DOCSLIB.ORG

Function and Crystal Structure of the Dimeric P-Loop Atpase CFD1 Coordinating an Exposed [4Fe-4S] Cluster for Transfer to Apoproteins

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Function and Crystal Structure of the Dimeric P-Loop Atpase CFD1 Coordinating an Exposed [4Fe-4S] Cluster for Transfer to Apoproteins Function and crystal structure of the dimeric P-loop ATPase CFD1 coordinating an exposed [4Fe-4S] cluster for transfer to apoproteins Oliver Stehlinga, Jae-Hun Jeoungb, Sven A. Freiberta,c, Viktoria D. Paula, Sebastian Bänfera, Brigitte Niggemeyera, Ralf Rössera, Holger Dobbekb, and Roland Lilla,c,1 aInstitut für Zytobiologie und Zytopathologie, Philipps-Universität Marburg, 35033 Marburg, Germany; bInstitut für Biologie, Strukturbiologie/Biochemie, Humboldt-Universität zu Berlin, 10115 Berlin, Germany; and cZentrum für Synthetische Mikrobiologie SynMikro, Offensive for the Development of Scientific and Economic Excellence of the State of Hesse (LOEWE), 35043 Marburg, Germany Edited by Elizabeth Anne Craig, University of Wisconsin, Madison, WI, and approved August 13, 2018 (received for review May 4, 2018) Maturation of iron-sulfur (Fe-S) proteins in eukaryotes requires leased from the scaffold and transiently bound by transfer pro- complex machineries in mitochondria and cytosol. Initially, Fe-S teins. Finally, dedicated targeting factors assist the insertion of clusters are assembled on dedicated scaffold proteins and then are the cluster into specific apoproteins. trafficked to target apoproteins. Within the cytosolic Fe-S protein Insights into the composition and function of the CIA ma- assembly (CIA) machinery, the conserved P-loop nucleoside triphos- chinery were initially obtained in yeast. Two homologous P-loop phatase Nbp35 performs a scaffold function. In yeast, Nbp35 ATPases termed “Cfd1” and “Nbp35” were shown to serve as a cooperates with the related Cfd1, which is evolutionary less scaffold complex that de novo assembles a [4Fe-4S] cluster (12– conserved and is absent in plants. Here, we investigated the 18). This synthesis reaction requires the electron transport chain potential scaffold function of human CFD1 (NUBP2) in CFD1- composed of the diflavin oxidoreductase Tah18 and the Fe-S 55 depleted HeLa cells by measuring Fe-S enzyme activities or Fe in- protein Dre2 (19, 20). Trafficking of the [4Fe-4S] cluster and corporation into Fe-S target proteins. We show that CFD1, in com- its insertion into apoproteins are accomplished by the iron-only plex with NBP35 (NUBP1), performs a crucial role in the maturation hydrogenase-like Fe-S protein Nar1 (21, 22) and the CIA- BIOCHEMISTRY of all tested cytosolic and nuclear Fe-S proteins, including essential targeting complex (CTC) composed of the WD40 protein Cia1, ones involved in protein translation and DNA maintenance. CFD1 the DUF59 protein Cia2, and the HEAT repeat family protein also matures iron regulatory protein 1 and thus is critical for cellular Mms19 (23–25). A further, highly specialized function is exe- iron homeostasis. To better understand the scaffold function of cuted by the adapter complex Yae1-Lto1 that facilitates [4Fe-4S] Chaetomium ther- CFD1-NBP35, we resolved the crystal structure of cluster insertion into the ABC protein Rli1 (26). Functional mophilum holo-Cfd1 (ctCfd1) at 2.6-Å resolution as a model Cfd1 analyses revealed an additional requirement of the cytosolic protein. Importantly, two ctCfd1 monomers coordinate a bridging