Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

Irfan Ullah

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University

Islamabad, Pakistan Session: 2012-2017

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

A thesis submitted in the partial fulfillment of the requirements for the degree of Doctor of Philosophy

in Biochemistry

Irfan Ullah

Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan Session: 2012-2017

Dedicated to

Those marvelous personalities

Whose Love is Ceaseless

Whose Affections are Limitless

Whose Compassions are Matchless

and

Whose prayers are Selfless

Incontrovertibly

They are my kind father and sweet Mother

May they live long! Contents

CONTENTS Page No ACKNOWLEDGMENTS I LIST OF FIGURES III LIST OF TABLES IX LIST OF ABBREVIATIONS X ABSTRACT XVII Chapter 1 INTRODUCTION 1

Human Skeletal Architecture 2 The Skeletal Paraphernalia 4 Bone 4 Histology of Bone 4 Bone Anatomy 4 Types of Bones 5 Cartilage 6 Types of Cartilages 6 Skeletal Development 6 Genetic Regulation of Skeletal Development 8 Condensation of Mesenchymal Cells and Skeletal Patterning 8 Chondrocyte Differentiation and Development of Cartilage Growth Plate 10 Osteoblast differentiation and Bone Development 11 Osteoclast Differentiation and Bone Homeostasis 13 Hereditary Skeletal Disorders 13 Acromesomelic Dysplasias 14 Mucopolysaccharidosis 15

Ciliopathic Disorders of the Skeleton 18 Hereditary Limb Malformations 19

Polydactyly 19

Ectrodactyly or Split-hand/foot malformation (SHFM) 20 Mapping of Genes Involved in Hereditary Skeletal Disorders 21

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

Contents

Linkage Analysis 22 DNA Microarray and Genome-wide Linkage Analysis 22 Mutation Analysis 23 Sanger Sequencing 23 Next Generation Sequencing 23 Chapter 2 25 MATERIALS AND METHODS 25

Ethical Approval and Human Subjects 25 Extraction of Genomic DNA 25 Genetic Mapping 27 Genotyping using Microsatellite Markers 27 Polymerase Chain Reaction (PCR) 27 Polyacrylamide Gel Electrophoresis (PAGE) 27 SNP Microarray 28 Mutation Analysis 29 Sanger Sequencing 29 Whole Exome Sequencing 30 Online Tools for Predicting Pathogenicity of the Mutations 31 In Silico Protein Modeling 31 Molecular Docking 31

