): 165-169. Eades, S. J., A. W. Read, D. McAullay, B. McNamara, K. O'dea and F. J. Stanley (2010). "Modern and traditional diets for Noongar infants." Journal of paediatrics and child health 46(7‐8): 398-403. Eaton, S. B., M. Konner and M. Shostak (1988). "Stone agers in the fast lane: chronic degenerative diseases in evolutionary perspective." The American journal of medicine 84(4): 739-749. Ebrahim, S., S. Kinra, L. Bowen, E. Andersen, Y. Ben-Shlomo, T. Lyngdoh, L. Ramakrishnan, R. Ahuja, P. Joshi and S. M. Das (2010). "The effect of rural-to-urban migration on obesity and diabetes in India: a cross-sectional study." PLoS medicine 7(4): e1000268. Elphinstone, J. J. (1966). Endemic diseases in natives (Kimberleys). In Report of Commissioner of Public Health Western Australia, Appendix IV. Perth. Enright, E., A. P. Bland, E. C. Needs and A. L. Kelly (1999). "Proteolysis and physicochemical changes in milk on storage as affected by UHT treatment, plasmin activity and KIO 3 addition." International Dairy Journal 9(9): 581-591. Fang-Yen, C., L. Avery and A. D. Samuel (2009). "Two size-selective mechanisms specifically trap bacteria-sized food particles in Caenorhabditis elegans." Proceedings of the National Academy of Sciences 106(47): 20093-20096. Ferguson, M., C. Brown, C. Georga, E. Miles, A. Wilson and J. Brimblecombe (2017). "Traditional food availability and consumption in remote Aboriginal communities in the Northern Territory, Australia." Australian and New Zealand Journal of Public Health 41(3): 294-298. Finke, M. D. (2007). "Estimate of chitin in raw whole insects." Zoo Biology 26(2): 105-115. Flores, H. E. and A. W. Galston (1982). "Polyamines and plant stress: activation of putrescine biosynthesis by osmotic shock." Science 217(4566): 1259-1261. FNIGC (2012). First Nations Regional Health Survey (RHS) 2008/10: National report on adults, youth and children living in First Nations communities. Ottawa. Foley, W. (2005). "Tradition and change in urban indigenous food practices." Postcolonial Studies 8(1): 25-44. Frei, B. and J. V. Higdon (2003). "Antioxidant activity of tea polyphenols in vivo: evidence from animal studies." The Journal of nutrition 133(10): 3275S-3284S. Furukawa, S., T. Fujita, M. Shimabukuro, M. Iwaki, Y. Yamada, Y. Nakajima, O. Nakayama, M. Makishima, M. Matsuda and I. Shimomura (2017). "Increased oxidative stress in obesity and its impact on metabolic syndrome." The Journal of clinical investigation 114(12): 1752-1761. García-González, A. P., A. D. Ritter, S. Shrestha, E. C. Andersen, L. S. Yilmaz and A. J. Walhout (2017). "Bacterial metabolism affects the C. elegans response to cancer chemotherapeutics." Cell 169(3): 431-441. e438. Garnick, J. J., B. Singh and G. Winkley (1998). "Effectiveness of a medicament containing silicon dioxide, aloe, and allantoin on aphthous stomatitis." Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 86(5): 550-556. Gazis, A., D. White, S. Page and J. Cockcroft (1999). "Effect of oral vitamin E (α‐tocopherol) supplementation on vascular endothelial function in Type 2 diabetes mellitus." Diabetic Medicine 16(4): 304-311. Ghasemzadeh, A. and N. Ghasemzadeh (2011). "Flavonoids and phenolic acids: Role and biochemical activity in plants and human." Journal of medicinal plants research 5(31): 6697-6703. Gheldof, N., X.-H. Wang and N. J. Engeseth (2002). "Identification and quantification of antioxidant components of honeys from various floral sources." Journal of agricultural and food chemistry 50(21): 5870-5877.

157

Gil, M. I., F. A. Tomás-Barberán, B. Hess-Pierce, D. M. Holcroft and A. A. Kader (2000). "Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing." Journal of Agricultural and Food chemistry 48(10): 4581-4589. Gillingham, L. G., S. Harris-Janz and P. J. Jones (2011). "Dietary monounsaturated fatty acids are protective against metabolic syndrome and cardiovascular disease risk factors." Lipids 46(3): 209- 228. Goldberg, I. and J. S. Rokem (2009). Organic and Fatty Acid Production, Microbial A2 - Schaechter, Moselio. Encyclopedia of Microbiology (Third Edition). Oxford, Academic Press: 421-442. Gomez-Amaro, R. L., E. R. Valentine, M. Carretero, S. E. LeBoeuf, S. Rangaraju, C. D. Broaddus, G. M. Solis, J. R. Williamson and M. Petrascheck (2015). "Measuring food intake and nutrient absorption in caenorhabditis elegans." Genetics 200(2): 443-454. González-Castejón, M. and A. Rodriguez-Casado (2011). "Dietary phytochemicals and their potential effects on obesity: a review." Pharmacological Research 64(5): 438-455. Gould, R. A. (1969). "Subsistence Behaviour among the Western Desert Aborigines of Australia." Oceania 39(4): 253-274. Government, A. (2014). Aboriginal and Torres Strait Islander Health Performance Framework 2014 Report. D. o. t. P. M. a. Cabinet. Graf, E. (1992). "Antioxidant potential of ferulic acid." Free Radical Biology and Medicine 13(4): 435- 448. Green, J. (2003). "Anmatyerr plant stories." IAD Pres. Greer, E. L. and A. Brunet (2009). "Different dietary restriction regimens extend lifespan by both independent and overlapping genetic pathways in C. elegans." Aging cell 8(2): 113-127. Gross, L. S., L. Li, E. S. Ford and S. Liu (2004). "Increased consumption of refined carbohydrates and the epidemic of type 2 diabetes in the United States: an ecologic assessment." The American journal of clinical nutrition 79(5): 774-779. Guha, S., M. Cao, R. M. Kane, A. M. Savino, S. Zou and Y. Dong (2013). "The longevity effect of cranberry extract in Caenorhabditis elegans is modulated by daf-16 and osr-1." Age 35(5): 1559- 1574. Gullan, P. J. and A. Cockburn (1986). "Sexual dichronism and intersexual phoresy in gall-forming coccoids." Oecologia 68(4): 632-634. Gullan, P. J. and P. S. Cranston (2010). The insects: an outline of entomology, John Wiley & Sons. Gus' kov, E., M. Kletskii, I. Kornienko, L. Olekhnovich, V. Chistyakov, T. Shkurat, V. Prokof'ev and Y. A. Zhdanov (2002). Allantoin as a free-radical scavenger. Doklady Biochemistry and Biophysics, Springer. Gus' kov, E., T. Shkurat, N. Milyutina, V. Prokof'ev, I. Pokudina, E. Mashkina and I. Timofeeva (2001). Effect of allantoin on the activity of enzymes providing regulation of the ROS-dependent status of an organism. Doklady Biochemistry and Biophysics, Springer. Hales, C. N. and D. J. Barker (1992). "Type 2 (non-insulin-dependent) diabetes mellitus: the thrifty phenotype hypothesis." Diabetologia 35(7): 595-601. Hamada, A., T. Taguchi, H. Mori, M. Thorpe, Y. Yamori and M. Mori (2011). "Possible association of high urinary magnesium and taurine to creatinine ratios with metabolic syndrome risk reduction in Australian aboriginals." Cardiology research and practice 2011. Hamm, G., P. Mitchell, L. J. Arnold, G. J. Prideaux, D. Questiaux, N. A. Spooner, V. A. Levchenko, E. C. Foley, T. H. Worthy and B. Stephenson (2016). "Cultural innovation and megafauna interaction in the early settlement of arid Australia." Nature 539(7628): 280-283. Hancock, R. D., G. J. McDougall and D. Stewart (2007). "Berry fruit as ‘superfood’: hope or hype." Biologist 54(2): 73-79. Harding, A.-H., N. J. Wareham, S. A. Bingham, K. Khaw, R. Luben, A. Welch and N. G. Forouhi (2008). "Plasma vitamin C level, fruit and vegetable consumption, and the risk of new-onset type 2 diabetes mellitus: the European prospective investigation of cancer–Norfolk prospective study." Archives of internal medicine 168(14): 1493-1499.

158

Harrington, L. A. and C. B. Harley (1988). "Effect of vitamin E on lifespan and reproduction in Caenorhabditis elegans." Mechanisms of ageing and development 43(1): 71-78. Harris, T. W., N. Chen, F. Cunningham, M. Tello‐Ruiz, I. Antoshechkin, C. Bastiani, T. Bieri, D. Blasiar, K. Bradnam and J. Chan (2004). "WormBase: a multi‐species resource for nematode biology and genomics." Nucleic acids research 32(suppl_1): D411-D417. Haug, A., A. T. Høstmark and O. M. Harstad (2007). "Bovine milk in human nutrition–a review." Lipids in health and disease 6(1): 25. Hector, I., G. J. Kalabidi, S. Banjo, T. N. N. Dodd, R. J. W. Wavehill, D. Danbayarri, V. N. Wadrill, B. Puntiyarri, I. B. Malyik and B. Wavehill (2012). "Bilinarra, Gurindji and Malngin plants and animals." Northern Territory Government, Department of Natural Resources, Palmerston, Australia. Heinemann, T., G. Axtmann and K. v. Bergmann (1993). "Comparison of intestinal absorption of cholesterol with different plant sterols in man." European journal of clinical investigation 23(12): 827-831. Hodgson, J. M., B. H. H. Hsu‐Hage and M. L. Wahlqvist (1994). "Food variety as a quantitative descriptor of food intake." Ecology of food and nutrition 32(3-4): 137-148. Hokayem, M., E. Blond, H. Vidal, K. Lambert, E. Meugnier, C. Feillet-Coudray, C. Coudray, S. Pesenti, C. Luyton and S. Lambert-Porcheron (2013). "Grape polyphenols prevent fructose-induced oxidative stress and insulin resistance in first-degree relatives of type 2 diabetic patients." Diabetes care 36(6): 1454-1461. Holt, A. (2001). Forcibly removed, Magabala Books. Honda, Y., Y. Fujita, H. Maruyama, Y. Araki, K. Ichihara, A. Sato, T. Kojima, M. Tanaka, Y. Nozawa and M. Ito (2011). "Lifespan-extending effects of royal jelly and its related substances on the nematode Caenorhabditis elegans." PloS one 6(8): e23527. Hossain, P., B. Kawar and M. El Nahas (2007). "Obesity and diabetes in the developing world—a growing challenge." New England journal of medicine 356(3): 213-215. Houthoofd, K., B. P. Braeckman, I. Lenaerts, K. Brys, A. De Vreese, S. Van Eygen and J. R. Vanfleteren (2002). "Axenic growth up-regulates mass-specific metabolic rate, stress resistance, and extends life span in Caenorhabditis elegans." Experimental gerontology 37(12): 1371-1378. Hraš, A. R., M. Hadolin, Ž. Knez and D. Bauman (2000). "Comparison of antioxidative and synergistic effects of rosemary extract with α-tocopherol, ascorbyl palmitate and citric acid in sunflower oil." Food chemistry 71(2): 229-233. Hsu, C. Y., H. Y. Shih, Y. C. Chang, Z. L. Huang, M. J. Tsai, Y. C. Chia, C. Chen, Y. K. Lai and C. F. Weng (2015). "The beneficial effects of tetracosanol on insulin-resistance by insulin receptor kinase sensibilisation." Journal of Functional Foods 14(Supplement C): 174-182. Hu, F. B., J. E. Manson and W. C. Willett (2001). "Types of dietary fat and risk of coronary heart disease: a critical review." Journal of the American College of Nutrition 20(1): 5-19. Huang, J., D. B. Agus, C. J. Winfree, S. Kiss, W. J. Mack, R. A. McTaggart, T. F. Choudhri, L. J. Kim, J. Mocco and D. J. Pinsky (2001). "Dehydroascorbic acid, a blood–brain barrier transportable form of vitamin C, mediates potent cerebroprotection in experimental stroke." Proceedings of the National Academy of Sciences 98(20): 11720-11724. Ibe, S., K. Kumada, K. Yoshida and K. Otobe (2013). "Natto (fermented soybean) extract extends the adult lifespan of Caenorhabditis elegans." Bioscience, biotechnology, and biochemistry 77(2): 392- 394. Ihara, Y., Y. Yamada, S. Toyokuni, K. Miyawaki, N. Ban, T. Adachi, A. Kuroe, T. Iwakura, A. Kubota and H. Hiai (2000). "Antioxidant α‐tocopherol ameliorates glycemic control of GK rats, a model of type 2 diabetes." FEBS letters 473(1): 24-26. Ilja, C. W. A., D. R. Jacobs, L. J. Harnack, M. Gross and A. R. Folsom (2001). "Dietary Catechins in Relation to Coronary Heart Disease Death among Postmenopausal Women." Epidemiology 12(6): 668-675.