monothiol glutaredoxins Grx3 and Grx4 for cytosolic-nuclear Fe-S [4Fe-4S] cluster via two conserved cysteine residues. The surface- protein biogenesis, but the step in the maturation pathway at exposed topology of the cluster is ideally suited for both de novo which they act is currently unknown (27). assembly and facile transfer to Fe-S apoproteins mediated by other CIA factors. ctCfd1 specifically interacted with ATP, which presum- ably associates with a pocket near the Cfd1 dimer interface formed Significance by the conserved Walker motif. In contrast, ctNbp35 preferentially bound GTP, implying differential regulation of the two fungal scaf- Eukaryotic iron-sulfur (Fe-S) proteins play essential roles in fold components during Fe-S cluster assembly and/or release. energy conversion, antiviral defense, protein translation, genome integrity, and iron homeostasis. Assembly of the CIA machinery | NUBP1-NUBP2 | NBP35 | iron-sulfur protein | metallo-cofactors is assisted by complex machineries involving iron homeostasis more than 30 known components. The initial phase of Fe-S protein maturation in the human cytosol is poorly studied thus far, with the P-loop nucleoside triphosphatase NBP35 being the roteins harboring iron-sulfur (Fe-S) cofactors participate in only known assembly factor. Here, we identified and charac- numerous essential cellular processes including respiration, P terized human CFD1 as an indispensable complex partner of nucleotide and amino acid metabolism, genome maintenance, NBP35 in cytosolic Fe-S protein assembly (CIA). The crystal ribosome function, antiviral response, and iron homeostasis. The structure of fungal holo-Cfd1 showed a surface-exposed [4Fe-4S] synthesis of these simple metallo-cofactors and their target- cluster. Its shared, surface-exposed coordination by two specific insertion into apoproteins follows a complex pathway Cfd1 monomers has important mechanistic implications for the mediated by conserved assembly systems in mitochondria and – ATP-dependent de novo cluster assembly and subsequent cytosol (1 4). The mitochondrial Fe-S cluster (ISC) assembly transfer to apoproteins via downstream CIA components. machinery includes the cysteine desulfurase complex NFS1- ISD11 that provides the sulfur required for the assembly of Author contributions: O.S., J.-H.J., S.A.F., H.D., and R.L. designed research; O.S., J.-H.J., both mitochondrial and extramitochondrial Fe-S clusters (5, 6). S.A.F., V.D.P., S.B., B.N., and R.R. performed research; O.S., J.-H.J., S.A.F., V.D.P., S.B., H.D., An export system with the mitochondrial inner membrane ATP- and R.L. analyzed data; and O.S., J.-H.J., S.A.F., H.D., and R.L. wrote the paper. binding cassette (ABC) transporter Atm1 (human ABCB7) The authors declare no conflict of interest. transports an ill-defined sulfur-containing compound from mi- This article is a PNAS Direct Submission. tochondria to the cytosolic Fe-S protein assembly (CIA) ma- Published under the PNAS license. chinery that catalyzes maturation of both cytosolic and nuclear Data deposition: The atomic coordinates and structure factors reported in this paper have Fe-S proteins (7–9). Although the ISC and CIA systems are not been deposited in the Protein Data Bank, www.wwpdb.org (PDB ID code 6G2G). evolutionarily related, they share some common mechanistic 1To whom correspondence should be addressed. Email: [email protected]. principles during biogenesis (10, 11). First, dedicated assembly