Molecular Characterization, Protein-Protein Interaction Network
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Proceedings of the 76Th National Conference of the Unione Zoologica Italiana
Quaderni del Centro Studi Alpino – IV th Proceedings of the 76 National Conference of the Unione Zoologica Italiana A cura di Marzio Zapparoli, Maria Cristina Belardinelli Università degli Studi della Tuscia 2015 Quaderni del Centro Studi Alpino – IV Unione Zoologica Italiana 76th National Conference Proceedings Viterbo, 15-18 September 2015 a cura di Marzio Zapparoli, Maria Cristina Belardinelli Università degli Studi della Tuscia 2015 1 Università degli Studi della Tuscia Centro Studi Alpino Via Rovigo 7, 38050 Pieve Tesino (TN) Sede Amministrativa c/o Dipartimento per l’Innovazione nei sistemi Biologici, Agroalimentari e Forestali, Università della Tuscia Via San Camillo de Lellis, s.n.c. 01100 Viterbo (VT) Consiglio del Centro Luigi Portoghesi (Presidente) Gian Maria Di Nocera Maria Gabriella Dionisi Giovanni Fiorentino Anna Scoppola Laura Selbmann Alessandro Sorrentino ISBN: 978 - 88 - 903595 - 4 - 5 Viterbo 2015 2 76th National Conference of the Unione Zoologica Italiana Università degli Studi della Tuscia Viterbo, 15-18 September 2015 Organizing Committee Anna Maria Fausto (President), Carlo Belfiore, Francesco Buonocore, Romolo Fochetti, Massimo Mazzini, Simona Picchietti, Nicla Romano, Giuseppe Scapigliati, Marzio Zapparoli Scientific Committee Elvira De Matthaeis (UZI President), Sapienza, Università di Roma Roberto Bertolani (UZI Secretary-Treasurer), Università di Modena e Reggio Emilia Carlo Belfiore, Università della Tuscia, Viterbo Giovanni Bernardini, Università dell’Insubria, Varese Ferdinando Boero, Università del Salento, -
(ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process. -
SUPPLEMENTARY DATA Supplementary Figure 1. The
SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary -
Foraging Behaviour of Female Weddell Seals (Leptonychotes Weddellii) During Lactation: New Insights from Dietary Biomarkers
Foraging behaviour of female Weddell seals (Leptonychotes weddellii) during lactation: new insights from dietary biomarkers A thesis submitted in partial fulfilment of the requirements for the degree in Doctor of Philosophy in Antarctic Studies by Crystal C. Lenky November 2012 Acknowledgements Only one name appears on the cover of a thesis, but there are many people involved in its creation. First and foremost, I thank my supervisors for their endless encouragement, knowledge and insightful conversations throughout this journey. I thank Dr Regina Eisert for instilling in me an appreciation of the analytical method and her expertise on data analysis; Dr Victoria Metcalf for her friendship, enthusiasm and advice on all aspects of life; Dr Michael Lever for his wealth of knowledge on betaines and for providing me with lab and office space after the February 22 earthquake; Dr Olav Oftedal for his expertise in nutrition and guidance on scientific writing; Dr Marie Squire for her guidance on the NMR assays, and Professor Bryan Storey for providing me with a great working environment. Funding for this thesis was provided by a National Science Foundation, Office of Polar Programs grant to Drs Regina Eisert and Olav Oftedal. Many people have also given their time and expertise in assisting me with fieldwork, laboratory and data analysis. I thank Dr Wendy Hood, Lisa Ware, Warren Lynch and Rich Joss for their assistance in the field and for making my time in Antarctica an enjoyable experience. Michael Jakubasz (Smithsonian National Zoological Park) provided invaluable assistance during my stay at the Nutrition Lab. I thank him for his guidance on the proximate composition assays and for sorting permits and shipping details. -
GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1. -
Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals
antioxidants Review Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals Da-Young Lee, Moon-Young Song and Eun-Hee Kim * College of Pharmacy and Institute of Pharmaceutical Sciences, CHA University, Seongnam 13488, Korea; [email protected] (D.-Y.L.); [email protected] (M.-Y.S.) * Correspondence: [email protected]; Tel.: +82-31-881-7179 Abstract: Colorectal cancer still has a high incidence and mortality rate, according to a report from the American Cancer Society. Colorectal cancer has a high prevalence in patients with inflammatory bowel disease. Oxidative stress, including reactive oxygen species (ROS) and lipid peroxidation, has been known to cause inflammatory diseases and malignant disorders. In particular, the nuclear factor erythroid 2-related factor 2 (Nrf2)/Kelch-like ECH-related protein 1 (KEAP1) pathway is well known to protect cells from oxidative stress and inflammation. Nrf2 was first found in the homolog of the hematopoietic transcription factor p45 NF-E2, and the transcription factor Nrf2 is a member of the Cap ‘N’ Collar family. KEAP1 is well known as a negative regulator that rapidly degrades Nrf2 through the proteasome system. A range of evidence has shown that consumption of phytochemicals has a preventive or inhibitory effect on cancer progression or proliferation, depending on the stage of colorectal cancer. Therefore, the discovery of phytochemicals regulating the Nrf2/KEAP1 axis and Citation: Lee, D.