159

Ishii, N., N. Senoo-Matsuda, K. Miyake, K. Yasuda, T. Ishii, P. S. Hartman and S. Furukawa (2004). "Coenzyme Q 10 can prolong C. elegans lifespan by lowering oxidative stress." Mechanisms of ageing and development 125(1): 41-46. Johnson, R. J., M. S. Segal, Y. Sautin, T. Nakagawa, D. I. Feig, D.-H. Kang, M. S. Gersch, S. Benner and L. G. Sánchez-Lozada (2007). "Potential role of sugar (fructose) in the epidemic of hypertension, obesity and the metabolic syndrome, diabetes, kidney disease, and cardiovascular disease." The American journal of clinical nutrition 86(4): 899-906. Jones, R. (1969). "Fire-stick farming." Australian Natural History 16(7): 224-228. Jongema, Y. (2012). "List of edible insects of the world (April 4, 2012)." Wageningen Wageningen University, Wageningen, the Netherlands. Kader, A. A., M. A. Stevens, M. Albright-Holton, L. L. Morris and M. Algazi (1977). "Effect of fruit ripeness when picked on flavor and composition in fresh market tomatoes." J. Amer. Soc. Hort. Sci 102(6): 724-731. Kaletta, T. and M. O. Hengartner (2006). "Finding function in novel targets: C. elegans as a model organism." Nature reviews Drug discovery 5(5): 387-399. Kamal-Eldin, A. and R. Andersson (1997). "A multivariate study of the correlation between tocopherol content and fatty acid composition in vegetable oils." Journal of the American Oil Chemists' Society 74(4): 375-380. Kanazawa, K. and H. Sakakibara (2000). "High content of dopamine, a strong antioxidant, in cavendish banana." Journal of agricultural and food chemistry 48(3): 844-848. Kaplan, M., T. Hayek, A. Raz, R. Coleman, L. Dornfeld, J. Vaya and M. Aviram (2001). "Pomegranate juice supplementation to atherosclerotic mice reduces macrophage lipid peroxidation, cellular cholesterol accumulation and development of atherosclerosis." The Journal of nutrition 131(8): 2082-2089. Kashiwada, Y., H.-K. Wang, T. Nagao, S. Kitanaka, I. Yasuda, T. Fujioka, T. Yamagishi, L. M. Cosentino, M. Kozuka and H. Okabe (1998). "Anti-AIDS agents. 30. Anti-HIV activity of oleanolic acid, pomolic acid, and structurally related triterpenoids 1." Journal of Natural Products 61(9): 1090-1095. Kastorini, C.-M., H. J. Milionis, K. Esposito, D. Giugliano, J. A. Goudevenos and D. B. Panagiotakos (2011). "The effect of Mediterranean diet on metabolic syndrome and its components: a meta- analysis of 50 studies and 534,906 individuals." Journal of the American College of Cardiology 57(11): 1299-1313. Katiki, L. M., J. F. Ferreira, J. M. Gonzalez, A. M. Zajac, D. S. Lindsay, A. C. S. Chagas and A. F. Amarante (2013). "Anthelmintic effect of plant extracts containing condensed and hydrolyzable tannins on Caenorhabditis elegans, and their antioxidant capacity." Veterinary parasitology 192(1): 218-227. Katiki, L. M., J. F. Ferreira, A. M. Zajac, C. Masler, D. S. Lindsay, A. C. S. Chagas and A. F. Amarante (2011). "Caenorhabditis elegans as a model to screen plant extracts and compounds as natural anthelmintics for veterinary use." Veterinary parasitology 182(2): 264-268. Kawaii, S., Y. Yoshizawa and J. Mizutani (1993). "Measurement of intracellular ionized calcium in a free-living soil nematode, Caenorhabditis elegans." Bioscience, biotechnology, and biochemistry 57(7): 1115-1118. Kawate, R., M. Yamakido, Y. Nishimoto, P. H. Bennett, R. F. Hamman and W. C. Knowler (1979). "Diabetes mellitus and its vascular complications in Japanese migrants on the Island of Hawaii." Diabetes Care 2(2): 161-170. Kayashima, T. and T. Katayama (2002). "Oxalic acid is available as a natural antioxidant in some systems." Biochimica et Biophysica Acta (BBA)-General Subjects 1573(1): 1-3. Kelebek, H., S. Selli, A. Canbas and T. Cabaroglu (2009). "HPLC determination of organic acids, sugars, phenolic compositions and antioxidant capacity of orange juice and orange wine made from a Turkish cv. Kozan." Microchemical Journal 91(2): 187-192.

160

Khadir, F., M. Pouramir, S. G. Joorsaraee, F. Feizi, H. Sorkhi and F. Yousefi (2015). "The effect of arbutin on lipid peroxidation and antioxidant capacity in the serum of cyclosporine-treated rats." Caspian journal of internal medicine 6(4): 196. Kim, J.-I., J. Kim, M.-J. Kang, M.-S. Lee, J.-J. Kim and I.-J. Cha (2005). "Effects of pinitol isolated from soybeans on glycaemic control and cardiovascular risk factors in Korean patients with type II diabetes mellitus: a randomized controlled study." European journal of clinical nutrition 59(3): 456- 458. Kiyama, Y., K. Miyahara and Y. Ohshima (2012). "Active uptake of artificial particles in the nematode Caenorhabditis elegans." Journal of Experimental Biology 215(7): 1178-1183. Konczak, I., D. Zabaras, M. Dunstan and P. Aguas (2010). "Antioxidant capacity and phenolic compounds in commercially grown native Australian herbs and spices." Food Chemistry 122(1): 260- 266. Konczak, I., D. Zabaras, D. Xiao, D. Shapira and G. Lee (2008). "Screening native Australian fruits for health-promoting properties. Anti-proliferative and pro-apoptotic activity of Illawarra Plum." J Clin Biochem Nutr 43(S1): 543-547. Kopelman, P. (2007). "Health risks associated with overweight and obesity." Obesity reviews 8(s1): 13-17. Koutsou, G., D. Storey, A. Lee, A. Zumbe, B. Flourie, Y. LeBot and P. Olivier (1996). "Dose-related gastrointestinal response to the ingestion of either isomalt, lactitol or maltitol in milk chocolate." European journal of clinical nutrition 50(1): 17-21. Kovacs, A., K. Yacoby and U. Gophna (2010). "A systematic assessment of automated ribosomal intergenic spacer analysis (ARISA) as a tool for estimating bacterial richness." Research in microbiology 161(3): 192-197. Kritchevsky, D. and S. C. Chen (2005). "Phytosterols—health benefits and potential concerns: a review." Nutrition Research 25(5): 413-428. Kumarasingha, R., E. Palombo, M. Bhave, T. Yeo, D. Lim, C. Tu, J. Shaw and P. Boag (2014). "Enhancing a search for traditional medicinal plants with anthelmintic action by using wild type and stress reporter Caenorhabditis elegans strains as screening tools." International journal for parasitology 44(5): 291-298. La Lastra, C., M. Barranco, V. Motilva and J. Herrerias (2001). "Mediterrranean diet and health biological importance of olive oil." Current pharmaceutical design 7(10): 933-950. Landry, S. V., G. R. Defoliart and M. L. Sunde (1986). "Larval protein quality of six species of Lepidoptera (Saturniidae, Sphingidae, Noctuidae)." Journal of economic entomology 79(3): 600-604. Latz, P. K. (1995). Bushfires & bushtucker, Iad Press. Lee, G. D., M. A. Wilson, M. Zhu, C. A. Wolkow, R. De Cabo, D. K. Ingram and S. Zou (2006). "Dietary deprivation extends lifespan in Caenorhabditis elegans." Aging cell 5(6): 515-524. Lee, M.-Y., N.-H. Lee, D. Jung, J.-A. Lee, C.-S. Seo, H. Lee, J.-H. Kim and H.-K. Shin (2010). "Protective effects of allantoin against ovalbumin (OVA)-induced lung inflammation in a murine model of asthma." International immunopharmacology 10(4): 474-480. Lenaerts, I., G. A. Walker, L. Van Hoorebeke, D. Gems and J. R. Vanfleteren (2008). "Dietary restriction of Caenorhabditis elegans by axenic culture reflects nutritional requirement for constituents provided by metabolically active microbes." The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 63(3): 242-252. Li, J., W.-J. Guo and Q.-Y. Yang (2002). "Effects of ursolic acid and oleanolic acid on human colon carcinoma cell line HCT15." World Journal of Gastroenterology 8(3): 493. Li, X.-W., Y. Liu, W. Hao and J.-R. Yang (2014). "Sequoyitol ameliorates diabetic nephropathy in diabetic rats induced with a high-fat diet and a low dose of streptozotocin." Canadian journal of physiology and pharmacology 92(5): 405-417. Liao, V. H.-C., C.-W. Yu, Y.-J. Chu, W.-H. Li, Y.-C. Hsieh and T.-T. Wang (2011). "Curcumin-mediated lifespan extension in Caenorhabditis elegans." Mechanisms of ageing and development 132(10): 480-487.

161

Lipman, R., R. Bronson, D. Wu, D. Smith, R. Prior, G. Cao, S. Han, K. Martin, S. Meydani and M. Meydani (1998). "Disease incidence and longevity are unaltered by dietary antioxidant supplementation initiated during middle age in C57BL/6 mice." Mechanisms of ageing and development 103(3): 269-284. Lithgow, G. J., M. Driscoll and P. Phillips (2017). "A long journey to reproducible results." Nature 548(7668): 387-388. Liu, R. H. (2003). "Health benefits of fruit and vegetables are from additive and synergistic combinations of phytochemicals." The American journal of clinical nutrition 78(3): 517S-520S. Liu, R. H. and J. Finley (2005). "Potential cell culture models for antioxidant research." Journal of agricultural and food chemistry 53(10): 4311-4314. Liu, S. (2002). "Intake of refined carbohydrates and whole grain foods in relation to risk of type 2 diabetes mellitus and coronary heart disease." Journal of the American College of Nutrition 21(4): 298-306. Lu, N. and K. Goetsch (1993). "Carbohydrate requirement of Caenorhabditis elegans and the final development of a chemically defined medium." Nematologica 39(1): 303-311. Lu, N. C., C. Newton and E. Stokstad (1977). "The requirement of sterol and various sterol precursors in free-living nematodes." Nematologica 23(1): 57-61. MacEvilly, C. (2000). "Bugs in the system." Nutrition Bulletin 25(4): 267-268. MacKay, D., J. Hathcock and E. Guarneri (2012). "Niacin: chemical forms, bioavailability, and health effects." Nutrition reviews 70(6): 357-366. Mackerras, D. and J. Cunningham (1996). Body mass index distribution in adults in the 1994 National Aboriginal and Torres Strait Islander Survey. PROCEEDINGS-NUTRITION SOCIETY OF AUSTRALIA. Maki, K. C., M. S. Reeves, M. Farmer, K. Yasunaga, N. Matsuo, Y. Katsuragi, M. Komikado, I. Tokimitsu, D. Wilder and F. Jones (2009). "Green tea catechin consumption enhances exercise- induced abdominal fat loss in overweight and obese adults." The Journal of nutrition 139(2): 264- 270. Marchant Jones, J., D. Bardbariya, E. Raymond, D. Roberts, D. McDonald, D. McDonald, M. McDonald, C. Simard, C. Moerkerken and G. Wightman (2011). Jaminjung, Ngaliwurru and Nungali plants and animals: Aboriginal flora and fauna knowledge from the Bradshaw and Judbarra/Gregory National Park area, north Australia, Dept. of Natural Resources, Environment, The Arts and Sport & Diwurruwurru-Jaru Aboriginal Corporation. Maritim, A., a. Sanders and J. Watkins, 3rd (2003). "Diabetes, oxidative stress, and antioxidants: a review." Journal of biochemical and molecular toxicology 17(1): 24-38. Markides, K. S. and J. Coreil (1986). "The health of Hispanics in the southwestern United States: an epidemiologic paradox." Public health reports 101(3): 253. Marventano, S., P. Kolacz, S. Castellano, F. Galvano, S. Buscemi, A. Mistretta and G. Grosso (2015). "A review of recent evidence in human studies of n-3 and n-6 PUFA intake on cardiovascular disease, cancer, and depressive disorders: does the ratio really matter?" International Journal of Food Sciences and Nutrition 66(6): 611-622. McCance, R. A. and R. D. Lawrence (1933). "An investigation of quebrachitol as a sweetening agent for diabetics." Biochemical Journal 27(4): 986. McDermott, R. (1998). "Ethics, epidemiology and the thrifty gene: biological determinism as a health hazard." Social science & medicine 47(9): 1189-1195. McGaw, L., A. Jäger and J. Van Staden (2000). "Antibacterial, anthelmintic and anti-amoebic activity in South African medicinal plants." Journal of ethnopharmacology 72(1): 247-263. McKeown, K. C. (1936). "Insect wonders of Australia." McMahon, E., T. Wycherley, K. O’Dea and J. Brimblecombe (2017). "A comparison of dietary estimates from the National Aboriginal and Torres Strait Islander Health Survey to food and beverage purchase data." Australian and New Zealand Journal of Public Health. Meggitt, M. J. (1957). "Notes on the vegetable foods of the Walbiri of Central Australia." Oceania 28(2): 143-145.