This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. factors catalyze the de novo formation of an Fe-S cluster on a 1073/pnas.1807762115/-/DCSupplemental. scaffold complex. Second, the newly made Fe-S cluster is re- www.pnas.org/cgi/doi/10.1073/pnas.1807762115 PNAS Latest Articles | 1of10 Downloaded by guest on September 30, 2021 In human cells, the CIA pathway is less well characterized, Depletion of Human CFD1 Affects both Fe-S Cluster Assembly on especially in its initial steps where only NBP35 [also termed IRP1 and Cellular Iron Homeostasis. We tested the effect of CFD1 “NUBP1” (28)] has been functionally defined as a CIA factor depletion on the maturation of iron regulatory protein 1 (IRP1), (29). So far, the human homologs of yeast Tah18, Dre2, and a bifunctional cytosolic protein with a critical sensory role in iron Cfd1, termed “NDOR1,”“CIAPIN1,” and “CFD1” (NUBP2), metabolism (2, 44). Assembly of its [4Fe-4S] cluster and con- respectively, have not been assigned a function in Fe-S protein version to cytosolic aconitase (cytAco) was shown previously to biogenesis in vivo. Work performed in vitro and by yeast com- require NBP35, IOP1, and the specialized CIA-targeting factor plementation has suggested that human NDOR1 and CIAPIN1 CIA2A (29, 36, 38). The Fe-S cluster is lost under iron deficiency have a biochemical function similar to that of their homologs in or upon Fe-S protein biogenesis defects, which induce IRP1 to bind to mRNA stem–loop structures called “iron-responsive el- yeast (20, 30). Interestingly, plants lack a homolog of Cfd1, and ” plant Nbp35 has been shown to fulfill its scaffold function in- ements (IREs), thereby posttranscriptionally regulating the dependently of this partner (31). Trypanosomes, on the other expression of various proteins involved in cellular iron homeo- stasis. We assessed cytAco activity in cytosolic fractions almost hand, seem to rely on both Nbp35 and Cfd1 for cytosolic Fe-S devoid of mitochondrial contaminations as indicated by cytosolic protein biogenesis (32). In higher eukaryotes NBP35 and CFD1 lactate dehydrogenase (LDH) and mitochondrial citrate synthase have been implicated in the organization of microtubules, cen- – (CS) enzyme activities (SI Appendix,Fig.S3A and B). RNAi- trosomes, and cilia (33 35), but it remains unclear whether this mediated depletion of CFD1 resulted in a time-dependent de- role is direct or indirect. The second part of the human CIA cline of cytAco activity by up to 70% (Fig. 1B, Lower and SI pathway is much better characterized than the initial phase. Cell Appendix, Fig. S3C), in line with earlier findings in HEK293 cells biological and biochemical studies have identified essential roles (45). Further, IRP1 protein levels decreased substantially (Fig. 1B, of the Nar1 homolog IOP1, the CTC components CIAO1- Upper and SI Appendix, Fig. S3D), presumably due to impaired – CIA2B-MMS19, and CIA2A (25, 36 41). The latter four com- IRP1 protein stability as a consequence of defective Fe-S cluster ponents, in particular, were shown to assist several target-specific assembly (38, 46). Consistent with the cytosolic location of CFD1, Fe-S cluster-insertion routes by transient binding to their dedi- its depletion did not affect activities or protein levels of the two cated Fe-S apoproteins (SI Appendix, Fig. S1) (9, 25, 38, 42). mitochondrial Fe-S enzymes aconitase (mtAco) and succinate Nbp35 and Cfd1 belong to the SIMIBI (signal recognition, dehydrogenase (SDH) (SI Appendix,Fig.S3E–H).
