DOCSLIB.ORG

DOCTOR of PHILOSOPHY in Department of Biotechnology Sumit

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DOCTOR of PHILOSOPHY in Department of Biotechnology Sumit BIOACCESSIBILITY OF SELENIUM IN WHEAT, RICE AND MUSTARD GROWN IN SELENIFEROUS SOILS AND ITS BIOACTIVITY A thesis submitted in fulfillment of the requirement for the award of the degree of DOCTOR OF PHILOSOPHY in Department of Biotechnology by Sumit Kumar Jaiswal (Regd No. 900900011) Department of Biotechnology Thapar University Patiala – 147004, India July 2016 § Dedicated To My Parents § Acknowledgement At the very onset and above all I must bow with all the humility before the divine power who has bestowed me with the requisite intelligence health and above all the will to carry out to consummation the stupendous task of investigation. I also thank him for bringing in contact with learned team of guides as well as loving and caring friends all of whom have contributed to my success. I feel privileged to express my dense sense of gratitude, indebtedness to my respected and worthy supervisor Prof. N. Tejo Prakash, Professor, School of Energy and Environment , Thapar University, Patiala, India, for their valuable guidance, keen interest, constant and vital encouragement, constructive criticism, patronage and dedication for research rendered to me during my work as well as in preparation of manuscript, which led me with perfection to achieve my goal. I extend my heartfelt thanks to them forever throughout my life. I would like to thank the rest of my doctoral committee, Dr. Dinesh Goyal (Professor and Head, DBT, TU), Dr. Sanjai Saxena (Professor, DBT, TU) and Dr. Bonamali Pal, (Professor and Head, SCBC, TU), for their encouragement, insightful comments, and relevant mid-course suggestion. I deem it a pleasure to express my regards and gratitude to Dr. Ranjana Prakash, (Associate Professor, SCBC, TU), Dr. Raghunath Acharya (Scientific officer ‘G’, RCD, BARC, India) for their kindness, support, professional guidance and valuable advice in many different ways and Dr. O. P. Pandey, Dean (Research and Sponsored Projects) for providing help and support during the course of work. i My warm thanks are due to all faculty members of Department of Biotechnology and School of Energy and Environment, TU, Patiala, for their meticulous guidance, keen interest, invaluable suggestion and constant support during the course of my study. The personal and professional guidance that I received from them would be cherished lifelong. I express my regards and grateful to my seniors Dr. Saurabh Gupta, Dr. Neetu Sharma, Dr. Satnam Singh Aulakh, Dr. Poonam Bhatia and my lab mates Mr. Anirudh sharma, Ms. Noorpreet, Mr. Avdhesh Kumar Gangwar and Ms. Rachana Pandey for providing keen interest, unfailing support, inspiration, critical observations and ingenuous suggestions for my research work. I would like this opportunity to express my heartfelt thanks to my friends, Dr. Nadeem Akhtar, Dr. Raghu, Dr. Anshu Bansal, Mr. Rajneesh Verma, Mr. Vineet Meshram, Ms. Neha Lohia, Ms. Neha Kapoor, Ms. Mahiti Gupta, Ms. Divya Singhal, Mr. Vagish Dwibedi and Ms. Prerna for their invaluable smiles and friendship during the course, which has motivated and encouraged me for my research work. I also thank those who could not find a separate name but helped me directly or indirectly. For all the sacrifices that my dear parents so selflessly made, words at my command are inadequate in form and spirit to convey the depth of feelings towards them for showering their blessings, flourishing, inspiration, encouraging support which brought me up to this level. Words are too less to express my love towards my younger brother Amit and sweet sister Shuchi for their loving affection throughout. Date: 14-10-2016 Sumit Kumar Jaiswal Place: Patiala ii Table of Content Page No. Acknowledgement i-ii Table of Content iii-v