162

Merkl, R., I. HRádkoVá, V. FIlIp and J. ŠMIdRkal (2010). "Antimicrobial and antioxidant properties of phenolic acids alkyl esters." Czech J Food Sci 28(4): 275-279. Meyer, A. S., J. L. Donovan, D. A. Pearson, A. L. Waterhouse and E. N. Frankel (1998). "Fruit hydroxycinnamic acids inhibit human low-density lipoprotein oxidation in vitro." Journal of Agricultural and Food Chemistry 46(5): 1783-1787. Miettinen, T. A. and H. Gylling (2000). "Cholesterol absorption efficiency and sterol metabolism in obesity." Atherosclerosis 153(1): 241-248. Miller, J. B., K. W. James and P. M. A. Maggiore (1993). Tables of composition of Australian Aboriginal foods, Aboriginal Studies Press. Mills, M., C. Damron and J. Roe (1949). "Ascorbic acid, dehydroascorbic acid, and diketogulonic acid in fresh and processed foods." Analytical Chemistry 21(6): 707-709. Mitscher, L. A., M. Jung, D. Shankel, J. H. Dou, L. Steele and S. P. Pillai (1997). "Chemoprotection: a review of the potential therapeutic antioxidant properties of green tea (Camellia sinensis) and certain of its constituents." Medicinal research reviews 17(4): 327-365. Motala, A. A., M. A. Omar and F. J. Pirie (2003). "Epidemiology of type 1 and type 2 diabetes in Africa." Journal of cardiovascular risk 10(2): 77-83. Muroyama, K., S. Murosaki, Y. YAMAMOTOI, H. Odaka, H. C. Chung and M. Miyoshi (2003). "Anti- obesity effects of a mixture of thiamin, arginine, caffeine, and citric acid in non-insulin dependent diabetic KK mice." Journal of nutritional science and vitaminology 49(1): 56-63. Nair, P. P., N. Turjman, G. Kessie, B. Calkins, G. T. Goodman, H. Davidovitz and G. Nimmagadda (1984). "Diet, nutrition intake, and metabolism in populations at high and low risk for colon cancer. Dietary cholesterol, beta-sitosterol, and stigmasterol." The American journal of clinical nutrition 40(4): 927-930. Namiesnik, J., K. Vearasilp, M. Kupska, K.-S. Ham, S.-G. Kang, Y.-K. Park, D. Barasch, A. Nemirovski and S. Gorinstein (2013). "Antioxidant activities and bioactive components in some berries." European Food Research and Technology 237(5): 819-829. Naqshbandi, M., S. B. Harris, J. G. Esler and F. Antwi-Nsiah (2008). "Global complication rates of type 2 diabetes in Indigenous peoples: A comprehensive review." Diabetes research and clinical practice 82(1): 1-17. Nass, R. and I. Hamza (2007). "The nematode C. elegans as an animal model to explore toxicology in vivo: solid and axenic growth culture conditions and compound exposure parameters." Current Protocols in Toxicology: 1.9. 1-1.9. 18. Naughton, J. M., K. O'Dea and A. J. Sinclair (1986). "Animal foods in traditional Australian aboriginal diets: polyunsaturated and low in fat." Lipids 21(11): 684-690. Neel, J. V. (1962). "Diabetes mellitus: a “thrifty” genotype rendered detrimental by “progress”?" American journal of human genetics 14(4): 353. Nettleton, J. A. and R. Katz (2005). "n-3 long-chain polyunsaturated fatty acids in type 2 diabetes: a review." Journal of the American Dietetic Association 105(3): 428-440. Netzel, M., G. Netzel, Q. Tian, S. Schwartz and I. Konczak (2006). "Sources of antioxidant activity in Australian native fruits. Identification and quantification of anthocyanins." Journal of agricultural and food chemistry 54(26): 9820-9826. Netzel, M., G. Netzel, Q. Tian, S. Schwartz and I. Konczak (2007). "Native Australian fruits—a novel source of antioxidants for food." Innovative food science & emerging technologies 8(3): 339-346. Noonan, S. and G. Savage (1999). "Oxalate content of foods and its effect on humans." Asia Pacific Journal of Clinical Nutrition 8(1). NUTTAB (2010). "NUTTAB 2010–Australian Food Composition Tables." Canberra: FSANZ. O'dea, K. (1984). "Marked improvement in carbohydrate and lipid metabolism in diabetic Australian Aborigines after temporary reversion to traditional lifestyle." Diabetes 33(6): 596-603. O'Dea, K., P. Jewell, A. Whiten, S. Altmann, S. Strickland and O. Oftedal (1991). "Traditional diet and food preferences of Australian Aboriginal hunter-gatherers." Philosophical Transactions of the Royal Society of London B: Biological Sciences 334(1270): 233-241.

163

O'Dea, K., J. Naughton, A. Sinclair, L. Rabuco and R. Smith (1987). "Lifestyle change and nutritional status in Kimberley Aborigines." Australian Aboriginal Studies(1): 46. O'Dea, K., K. Traianedes, J. L. Hopper and R. G. Larkins (1988). "Impaired glucose tolerance, hyperinsulinemia, and hypertriglyceridemia in Australian aborigines from the desert." Diabetes Care 11(1): 23-29. O’Connell, J. F., P. K. Latz and P. Barnett (1983). "Traditional and modern plant use among the Alyawara of central Australia." Economic Botany 37(1): 80-109. Oomura, Y. (1988). "Chemical and neuronal control of feeding motivation." Physiology & behavior 44(4): 555-560. Padayatty, S. J., A. Katz, Y. Wang, P. Eck, O. Kwon, J.-H. Lee, S. Chen, C. Corpe, A. Dutta and S. K. Dutta (2003). "Vitamin C as an antioxidant: evaluation of its role in disease prevention." Journal of the American college of Nutrition 22(1): 18-35. Palm, F., J. Cederberg, P. Hansell, P. Liss and P.-O. Carlsson (2003). "Reactive oxygen species cause diabetes-induced decrease in renal oxygen tension." Diabetologia 46(8): 1153-1160. Pandey, K. B. and S. I. Rizvi (2009). "Plant polyphenols as dietary antioxidants in human health and disease." Oxidative medicine and cellular longevity 2(5): 270-278. Payne, A., C. Chassard and C. Lacroix (2012). "Gut microbial adaptation to dietary consumption of fructose, artificial sweeteners and sugar alcohols: implications for host–microbe interactions contributing to obesity." Obesity reviews 13(9): 799-809. Peile, A. R. (1980). Preliminary notes on the ethno-botany of the Gugadja Aborigines at Balgo, Western Australia. Pero, R. W., H. Lund and T. Leanderson (2009). "Antioxidant metabolism induced by quinic acid. Increased urinary excretion of tryptophan and nicotinamide." Phytotherapy research 23(3): 335-346. Petchkovsky, L., C. San Roque, R. Napaljarri Jurra and S. Butler (2004). "Indigenous maps of subjectivity and attacks on linking: Forced separation and its psychiatric sequelae in Australia’s Stolen Generation." Australian e-Journal for the Advancement of Mental Health 3(3): 113-128. Plata-Salamán, C. R., Y. Oomura and N. Shimizu (1986). "Endogenous sugar acid derivative acting as a feeding suppressant." Physiology & behavior 38(3): 359-373. Prior, R. L., G. Cao, A. Martin, E. Sofic, J. McEwen, C. O'Brien, N. Lischner, M. Ehlenfeldt, W. Kalt, G. Krewer and C. M. Mainland (1998). "Antioxidant Capacity As Influenced by Total Phenolic and Anthocyanin Content, Maturity, and Variety of Vaccinium Species." Journal of Agricultural and Food Chemistry 46(7): 2686-2693. Prior, R. L., X. Wu, L. Gu, T. J. Hager, A. Hager and L. R. Howard (2008). "Whole berries versus berry anthocyanins: interactions with dietary fat levels in the C57BL/6J mouse model of obesity." Journal of Agricultural and Food Chemistry 56(3): 647-653. Radcliffe, J. (2012). "Treatment of obesity with ACE-inhibitory compounds: effects of captopril and culinary herbs and spices, and the interaction effect with dietary salt." Raphael, T. and G. Kuttan (2003). "Effect of naturally occurring triterpenoids glycyrrhizic acid, ursolic acid, oleanolic acid and nomilin on the immune system." Phytomedicine 10(6): 483-489. Rasmussen, M., X. Guo, Y. Wang, K. E. Lohmueller, S. Rasmussen, A. Albrechtsen, L. Skotte, S. Lindgreen, M. Metspalu and T. Jombart (2011). "An Aboriginal Australian genome reveals separate human dispersals into Asia." Science 334(6052): 94-98. Roberts, J. G., Conway, S.Y., Morgan, R., Dirn,gayg, A., Harris, S., Farrar,, R. E.B., F.B., Merlan, F., Collyer, E., Calnan, T. and Wightman, and G. (2011). "Mangarrayi andYangman plants and animals. ." Northern Territory Botanical Bulletin 39. Roussel, A.-M., I. Hininger, R. Benaraba, T. N. Ziegenfuss and R. A. Anderson (2009). "Antioxidant effects of a cinnamon extract in people with impaired fasting glucose that are overweight or obese." Journal of the American College of Nutrition 28(1): 16-21.

164

Ruxton, C., S. C. Reed, M. Simpson and K. Millington (2004). "The health benefits of omega‐3 polyunsaturated fatty acids: a review of the evidence." Journal of Human Nutrition and Dietetics 17(5): 449-459. Rychlinska, I. and S. Nowak (2012). "Quantitative determination of arbutin and hydroquinone in different plant materials by HPLC." Notulae Botanicae Horti Agrobotanici Cluj-Napoca 40(2): 109- 113. Saeidnia, S., A. Manayi, A. R. Gohari and M. Abdollahi (2014). "The Story of Beta-sitosterol-A Review." Sakulnarmrat, K. and I. Konczak (2012). "Composition of native Australian herbs polyphenolic-rich fractions and in vitro inhibitory activities against key enzymes relevant to metabolic syndrome." Food chemistry 134(2): 1011-1019. Sam, M. A. (2006). Mitakoodi Bush Tucker: Edible and Medicinal Plants of the Northwest Highlands and Gulf Plains of Queensland, Mitakoodi Juhnjlar Corporation. Samuel, T. K., J. W. Sinclair, K. L. Pinter and I. Hamza (2014). "Culturing Caenorhabditis elegans in axenic liquid media and creation of transgenic worms by microparticle bombardment." Journal of visualized experiments: JoVE(90). Santos, F. A., J. T. Frota, B. R. Arruda, T. S. de Melo, G. A. de Castro Brito, M. H. Chaves and V. S. Rao (2012). "Antihyperglycemic and hypolipidemic effects of α, β-amyrin, a triterpenoid mixture from Protium heptaphyllum in mice." Lipids in Health and Disease 11(1): 98. Scelza, B. A., D. W. Bird and R. Bliege Bird (2014). "Bush tucker, shop tucker: production, consumption, and diet at an Aboriginal outstation." Ecology of food and nutrition 53(1): 98-117. Schieber, A., P. Keller and R. Carle (2001). "Determination of phenolic acids and flavonoids of apple and pear by high-performance liquid chromatography." Journal of Chromatography A 910(2): 265- 273. Schulz, T. J., K. Zarse, A. Voigt, N. Urban, M. Birringer and M. Ristow (2007). "Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress." Cell metabolism 6(4): 280-293. Scott, T. A., L. M. Quintaneiro, P. Norvaisas, P. P. Lui, M. P. Wilson, K.-Y. Leung, L. Herrera- Dominguez, S. Sudiwala, A. Pessia and P. T. Clayton (2017). "Host-microbe co-metabolism dictates cancer drug efficacy in C. elegans." Cell 169(3): 442-456. e418. Semple, T. L., P. J. Gullan, C. J. Hodgson, N. B. Hardy and L. G. Cook (2015). "Systematic review of the Australian ‘bush coconut’genus Cystococcus (Hemiptera: Eriococcidae) uncovers a new species from Queensland." Invertebrate systematics 29(3): 287-312. Shen, H., M. Shao, K. W. Cho, S. Wang, Z. Chen, L. Sheng, T. Wang, Y. Liu and L. Rui (2012). "Herbal constituent sequoyitol improves hyperglycemia and glucose intolerance by targeting hepatocytes, adipocytes, and β-cells." American Journal of Physiology-Endocrinology and Metabolism 302(8): E932-E940. Shibamura, A., T. Ikeda and Y. Nishikawa (2009). "A method for oral administration of hydrophilic substances to Caenorhabditis elegans: effects of oral supplementation with antioxidants on the nematode lifespan." Mechanisms of ageing and development 130(9): 652-655. Shinbori, C., M. Saito, Y. Kinoshita, I. Satoh, T. Kono, T. Hanada, E. Nanba, K. Adachi, H. Suzuki and M. Yamada (2006). "N-hexacosanol reverses diabetic induced muscarinic hypercontractility of ileum in the rat." European journal of pharmacology 545(2): 177-184. Si, A. and M. Turpin (2015). "The importance of insects in Australian Aboriginal society: a dictionary survey." Ethnobiology Letters 6(1): 175-182. Simopoulos, A. P. (1999). "Essential fatty acids in health and chronic disease." The American journal of clinical nutrition 70(3): 560s-569s. Simpkin, K. G. and G. C. Coles (1981). "The use of Caenorhabditis elegans for anthelmintic screening." Journal of Chemical Technology and Biotechnology 31(1): 66-69. Siri-Tarino, P. W., Q. Sun, F. B. Hu and R. M. Krauss (2010). "Saturated fat, carbohydrate, and cardiovascular disease." The American journal of clinical nutrition 91(3): 502.