RESULTS Chapter 3 MUCOPOLYSACCHARIDOSIS 47 Family A 48

Clinical Features 48

Genetic Mapping 49

Mutation Analysis 49

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

Contents

In Silico Protein Modeling and Molecular Docking Analysis 49

Family B 50

Clinical Features 50

Genetic Mapping and Mutation Analysis 50

Family C 51

Clinical Features 51

Molecular Analysis 51

In Silico Protein Modeling and Docking Analysis 52

Family D 52

Clinical Features 53

Genetic Mapping and Mutation Analysis 53

In Silico Structural and Functional Analysis 53

Family E 54

Clinical Features 54

Genetic Mapping and Mutation Screening 54

Family F 55

Phenotypes in the Family 55

Genetic Mapping and Mutation Analysis 55

Discussion 55 Chapter 4 ACROMESOMELIC DYSPLASIA 78 Family G 78

Clinical Features 79

Genetic Mapping and Mutation Analysis 79

Family H 80

Clinical Features Observed in Family H 80

Genotyping and Mutation Screening 80

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

Contents

Family I 81

Clinical Features 81

Genetic Mapping and Mutation Analysis 81

Discussion 82 Chapter 5 POSTAXIAL POLYDACTYLY 94 Family J 94

Clinical Features 94

Exclusion Mapping 95

SNP Microarray Analysis 95

Analysis of Exome Sequencing Data 96

Validating Mutations by Sanger Sequencing 96

Family K 97

Clinical Features 97

Exclusion Mapping 98

Whole Exome Sequencing 98

Sanger Sequencing 99

In Silico Analysis of the MKS1 Protein 99

Discussion 99

Chapter 6 SPLIT HAND/FOOT MALFORMATION 112 Family L 113

Clinical Features 113

Genetic Mapping 114

Mutation Analysis 114

Family M 114

Clinical Features 115

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

Contents

Homozygousity Mapping and Mutation Analysis 115

In Silico Structural Analysis 115

Family N 116

Clinical Features 116

Exclusion Mapping 117

Whole Exome Sequencing and Microarray Analysis 118

Segregation Analysis by Sanger Sequencing 118

Discussion 119 Chapter 7 CONCLUSIONS 133 REFERENCES 139

Annexures Thesis Evaluation Reports Sent by External Examiners

Plagiarism Report

Abstracts of Publications

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders

Acknowledgments

ACKNOWLEDGMENTS

All praises and thanks be to Almighty Allah for bestowing upon me this excellent opportunity and aptitude to go through this challenging time and making my struggles worthwhile. In spite of the fact that, this thesis is being published only in my name but it complements the cooperation and support of many people which really deserve to be acknowledged.

First of all, I am obliged to express my sincere gratitude to my honorable supervisor Professor Dr. Wasim Ahmad, whose scholastic guidance, kind interest and valuable suggestions proved crucial in the smooth completion of my PhD studies and related research. His continuous support patience, motivation, and immense knowledge helped me in all the time of research and writing of this thesis. On this occasion, I present my heartfelt thanks to the chairman department of Biochemistry and Molecular Biology QAU, Prof. Dr. Muhammad Ansar, who provided us a perfect, amicable and constructive research environment.

My sincere thanks also go to Prof. Dr. Johan T den Dunnen, Dr. Gijs WE Santen, Dr. Claudia AL Ruivenkamp, Dr. Mariëtte JV Hoffer and Maaike Verschuren, who provided me an opportunity to join their team during my stay in the LUMC, Netherlands, and who provided me access to the laboratory and research facilities. In addition, I am especially thankful to my friends Dr. Enamul Haque Mojumdar and Mr. Majid Khan for their kind support and sincere hospitality during my stay in the Netherlands. The time I spent with them is a precious asset and will be a cherished memory throughout my life.

I have to appreciate the friendly and cooperative attitude of my lab seniors and fellows: Dr. Sulman Basit, Dr. Gul Naz, Dr. Rabia Habib, Dr. Umm-e-Kalsoom, Dr. Bushra Khan, Dr. Syed Irfan Raza, Dr. Abid Jan, Dr. Raja Husain Ali, Muhammad Umair, Shabir Hussain, Khurrum Liaqat, Asmat Ullah, Shazia Khan and Saba Mehmood during the entire period of my PhD studies. I am also thankful to all my lab juniors, specifically: Mehboob Ali, Sarmad Mehmood, Wajid Amin, Nouman, Soahil Ahmad, Abdullah, Naseebullah, Zohaib, Hammal and Naila Shinwari for the respect they gave to me and for their moral support.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders I

Acknowledgments

I have a vast sphere of friends and I am thankful to all of them who well-kept-up sincere and candid wishes for me in their hearts. I am particularly thankful to Mr. Zul Kamal, Muhammad Fayyaz, Mr. Zul Rafat, Mr. Abul Faiz, Mr. Zul Waqar and Mr. Abul Fazal for their consistent moral support and stimulation. During the fleeting six years of MPhil and PhD studies, my life was beautified by my sweet friends: Dr. Saadullah Khan Wazir, Dr. Abdul Aziz, Faiz ur Rahman, Zakaullah Durrani, Asif Khan, Imranullah, Shamim Shahi, Saima Ali, Zulfiqar Ahmad Barki, Rahman Ali, Ikram Ali, Muhammad Kashif Raza, Ijaz Ali, Aslam Khan, Raheemullah, Fazal Wahab, Mehtab Khan, Muzaffar Khan, Khadim Shah, Farooq Ahmed, Kamran Saeed, Ahmad Khan Wazir, Latif Ahmad and Hanif Khan. They filled every moment of my life with such ecstasy that I never felt any moment of sadness.