List of Figures vi-viii List of Tables ix ABSTRACT 1-2 CHAPTER 1.0 INTRODUCTION 3-11 1.1 Geographic distribution of selenium 3 1.2 Biological role of selenium 4 1.3 Selenium metabolism in plants 6 1.4 Selenium metabolism in humans 8 1.5 Selenium in food crops and their biological properties 9 CHAPTER 2.0 REVIEW OF LITERATURE 12-23 2.1 Selenium in soil 12 2.2 Selenium in food 14 2.3 Selenium intake and bioavailability 15 2.4 Selenium deficiency and toxicity 16 2.5 Metabolic importance of selenium 18 2.6 Bioactive properties of selenium in plants 19 2.7 Lacunae 23 CHAPTER 3.0 MATERIALS AND METHODS 24-41 3.1 Sample collection 24 3.2 Sample preparation 24 3.2.1 Raw and baked wheat 24 3.2.2 Raw and cooked rice 24 3.2.3 Wheatgrass 24 3.2.4 Mustard seed, oil and oil cake 25 3.3 Estimation of total selenium 25 3.3.1 Estimation of selenium using fluorescence spectrometer 25 3.3.2 Estimation of selenium in mustard samples using instrumental neutron 26 activation analysis (INAA) 3.4 Studies on bioaccessibility of selenium in various matrices 27 3.4.1 Sample preparation 27 3.4.2 Procedure for in-vitro GI digestion 28 3.4.3 Quantification of bioaccessible selenium 28 3.5 Studies on selenium induced properties in wheatgrass 29 3.5.1 Bioactive properties of wheatgrass - In-vitro assays 29 3.5.1.1 Preparation of extracts 29 3.5.1.2 Determination of total phenolic content (TPC) 29 3.5.1.3 Determination of total flavonoid content 30 3.5.1.4 DPPH radical scavenging assay 30 3.5.1.5 Trolox equivalent antioxidant capacity (TEAC) assay 30 3.5.1.6 Ferric reducing antioxidant power (FRAP) assay 31 3.5.1.7 Iron (Fe2+) chelating capacity 31 iii 3.5.1.8 Determination of lipid peroxidation (TBARS assay) 31 3.5.1.9 Estimation of chlorophyll content in wheatgrass 32 3.5.2 Bioactive properties of wheatgrass - Antioxidant enzyme assay 32 3.5.2.1 Preparation of enzyme extracts 33 3.5.2.2 Catalase (CAT) activity 33 3.5.2.3 Ascorbate peroxidase (APx) activity 33 3.5.2.4 Glutathione reductase (GR) activity 33 3.5.2.5 Glutathione peroxidase (GPx) activity 34 3.5.2.6 Guaiacol peroxidase (GuPx) activity 34 3.5.2.7 Superoxide dismutase (SOD) activity 34 3.5.3 Characterization of free and bound phenolic compounds, and their 35 bioaccessibility from wheatgrass 3.5.3.1 Extraction of free phenolic compounds 35 3.5.3.2 Extraction of cell wall bound phenolics 35 3.5.3.3 HPLC analysis of phenolics 35 3.5.3.4 Bioaccessibility of phenolic compounds from wheatgrass 36 3.6 Isoselenocyanates and Se-rich proteins form selenium-rich mustard cake 36 3.6.1 Isolation of isoselenocyanates from selenium-rich mustard cake 36 3.6.2 Estimation of selenium from crude ITCs/ISeCs fraction 37 3.6.3 Cyclocondensation assay based quantification of ITCs/ISeCs in crude 37 oily residue 3.6.4 Speciation of ITCs/ISCs in oily residue using GC-MS 38 3.6.5 Extraction of protein from Se-rich mustard cake 38 3.6.6 Cytoprotective effect of Se-rich mustard protein 39 3.6.7 Assay of antioxidant enzyme 40 CHAPTER 4.0 RESULTS AND DISCUSSION 42-113 4.1 Estimation of total selenium 42 4.2 Quantification of bioaccessible selenium 50 4.3 Studies on selenium induced properties in wheatgrass 55 4.3.1 Bioactive properties of wheatgrass - In-vitro biochemical assays 55 4.3.1.1 Total phenolic content (TPC) 55 4.3.1.2 Total flavonoid content (TFC) 60 4.3.1.3 DPPH radical scavenging capacity 62 4.3.1.4 Trolox equivalent antioxidant capacity (TEAC) assay 65 4.3.1.5 Ferric reducing antioxidant power (FRAP) assay 66 4.3.1.6 Iron (Fe2+) chelating capacity 68 4.3.1.7 Lipid peroxidation (TBARS assay) 70 4.3.1.8 Chlorophyll content 72 4.3.2 Bioactive properties of wheatgrass – In-vitro Antioxidant enzyme 75 assay 4.3.2.1 Superoxide dismutase (SOD) activity 75 4.3.2.2 Catalase (CAT) activity 77 4.3.2.3 Glutathione peroxidase (GPx), ascorbate peroxidase (APx), 78 guaiacol peroxidase (GuPx) and glutathione reductase (GR) activity 4.3.3 