165

So, S., K. Miyahara and Y. Ohshima (2011). "Control of body size in C. elegans dependent on food and insulin/IGF‐1 signal." Genes to Cells 16(6): 639-651. Somova, L., A. Nadar, P. Rammanan and F. Shode (2003). "Cardiovascular, antihyperlipidemic and antioxidant effects of oleanolic and ursolic acids in experimental hypertension." Phytomedicine 10(2- 3): 115-121. Sosa, V., T. Moliné, R. Somoza, R. Paciucci, H. Kondoh and M. E. LLeonart (2013). "Oxidative stress and cancer: an overview." Ageing research reviews 12(1): 376-390. Speakman, J. R. (2008). "Thrifty genes for obesity, an attractive but flawed idea, and an alternative perspective: the ‘drifty gene’hypothesis." International journal of obesity 32(11): 1611-1617. Sroka, Z. and W. Cisowski (2003). "Hydrogen peroxide scavenging, antioxidant and anti-radical activity of some phenolic acids." Food and Chemical Toxicology 41(6): 753-758. Statistics, A. B. o. (2014). Australian Aboriginal and Torres Strait Islander Health Survey: Updated Results, 2012–13 Strauss, R. S. (1999). "Comparison of serum concentrations of α-tocopherol and β-carotene in a cross-sectional sample of obese and nonobese children (NHANES III)." The Journal of pediatrics 134(2): 160-165. Suzuki, Y., N. Miyoshi and M. Isemura (2012). "Health-promoting effects of green tea." Proceedings of the Japan Academy, Series B 88(3): 88-101. Sweeney, G. (1947). "Food supplies of a desert tribe." Oceania 17(4): 289-299. Symonds, E. L., I. Konczak and M. Fenech (2013). "The Australian fruit Illawarra plum (Podocarpus elatus Endl., Podocarpaceae) inhibits telomerase, increases histone deacetylase activity and decreases proliferation of colon cancer cells." British Journal of Nutrition 109(12): 2117-2125. Szewczyk, N., J. Sunga and C. Conley (2003). "Baseline data for worms grown in C. elegans Maintenance Medium." Worm Breeder\'s Gazette 17. Szewczyk, N. J., E. Kozak and C. A. Conley (2003). "Chemically defined medium and Caenorhabditis elegans." BMC biotechnology 3(1): 19. Szewczyk, N. J., I. A. Udranszky, E. Kozak, J. Sunga, S. K. Kim, L. A. Jacobson and C. A. Conley (2006). "Delayed development and lifespan extension as features of metabolic lifestyle alteration in <em>C. elegans</em> under dietary restriction." Journal of Experimental Biology 209(20): 4129. Szewczyk, N. J., I. A. Udranszky, E. Kozak, J. Sunga, S. K. Kim, L. A. Jacobson and C. A. Conley (2006). "Delayed development and lifespan extension as features of metabolic lifestyle alteration in C. elegans under dietary restriction." Journal of Experimental Biology 209(20): 4129-4139. Takagi, H., Y. Ishiga, S. Watanabe, T. Konishi, M. Egusa, N. Akiyoshi, T. Matsuura, I. C. Mori, T. Hirayama and H. Kaminaka (2016). "Allantoin, a stress-related purine metabolite, can activate jasmonate signaling in a MYC2-regulated and abscisic acid-dependent manner." Journal of experimental botany 67(8): 2519-2532. Takebayashi, J., R. Ishii, J. Chen, T. Matsumoto, Y. Ishimi and A. Tai (2010). "Reassessment of antioxidant activity of arbutin: multifaceted evaluation using five antioxidant assay systems." Free radical research 44(4): 473-478. Takii, H., K. Matsumoto, T. Kometani, S. Okada and T. Fushiki (1997). "Lowering effect of phenolic glycosides on the rise in postprandial glucose in mice." Bioscience, biotechnology, and biochemistry 61(9): 1531-1535. Tan, A. C., D.-X. Hou, I. Konczak, S. Tanigawa, I. Ramzan and D. M.-Y. Sze (2011). "Native Australian fruit polyphenols inhibit COX-2 and iNOS expression in LPS-activated murine macrophages." Food research international 44(7): 2362-2367. Tan, A. C., I. Konczak, I. Ramzan and D. M.-Y. Sze (2011). "Antioxidant and cytoprotective activities of native Australian fruit polyphenols." Food research international 44(7): 2034-2040. Tan, A. C., I. Konczak, I. Ramzan and D. M.-Y. Sze (2011). "Native Australian fruit polyphenols inhibit cell viability and induce apoptosis in human cancer cell lines." Nutrition and cancer 63(3): 444-455.

166

Tan, A. C., I. Konczak, I. Ramzan, D. Zabaras and D. M.-Y. Sze (2011). "Potential antioxidant, antiinflammatory, and proapoptotic anticancer activities of Kakadu plum and Illawarra plum polyphenolic fractions." Nutrition and cancer 63(7): 1074-1084. Tappel, A., B. Fletcher and D. Deamer (1973). "Effect of antioxidants and nutrients on lipid peroxidation fluorescent products and aging parameters in the mouse." Journal of gerontology 28(4): 415-424. Tappy, L., K. A. Lê, C. Tran and N. Paquot (2010). "Fructose and metabolic diseases: new findings, new questions." Nutrition 26(11): 1044-1049. Taylor, J. C., L. Rapport and G. B. Lockwood (2003). "Octacosanol in human health." Nutrition 19(2): 192-195. Teixeira-Lemos, E., F. Reis, F. Teixeira and S. Nunes (2011). "Regular physical exercise training assists in preventing type 2 diabetes development: focus on its antioxidant and anti-inflammatory properties." Cardiovascular diabetology 10(1): 12. Terés, S., G. Barceló-Coblijn, M. Benet, R. Alvarez, R. Bressani, J. Halver and P. Escriba (2008). "Oleic acid content is responsible for the reduction in blood pressure induced by olive oil." Proceedings of the National Academy of Sciences 105(37): 13811-13816. Thorburn, A. W., J. Brand and A. Truswell (1987a). "Slowly digested and absorbed carbohydrate in traditional bushfoods: a protective factor against diabetes?" The American journal of clinical nutrition 45(1): 98-106. Thorburn, A. W., J. C. Brand, K. O'Dea, R. M. Spargo and A. S. Truswell (1987b). "Plasma glucose and insulin responses to starchy foods in Australian aborigines: a population now at high risk of diabetes." The American journal of clinical nutrition 46(2): 282-285. Tindale, N. B. (1953). "On some Australian Cossidae including the moth of the witjuti (witchety) grub." Transactions of the Royal Society of South Australia 76: 56-65. Tindale, N. B. (1966). Insects as food for the Australian Aborigines. Ting, H. H., F. K. Timimi, K. S. Boles, S. J. Creager, P. Ganz and M. A. Creager (1996). "Vitamin C improves endothelium-dependent vasodilation in patients with non-insulin-dependent diabetes mellitus." Journal of Clinical Investigation 97(1): 22. Truswell, A. S. (1987). "Evolution of dietary recommendations, goals, and guidelines." American journal of clinical nutrition (USA). Turpin, M. and A. Ross (2012). Kaytetye to English dictionary, IAD Press. Vanfleteren, J. R. (1974). "Nematode growth factor." Nature 248(5445): 255-257. Vannice, G. and H. Rasmussen (2014). "Position of the academy of nutrition and dietetics: dietary fatty acids for healthy adults." Journal of the Academy of Nutrition and Dietetics 114(1): 136-153. Vayndorf, E. M., S. S. Lee and R. H. Liu (2013). "Whole apple extracts increase lifespan, healthspan and resistance to stress in Caenorhabditis elegans." Journal of functional foods 5(3): 1235-1243. Visioli, F., L. Borsani and C. Galli (2000). "Diet and prevention of coronary heart disease: the potential role of phytochemicals." Cardiovascular Research 47(3): 419-425. Wang, D., S. Zhang, Z. Chang, D.-X. Kong and Z. Zuo (2017). "Quebrachitol: Global Status and Basic Research." Natural Products and Bioprospecting 7(1): 113-122. Wang, P., C.-H. Kong, B. Sun and X.-H. Xu (2012). "Distribution and function of allantoin (5- ureidohydantoin) in rice grains." Journal of agricultural and food chemistry 60(11): 2793-2798. Watson, E., L. T. MacNeil, A. D. Ritter, L. S. Yilmaz, A. P. Rosebrock, A. A. Caudy and A. J. Walhout (2014). "Interspecies systems biology uncovers metabolites affecting C. elegans gene expression and life history traits." Cell 156(4): 759-770. Watson, E., Lesley T. MacNeil, Ashlyn D. Ritter, L. S. Yilmaz, Adam P. Rosebrock, Amy A. Caudy and Albertha J. M. Walhout (2014). "Interspecies Systems Biology Uncovers Metabolites Affecting C. elegans Gene Expression and Life History Traits." Cell 156(4): 759-770. Weihrauch, J. L. and J. M. Gardner (1978). "Sterol content of foods of plant origin." Journal of the American Dietetic Association 73(1): 39-47.

167

Weisburg, W. G., S. M. Barns, D. A. Pelletier and D. J. Lane (1991). "16S ribosomal DNA amplification for phylogenetic study." Journal of bacteriology 173(2): 697-703. Wenjie, M., J. H. Wu, Q. Wang, R. N. Lemaitre, K. J. Mukamal, L. Djoussé, I. B. King, X. Song, M. L. Biggs and J. A. Delaney (2015). "Prospective association of fatty acids in the de novo lipogenesis pathway with risk of type 2 diabetes: The Cardiovascular Health Study." American Journal of Clinical Nutrition 101(1): 153-163. White, D. L., E. A. O'Brien, D. M. Fejo, R. W. Yates, A. A. Goodman, M. Harvey and G. Wightman (2009). "Warray plants and animals: Aboriginal flora and fauna knowledge from the upper Adelaide and upper Finniss Rivers, northern Australia." WHO (2017). "Obesity and Overweight factsheet from the WHO." Health. Wightman, G., J. G. Roberts and L. Williams (1992). "Mangarrayi ethnobotany aboriginal plant use from the Elsey area Northern Australia." North. Terr. Bot. Bull(15). Williams, D. J., D. Edwards, I. Hamernig, L. Jian, A. P. James, S. K. Johnson and L. C. Tapsell (2013). "Vegetables containing phytochemicals with potential anti-obesity properties: A review." Food Research International 52(1): 323-333. Williams, D. J., D. Edwards, S. Pun, M. Chaliha, B. Burren, U. Tinggi and Y. Sultanbawa (2016). "Organic acids in Kakadu plum (Terminalia ferdinandiana): The good (ellagic), the bad (oxalic) and the uncertain (ascorbic)." Food Research International 89: 237-244. Wilson, J. X. (2002). "The physiological role of dehydroascorbic acid." FEBS letters 527(1-3): 5-9. Wilson, M. A., B. Shukitt‐Hale, W. Kalt, D. K. Ingram, J. A. Joseph and C. A. Wolkow (2006). "Blueberry polyphenols increase lifespan and thermotolerance in Caenorhabditis elegans." Aging cell 5(1): 59- 68. Wolever, T. M., A. Piekarz, M. Hollands and K. Younker (2002). "Sugar alcohols and diabetes: a review." Can J Diabetes 26(4): 356-362. Xu, H., G. T. Barnes, Q. Yang, G. Tan, D. Yang, C. J. Chou, J. Sole, A. Nichols, J. S. Ross and L. A. Tartaglia (2003). "Chronic inflammation in fat plays a crucial role in the development of obesity- related insulin resistance." Journal of clinical investigation 112(12): 1821. Xue, Y., Q. Miao, A. Zhao, Y. Zheng, Y. Zhang, P. Wang, H. Kallio and B. Yang (2015). "Effects of sea buckthorn (Hippophaë rhamnoides) juice and L-quebrachitol on type 2 diabetes mellitus in db/db mice." Journal of Functional Foods 16: 223-233. Yang, Q., S. Liu, J. Sun, L. Yu, C. Zhang, J. Bi and Z. Yang (2014). "Nutritional composition and protein quality of the edible beetle Holotrichia parallela." Journal of Insect Science 14(1). Yen, A. (2015). "Insects as food and feed in the Asia Pacific region: current perspectives and future directions." Journal of Insects as Food and Feed 1(1): 33-55. Yen, A., C. Bilney, M. Shackleton and S. Lawler (2016). "Current issues involved with the identification and nutritional value of wood grubs consumed by Australian Aborigines." Insect science. Yen, A. L. (2010). "Edible insects and other invertebrates in Australia: future prospects." Forest insects as food: humans bite back: 65. Yousefi, F., S. Mahjoub, M. Pouramir and F. Khadir (2013). "Hypoglycemic activity of Pyrus biossieriana Buhse leaf extract and arbutin: Inhibitory effects on alpha amylase and alpha glucosidase." Caspian journal of internal medicine 4(4): 763. Yu, Y.-B., L. Dosanjh, L. Lao, M. Tan, B. S. Shim and Y. Luo (2010). "Cinnamomum cassia bark in two herbal formulas increases life span in Caenorhabditis elegans via insulin signaling and stress response pathways." PloS one 5(2): e9339. Yunupingu, B., L. Yunupingu-Marika, D. Marika, B. Marika, B. Marika, R. Marika and G. Wightman (1995). "Rirratjingu ethnobotany: Aboriginal plant use from Yirrkala, Arnhem Land, Australia." Northern Territory Botanical Bulletin 21: 1-112. Zheng, S., S. Liao, Y. Zou, Z. Qu, W. Shen and Y. Shi (2014). "Mulberry leaf polyphenols delay aging and regulate fat metabolism via the germline signaling pathway in Caenorhabditis elegans." Age 36(6): 9719.