I am indeed ineffable to mention my appreciation to my loving father for his unstinting support, encouragement and guidance which made me able to achieve this goal. Besides, the love of my sweet mother proved a beacon of light at every step of my life. I am unable to find words which can express my feelings of thanks for my sisters and brothers, especially my elder brothers Syed Nasir Mahmood Haidry and Mr. Ihsanullah, for their valuable support and encouragement. In the same way, the prayers and good wishes of my all relatives were go together with me but I am especially thankful to my dear cousin Mr. Waliulhaq for his consistent affection and empathy during my stay in Islamabad.

Conspicuously, I convey my heartiest thanks to the departmental clerical staff Mr. Tariq Mehmood, Mr. Fayyaz and Mr. Shehzad for their sociable cooperation and sincere services towards students.

Finally, I would like to express thanks to the higher education commission (HEC) of Pakistan for providing me financial backing in the form of indigenous PhD fellowship and IRSIP fellowship during my PhD studies.

May Allah succeed all of us in our virtuous and noble ambitions and empower us to serve mankind (Ameen).

IRFANULLAH

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders II

List of Figures

LIST OF FIGURES

Figure No Title Page No

Figure 1.1 Cartoon exhibition of human skeletal system in anterior and 3 posterior view.

Figure 3.1 Pedigree drawing of the family A segregating autosomal 61 recessive Morquio A syndrome

Figure 3.2 Photographs and radiographs of affected individuals in family 62 A

Figure 3.3 Haplotypes, demonstrating segregation of Morquio A 63 syndrome in family A

Figure 3.4 Sequence analysis of a missense mutation (c.1259C>G, 63 p.Pro420Atg) in the gene GALNS in family A

Figure 3.5 In silico structural modeling of GALNS mutation 64 (p.Pro420Arg) showing intermolecular interactions and docking pose of 6S-GalNAc ligand

Figure 3.6 Pedigree drawing of the family B segregating autosomal 65 recessive mucopolysaccharidosis type IVA

Figure 3.7 Clinical features of affected individuals in family B 65

Figure 3.8 Haplotypes indicating segregation of Morquio A syndrome in 66 family B

Figure 3.9 Chromatograms of exon 12 of the GALNS gene showing a 67 missense mutation (c.1259C>G, p.Pro420Atg) in family B

Continued

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders III

List of Figures

Continued from the previous page

Figure No Title Page No

Figure 3.10 Partial amino acid sequence comparison of human GALNS 67 protein with other orthologs, showing shaded Proline residue (Pro420) which is highly conserved across different species

Figure 3.11 Pedigree drawing of family C exhibiting autosomal recessive 68 Morquio A syndrome

Figure 3.12 Clinical features of affected individuals in family C 68

Figure 3.13 Haplotypes, of family C showing linkage at chromosome 69 16q24.

Figure 3.14 Chromatograms of sequencing GALNS gene in family C 69

Figure 3.15 In silico structural and functional analysis of normal and 70 mutated GALNS protein having p.Arg386Cys mutation

Figure 3.16 Pedigree outline of family D segregating autosomal recessive 71 Morquio A syndrome

Figure 3.17 Clinical features of an affected individual in family D 71

Figure 3.18 Haplotypes representing allelic pattern of GALNS in family D 72

Figure 3.19 Sequence analysis of exon 7 of the GALNS gene in family D 72

Figure 3.20 Bioinformatics analysis of normal and Mutant GALNS 73 protein in family D

Figure 3.21 Pedigree drawing of family E segregating autosomal recessive 74 mucopolysccharidosis type IVA (MPS IVA)

Continued

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders IV

List of Figures

Continued from the previous page

Figure No Title Page No

Figure 3.22 Photographs of affected individuals in family E 74

Figure 3.23 Haplotypes generated by linkage analysis in family E 75

Figure 3.24 Sequencing chromatograms of exon 4 of the GALNS gene in 75 family E

Figure 3.25 Pedigree diagram of family F with autosomal recessive MPS 76 IVA

Figure 3.26 Clinical presentation of affected individual (IV-2) of family F 76

Figure 3.27 Haplotypes demonstrating allelic pattern of the GALNS gene 77 in family F

Figure 3.28 Nucleotide sequence of exon 4 of the GALNS gene in family 77 F exhibiting frameshift mutation (c.360-361InsA)