Characterization of free and bound phenolic compounds, and their in- 83 iv vitro bioaccessibility from wheatgrass 4.4 Isolation, quantification and characterization of isoselenocyanates (ISeCs) 93 from Se-rich mustard cake 4.4.1 GC-MS based speciation of ITCs/ISeCs in oily residue isolated from 94 Se-rich mustard cake 4.5 Cytoprotective effect of selenium-rich mustard protein 101 4.6 Selenium induced glutathione peroxidase (GPx) enzyme in mouse melanoma 109 cells CONCLUSION 114 REREFENCES 115-153 PUBLICATIONS 154 v List of Figures Figure. No. Title Page No. Figure 1.1 Schematic overview of Se metabolism in plants 6 Figure 1.2 Metabolic pathways of selenium assimilation in humans 8 Figure 4.1 Typical gamma ray spectrum of selenium as acquired after 44 irradiation, using high purity germanium-bismuth germanate (HPGe-BGO) Compton suppressed detection system Figure 4.2 Total phenolic content in different wheatgrass samples and values 57 in parentheses showing fold increase in TPC with respect to control Figure 4.3 Total flavonoid content in different wheatgrass samples and values 61 in parentheses showing fold increase in TFC with respect to control Figure 4.4 Percentage DPPH radical scavenging capacity of different 63 wheatgrass samples and values in parentheses showing fold increase in scavenging capacity with respect to control Figure 4.5 Percentage ABTS radical scavenging capacity of different 66 wheatgrass samples and values in parentheses showing fold increase in radical scavenging capacity with respect to control Figure 4.6 Ferric reducing antioxidant power (FRAP) of different wheatgrass 67 samples and values in parentheses showing fold increase in FRAP with respect to control Figure 4.7 Percentage iron (Fe2+) chelating capacity of different wheatgrass 69 samples and values in parentheses showing fold increase in chelation capacity with respect to control Figure 4.8 TBARS contents of different wheatgrass samples and values in 71 parentheses
Load more

Recommended publications
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals
    antioxidants Review Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals Da-Young Lee, Moon-Young Song and Eun-Hee Kim * College of Pharmacy and Institute of Pharmaceutical Sciences, CHA University, Seongnam 13488, Korea; [email protected] (D.-Y.L.); [email protected] (M.-Y.S.) * Correspondence: [email protected]; Tel.: +82-31-881-7179 Abstract: Colorectal cancer still has a high incidence and mortality rate, according to a report from the American Cancer Society. Colorectal cancer has a high prevalence in patients with inflammatory bowel disease. Oxidative stress, including reactive oxygen species (ROS) and lipid peroxidation, has been known to cause inflammatory diseases and malignant disorders. In particular, the nuclear factor erythroid 2-related factor 2 (Nrf2)/Kelch-like ECH-related protein 1 (KEAP1) pathway is well known to protect cells from oxidative stress and inflammation. Nrf2 was first found in the homolog of the hematopoietic transcription factor p45 NF-E2, and the transcription factor Nrf2 is a member of the Cap ‘N’ Collar family. KEAP1 is well known as a negative regulator that rapidly degrades Nrf2 through the proteasome system. A range of evidence has shown that consumption of phytochemicals has a preventive or inhibitory effect on cancer progression or proliferation, depending on the stage of colorectal cancer. Therefore, the discovery of phytochemicals regulating the Nrf2/KEAP1 axis and Citation: Lee, D.-Y.; Song, M.-Y.; verification of their efficacy have attracted scientific attention. In this review, we summarize the role Kim, E.-H. Role of Oxidative Stress of oxidative stress and the Nrf2/KEAP1 signaling pathway in colorectal cancer, and the possible and Nrf2/KEAP1 Signaling in utility of phytochemicals with respect to the regulation of the Nrf2/KEAP1 axis in colorectal cancer.