168

Zhou, L., X. Fu, L. Jiang, L. Wang, S. Bai, Y. Jiao, S. Xing, W. Li and J. Ma (2017). "Arbutin increases Caenorhabditis elegans longevity and stress resistance." PeerJ 5: e4170. Zhu, W. and J. Gao (2008). The use of botanical extracts as topical skin-lightening agents for the improvement of skin pigmentation disorders. Journal of Investigative Dermatology Symposium Proceedings, Elsevier. Zou, M. L., P. J. Moughan, A. Awati and G. Livesey (2007). "Accuracy of the Atwater factors and related food energy conversion factors with low-fat, high-fiber diets when energy intake is reduced spontaneously." The American journal of clinical nutrition 86(6): 1649-1656.

169

Appendix A: Publications during PhD candidature

Flavel, M.R., Mechler, A., Shahmiri, M., Mathews, E.R., Franks, A.E., Chen, W., Zanker, D.,

Xian, B., Gao, S., Luo, J. and Tegegne, S., 2017. Growth of Caenorhabditis elegans in

Defined Media Is Dependent on Presence of Particulate Matter. G3: Genes, Genomes,

Genetics, pp.g3-300325.

Chen, W., Liao, B., Li, W., Dong, X., Flavel, M., Jois, M., Li, G. and Xian, B., 2017.

Segmenting microscopy images of multi-well plates based on image contrast. Microscopy and Microanalysis, 23(5), pp.932-937.

Yen, A., Flavel, M., Bilney, C., Brown, L., Butler, S., Crossing, K., Jois, M., Napaltjarri, Y.,

Napaltjarri, Y., West, P. and Wright, B., 2016. The bush coconut (scale insect gall) as food at

Kiwirrkurra, Western Australia. Journal of Insects as Food and Feed, 2(4), pp.293-299.

Smith, B., Flavel, M. and Simpson, B., 2016. Quantification of salivary cortisol from captive dingoes (Canis dingo) in relation to age, sex, and breeding season: implications for captive management. Australian Mammalogy, 38(1), pp.21-28.

170

Appendix B: Signed Research agreement with Tjamu Tjamu Aboriginal Corporation

Our ref: 210.1

18 May 2016

Mr Mathew Flavel

PhD Research Candidate

La Trobe University

Bundoora, Victoria 3083

By email: [email protected]

Dear Mathew Project Agreement - Kiwirrkurra Bush Foods Project I refer to our recent discussions in relation to the proposed Kiwirrkurra Bush Foods Project that emerged as an ongoing side project from the Bush Blitz activities conducted in the Kiwirrkurra native title determination area during 2015. The Kiwirrkurra native title holders (Kiwirrkurra People) and their representative prescribed body corporate, Tjamu Tjamu (Aboriginal Corporation) RNTBC (Tjamu Tjamu), are very keen for this project to take place.

As the Kiwirrkurra Bush Foods Project does not fall within the existing Bush Blitz agreement, Tjamu Tjamu considers that an agreement is required with each individual researcher involved to set out the specifics of the proposed project and the terms upon which it is undertaken. Most of the terms of engagement are contained in the Kiwirrkurra Indigenous Engagement Protocol (Protocol), contained

171 in Annexure 1 of the Kiwirrkurra Bush Foods Project Agreement attached to this letter. The Protocol was developed based on the content of the Bush Blitz Indigenous Engagement Protocol. The remaining content of the project agreement sets out the detail of the proposed project including its aim, the dates of fieldwork, project participants, project duration and some background on how the project has been developed.

Tjamu Tjamu considers this to be a long-term, ongoing project with excellent opportunities for mutually beneficial outcomes. If the content of the attached agreement is acceptable to you please sign the attached agreement and also arrange for Alan Yen to sign it. Once executed please send it back to me at your earliest convenience. As the agreement can be executed in counterparts I will arrange for the Tjamu Tjamu Directors to sign the agreement as soon as possible.

Yours sincerely

Kate Crossing

Kiwirrkurra Program Leader – Land Management

Att: Kiwirrkurra Bush Foods Project Agreement

172

Kiwirrkurra Bush Foods Project Agreement

Parties:

Tjamu Tjamu (Aboriginal Corporation) RNTBC (ICN: 4148) c/- 76 Wittenoom Street, East Perth in the State of Western Australia, referred to as Tjamu Tjamu in this agreement.

And

Alan Yen, La Trobe University; and

Mathew Flavel, La Trobe University.

Collectively referred to as the Researchers in this Agreement.

1. Background and Aim of Project This project arises out of observations and activities conducted in the Kiwirrkurra native title determination area as part of the Bush Blitz program in 2015. In 2016 the Researchers sought and received separate funding for this project. The aim of the Kiwirrkurra Bush Foods Project is to investigate the edible insects, seeds and other bush foods that are being used by Kiwirrkurra People. This investigation will include:  taxonomy of species;  documentation of language names and descriptions;  assessment and understanding of host plant and insect relationships; and  assessment of the nutritional value of the foods identified.

2. Project Participants Alan Yen, La Trobe University Mathew Flavel, La Trobe University

3. Project Duration The project is expected to be an ongoing with linkages being established to the Kiwirrkurra Indigenous Protected Area (IPA) program that may collaborate with the researchers and provide them with field data and specimens. The initial fieldwork component of the project is expected to take place between 3 June and 8 June with the aim of publishing results in 2017. These publications are intended to be both the development of local resources such as the development of booklets and video footage and the development of scholarly articles for publication in scientific journals.

173

4. Proposed Fieldwork The fieldwork component of the project will take place between 3 June – 8 June 2016 within the Kiwirrkurra native title determination area and IPA. 5. Agreement to comply with Kiwirrkurra Indigenous Engagement Protocol The Researchers agree to comply with the terms of the Kiwirrkurra Indigenous Engagement Protocol (Annexure 1) while conducting the project. The Researchers will endeavour to engage some Kiwirrkurra Rangers to work with them during the fieldwork in order that they gain experience and insight into the scientific methods employed in this type of research. 6. Counterparts This agreement can be executed in two counterparts. If executed in two counterparts, both counterparts together shall be taken to constitute one instrument.

174

Executed by the Parties as a Deed.

Signed for an on behalf of Tjamu Tjamu

175

Signed on behalf of the Researchers:

______

Alan Yen

Associate Professor

School of Applied Systems Biology

La Trobe University

Mathew Flavel

PhD student

School of Applied Systems Biology

La Trobe University

176

Annexure 1 – Kiwirrkurra Indigenous Engagement Protocol

Kiwirrkurra Indigenous Engagement Protocol1

Statement

The Kiwirrkurra native title holders (Kiwirrkurra People) are keen to work with scientists and research organisations (Researchers) to undertake land management related activities within the Kiwirrkurra native title determination area and Indigenous Protected Area (IPA). They understand that the exchange between indigenous participants and Researchers provides opportunities for indigenous employment, skills transfer, knowledge sharing and an increase in cultural awareness amongst all parties. Research expeditions provide the impetus for ongoing and productive relationships between the Kiwirrkurra People and Researchers.

When undertaking activities within the Kiwirrkurra native title determination area and IPA, visiting Researchers agree to respect traditional laws, intellectual property and cultural protocols. Tjamu Tjamu (Aboriginal Corporation) RNTBC (Tjamu Tjamu), on behalf of the Kiwirrkurra People, will negotiate a project agreement with the proponents of a project setting out the specific details of the proposed project. The agreement will be designed to suit the budget, scale and logistical constraints of the particular project being negotiated. An important aspect of any agreement entered into by the Kiwirrkurra People is the requirement that researchers be bound by the terms contained in this Kiwirrkurra Indigenous Engagement Protocol (Protocol)

Terms

The Researchers agree to the following:

Consultation and Planning  Start talking with Kiwirrkurra People as early as possible to allow for adequate consultation and planning.  Meet with Kiwirrkurra People through Tjamu Tjamu or the Kiwirrkurra IPA Management Team, to discuss the project proposal.  Provide a contact person to liaise with the Kiwirrkurra native title holders and their representatives.  Engage an interpreter if needed.

Permits and Project Agreement

1 This protocol has been adapted from one endorsed and adopted by the Bush Blitz program involving the Director of National Parks, numerous indigenous land manager groups and research organisations.

177

 Apply for permits from the Ngaanyatjarra Council (Aboriginal Corporation) or the Department of Aboriginal Affairs to enter and undertake research on the Kiwirrkurra native title determination area and IPA.  Enter into a project agreement with Tjamu Tjamu that, among other things, sets out the details and specifics of any fieldwork proposed to be undertaken

Indigenous Participation and Benefit Sharing Within the budget and logistical constraints of the project, investigate ways it can benefit the Kiwirrkurra People and meet their information needs, which could include some of the following:  select some areas for survey that are of interest for IPA and land management purposes;  undertake an activity at the local school;  attend a community event to share stories about the research;  provide support for the recording of indigenous observations and knowledge of country during the project;  assist traditional owners to participate in fieldwork;  employ cultural advisers to assist in facilitating project activities;  involve traditional owners in promotional activities and developing shared key messages; and  consider proposals from local indigenous businesses to supply services required for the project.

Fieldwork Practices  Ask traditional owners to brief the project participants on cultural protocols and sensitive sites prior to the project activities commencing.  Ensure that Researchers follow reasonable direction from traditional owners at all times whilst on country, this includes taking direction on suitable sites for sampling and requests that Researchers be accompanied to particular sites during fieldwork.  Not disturb or remove cultural material without permission.  Not release to any person without prior written consent, information that is considered to be confidential.  Ensure that traditional owners consent to being photographed, filmed or recorded.

Acknowledgments  Ensure all publications produced acknowledge the Kiwirrkurra People and Tjamu Tjamu .  Encourage scientists to seek co-authorship of research papers with Kiwirrkurra People as a means of acknowledging indigenous expertise, where their knowledge has assisted with the research outcomes or is included in the report.

Ownership of materials  Use of intellectual property and traditional knowledge in reports and other outputs shall only be with the prior consent of the providers.  The intellectual property and entire copyright of all traditionally owned materials (such as songs, images, stories, names and other traditional knowledge) which is recorded and otherwise documented in association with the project shall remain the sole property of the original owners.

178

 If any new intellectual property created in partnership with the Kiwirrkurra People and Researchers under the project is of commercial value, Researchers will be required to negotiate a new agreement with the Kiwirrkurra People through Tjamu Tjamu.

Opportunity for traditional owners to review contents of reports, papers and presentations  The Researchers will provide Tjamu Tjamu with a copy of the final draft of any reports before publishing and distribution.  If Researchers plan to publish or present results from the project that includes intellectual property or traditional knowledge provided by traditional owners, the researchers will be asked to send a draft of the paper or conference presentation to Tjamu Tjamu for review before publication.  Prior to publication provide Tjamu Tjamu with copies of all photographs and video footage taken by the Researchers during the project.

179

Appendix C: Ngaanyatjarra council: Permit to enter a reserve

PERMIT NO.

NgC 737 05 2016

58 Head Street Alice Springs NT 0871 Telephone: (08) 8950 1711 Facsimile: (08) 8953 1892 PERMIT TO ENTER A RESERVE

DATE ISSUED: 28 August 2018

In pursuance of the provisions of Section 31 of the Aboriginal Affairs Planning Authority Act, 1972, and of the regulations made under the Act, I hereby grant:

Name/s: Matthew Flavel

Make Model Colour Registration Number Vehicle/s: Toyota Landcruiser Dual White 1ESG448 (WA) Cab

Route: Travelling to Kiwirrkurra Community via Gary Junction Road in relation to the proposed Kiwirrkurra Bush Foods Project. Meeting with Kiwirrkurra native title holders and their representative prescribed body corporate, Tjamu Tjamu (Aboriginal Corporation) Please Note:  You must carry the permit in the vehicle specified herein while on reserve land.  Under the Aboriginal Communities Act 1979, any person who brings, possesses or uses liquor on Ngaanyatjarra Lands, or supplies it to others, commits an offence. A fine of up to $5,000 may apply.  Refrain from photographs/video of community areas and residents within reserve lands unless you have specific approval from the community.  Remain on established roads and use approved camping areas/accommodation without prior approval.  Observe all laws having application in WA including Aboriginal Community by-laws.  Refrain from mining and/or prospecting (including fossicking) activity within reserve lands. A specific permit is required for this purpose.  Refrain from using firearms within reserve lands.  Refrain from hunting or fishing within reserve lands without prior approval.  Refrain from littering within reserve lands and observe fire restrictions and regulations.