Load more

Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name NADPH dependent diflavin oxidoreductase 1 Gene Symbol NDOR1 Organism Human Gene Summary This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. Gene Aliases MGC138148, NR1, bA350O14.9 RefSeq Accession No. NC_000009.11, NG_027801.1, NT_024000.16 UniGene ID Hs.512564 Ensembl Gene ID ENSG00000188566 Entrez Gene ID 27158 Assay Information Unique Assay ID qHsaCED0004821 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000371521, ENST00000344894, ENST00000458322, ENST00000427047 Amplicon Context Sequence CATGAGCTGGAGCGGGAGAAGCTGCTGGAGTTCAGTTCTGCCCAAGGCCAGGA GGAGCTCTTTGAATACTGCAACCGGCCCCGCAGGACCATC Amplicon Length (bp) 63 Chromosome Location 9:140109372-140109464 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9996 cDNA Cq 22.5 cDNA Tm (Celsius) 82 gDNA Cq 24.37 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report NDOR1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Download Download
    Supplementary Figure S1. Results of flow cytometry analysis, performed to estimate CD34 positivity, after immunomagnetic separation in two different experiments. As monoclonal antibody for labeling the sample, the fluorescein isothiocyanate (FITC)- conjugated mouse anti-human CD34 MoAb (Mylteni) was used. Briefly, cell samples were incubated in the presence of the indicated MoAbs, at the proper dilution, in PBS containing 5% FCS and 1% Fc receptor (FcR) blocking reagent (Miltenyi) for 30 min at 4 C. Cells were then washed twice, resuspended with PBS and analyzed by a Coulter Epics XL (Coulter Electronics Inc., Hialeah, FL, USA) flow cytometer. only use Non-commercial 1 Supplementary Table S1. Complete list of the datasets used in this study and their sources. GEO Total samples Geo selected GEO accession of used Platform Reference series in series samples samples GSM142565 GSM142566 GSM142567 GSM142568 GSE6146 HG-U133A 14 8 - GSM142569 GSM142571 GSM142572 GSM142574 GSM51391 GSM51392 GSE2666 HG-U133A 36 4 1 GSM51393 GSM51394 only GSM321583 GSE12803 HG-U133A 20 3 GSM321584 2 GSM321585 use Promyelocytes_1 Promyelocytes_2 Promyelocytes_3 Promyelocytes_4 HG-U133A 8 8 3 GSE64282 Promyelocytes_5 Promyelocytes_6 Promyelocytes_7 Promyelocytes_8 Non-commercial 2 Supplementary Table S2. Chromosomal regions up-regulated in CD34+ samples as identified by the LAP procedure with the two-class statistics coded in the PREDA R package and an FDR threshold of 0.5. Functional enrichment analysis has been performed using DAVID (http://david.abcc.ncifcrf.gov/)
    [Show full text]
  • UNIVERSITY of CALIFORNIA, SAN DIEGO Biochemical and Structural
    UNIVERSITY OF CALIFORNIA, SAN DIEGO Biochemical and Structural Characterization of the NEET Protein Family and their Role in Iron Homeostasis and Disease A Dissertation submitted in partial satisfaction of the requirements of the degree Doctor of Philosophy in Chemistry by Colin Harrison Lipper Committee in charge: Professor Patricia A. Jennings, Chair Professor Joseph A. Adams Professor Michael Galperin Professor Stanley J. Opella Professor Navtej Toor 2017 Copyright Colin Harrison Lipper, 2017 All rights reserved The dissertation of Colin Harrison Lipper is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Chair UNIVERSITY OF CALIFORNIA, SAN DIEGO 2017 iii DEDICATION To my wife Hope. Thank you for all of your love and support. I could not have done this without you. iv TABLE OF CONTENTS Signature Page ................................................................................................ iii Dedication ....................................................................................................... iv Table of Contents ............................................................................................. v List of Figures .................................................................................................. vi List of Tables ................................................................................................... ix List of Abbreviations ..............................................................................……... x Acknowledgements .......................................................................................