    [Show full text]
  • Synergic Crosstalk Between Inflammation, Oxidative Stress
    antioxidants Review Synergic Crosstalk between Inflammation, Oxidative Stress, and Genomic Alterations in BCR–ABL-Negative Myeloproliferative Neoplasm Alessandro Allegra 1,* , Giovanni Pioggia 2 , Alessandro Tonacci 3 , Marco Casciaro 4 , Caterina Musolino 1 and Sebastiano Gangemi 4 1 Department of Human Pathology in Adulthood and Childhood “Gaetano Barresi”, Division of Hematology, University of Messina, 98125 Messina, Italy; [email protected] 2 Institute for Biomedical Research and Innovation (IRIB), National Research Council of Italy (CNR), 98164 Messina, Italy; [email protected] 3 Clinical Physiology Institute, National Research Council of Italy (IFC-CNR), 56124 Pisa, Italy; [email protected] 4 School and Operative Unit of Allergy and Clinical Immunology, Department of Clinical and Experimental Medicine, University of Messina, 98125 Messina, Italy; [email protected] (M.C.); [email protected] (S.G.) * Correspondence: [email protected]; Tel.: +39-09-0221-2364 Received: 2 September 2020; Accepted: 21 October 2020; Published: 23 October 2020 Abstract: Philadelphia-negative chronic myeloproliferative neoplasms (MPNs) have recently been revealed to be related to chronic inflammation, oxidative stress, and the accumulation of reactive oxygen species. It has been proposed that MPNs represent a human inflammation model for tumor advancement, in which long-lasting inflammation serves as the driving element from early tumor stage (over polycythemia vera) to the later myelofibrotic cancer stage. It has been theorized that the starting event for acquired stem cell alteration may occur after a chronic inflammation stimulus with consequent myelopoietic drive, producing a genetic stem cell insult. When this occurs, the clone itself constantly produces inflammatory components in the bone marrow; these elements further cause clonal expansion.
    [Show full text]
  • Characterization of Cytosolic Glutathione Peroxidase And
    Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.
    [Show full text]
  • Molecular Characterization, Protein–Protein Interaction Network, and Evolution of Four Glutathione Peroxidases from Tetrahymena Thermophila
    antioxidants Article Molecular Characterization, Protein–Protein Interaction Network, and Evolution of Four Glutathione Peroxidases from Tetrahymena thermophila Diana Ferro 1,2, Rigers Bakiu 3 , Sandra Pucciarelli 4, Cristina Miceli 4 , Adriana Vallesi 4 , Paola Irato 5 and Gianfranco Santovito 5,* 1 BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA; [email protected] 2 Department of Pediatrics, Children’s Mercy Hospital and Clinics, Kansas City, MO 64108, USA 3 Department of Aquaculture and Fisheries, Agricultural University of Tirana, 1000 Tiranë, Albania; [email protected] 4 School of Biosciences and Veterinary Medicine, University of Camerino, 62032 Camerino, Italy; [email protected] (S.P.); [email protected] (C.M.); [email protected] (A.V.) 5 Department of Biology, University of Padova, 35131 Padova, Italy; [email protected] * Correspondence: [email protected] Received: 6 September 2020; Accepted: 1 October 2020; Published: 2 October 2020 Abstract: Glutathione peroxidases (GPxs) form a broad family of antioxidant proteins essential for maintaining redox homeostasis in eukaryotic cells. In this study, we used an integrative approach that combines bioinformatics, molecular biology, and biochemistry to investigate the role of GPxs in reactive oxygen species detoxification in the unicellular eukaryotic model organism Tetrahymena thermophila. Both phylogenetic and mechanistic empirical model analyses provided indications about the evolutionary relationships among the GPXs of Tetrahymena and the orthologous enzymes of phylogenetically related species. In-silico gene characterization and text mining were used to predict the functional relationships between GPxs and other physiologically-relevant processes. The GPx genes contain conserved transcriptional regulatory elements in the promoter region, which suggest that transcription is under tight control of specialized signaling pathways.