Figure 4.1 Pedigree diagram of family G segregating autosomal 86 recessive AMDM

Figure 4.2 Clinical features of affected individuals in family G 86

Figure 4.3 Haplotypes demonstrating linkage at chromosome 9p13.3 in 87 family G

Figure 4.4 Partial DNA sequence of the NPR2 gene showing missense 87 mutation (c.2245C>T) in family G

Figure 4.5 Pedigree of family H segregating autosomal recessive 89 AMDM

Figure 4.6 Clinical features of affected individuals in family H 89

Continued

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders V

List of Figures

Continued from the previous page

Figure No Title Page No

Figure 4.7 Haplotypes demonstrating allelic pattern of NPR2 in family 90 H

Figure 4.8 Partial DNA sequence of exon 11 of the NPR2 gene in 90 family H

Figure 4.9 Pedigree diagram of family I, segregating autosomal 91 recessive AMDM

Figure 4.10 Clinical features of affected individuals in family I 91

Figure 4.11 Haplotypes of family I, showing linkage on chromosome 92 9p13.3

Figure 4.12 Nucleotides sequence of exon three of the NPR2 gene 93 showing missense mutation (c.941T>G; p. Leu314Arg) in family I

Figure 4.13 Amino acid sequence of NPR2 protein in human and other 93 species showing that amino acid residue (Leu314) is highly conserved.

Figure 5.1 Pedigree drawing of family J segregating autosomal 104 recessive postaxial polydactyly

Figure 5.2 Photographs and radiographs of the hands and feet of the 105 patients with bilateral postaxial polydactyly in the family J

Figure 5.3 Sequencing analysis of KIAA085 gene in individuals of 106 family J segregating autosomal recessive postaxial polydactyly

Continued

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders VI

List of Figures

Continued from the previous page

Figure No Title Page No

Figure 5.4 Pedigree of family K demonstrating autosomal mode of 109 inheritance

Figure 5.5 Clinical features of the affected individuals in family K 110

Figure 5.6 Sequence analysis of novel mutation (c.1115_1117delCCT; 111 p.S372del) in the MKS1 gene

Figure 5.7 In silico protein models of normal and mutated MKS1 protein 111

Figure 6.1 Pedigree drawing of family L segregating autosomal rcessive 125 split hand/foot malformation

Figure 6.2 Clinical features of affected inviduals in family L 125

Figure 6.3 Haplotype of family L showing linkage at SHFM6 locus on 126 chromosome 12q13.12

Figure 6.4 Nucleotide sequence of exon 3 of WNT10B gene demonstrating 126 genotypes of affected and unaffected members of family L

Figure 6.5 Pedigree diagram of family M segregating autosomal recessive 127 SHFM

Figure 6.6 Clinical features of affeceted individuals in family M 127

Figure 6.7 Haplotypes of family M showing allelic pattern of SHFM6 128 locus in family M

Figure 6.8 Nucloetied sequence of exon 3 of WNT10B gene demonstrating 128 segregation of frameshift mutation (c.300-306dupAGGGCGG) in family M

Figure 6.9 In silico modeling and conservation analysis of frameshift 129 mutation (p. Leu103Argfs*52) in WNT10B protein.

Continued

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders VII

List of Figures

Continued from the previous page

Figure No Title Page No

Figure 6.10 Pedigree drawing of family N segregating autosomal recessive 130 split hand/foot malformation

Figure 6.11 Phenotypes of affected individuals in family N 131

Figure 6.12 Ideogram of chromosome 2 displaying the genetic contents of 132 homozygous region on chr2q31.1-q31.3 identified by SNP array in family N

Figure 6.13 Partial DNA sequence of the HOXD8 gene showing six 132 nucleotides duplication (c.217-222dupCACCCG) in family N

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders VIII

List of Tables

Table No Title Page No

Table 2.1 List of microsatellite markers used for genetic mapping of the 33 genes/loci involved in hereditary skeletal disorders