-Y.; Song, M.-Y.; verification of their efficacy have attracted scientific attention. In this review, we summarize the role Kim, E.-H. Role of Oxidative Stress of oxidative stress and the Nrf2/KEAP1 signaling pathway in colorectal cancer, and the possible and Nrf2/KEAP1 Signaling in utility of phytochemicals with respect to the regulation of the Nrf2/KEAP1 axis in colorectal cancer. -
Insertion Hot Spots of DIRS1 Retrotransposon and Chromosomal Diversifications Among the Antarctic Teleosts Nototheniidae
International Journal of Molecular Sciences Article Insertion Hot Spots of DIRS1 Retrotransposon and Chromosomal Diversifications among the Antarctic Teleosts Nototheniidae Juliette Auvinet 1,* , Paula Graça 1, Laura Ghigliotti 2 , Eva Pisano 2, Agnès Dettaï 3, Catherine Ozouf-Costaz 1 and Dominique Higuet 1,3,* 1 Laboratoire Evolution Paris Seine, Sorbonne Université, CNRS, Univ Antilles, Institut de Biologie Paris Seine (IBPS), F-75005 Paris, France; [email protected] (P.G.); [email protected] (C.O.-C.) 2 Istituto per lo Studio degli Impatti Antropici e la Sostenibilità in Ambiente Marino (IAS), National Research Council (CNR), 16149 Genoa, Italy; [email protected] (L.G.); [email protected] (E.P.) 3 Institut de Systématique, Evolution, Biodiversité (ISYEB), Museum National d’Histoire Naturelle, CNRS, Sorbonne Université, EPHE, 57, rue Cuvier, 75005 Paris, France; [email protected] * Correspondence: [email protected] (J.A.); [email protected] (D.H.) Received: 28 December 2018; Accepted: 3 February 2019; Published: 6 February 2019 Abstract: By their faculty to transpose, transposable elements are known to play a key role in eukaryote genomes, impacting both their structuration and remodeling. Their integration in targeted sites may lead to recombination mechanisms involved in chromosomal rearrangements. The Antarctic fish family Nototheniidae went through several waves of species radiations. It is a suitable model to study transposable element (TE)-mediated mechanisms associated to genome and chromosomal diversifications. After the characterization of Gypsy (GyNoto), Copia (CoNoto), and DIRS1 (YNoto) retrotransposons in the genomes of Nototheniidae (diversity, distribution, conservation), we focused on their chromosome location with an emphasis on the three identified nototheniid radiations (the Trematomus, the plunderfishes, and the icefishes). -
Mucosal Health in Aquaculture Page Left Intentionally Blank Mucosal Health in Aquaculture
Mucosal Health in Aquaculture Page left intentionally blank Mucosal Health in Aquaculture Edited by Benjamin H. Beck Stuttgart National Aquaculture Research Center, Stuttgart, Arkansas, USA Eric Peatman School of Fisheries, Aquaculture, and Aquatic Sciences, Auburn University, Alabama, USA AMSTERDAM • BOSTON • HEIDELBERG • LONDON • NEW YORK OXFORD • PARIS • SAN DIEGO • SAN FRANCISCO • SINGAPORE SYDNEY • TOKYO Academic Press is an Imprint of Elsevier Academic Press is an imprint of Elsevier 125, London Wall, EC2Y 5AS, UK 525 B Street, Suite 1800, San Diego, CA 92101-4495, USA 225 Wyman Street, Waltham, MA 02451, USA The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, UK Copyright © 2015 Elsevier Inc. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher. Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: [email protected]. Alternatively, visit the Science and Technology Books website at www.elsevierdirect.com/rights for further information. Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. -
Synergic Crosstalk Between Inflammation, Oxidative Stress
antioxidants Review Synergic Crosstalk between Inflammation, Oxidative Stress, and Genomic Alterations in BCR–ABL-Negative Myeloproliferative Neoplasm Alessandro Allegra 1,* , Giovanni Pioggia 2 , Alessandro Tonacci 3 , Marco Casciaro 4 , Caterina Musolino 1 and Sebastiano Gangemi 4 1 Department of Human Pathology in Adulthood and Childhood “Gaetano Barresi”, Division of Hematology, University of Messina, 98125 Messina, Italy; [email protected] 2 Institute for Biomedical Research and Innovation (IRIB), National Research Council of Italy (CNR), 98164 Messina, Italy; [email protected] 3 Clinical Physiology Institute, National Research Council of Italy (IFC-CNR), 56124 Pisa, Italy; [email protected] 4 School and Operative