    [Show full text]
  • Genomic Evidence of Reactive Oxygen Species Elevation in Papillary Thyroid Carcinoma with Hashimoto Thyroiditis
    Endocrine Journal 2015, 62 (10), 857-877 Original Genomic evidence of reactive oxygen species elevation in papillary thyroid carcinoma with Hashimoto thyroiditis Jin Wook Yi1), 2), Ji Yeon Park1), Ji-Youn Sung1), 3), Sang Hyuk Kwak1), 4), Jihan Yu1), 5), Ji Hyun Chang1), 6), Jo-Heon Kim1), 7), Sang Yun Ha1), 8), Eun Kyung Paik1), 9), Woo Seung Lee1), Su-Jin Kim2), Kyu Eun Lee2)* and Ju Han Kim1)* 1) Division of Biomedical Informatics, Seoul National University College of Medicine, Seoul, Korea 2) Department of Surgery, Seoul National University Hospital and College of Medicine, Seoul, Korea 3) Department of Pathology, Kyung Hee University Hospital, Kyung Hee University School of Medicine, Seoul, Korea 4) Kwak Clinic, Okcheon-gun, Chungbuk, Korea 5) Department of Internal Medicine, Uijeongbu St. Mary’s Hospital, Uijeongbu, Korea 6) Department of Radiation Oncology, Seoul St. Mary’s Hospital, Seoul, Korea 7) Department of Pathology, Chonnam National University Hospital, Kwang-Ju, Korea 8) Department of Pathology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea 9) Department of Radiation Oncology, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, Seoul, Korea Abstract. Elevated levels of reactive oxygen species (ROS) have been proposed as a risk factor for the development of papillary thyroid carcinoma (PTC) in patients with Hashimoto thyroiditis (HT). However, it has yet to be proven that the total levels of ROS are sufficiently increased to contribute to carcinogenesis. We hypothesized that if the ROS levels were increased in HT, ROS-related genes would also be differently expressed in PTC with HT. To find differentially expressed genes (DEGs) we analyzed data from the Cancer Genomic Atlas, gene expression data from RNA sequencing: 33 from normal thyroid tissue, 232 from PTC without HT, and 60 from PTC with HT.
    [Show full text]
  • Involvement of Glutathione Peroxidases in the Occurrence And
    Zhang et al. J Transl Med (2020) 18:247 https://doi.org/10.1186/s12967-020-02420-x Journal of Translational Medicine REVIEW Open Access Involvement of glutathione peroxidases in the occurrence and development of breast cancers Man‑Li Zhang1†, Hua‑Tao Wu2†, Wen‑Jia Chen1,3, Ya Xu1, Qian‑Qian Ye1,3, Jia‑Xin Shen4 and Jing Liu1,3* Abstract Glutathione peroxidases (GPxs) belong to a family of enzymes that is important in organisms; these enzymes pro‑ mote hydrogen peroxide metabolism and protect cell membrane structure and function from oxidative damage. Based on the establishment and development of the theory of the pathological roles of free radicals, the role of GPxs has gradually attracted researchers’ attention, and the involvement of GPxs in the occurrence and development of malignant tumors has been shown. On the other hand, the incidence of breast cancer in increasing, and breast cancer has become the leading cause of cancer‑related death in females worldwide; breast cancer is thought to be related to the increased production of reactive oxygen species, indicating the involvement of GPxs in these processes. Therefore, this article focused on the molecular mechanism and function of GPxs in the occurrence and development of breast cancer to understand their role in breast cancer and to provide a new theoretical basis for the treatment of breast cancer. Keywords: Glutathione peroxidase, Breast cancer, Reactive oxygen species, Occurrence Background [4]. However, the mechanisms of the occurrence, devel- Breast cancer has become the most common cancer and opment, and metastasis of breast cancer are very com- the leading cause of cancer-related deaths in females plicated and overlap, suggesting the necessity of diferent worldwide, according to a status report on the global therapies to treat diferent subtypes of breast cancer.