180

TRANSIT PERMIT TO ENTER CENTRAL RESERVE FOR THE PERIOD OF TIME STATED BELOW: Permission to enter and remain on Aboriginal Reserve situated at CENTRAL RESERVE, WA in the State of Western Australia, subject to the person/s named herein AT ALL TIMES ABIDING BY THE CONDITIONS LISTED ABOVE AND ON THE REVERSE OF THIS FORM.

THIS PERMIT IS VALID FROM: 3rd June 2016 UNTIL: 8th June 2016

UNLESS SOONER REVOKED BY THE MINISTER FOR ABORIGINAL AFFAIRS

For and on behalf of the Minister for Aboriginal Affairs

181

Appendix D GC-MS chromatograms

Solanum chippendalei

182

Solanum centrale

Endoxyla leucomochla

183

Acacia colei

Carrissa lanceolata

184

Acacia tetragonophylla

185

Solanum cleistogranum

Eragorstis erodopida

186

Cyperus bulbosa

Appendix E: Compounds identified by GC-MS in 9 traditional bushfoods.

A. Solanum chippendalei B. Solanum centrale C. Endoxyla leucomochla D. Acacia colei E.

Carrisa lanceolata F. Acacia tetragonophylla G. Solanum cleistogranum H. Eragrostis

erodopida I. Cyperus bulbosa. Numbers at the end of a compound denote how many food

types that compound was found. If no number is present compound is unique to that food

source.

Chemical classification A. B. C. D. E. F. G. H. I. Compound

Allantoin Acylureas X

Dopamine Amine x

Putrescine (3) Amine x x x

2 Amino- Butyric Acid Amino Acid x

3-cyano-L-Alanine Amino Acid x

187

4-Aminobutyric acid (7) Amino Acid x x x x x x x beta- Alanine (6) Amino Acid x x x x x X x

DL- Alanine (6) Amino Acid

DL- Arginine (3) Amino Acid

DL- Asparagine (7) Amino Acid

DL- Aspartic Acid (7) Amino Acid x x x x x x x x

DL- Cysteine (2) Amino Acid

DL- Glutamic Acid (8) Amino Acid x x x x x x x x

DL- Glutamine (6) Amino Acid x x x x x x

DL- Histidine (2) Amino Acid x x

DL- Homoserine (6) Amino Acid x x x x x x

DL- Isoleucine (8) Amino Acid x x x x x x x x

DL- Leucine (2) Amino Acid x x

DL- Lysine (5) Amino Acid x x x x x

DL- Methionine (4) Amino Acid x x x x

DL- Ornithine (6) Amino Acid x x x x x x

DL- Phenylalanine (8) Amino Acid x x x x x x x x

DL- Proline (8) Amino Acid x x x x x x x x

DL- Pyroglutamic Acid (7) Amino Acid x x x x x x x

DL- Serine (9) Amino Acid x x x x x x x x x

DL- S-methyl Cysteine Amino Acid x

DL- Threonine (9) Amino Acid x x x x x x x x x

DL- Tryptophan (4) Amino Acid x x x x

DL- Tyrosine (7) Amino Acid x x x x x x x

DL- Valine (8) Amino Acid x x x x x x x x

DL-2 Amino Adipic Acid Amino Acid x x x (2)

DL-2-Amino Butyric Acid Amino Acid x x x x (4)

188

DL-3-Amino- Butyric Acid Amino Acid x x (2)

Glycine (8) Amino Acid x x x x x x x x

L- Tyrosine Amino Acid x

L-Alanine Amino Acid x

L-Asparagine Amino Acid x

L-Cystathionine Amino Acid x

Levodopa (3) Amino Acid x x x

L-Glutamine Amino Acid x

Pipecolic Acid (5) Amino Acid x x x x x

L-Aspartic Acid (2) Amino Acid x x

D-Pantothenic Acid (2) Amino Acid x x

Benzoic Acid Aromatic Carboxylic Acid x

2-methyl Butanedioic Acid Branched Fatty Acid x

3-caffeoyl trans-Quinic Acid Cyclic Polyol x x (2)

3-p-coumaroyl-trans Quinic Cyclic Polyol x Acid

Ononitol (3) Cyclic Polyol x x x

Pinitol (4) Cyclic Polyol x x x x

Sequoyitol Cyclic Polyol x

Shikimic Acid (3) Cyclic Polyol x x x

D(-) Quinic Acid (9) Cyclic Polyol x x x x x x x x X

Quebrachitol (2) Cyclic Polyol x x

Malonic Acid (7) Dicarboxylic Acid x x x x x x x

Oxalic Acid (6) Dicarboxylic Acid x x x x x x

2-oxo Glutaric Acid (3) Dicarboxylic Acid x x x bis(trimethylsilyl) ester Dicarboxylic Acid x Ethanedioic Acid

189

Butanedioic Acid Dicarboxylic Acid x

Fumaric Acid (7) Dicarboxylic Acid x x x x x x x

Methylmalonic acid (3) Dicarboxylic Acid x x x

Succinic Acid (8) Dicarboxylic Acid x x x x x x x x beta-D-Glucopyranuronic Dicarboxylic Acid x acid

DL- Malic Acid (9) Dicarboxylic Acid x x x x x x x x x

Monohexadecanoylglycerol Fatty Acid Ester x

Monopalmitoylglycerol Fatty Acid Ester x

Hexacosanol Fatty Alcohol x

Octasanol Fatty Alcohol x

Tetracosanol Fatty Alcohol x

Catechine (8) Flavonoid x x x x x x x x trans-Caffeic Acid (5) Flavonoid x x x x x trans-Ferulic Acid Flavonoid x

4-hydroxybenzoic Acid (2) Flavonoid x x

Salicylic Acid Flavonoid x

1-methyl-beta-D- Glycoside x galactopyranoside

Hydroquinone-beta-D- Glycoside x glucopyranoside (Arbutin)

Galactosylglycerol Glycosylglycerol x

Glycolic Acid Hydroxy Acid x

Uric Acid (5) Imidazopyrimidine x x x x x

Pyruvic Acid (5) Keto Acid x x x x x

Phenylpyruvic Acid Keto Acid x

1,4-Butyro lactam (5) Lactam x x x x x

2,5-Diaminovalerolactam Lactam x

3-amino-Piperidin-2-one (5) Lactam x x x x x

190

1,4-Erythronic Acid Lactone Lactone x x (2)

1,4-Threonic Acid Lactone Lactone x

1,5 Gluconate Lactone Lactone x

1-4 Pentonic Acid Lactone Lactone x x (2)

1-5-Mevalonic Acid Lactone Lactone x

DL- Glucuronic acid-e- Lactone x lactone

Succinic anhydride Lactone x

Galactonate (3) Medium Chain Fatty Acid x x x

Galactonic Acid (3) Medium Chain fatty Acid x x x

Gulonic Acid (3) Medium Chain Fatty Acid x x x

2,3-Dimethylsuccinic Acid Methyl-branched Fatty Acids x

2,4-dihdroxy-Butanoic Acid Monocarboxylic Acid x x (2)

2-Keto-D-gluconic Acid (5) Monocarboxylic Acid x x x x x

3-Hydroxypropanoic acid Monocarboxylic Acid x x x x x (5)

Dehydroascorbic Acid dimer Monocarboxylic Acid x

Ascorbic Acid Monocarboxylic Acid x

Adenine Nucleobase x

Guanine (3) Nucleobase x x x

Thymine (2) Nucleobase x x

Uracil (5) Nucleobase x x x x x

Hypoxanthine Nucleobase x

Adenosine (2) Nucleoside x x

Guanosine Nucleoside x

Inosine (2) Nucleoside x

191

Uridine (2) Nucleoside x x

Adenosine-5- Nucleotide x monophosphate

Urea (8) Organic Carbonic Acid x x x x x x x x

Phosphoric Acid (5) Orthophosphoric Acid x x x x x

Phosphoric acid Orthophosphoric Acid x x x monomethyl ester (3)

1,3-bis(trimethylsilyl) Primary Alcohol x Pyrimidinedione

2-methyl-1,2-propanediol Primary Alcohol x

Ethanolamine (7) Primary Alcohol x x x x x x x

Galactinol (6) Primary Alcohol x x x x x x trans-Coniferyl Alcohol Primary Alcohol x

Nicotinic Acid (9) Pyridinecarboxylic acids x x x x x x x x x

Eicosanoic Acid (Arachidic Saturated Fatty Acid x x x x x x x acid )(7) n- Octadecanoic Acid Saturated Fatty Acid x x x x x x x x x (Stearic acid) (9) n-Docosanoic Behenic acid Saturated Fatty Acid x x (2) n-Hexadecanoic Acid (8) Saturated Fatty Acid x x x x x x x x (Palmitic acid) n-Heptadecanoic Acid Saturated Fatty Acid x x x x x x (margaric acid) (6)

1- Secondary Alcohol x Monohexadecanoylglycerol

2-(4-(2-Hydroxy--3-

(isopropylamino)propoxy)ph Secondary Alcohol x enyl) acetimide

192

2-Hydroxyglutaric Acid (5) Short Chain Fatty Acid x x x x x

4-hydroxybutyric Acid (5) Short Chain Fatty Acid x x x x x

β-Sitosterol (3) Steroid x x x

Campesterol (3) Steroid x x x

Cholesterol Steroid x

Fucosterol (3) Steroid x x x

Stigmasterol (4) Steroid x x x x alpha-Tocopherol Steroid x beta-Tocopherol Steroid x gamma-Tocopherol (2) Steroid x x

2-4-Methylenecycloartanol Steroid x

Arabinose (6) Sugar x x x x x x beta-Gentibiose (2) Sugar x

Erythrose MX1 Sugar x

Erythrose MX2 Sugar x

Fructose MX1 (8) Sugar x x x x x x x x

Fructose MX2 (7) Sugar x x x x x x x

Fructose-6-P Sugar x

Fucose MX1 Sugar x

Fucose MX2 Sugar x

Glucose MX1 (5) Sugar x x x x

Glucose MX2 (6) Sugar x x x x x

Glucose-6-P MX1 Sugar x

Kestose Sugar x

Maltose (4) Sugar x x x x

Melezitose Sugar x

Melibiose MX1 (2) Sugar x x

Raffinose (4) Sugar x x x x

Rhamnose (3) Sugar x x x

193

Ribose (2) Sugar x x

Sorbose MX1 (3) Sugar x x x

Sorbose MX2 (2) Sugar x x

Sucrose (7) Sugar x x x x x x x

Trehalose (6) Sugar x x x x x x

Turanose MX1 Sugar x

Turanose MX2 Sugar x

Xylose MX1 (3) Sugar x x x

Xylose MX2 (3) Sugar x x x

2,3-Dihydroxybutanedioic Sugar Acid x x Acid (Tartaric Acid) (2)

2,4,5-Trihydroxypentanoic Sugar Acid x acid

3-Deoxyarabinohexaric Acid Sugar Acid x

D-Galacturonic Acid Sugar Acid x

D-Glucuronic Acid Sugar Acid x

Galacturonate MX1 (2) Sugar Acid x x

Galacturonate MX2 Sugar Acid x

Glucaric Acid (2) Sugar Acid x x

Gluconate (4) Sugar Acid x x x x

Gluconate—P Sugar Acid x

Gluconic Acid (4) Sugar Acid x x x x

Glucuronate MX1 (2) Sugar Acid x x

Glucuronate MX2 (2) Sugar Acid x x

Glyceric Acid Sugar Acid x x x x x

Mucic Acid Sugar Acid x

Saccharic Acid (4) Sugar Acid x x x x

Threonic Acid (6) Sugar Acid x x x x x x

Erythronic Acid (4) Sugar Acid x x x x

194

Ribonic Acid (3) Sugar Acid x x x

DL- Glyceric Acid (6) Sugar Acid x x x x x x

Arabitol (4) Sugar Alcohol x x x x

Erythritol (5) Sugar Alcohol x x x x x

Inositol (7) Sugar Alcohol x x x x x x x

Inositol-2-P (2) Sugar Alcohol x x

Glycerol (7) Sugar Alcohol x x x x x x x

Mannitol (3) Sugar Alcohol x x x

Sorbitol (5) Sugar Alcohol x x x x x

Theitol (2) Sugar Alcohol x x

Virburnitol Sugar Alcohol x

Xylitol (3) Sugar Alcohol x x x cis-Aconitic Acid (3) Tricarboxylic Acid x x x

Citric Acid (9) Tricarboxylic Acid x x x x x x x x x

Oleanolic Acid Triterpenoid x beta-Amyrin (2) Triterpenoid x x

Ursolic Acid Triterpenoid x

2-methyl-Maleic Acid (2) Unsaturated Fatty Acid x x (Citraconic Acid)

9-(Z)-Hexadecenoic Acid Unsaturated Fatty Acid x (palmitoleic acid)

9-(Z) Octadecanoic acid Unsaturated Fatty Acid x x x x x x (Oleic acid) (6)

9,12-(Z,Z) Octadecadienoic Unsaturated Fatty Acid X x x x x x x Acid (Linoleic acid) (7)

9,12,15-(Z,Z,Z)

Octadecatrienoic acid Unsaturated Fatty Acid X methylester (Methyl linolenate)

195

Itaconic Acid (2) Unsaturated Fatty Acid x x

Appendix F. Life stages at 24-hour intervals in tested dietary conditions

24 48 120 72 hours 96 hours 144 Hours hours hours hours

CeHR + L1 L2 L4 Adult Adult Adult Milk

CeHR +

Particulate L1 L2 L4 Adult Adult Adult

Mater

Milk

Particulate L1 L2 L3 L4 Adult Adult

Matter

CeHR no L1 L1 L1 L1 L1 L1

196

Milk

CeHR L1 L1 L1 L1 L1 L1 Filtered

M9 Buffer L1 L1 L1 L1 L1 L1

S medium

and OP50 L1 L3 Adult Adult Adult Adult

(4.5 x 109)

S medium and OP50 (9 L1 L2 L3 L4 Adult Adult

x 108)

Control L1 L2 L3 Adult Adult Adult Media

Solubilised L1 L1 L1 L1 L1 L1 Media

AXM L1 L2 L2 L3 L3 L3

CeMM L1 L2 L2 L3 L3 L3

AXM L1 L1 L1 L1 L1 L1 Filtered

CeMM L1 L1 L1 L1 L2 L2 Filtered

Liposomes packed with L1 L2 L4 Adult Adult Adult CeHR no

Milk

197

Liposomes packed with L1 L1 L1 L1 L1 L1

Liposomes packed with L1 L2 L4 Adult Adult Adult filtered

AXM

Liposomes packed with L1 L2 L4 Adult Adult Adult filtered

CeMM

Liposomes packed with

CeHR, no L1 L1 L1 L1 L1 L1

milk or

cholesterol

198

Typical worms at each life stage: Worms were scored as which of these life stages they best represented at 24 hour intervals. L1 arrest was scored when there was no change from the L1 phenotype across 144 hours.