Table 2.2 List of primer sequences used to amplify GALNS gene exons 39

Table 2.3 List of primers used for sequencing GALNT3 gene 40

Table 2.4 Primer sequences used for sequencing the coding region of 42 GDF5 gene

Table 2.5 List of primers used for exon amplification of WNT10B gene 42

Table 2.6 List of primers used for NPR2 gene sequencing 43

Table 2.7 Primers used for segregation analysis of the variants detected 45 by whole exome sequencing

Table 3.1 Summary of clinical and mutational spectrum identified in the 60 six families demonstrating MPS IVA

Table 4.1 Clinical features observed in affected individuals of family G 85

Table 4.2 Clinical features of affected individuals in family H 88

Table 5.1 List of mutations identified by WES and their segregation 103 patterns within family J

Table 5.2 Clinical information of affected individuals in family K 107

Table 5.3 Segregation patern of mutations idetified by exome 108 sequencing in family K

Table 6.1 Segregation pattern of mutations detected by whole exome 124 sequencing in HOXD8, HOXD9 and HOXD13 in family N

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders IX

List of Abbreviations

µl Microliter

AMDG Acromesomelic dysplasia type Grebe

AMDH Acromesomelic dysplasia type Hunter and Thompson

AMDM Acromesomelic dysplasia Maroteaux type

A-P Anterior-posterior axis

APS Ammonium persulphate

ARSB Arylsulfatase B

ATF4 Activating transcription factor 4

BAM Burrows-Wheeler Alignment

BBS Bardet–Biedl syndrome

BMPs Bone morphogenetic proteins bp Base pair

CATSHL Camptodactyly, tall stature, and hearing loss syndrome

ChaS Chromosome analysis suite

Cm Centi meter cM Centi morgan

CNP C-type natriuretic peptide

CNV Copy number variation

COL11A1 Type 11 collagen gene

COL2A1 Type II collagen gene

CREBBP Creb-binding protein

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders X

List of Abbreviations

CTGF Connective tissue growth factor

DLX5 Distal-Less Homeobox 5

DLX6 Distal-Less Homeobox 6 dNTPs Deoxy nucleotide triphosphates

DTCS Dye terminator cycle sequencing

D-V Dorsal-ventral axis

EDTA Ethylene diamine tetra-acetic acid

EGF Endothelial growth factor

EVC Ellis–van Creveld syndrome

ExAC Exome Aggregation Consortium

FGF Fibroblast growth factor

FGFR Fibroblast growth factor receptor

FOS V-Fos Fbj Murine Osteosarcoma Viral Oncogene Homolog

FZD Frizzled, Drosophila, Homolog

GAGs Glycosaminoglycans

GALNS Galactosamine (N-acetyl)-6-sulfate sulfatase

GATK Genome Analysis Toolkit

GDF5 Growth/differentiation factor 5

GHRH Growth hormone-releasing hormone

GJA1 Gap junction protein, alpha-1

GLB1 β-Galactosidase

GLI3 Gli-kruppel family member3

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XI

List of Abbreviations gm Gram

GNS N-acetyl glucosamine 6-sulfatase

H/S Hurler- Scheie syndrome

HCl Hydrochloric acid

HGMD Human Gene Mutation Database

HGSNAT Heparin acetyl-CoA:alpha-glucosaminide N-acetyltransferase

HOXA Homeobox A

HOXB Homeobox B

HOXC Homeobox C

HOXD Homeobox D

HS Hurler syndrome

HYAL2 Hyaluronidases 2

IDS Iduronate-2-sulfatase isoform A precursor

IDUA Iduronidase

IGF Insulin-like growth factors

IHH Indian hedgehog

IRB Institutional Review Board

JS Joubert syndrome

Potassium ethylindiamine tetra accetate K3EDTA

Kb Kilo base

KPK Khyber Pakhtonkhwa

LADD Lacrimoauriculodentodigital syndrome

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XII

List of Abbreviations

LMBR1 Limb region 1

LOH Loss of heterozygousity

LOVD Leiden Open (source) Variation Database

LUMC Leiden University Medical Center

MAF V-Maf Avian Musculoaponeurotic Fibrosarcoma oncogene homolog

MAGPIE Modular GATK-Based Variant Calling Pipeline

MEF MADS-box transcription factors mg Milli gram

Magnesium chloride MgCl2

MIM Mendelian inheritance in man

MKS1 Meckel Syndrome, Type 1 ml Milliliter mM Milli molar mm Milli meter

MMP13 Matrix metalloproteinase 13

MPS Mucopolysaccharidosis