    [Show full text]
  • DMD #75135 1 RNA-Seq Reveals
    DMD Fast Forward. Published on February 23, 2017 as DOI: 10.1124/dmd.117.075135 This article has not been copyedited and formatted. The final version may differ from this version. DMD #75135 RNA-Seq Reveals Age- and Species Differences of CAR-targeted Drug-Processing Genes in Liver Sunny Lihua Cheng, Theo K. Bammler, and Julia Yue Cui Laboratories of origin: SLC, TKB, and JYC: Department of Environmental and Occupational Health Sciences, Downloaded from University of Washington, Seattle 98105 dmd.aspetjournals.org at ASPET Journals on September 26, 2021 1 DMD Fast Forward. Published on February 23, 2017 as DOI: 10.1124/dmd.117.075135 This article has not been copyedited and formatted. The final version may differ from this version. DMD #75135 Running title: Regulation of DPGs by CAR in developing liver Address for correspondence: Julia Yue Cui, PhD Assistant Professor Department of Environmental and Occupational Health Sciences University of Washington 4225 Roosevelt Way NE, Seattle, WA 98105 Email: [email protected] Tel: 206-616-4331 Downloaded from Document statistics: Text pages: 38 Tables: 1 Figures: 10 dmd.aspetjournals.org References: 66 Words in Abstract: 264 Words in Introduction: 1051 Words in Discussion: 1476 ABBREVIATIONS at ASPET Journals on September 26, 2021 Aadac, arylacetamide deacetylase (esterase); Abc, ATP-binding cassette; Ache, acetylcholinesterase; Acsm, acyl-CoA synthetase medium-chain family member; Adh, alcohol dehydrogenase; Ahr, aryl hydrocarbon receptor; Akr, aldo-keto reductase; Aldh, aldehyde dehydrogenase;
    [Show full text]
  • Emerging Roles for Non-Selenium Containing ER-Resident Glutathione
    Biol. Chem. 2021; 402(3): 271–287 Review Katalin Buday and Marcus Conrad* Emerging roles for non-selenium containing ER-resident glutathione peroxidases in cell signaling and disease https://doi.org/10.1515/hsz-2020-0286 Introduction Received August 17, 2020; accepted October 8, 2020; published online October 22, 2020 Maintenance of redox homeostasis is essential for preventing the oxidative damage of biological molecules such as proteins, Abstract: Maintenance of cellular redox control is pivotal lipids and DNA (Poli et al. 2004). The insufficient elimination of for normal cellular functions and cell fate decisions reactive oxygen species (ROS) may trigger cell death and as including cell death. Among the key cellular redox systems such might be a detrimental factor to human health and life- in mammals, the glutathione peroxidase (GPX) family of span (Navarro-Yepes et al. 2014; Valko et al. 2007). Up until proteins is the largest conferring multifaceted functions now, a number of diseases have been directly linked with and affecting virtually all cellular processes. The endo- dysregulated redox homeostasis, including cancer, neurolog- plasmic reticulum (ER)-resident GPXs, designated as GPX7 ical disorders, cardiovascular diseases, obesity and metabolic and GPX8, are the most recently added members of this diseases, as well as aging (Sayre et al. 2001; Valko et al. 2006, family of enzymes. Recent studies have provided exciting 2007). To counterbalance the level of ROS, mammals have insights how both enzymes support critical processes of the evolved a complex ROS scavenging system consisting of ER including oxidative protein folding, maintenance of ER diverseenzymes,suchascatalase(CAT),superoxidedismut- redox control by eliminating H2O2, and preventing palmitic ase (SOD), thioredoxin reductases (TXNRD) and glutathione acid-induced lipotoxicity.
    [Show full text]
  • Unglycosylated Recombinant Human Glutathione Peroxidase 3 Mutant
    OPEN Unglycosylated recombinant human SUBJECT AREAS: glutathione peroxidase 3 mutant from MOLECULAR MODELLING DNA RECOMBINATION Escherichia coli is active as a monomer RECOMBINASES Jian Song1*, Yang Yu2*, Ruiqing Xing1, Xiao Guo2, Dali Liu1, Jingyan Wei2,3 & Hongwei Song1 SELENIUM-BINDING PROTEINS 1College of Electronic Science and Engineering, Jilin University, 2699 Qianjin Street, Changchun 130012, China, 2College of 3 Received Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun 130021, China, State Key Laboratory of Theoretical and 1 August 2014 Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun 130021, China. Accepted 1 October 2014 Glutathione peroxidase 3 (GPx3) is a glycosylated member of GPx family and can catalyze the reaction of different types of peroxides with GSH to form their corresponding alcohols in vitro. The active center of Published GPx3 is selenocysteine (Sec), which is incorporated into proteins by a specific mechanism. In this study, we 21 October 2014 prepared a recombinant human GPx3 (rhGPx3) mutant with all Cys changed to Ser from a Cys auxotrophic strain of E. coli, BL21(DE3)cys. Although lacking post-translational modification, rhGPx3 mutant still retained the ability to reduce H2O2 and PLPC-OOH. Study on the quaternary structure suggested that rhGPx3 mutant existed as a monomer in solution, which is different from native tetrameric GPx3. Loss of Correspondence and the catalytic activity was considered to be attributed to both the absence of glycosylation and the failure of requests for materials the tetramer. Further analysis was performed to compare the structures of rhGPx3 and GPx4 mutant, which should be addressed to were quite similar except for oligomerization loop.
    [Show full text]