Appendix G: Statistical significance of each relative condition in the chapter 5 equivalent growth rate experiments:

199

Condition ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Condition CeHR Liposomes CeHR + CeHR Liposomes M9 AXM CeHR (no CeHR + CeHR Liposome no CeMM Control packed with Milk OP 50 4.5 OP 50 9 x Solubilised AXM Milk Liposom CeMM packed with M9 Liposom filtered milk) Milk Filtered milk or Filtered Media filtered Pellet x 109 108 Media Pellet e filtered CeMM e cholesterol AXM

Mean growth rate between 24 and 48 hours. 120.12 -5.62 22.24 180.70 152.38 -2.10 175.96 -4.65 206.42 9.21 48.22 243.23 313.67 1.36 -10.80 84.55 282.42 278.38 11.12

SD 34.46 17.64 12.53 26.28 33.07 19.62 99.86 27.31 32.78 23.43 34.74 84.34 52.89 15.57 31.19 15.22 44.96 68.06 21.73 Significantly 2, 3, 4, 5, different (P<0.05) 6, 7, 8, 9, 1, 2, 3, 5, 1, 2, 3, 4, 1, 2, 3, 4, between 24 and 48 10, 11, 1, 2, 4, 5, 1, 2, 3, 6, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 6, 8, 9, 6, 8, 9, 5, 6, 7, 8, 1, 2, 3, 4, 5, 1, 3, 4, 5, hours from 12, 13, 1, 3, 4, 5, 6, 7, 8, 9, 1, 3, 4, 5, 8, 9, 10, 1, 4, 5, 7, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 1, 3, 4, 5, 5, 6, 7, 8, 5, 6, 7, 8, 5, 6, 7, 8, 10, 11, 10, 11, 1, 3, 4, 5, 7, 10, 11, 6, 7, 8, 9, 10, 7, 8, 9, 1, 4, 5, 7, 9, condition ID: 14, 15, 7, 9, 11, 11, 12, 7, 9, 11, 11, 12, 9, 11, 12, 9, 10, 12, 7, 8, 9, 10, 11, 7, 9, 11, 9, 10, 11, 9, 10, 11, 9, 10, 11, 12, 13, 12, 13, 9, 11, 12, 13, 12, 13, 11, 13, 14, 10, 11, 11, 12, 13, 16, 17, 12, 13, 13, 14, 12, 13, 13, 14, 13, 16, 13, 14, 12, 14, 15, 16, 12, 13, 12, 13, 12, 13, 12, 13, 14, 15, 14, 15, 16, 17, 18 14, 15, 15, 16, 17, 12, 13, 16, 17, 18 18, 19 16, 17 ,18 15, 16, 16, 17, 18 15, 16, 17, 18 15, 16, 17, 18, 19 16, 17, 18 14, 15, 14, 15, 14, 15, 16, 17, 16, 17, 16, 17, 18, 19 16, 17, 18 17, 18 17, 18, 19 17, 18, 19 17, 18, 19 16, 19 16, 17, 19 18, 19 18, 19 18, 19

Mean growth rate between 48 and 72 hours 53.31 80.98 1.04 602.67 703.01 -3.36 444.63 8.59 22.66 68.58 422.81 493.35 341.61 -0.94 -0.88 273.18 164.91 110.19 2.26

SD 44.23 28.65 11.14 53.42 89.27 22.01 110.89 31.39 28.30 23.45 130.61 154.79 101.55 13.97 29.99 27.71 62.98 83.51 21.87 Significantly different (P<0.05) 1, 2, 3, 5, 1, 2, 3, 4, between48 and 72 3, 4, 5, 6, 3, 4, 5, 6, 1, 2, 3, 4, 3, 4, 5, 6, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 3, 4, 5, 6, 7, 8, 9, 6, 7, 8, 9, 1, 2, 3, 4, 5, hours from 7, 8, 11, 7, 8, 9, 1, 2, 4, 5, 1, 2, 4, 5, 5, 6, 8, 9, 2, 3, 4, 5, 7, 8, 9, 5, 6, 8, 9, 1, 2, 3, 4, 5, 6, 1, 2, 4, 5, 1, 2, 4, 5, 5, 6, 7, 8, 5, 6, 7, 8, 6, 7, 8, 9, 10, 11, 10, 11, 1, 2, 4, 5, 7, 6, 7, 8, 9, 10, 1, 2, 4, 5, 7, treament ID: 12, 13, 11, 12, 7, 10, 11, 7, 10, 11, 10, 12, 7, 10, 11, 11, 12, 10, 12, 7, 8, 9, 10, 11, 7, 10, 11, 7, 10, 11, 9, 10, 11, 9, 10, 11, 10, 11, 12, 13, 12, 13, 10, 11, 12, 11, 13, 14, 10, 11, 12, 14, 15, 13, 14, 12, 13, 12, 13, 13, 14, 12, 13, 13, 14, 13, 14, 12, 14, 15, 16, 12, 13, 12, 13, 12, 13, 12, 13, 12, 13, 14, 15, 14, 15, 13, 16, 17, 18 15, 16, 17, 13, 16, 17, 18 16, 17, 15, 16, 16, 17, 18 16, 17, 18 15, 16, 16, 17, 18 15, 16, 15, 16, 17, 18, 19 16, 17, 18 16, 17, 18 14, 15, 14, 15, 14, 15, 16, 17, 16, 17, 18, 19 18, 19 17, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 16, 18, 19 16, 17, 19 18, 19 18, 19

Mean growth rate between 72 and 96 hours 230.90 -0.42 1.74 118.66 71.82 -4.38 125.18 8.96 159.64 -2.29 418.35 103.72 255.37 2.55 10.34 346.27 104.08 39.84 1.95

SD 236.10 54.88 29.59 13.37 69.06 62.24 23.11 75.92 27.63 40.63 11.25 120.15 124.76 123.82 20.68 43.23 48.63 44.67 63.30 Significantly different (P<0.05) 1, 2, 3, 4, between 72 and 96 2, 3, 4, 5, 1, 2, 3, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 4, 5, 5, 6, 8, 1, 2, 3, 6, hoursl from 6, 7, 8, 9, 1, 4, 5, 7, 1, 4, 5, 7, 6, 8, 9, 1, 4, 5, 7, 1, 4, 5, 7, 5, 6, 7, 8, 1, 2, 3, 5, 6, 2, 3, 4, 5, 6, 7, 1, 4, 5, 7, 5, 6, 7, 8, 6, 7, 9, 6, 7, 8, 9, 6, 8, 10, 1, 4, 5, 7, 9, 10, 11, 1, 4, 5, 7, 8, 9, 10, 1, 4, 5, 7, 9, condition id: 10, 11, 9, 11, 12, 9, 11, 12, 10, 11, 9, 11, 12, 9, 11, 12, 9, 10, 12, 8, 9, 10, 11, 8, 9, 10, 11, 12, 9, 11, 12, 9, 10, 11, 10, 11, 10, 11, 11, 13, 11, 12, 13, 12, 13, 9, 11, 12, 11, 13, 10, 11, 12, 12, 14, 13, 16, 13, 16, 13, 14, 13, 16, 13, 16, 13, 14, 13, 14, 15, 14, 15, 16, 17, 13, 16, 12, 13, 12, 13, 13, 14, 14, 15, 16, 17 14, 15, 13, 16, 17 14, 15, 13, 16, 17, 18 15, 16, 17, 18 17, 18 15, 16, 17, 18 17, 18 15, 16, 16, 18, 19 18, 19 17, 18 14, 15, 14, 16, 15, 16, 19 16, 18, 19 16, 17, 16, 18, 19 17, 18, 19 18, 19 17, 18, 19 17, 18, 19 17, 19 18, 19

Mean growth rate between 96 and 120 hours 101.41 15.27 -0.09 128.99 103.60 11.59 131.78 -12.37 106.16 78.40 194.77 95.98 91.82 2.09 -6.34 141.38 34.89 45.21 -2.84

SD 46.93 23.07 17.15 103.94 91.11 30.50 74.94 33.29 50.09 25.93 106.51 63.52 62.85 30.66 41.55 86.04 33.20 97.36 24.08 Significantly different (P<0.05) between 96 and 1, 2, 3, 4, 1, 2, 3, 4, 120 hours from 2, 3, 6, 8, 2, 3, 4, 6, 2, 3, 6, 8, 1, 3, 4, 5, 1, 3, 4, 5, 2, 3, 6, 8, 1, 4, 5, 7, 2, 3, 6, 8, 2, 3, 4, 6, 5, 6, 7, 8, 1, 4, 5, 7, 6, 8, 9, condition ID: 1, 4, 5, 7, 10, 11, 8, 10, 11, 1, 4, 5, 7, 10, 11, 1, 4, 5, 7, 9, 2, 3, 6, 7, 8, 2, 3, 4, 6, 7, 8, 1, 4, 5, 7, 7, 8, 9, 7, 8, 9, 1, 4, 5, 7, 9, 11, 14, 9, 10, 11, 11, 14, 7, 8, 11, 9, 10, 12, 9, 10, 11, 10, 11, 9, 10, 11, 13, 14, 13, 14, 9, 10, 11, 12, 13, 10, 11, 12, 11, 14, 15, 11, 14, 15, 16, 9, 10, 11, 10, 11, 11, 12, 10, 11, 12, 15, 16, 12, 13, 15, 16, 14, 15, 13, 14, 12, 13, 12, 13, 12, 13, 16 15, 17, 15, 17, 12, 13, 16 14, 15, 13, 16, 17, 18 16, 17, 18, 19 17, 18, 19 12, 13, 16 12, 13, 13, 14, 13, 16, 17, 18 17, 18, 19 16, 17, 18 17, 18, 19 16, 17, 19 15, 16, 16, 17, 18 14, 15, 18, 19 18, 19 17, 18, 19 15, 16 15, 16, 19 17, 18, 19 17, 18, 19

200

Condition ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Condition CeHR Liposomes CeHR + Liposomes M9 AXM CeHR (no CeHR + CeHR CeHR Liposome no CeMM Control packed with Milk OP 50 4.5 OP 50 9 x Solubilised AXM Milk CeMM packed with M9 Liposom filtered milk) Milk Filtered Liposome milk or Filtered Media filtered Pellet x 109 108 Media Pellet filtered CeMM e cholesterol AXM