MSX2 Muscle Segment Homeobox, Drosophila, Homolog of, 2

MTS Molar tooth sign

NaCl Sodium chloride

NAGLU α-N-acetylglucosaminidase

NCBI National center for biotechnology information

NGS Next generation sequencing

NOTCH Notch, Drosophila, Homolog

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XIII

List of Abbreviations

NPR2 Natriuretic peptide receptor B

OD Optical density

OMIM Online Mendelian Inheritance in Man

OSX Transcription factor sp7

PAGE Polyacrylamide gel electrophoresis

PAPA Postaxial polydactyly type A

PAPB Postaxial polydactyly type B

PCR Polymerase chain reaction

P-D Proximal-distal axis,

PDB Protein Data Bank pH Negative log of hydrogen ions concentration

PI3K Phosphoinositide 3-kinase pmol Pico mole

PolyPhen-2 Polymorphism Phenotyping v2

PPD Preaxial polydactyly

PTCH1 Patched drosophila homolog 1

PTCH1 Patched homolog 1

PTHR Parathyroid hormone receptor

RNF32 Ring finger protein 32

ROH Regions of homozygosity

Rpm Revolution per minute

RR ABI Prism BigDye® Terminator Cycle Sequencing Ready Reaction Kit v3.1

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XIV

List of Abbreviations

RUNX Runt-domain transcription factor

SD Syndactyly

SDS Sodium dodesyl sulfate

SGSH N-sulfoglucosaminesulfohydrolase

SHFLD Split-hand/foot malformation with long bone deficiency

SHFM Split-hand/foot malformation

SHH Sonic hedgehog

SIFT Sorting Intolerant From Tolerant

SMO Smoothened

SNP Single nucleotide polymorphism

SOX Sry-related HMG box transcription factor

SRPs Short rib-polydactyly group of ciliopathies

SRTD Short-Rib Thoracic Dysplasia 9 With or Without Polydactyly

SS Scheie syndrome

STAT1 Signal transducer and activator of transcription 1

Ta Annealing temperature

Taq Thermus aquaticus

TD Thanatophoric dysplasia

TEMED N, N, N’, N’-Tetra methylethylene diamine

TGF-β Transforming growth factor-β

TNFSF11 Tumor Necrosis Factor Ligand Superfamily, Member 11

UV Ultraviolent

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XV

List of Abbreviations v/v Volume by volume

VCF Variant Call Format

WES Whole exome sequencing

WGS Whole genome sequencing

WNT Wingless-Type MMTV Integration Site family

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XVI

Abstract

ABSTRACT

Genetic defects in the complex processes of embryonic development of the skeleton and its postnatal maintenance result in different types of clinically diverse and genetically heterogeneous skeletal disorders. This presents a diagnostic challenge because of their nonspecific presentation, variable clinical features, highly overlapping phenotypes and lack of recognition as a discrete clinical entity.

The research work, presented in this dissertation, describes clinical and molecular investigations of fourteen families (A-N) segregating various forms of skeletal disorders in autosomal recessive pattern. Clinical examinations were performed at local Government hospitals. Blood samples were collected from both affected and unaffected members of the families. Genomic DNA, extracted from the blood samples, was used for microsatellite and SNP based genetic mapping and whole exome and chain termination sequencing.

Clinical features, observed in affected members of six families (A-F), were analogous to a condition named as mucopolysaccharidosis. Linkage in these families was established to chromosome 16q24.3 harboring GALNS gene. Sanger sequencing revealed two novels (p.Phe216Ser, p.Glu121Argfs*37) and two previously reported mutations (p.Pro420Arg, p.Arg386Cys) in GALNS gene in the six families. In silico analysis predicted that the missense mutations affect structure and function of the GALNS protein.

Clinical and radiographic examinations of affected members in three families (G-I) underscored the manifestations of acromesomelic dysplasia. Microsatellite based genotyping followed by sequence analysis of the NPR2 gene identified three novel missense mutations (p.Arg749Trp, p.Arg601Ser, p.Leu314Arg) in the families.