    [Show full text]
  • Role of GSH and Iron-Sulfur Glutaredoxins in Iron Metabolism—Review
    molecules Review Role of GSH and Iron-Sulfur Glutaredoxins in Iron Metabolism—Review 1, 1, 1 1 Trnka Daniel y , Hossain Md Faruq y , Jordt Laura Magdalena , Gellert Manuela and Lillig Christopher Horst 2,* 1 Institute for Medical Biochemistry and Molecular Biology, University Medicine, University of Greifswald, 17475 Greifswald, Germany; [email protected] (T.D.); [email protected] (H.M.F.); [email protected] (J.L.M.); [email protected] (G.M.) 2 Christopher Horst Lillig, Institute for Medical Biochemistry and Molecular Biology, University Medicine Greifswald, Ferdinand-Sauerbruch-Straße, 17475 Greifswald, Germany * Correspondence: [email protected]; Tel.: +49-3834-865407; Fax: +49-3834-865402 These authors contributed equally to this work. y Academic Editor: Pál Perjési Received: 29 July 2020; Accepted: 22 August 2020; Published: 25 August 2020 Abstract: Glutathione (GSH) was initially identified and characterized for its redox properties and later for its contributions to detoxification reactions. Over the past decade, however, the essential contributions of glutathione to cellular iron metabolism have come more and more into focus. GSH is indispensable in mitochondrial iron-sulfur (FeS) cluster biosynthesis, primarily by co-ligating FeS clusters as a cofactor of the CGFS-type (class II) glutaredoxins (Grxs). GSH is required for the export of the yet to be defined FeS precursor from the mitochondria to the cytosol. In the cytosol, it is an essential cofactor, again of the multi-domain CGFS-type Grxs, master players in cellular iron and FeS trafficking. In this review, we summarize the recent advances and progress in this field. The most urgent open questions are discussed, such as the role of GSH in the export of FeS precursors from mitochondria, the physiological roles of the CGFS-type Grx interactions with BolA-like proteins and the cluster transfer between Grxs and recipient proteins.
    [Show full text]
  • Genomic and Transcriptomic Investigations Into the Feed Efficiency Phenotype of Beef Cattle
    Provided by the author(s) and NUI Galway in accordance with publisher policies. Please cite the published version when available. Title Genomic and transcriptomic investigations into the feed efficiency phenotype of beef cattle Author(s) Higgins, Marc Publication Date 2019-03-06 Publisher NUI Galway Item record http://hdl.handle.net/10379/15008 Downloaded 2021-09-25T18:07:39Z Some rights reserved. For more information, please see the item record link above. Genomic and Transcriptomic Investigations into the Feed Efficiency Phenotype of Beef Cattle Marc Higgins, B.Sc., M.Sc. A thesis submitted for the Degree of Doctor of Philosophy to the Discipline of Biochemistry, School of Natural Sciences, National University of Ireland, Galway. Supervisor: Dr. Derek Morris Discipline of Biochemistry, School of Natural Sciences, National University of Ireland, Galway. Supervisor: Dr. Sinéad Waters Teagasc, Animal and Bioscience Research Department, Animal & Grassland Research and Innovation Centre, Teagasc, Grange. Submitted November 2018 Table of Contents Declaration ................................................................................................................ vii Funding .................................................................................................................... viii Acknowledgements .................................................................................................... ix Abstract ......................................................................................................................
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Classification and Evolution of P-Loop Gtpases and Related Atpases Detlefd.Leipe,Yurii.Wolf,Eugenev.Koonin*Andl.Aravind
    doi:10.1006/jmbi.2001.5378availableonlineathttp://www.idealibrary.comon J. Mol. Biol. (2002) 317, 41±72 Classification and Evolution of P-loop GTPases and Related ATPases DetlefD.Leipe,YuriI.Wolf,EugeneV.Koonin*andL.Aravind National Center for Sequences and available structures were compared for all the widely dis- Biotechnology Information tributed representatives of the P-loop GTPases and GTPase-related pro- National Library of Medicine teins with the aim of constructing an evolutionary classi®cation for this National Institutes of Health superclass of proteins and reconstructing the principal events in their Bethesda, MD 20894, USA evolution. The GTPase superclass can be divided into two large classes, each of which has a unique set of sequence and structural signatures (synapomorphies). The ®rst class, designated TRAFAC (after translation factors) includes