Mean total growth between 24 and 48 505.73 90.22 24.92 1031.02 1030.81 1.76 877.55 0.52 494.88 153.90 1084.14 936.28 1002.47 5.06 -7.68 845.38 586.30 473.62 12.49 hours SD 51.42 24.31 16.72 86.43 72.73 25.64 81.31 25.49 38.43 26.47 51.50 75.99 69.55 29.45 36.71 72.04 60.59 86.38 20.56 Significantly 2, 3, 4, 5, 1, 3, 4, 5, 1, 2, 3, 6, 1, 2, 3, 6, 2, 3, 4, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 2, 3, 4, 5, different (P<0.05) 6, 7, 8, 6, 7, 8, 9, 1, 2, 4, 5, 1, 2, 4, 5, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 1, 2, 4, 5, 1, 2, 3, 4, 7, 8, 9, 7, 8, 9, 6, 7, 8, 5, 6, 7, 8, 5, 6, 7, 8, 1, 2, 3, 6, 7, 8, 5, 6, 7, 8, 5, 6, 7, 8, 6, 7, 8, in total growth 24 10, 11, 10, 11, 7, 9, 10, 7, 9, 10, 6, 8, 9, 10, 1, 2, 4, 5, 7, 6, 7, 8, 9, 10, 7, 9, 10, 5, 7, 9, 1, 2, 4, 5, 7, 10, 11, 10, 11, 10, 11, 9, 11, 12, 9, 10, 12, 9, 10, 11, 12, 9, 10, 11, 9, 10, 11, 10, 11, to 120 hours from 12, 13, 12, 13, 11, 12, 11, 12, 11, 12, 13, 9, 10, 11, 12, 11, 13, 14, 11, 12, 10, 11, 9, 10, 11, 12, 12, 14, 12, 14, 12, 13, 13, 14, 13, 14, 14, 15, 16, 17, 12, 13, 12, 13, 12, 13, condition ID. 14, 15, 14, 15, 13, 15, 13, 16, 14, 15, 16, 13, 16, 17, 18 15, 16, 17, 14, 16, 12, 13, 13, 16, 17, 18 15, 16, 15, 16, 14, 15, 15, 16, 15, 16, 18, 19 14, 15, 14, 15, 14, 15, 16, 17, 16, 17, 16, 17, 18 17, 18 17, 18, 19 18, 19 17, 18 16, 17, 18 17, 18, 19 17, 18, 19 16, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 16, 18, 19 16, 17, 19 18, 19 18, 19 Mean length at 24 261.45 262.06 247.65 262.31 263.60 257.57 261.37 183.74 260.25 258.73 218.15 367.12 386.99 239.77 211.59 269.67 398.12 341.28 185.48 hours SD 18.50 13.98 9.09 7.21 28.71 12.68 19.41 17.10 19.33 21.09 21.63 44.16 60.42 8.91 22.79 6.79 41.50 46.30 17.14 Significantly 1, 2, 3, 4, 1, 2, 4, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, different (P<0.05) 8, 11, 12, 8, 11, 12, 5, 8, 11, 8, 11, 12, 3, 8, 11, 8, 11, 12, 8,11, 12, 8, 11, 12, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 6, 7, 8, 9, 5, 6, 7, 8, 3, 8, 11, 5, 6, 7, 8, 5, 6, 7, 8, 8, 11, 12, 13, 6, 7, 9, 10, 6, 7, 8, 9, 10, 6, 7, 9, 10, in length at 24 13, 14, 13, 14, 12, 13, 13, 14, 12, 13, 13, 14, 13, 14, 13, 14, 9, 10, 12, 7, 8, 9, 10, 11, 10, 11, 9, 10, 12, 12, 13, 9, 10, 11, 9, 10, 11, 14, 15, 17, 11, 12, 13, 11, 13, 14, 11, 12, 13, hours from 15, 17, 15, 17, 15, 16, 15, 17, 14, 15, 15, 17, 15, 17, 15, 17, 13, 14, 12, 14, 15, 16, 12, 13, 13, 14, 14, 15, 12, 14, 12, 13, 18, 19 14, 15, 16, 15, 16, 17, 14, 15, 16, condition ID: 18, 19 18, 19 17, 18, 19 18, 19 17, 18, 19 18, 19 18, 19 18, 19 16, 17, 18, 19 15, 16, 16, 17, 17, 18, 19 15, 16, 14, 15, 17, 18 18, 19 17, 18 18, 19 17, 18, 19 18, 19 18, 19 16, 17, 19 Mean length at 48 381.57 256.44 269.88 443.01 415.98 255.47 437.33 179.09 466.67 267.94 266.36 610.35 700.66 241.13 200.79 354.21 680.54 619.66 196.60 hours SD 24.56 15.06 9.00 25.31 10.97 13.19 94.22 21.97 26.21 11.00 28.46 77.70 48.60 12.43 17.23 17.00 41.11 73.92 16.47 Significantly 2, 3, 4, 5, 1, 2, 3, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 3, 4, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, different (P<0.05) 6, 7, 8, 9, 1, 4, 5, 7, 1, 4, 5, 7, 6, 8, 9, 6, 8, 9, 1, 4, 5, 7, 1, 2, 3, 6, 8, 5, 6, 7, 8, 1, 4, 5, 7, 1, 4, 5, 7, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 5, 6, 7, 9, 5, 6, 7, 8, 5, 6, 7, 8, 5, 6, 7, 8, in length at 48 10, 11, 8, 9, 12, 8, 9, 12, 10, 11, 10, 11, 8, 9, 12, 9, 10, 11, 12, 10, 11, 8, 9, 12, 8, 9, 13, 6, 7, 9, 10, 6, 7, 9, 10, 6, 7, 8, 9, 10, 7, 8, 9, 10, 11, 10, 11, 10, 11, 9, 10, 11, 9, 10, 11, 9, 10, 11, hours condition ID: 12, 13, 13, 15, 13, 14, 12, 13, 12, 13, 13, 15, 13, 14, 15, 12, 13, 13, 14, 14, 15, 11, 12, 13, 11, 12, 13, 11, 13, 14, 12, 14, 15, 16, 12, 13, 12, 13, 12, 13, 12, 14, 13, 14, 14, 15, 16, 17, 15, 16, 14, 15, 14, 15, 16, 17, 16, 17, 18, 14, 15, 15, 16, 16, 17, 14, 15, 16, 14, 16, 17, 18 15, 16, 17, 19 18, 19 15, 16, 14, 16, 14, 15, 15, 16, 15, 16, 16, 17, 18, 19 17, 18, 19 16, 17, 16, 17, 18, 19 19 16, 17, 17, 18, 19 18, 19 17, 18 17, 18, 19 17, 18 17, 18, 19 18, 19 17, 19 18, 19 18, 19 18, 19 18, 19 Mean length at 72 434.88 337.42 270.92 1045.68 1118.99 252.11 881.96 187.67 489.33 336.52 689.17 1103.69 1042.27 240.19 199.92 627.39 845.45 729.85 198.86 hours SD 36.76 26.08 8.59 45.78 91.25 17.37 60.93 20.89 24.45 20.58 129.99 126.67 82.10 11.09 28.53 20.94 45.33 61.71 17.36 Significantly 2, 3, 4, 5, 1, 2, 3, 4, 1,3, 4, 5, 1, 2, 4, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 4, 5, 1, 3, 4, 5, 1, 2, 3, 4, 1, 2, 4, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, different (P<0.05) 6, 7, 8, 9, 1, 2, 3, 4, 5, 5, 6, 7, 8, 1, 2, 3, 4, 6, 6, 7, 8, 9, 7, 8, 9, 6, 7, 8, 9, 6, 7, 8, 9, 7, 8, 9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 5, 6, 7, 8, 1, 2, 3, 5, 6, 7, 7, 8, 9, 5, 6, 7, 9, 5, 6, 7, 8, 5, 6, 7, 8, 5, 6, 7, 8, 1, 2, 3, 4, 5, in length at 72 10, 11, 6, 8, 9, 10, 10, 11, 7, 8, 9, 10, 11, 12, 10, 11, 10, 11, 10, 11, 10, 11, 6, 7, 9, 10, 11, 12, 9, 10, 12, 8, 9, 10, 11, 12, 10, 11, 10, 11, 9, 10, 11, 9, 10, 11, 9, 10, 11, 6, 7, 9, 10, condition ID: 12, 13, 11, 12, 13, 12, 13, 11, 13, 14, 13, 14, 12, 13, 12, 14, 13, 14, 12, 13, 11, 12, 13, 13, 14, 13, 14, 14, 15, 16, 17, 12, 13, 12, 13, 12, 13, 12, 13, 12, 13, 11, 12, 13, 14, 15, 14, 15, 16, 14, 15, 15, 16, 17, 15, 16, 15, 16, 15, 16, 15, 16, 15, 16, 14, 16, 17, 18 15, 16, 15, 16, 18, 19 15, 16, 14, 16, 14, 15, 14, 15, 14, 15, 14, 16, 17, 18 16, 17, 17, 18, 19 16, 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18 17, 18, 19 16, 18, 19 16, 17, 19 18, 19 18, 19 Mean length at 96 665.78 337.01 272.66 1164.34 1190.81 247.73 1007.15 196.63 648.97 334.23 1107.52 1207.42 1297.64 242.74 209.02 973.67 949.53 769.69 200.81 hours SD 40.63 14.01 12.23 80.87 57.93 15.44 52.57 20.99 32.99 18.87 81.65 90.09 89.02 21.90 28.65 48.53 44.04 67.47 18.77 Significantly 2, 3, 4, 5, 1, 2, 4, 5, 1, 2, 3, 6, 2, 3, 4, 5, 1, 3, 4, 5, 1, 3, 4, 5, 1, 2, 3, 6, 1, 2, 4, 5, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, different (P<0.05) 6, 7, 8, 6, 7, 8, 9, 7, 8, 9, 1, 2, 3, 4, 5, 6, 7, 8, 6, 7, 8, 9, 1, 2, 3, 4, 6, 6, 7, 8, 9, 7, 8, 9, 7, 8, 9, 1, 2, 3, 4, 5, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 5, 7, 8, 9, 5, 6, 7, 9, 5, 6, 7, 8, 5, 6, 7, 8, 5, 6, 7, 8, 1, 2, 3, 4, 5, in length at 96 10, 11, 10, 11, 10, 11, 6, 8, 9, 10, 10, 11, 10, 11, 7, 8, 9, 10, 11, 12, 10, 11, 10, 11, 6, 7, 9, 10, 9, 10, 12, 7, 8, 9, 10, 11, 10, 11, 10, 11, 9, 10, 11, 9, 10, 11, 9, 10, 11, 6, 7, 9, 10, hours from 12, 13, 12, 13, 12, 13, 11, 12, 13, 12, 13, 12, 13, 11, 13, 14, 13, 14, 13, 14, 12, 13, 11, 12, 13, 13, 14, 12, 14, 15, 16, 12, 13, 12, 13, 12, 13, 12, 13, 12, 13, 11, 12, 13, condition ID: 14, 15, 14, 15, 14, 15, 14, 15, 16, 14, 15, 14, 15, 15, 16, 17, 15, 16, 15, 16, 15, 16, 14, 16, 17, 18 15, 16, 17, 18, 19 15, 16, 14, 16, 14, 15, 14, 15, 14, 15, 14, 16, 17, 18 16, 17, 16, 17, 16, 17, 17, 18, 19 16, 17, 16, 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18, 19 17, 18 18, 19 18, 19 16, 17, 19 18, 19 18, 19 18, 19 18, 19 18, 19 Mean Length at 120 767.18 352.27 272.57 1293.33 1294.41 259.33 1138.92 184.26 755.13 412.63 1302.29 1303.40 1389.47 244.83 205.15 1115.05 984.42 814.90 197.97 hours SD 47.98 18.85 11.77 85.78 74.58 20.97 73.50 21.51 34.34 19.64 47.18 62.00 55.09 28.91 30.04 70.11 41.82 74.15 15.97 Significantly 2, 3, 4, 5, 1, 3, 4, 5, 1, 2, 4, 5, 2, 3, 4, 5, 1, 2, 3, 6, 1, 2, 3, 6, 1, 2, 4, 5, 1, 2, 3, 4, 1, 2, 3, 6, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, 1, 2, 3, 4, different 6, 7, 8, 6, 7, 8, 9, 7, 8, 9, 1, 2, 3, 4, 5, 6, 7, 8, 7, 8, 9, 7, 8, 9, 7, 8, 9, 1, 2, 3, 4, 5, 5, 6, 7, 8, 7, 8, 9, 1, 2, 3, 6, 7, 1, 2, 3, 4, 5, 6, 5, 7, 8, 9, 5, 6, 7, 9, 5, 6, 8, 9, 5, 6, 7, 8, 5, 6, 7, 8, 1, 2, 3, 4, 5, (P<0.05)in length 10, 11, 10, 11, 10, 11, 6, 7, 9, 10, 10, 11, 10, 13, 10, 13, 10, 11, 6, 7, 9, 10, 9, 11, 12, 10, 13, 8, 9, 10, 13, 7, 8, 9, 10, 11, 10, 11, 10, 11, 10, 11, 9, 10, 11, 9, 10, 11, 6, 7, 9, 10, growth at 120 12, 13, 12, 13, 12, 13, 11, 12, 13, 12, 13, 14, 15, 14, 15, 12, 13, 11, 12, 13, 13, 14, 14, 15, 14, 15, 16, 12, 14, 15, 16, 12, 13, 12, 13, 12, 13, 12, 13, 12, 13, 11, 12, 13, hours from 14, 15, 14, 15, 14, 15, 14, 15, 17, 14, 15, 16, 17, 16, 17, 15, 16, 14, 16, 17, 18 15, 16, 16, 17, 17, 18, 19 17, 18, 19 15, 16, 14, 16, 14, 15, 14, 15, 14, 15, 14, 16, 17, 18 condition ID: 16, 17, 16, 17, 16, 17, 18, 19 16, 17, 18, 19 18, 19 17, 18, 19 17, 18, 19 18, 19 17, 18, 19 17, 18 17, 18, 19 16, 18, 19 16, 17, 19 18, 19 18, 19 18, 19 18, 19

201

202