Human genome scan using SNP microarray followed by exome sequencing discovered a potentially casual frameshift mutation (c.594-595insT; p.Gln198Thrfs*21) in a novel gene KIAA0825 in the family J segregating post-axial polydactyly in an autosomal recessive manner.

Affected individuals in family K exhibited peculiar clinical features including post axial polydactyly, speech impairment, hearing impairment of variable degree and proportionate short stature. This condition represented mild form of Joubert

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XVII

Abstract syndrome. Whole exome sequencing in the family revealed a novel in-frame deletion mutation (c.1115-1117delCCT; p.Ser372del) in the MKS1 gene. In silico analysis revealed that Ser372 residue resides in the “B9” interacting region of the MKS1 protein and inframe mutation (p.Ser372del) causes alteration in the conformation of mutant protein with two extra α helixes.

The present study described three families (L-N) with split hand/foot malformations. In two families (L, M), genetic mapping followed by Sanger sequencing detected a novel frameshift mutation (c.300-306dupAGGGCGG; p.Leu103Argfs*52) in the WNT10B gene. In the third family (N), whole exome sequencing accompanied by SNP microarray, identified six nucleotides duplication (c.217-222dupCACCCG; p.His73_Pro74dup) in a novel causative gene HOXD8.

The work presented in the dissertation resulted in the following publications.

1. Irfanullah, Saadullah Khan, Imran Ullah, C. Arnoud Meijer, Marlies Laurense Bik, Johan T den Dunnen, Claudia AL Ruivenkamp, Marriët JTV Hoffer, Gijs WE Santen, Wasim Ahmad (2016). Hypomorphic MKS1 mutation in a Pakistani family with mild Joubert syndrome and atypical features: expanding the phenotypic spectrum of MKS1-related ciliopathies. American Journal of Medical Genetics Part A 9999A:1–5

2. Irfanullah, Muhammad Umair, Saadullah Khan, Wasim Ahmad (2015). Homozygous Sequence Variants in the NPR2 Gene Underlying Acromesomelic Dysplasia Maroteaux Type (AMDM) in Consanguineous Families. Annals of Human Genetics 79: 238–244

3. Abdul Aziz, Irfanullah, Saadullah khan, Faridullah khan zimri, Noor Muhammad, Sajid Rashid, Wasim Ahmad (2014). Novel homozygous mutations in the WNT10B gene underlying autosomal recessive split hand/foot malformation in three consanguineous families. Gene 534: 265–271.

4. Irfanullah, Abdul Nasir, Sarmad Mahmood, Sohail Ahmed, Muhammad Ikram Ullah, Asmat Ullah, Abdul Aziz, Syed Irfan Raza, Khadim Shah, Saadullah Khan, Muhammad Jawad Hassan, Wasim Ahmad (2016). Identification and in silico analysis of GALNS mutations causing Morquio A syndrome in eight consanguineous families. Turkish Journal of Biology: DOI:10.3906/biy-1607-81

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XVIII

Abstract

5. Asmat Ullah, Ajab Gul, Muhammad Umair, Irfanullah, Abdul Wali, Farooq Ahmad, Abdul Aziz, Wasim Ahmad (2017). Homozygous sequence variants in the WNT10B gene underlie split hand/foot malformation. Genetics and Molecular Biology (Submitted)

6. Irfanullah, Muhammad Ansar, Saadullah Khan, Abdul Aziz, Wasim Ahmad. Exome sequencing revealed a novel gene KIAA0825 underlying autosomal recessive postaxial polydactyly (In Preparation).