Unit of Allergy and Clinical Immunology, Department of Clinical and Experimental Medicine, University of Messina, 98125 Messina, Italy; [email protected] (M.C.); [email protected] (S.G.) * Correspondence: [email protected]; Tel.: +39-09-0221-2364 Received: 2 September 2020; Accepted: 21 October 2020; Published: 23 October 2020 Abstract: Philadelphia-negative chronic myeloproliferative neoplasms (MPNs) have recently been revealed to be related to chronic inflammation, oxidative stress, and the accumulation of reactive oxygen species. It has been proposed that MPNs represent a human inflammation model for tumor advancement, in which long-lasting inflammation serves as the driving element from early tumor stage (over polycythemia vera) to the later myelofibrotic cancer stage. It has been theorized that the starting event for acquired stem cell alteration may occur after a chronic inflammation stimulus with consequent myelopoietic drive, producing a genetic stem cell insult. When this occurs, the clone itself constantly produces inflammatory components in the bone marrow; these elements further cause clonal expansion. -
Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A
Review Cite This: Chem. Rev. 2019, 119, 10829−10855 pubs.acs.org/CR Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A. Estrin, and Rafael Radi*,†,‡ † ‡ § Departamento de Bioquímica, Centro de Investigaciones Biomedicaś (CEINBIO), Facultad de Medicina, and Laboratorio de Fisicoquímica Biologica,́ Facultad de Ciencias, Universidad de la Republica,́ 11800 Montevideo, Uruguay ∥ Departamento de Química Inorganica,́ Analítica y Química-Física and INQUIMAE-CONICET, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 2160 Buenos Aires, Argentina ABSTRACT: Life on Earth evolved in the presence of hydrogen peroxide, and other peroxides also emerged before and with the rise of aerobic metabolism. They were considered only as toxic byproducts for many years. Nowadays, peroxides are also regarded as metabolic products that play essential physiological cellular roles. Organisms have developed efficient mechanisms to metabolize peroxides, mostly based on two kinds of redox chemistry, catalases/peroxidases that depend on the heme prosthetic group to afford peroxide reduction and thiol-based peroxidases that support their redox activities on specialized fast reacting cysteine/selenocysteine (Cys/Sec) residues. Among the last group, glutathione peroxidases (GPxs) and peroxiredoxins (Prxs) are the most widespread and abundant families, and they are the leitmotif of this review. After presenting the properties and roles of different peroxides in biology, we discuss the chemical mechanisms of peroxide reduction by low molecular weight thiols, Prxs, GPxs, and other thiol-based peroxidases. Special attention is paid to the catalytic properties of Prxs and also to the importance and comparative outlook of the properties of Sec and its role in GPxs. -
Induction of Heat Shock Proteins in Cold- Adapted and Cold
CORE Metadata, citation and similar papers at core.ac.uk Provided by ScholarWorks@UA INDUCTION OF HEAT SHOCK PROTEINS IN COLD- ADAPTED AND COLD- ACCLIMATED FISHES By Laura Elizabeth Teigen Dr. Kristin O'Brien Advisory Committee Chair Dr. Diane Wagner Chair, Department of Biology and Wildlife APPROVED: ;t.-/ INDUCTION OF HEAT SHOCK PROTEINS IN COLD- ADAPTED AND COLD- ACCLIMATED FISHES A THESIS Presented to the Faculty of the University of Alaska Fairbanks in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE By Laura Elizabeth Teigen, B.A. Fairbanks, Alaska May 2014 v Abstract I examined the effects of oxidative stress and changes in temperature on heat shock protein (Hsp) levels in cold-adapted and cold-acclimated fishes. Adaptation of Antarctic notothenioids to cold temperature is correlated with high levels of Hsps, thought to minimize cold-induced protein denaturation. Hsp70 levels were measured in red- and white-blooded Antarctic notothenioid fishes exposed to their critical thermal maximum (CTMax), 4C warm acclimated, and notothenioids from different latitudes. I determined the effect of cold acclimation on Hsp levels and the role of sirtuins in regulating Hsp expression and changes in metabolism in threespine stickleback, Gasterosteus aculeatus, cold-acclimated to 8C. Levels of Hsps do not increase in Antarctic notothenioids exposed to their CTMax, and warm acclimation reduced levels of Hsp70. Hsp70 levels were higher in Antarctic notothenioids compared to a temperate notothenioid and higher in white-blooded notothenioids compared to red-blooded notothenioids, despite higher oxidative stress levels in red-blooded fish, suggesting Hsp70 does not mitigate oxidative stress. -
Characterization of Cytosolic Glutathione Peroxidase And
Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.