enzymes involved in translation (initiation, elongation, and release factors), signal transduction (in particular, the extended Ras- like family), cell motility, and intracellular transport. The second class, designated SIMIBI (after signal recognition particle, MinD, and BioD), consists of signal recognition particle (SRP) GTPases, the assemblage of MinD-like ATPases, which are involved in protein localization, chromo- some partitioning, and membrane transport, and a group of metabolic enzymes with kinase or related phosphate transferase activity. These two classes together contain over 20 distinct families that are further subdi- vided into 57 subfamilies (ancient lineages) on the basis of conserved sequence motifs, shared structural features, and domain architectures. Ten subfamilies show a universal phyletic distribution compatible with presence in the last universal common ancestor of the extant life forms (LUCA). These include four translation factors, two OBG-like GTPases, the YawG/YlqF-like GTPases (these two subfamilies also consist of pre- dicted translation factors), the two signal-recognition-associated GTPases, and the MRP subfamily of MinD-like ATPases.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Fe-S Protein Synthesis in Green Algae Mitochondria
    plants Review Fe-S Protein Synthesis in Green Algae Mitochondria Diego F. Gomez-Casati * , Maria V. Busi *, Julieta Barchiesi, Maria A. Pagani , Noelia S. Marchetti-Acosta and Agustina Terenzi Centro de Estudios Fotosintéticos y Bioquímicos (CEFOBI-CONICET), Universidad Nacional de Rosario, 2000 Rosario, Argentina; [email protected] (J.B.); [email protected] (M.A.P.); [email protected] (N.S.M.-A.); [email protected] (A.T.) * Correspondence: [email protected] (D.F.G.-C.); [email protected] (M.V.B.); Tel.: +54-341-4391955 (ext. 113) (D.F.G.-C. & M.V.B.) Abstract: Iron and sulfur are two essential elements for all organisms. These elements form the Fe-S clusters that are present as cofactors in numerous proteins and protein complexes related to key processes in cells, such as respiration and photosynthesis, and participate in numerous enzymatic reactions. In photosynthetic organisms, the ISC and SUF Fe-S cluster synthesis pathways are located in organelles, mitochondria, and chloroplasts, respectively. There is also a third biosynthetic machinery in the cytosol (CIA) that is dependent on the mitochondria for its function. The genes and proteins that participate in these assembly pathways have been described mainly in bacteria, yeasts, humans, and recently in higher plants. However, little is known about the proteins that participate in these processes in algae. This review work is mainly focused on releasing the information on the existence of genes and proteins of green algae (chlorophytes) that could participate in the assembly process of Fe-S groups, especially in the mitochondrial ISC and CIA pathways.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Large-Scale Discovery of Mouse Transgenic Integration Sites Reveals Frequent Structural Variation and Insertional Mutagenesis
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Large-scale discovery of mouse transgenic integration sites reveals frequent structural variation and insertional mutagenesis Leslie O. Goodwin,1 Erik Splinter,2 Tiffany L. Davis,1 Rachel Urban,1 Hao He,3 Robert E. Braun,1 Elissa J. Chesler,1 Vivek Kumar,1 Max van Min,2 Juliet Ndukum,1 Vivek M. Philip,1 Laura G. Reinholdt,1 Karen Svenson,1 Jacqueline K. White,1 Michael Sasner,1 Cathleen Lutz,1 and Stephen A. Murray1 1The Jackson Laboratory, Bar Harbor, Maine 04609, USA; 2Cergentis B.V., 3584 CM Utrecht, The Netherlands; 3The Jackson Laboratory for Genomic Medicine, Farmington, Connecticut 06032, USA Transgenesis has been a mainstay of mouse genetics for over 30 yr, providing numerous models of human disease and critical genetic tools in widespread use today. Generated through the random integration of DNA fragments into the host genome, transgenesis can lead to insertional mutagenesis if a coding gene or an essential element is disrupted, and there is evidence that larger scale structural variation can accompany the integration. The insertion sites of only a tiny fraction of the thousands of transgenic lines in existence have been discovered and reported, due in part to limitations in the discovery tools. Targeted locus amplification (TLA) provides a robust and efficient means to identify both the insertion site and content of transgenes through deep sequencing of genomic loci linked to specific known transgene cassettes. Here, we report the first large-scale analysis of transgene insertion sites from 40 highly used transgenic mouse lines.
    [Show full text]