7. Irfanullah, Saadullah Khan, Maaike Verschuren, Marlies Laurense Bik, Johan T den Dunnen, Claudia AL Ruivenkamp, Marriët JTV Hoffer, Gijs WE Santen, Wasim Ahmad. Human HOXD8 is a novel candidate gene causing autosomal recessive split hand foot malformation in a large Pakistani consanguineous family (In Preparation)

8. Irfanullah, Syed Zohaib Tayyed Gilani, Saadullah Khan, Wasim Ahmad. Homozygous mutations in NPR2 gene underlying Acromesomelic dysplasia in Pakistani families (In preparation)

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders XIX

Chapter 1 Introduction

INTRODUCTION

Man is evolved in the best of stature that is proportionate, balanced and mounted in an excellent skeletal system. Human skeleton is a miraculous complex network of bones, joints, tendons, ligaments and cartilage that executes vivacious functions in our body. Primary functions of the skeletal system are supporting the bodily organs to keep up the shape of the body, to provide points of attachment for muscles to facilitate movement and protection of vital organs such as brain and spinal cord (Rodan, 2003; Blottner et al., 2006; Clarke, 2008). The human skeletal system is an endoskeleton that is uniquely designed for upright stance and bipedal movement. In addition, the skeleton is the key hematopoietic organ during postnatal life (Taichman, 2005; Fernández and de Alarcón, 2013). It also serves as a major storage reservoir of minerals and lipids (Blottner et al., 2006) and plays a part in endocrine regulation (Hartman, 2007). The skeleton is composed of a sophisticated framework of bones and cartilage which arise from three distinct mesenchymal lineages; the cranial neural crest cells, somites (paraxial mesoderm) and lateral plate mesoderm cells (Ballock and O’Keefe, 2003; Eames and Helms, 2004; Mackie et al., 2008). The prefiguring and architecture of the skeleton during embryonic development determine the number, size, and the shape of the future skeletal elements (Kornak and Mundlos, 2003). A number of transcription factors, hormones, growth factors and their intercellular complex series of signaling cascades, like BMP, FGF, TGF β, WNT, Notch, Hedgehog pathways are involved in proper growth and development of the skeletal elements (Karsenty and Wagner, 2002; Tuan, 2003). Disturbances in the complex processes of skeletal development, growth and homeostasis result in inexorable skeletal disorders (Kornak and Mundlos, 2003). Hereditary skeletal disorders have autosomal dominant, autosomal recessive or X-linked mode of inheritance enthralling a diagnostic challenge because of their variety (Warman et al., 2011). In order to specify diagnosis, radiological and pathological examinations in cooperation with molecular contemplations by identification of gene mutations are often necessary to refine diagnosis. Identification of genes and mutations involved in human hereditary skeletal disorders is important in understanding the pathogenesis of the disorders, for promoting genetic testing, and for the development of specific, targeted treatments for these diseases (Le Merrer et al., 1999; Sawai et al., 1999; Krakow and Rimoin, 2010).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 1

Chapter 1 Introduction

1. Human Skeletal Architecture

Human skeleton is a complex organ system composed of a strong framework of 206 bones (126 appendicular, 74 axial and 6 ossicles) accompanied by cartilage and ligaments that occur in the joints (Savarirayan and Rimoin, 2002). Along the lines of body axis, the skeleton is divided in to two principal parts; axial skeleton and appendicular skeleton (Fig 1.1).

Axial skeleton encompasses the core skeleton that lumps together around the axis to uphold the vertical-central axis of the body. Axial skeleton consists of 80 bones including bones of the head (cranium), ear ossicles, neck, chest, and back. Besides the hyoid bone and three pairs of ear ossicles, the cranial frame involves 22 bone of the skull which includes facial bones to supports the face, and brain case to protect the brain (Helms and Schneider, 2003; Ross et al., 2006). The thoracic cage contains 12 pairs of ribs and the sternum while vertebral column consists of 24 vertebrae plus sacrum and coccyx (Artner et al., 2003; Aguirre et al., 2014).

Appendicular skeleton serves as a pedestal of the body that supports the body weight and helps in locomotion. Overall, the appendicular skeleton consists of 126 bones including bones of upper and lower limbs (hands and feet), in addition to the bones that anchor the limbs to the axial skeleton (Artner et al., 2003; Clarke, 2008).

Concisely, each upper limb is tangled with the thoracic cage of the axial skeleton via pectoral girdle. Pectoral girdle contains the clavicle (collarbone) and scapula. Morphologically, the upper limb is subdivided into three different segments: proximal, medial and the distal parts called stylopod (arm), zeugopod (fore arm) and autopod (hand) respectively (Mundlos and Horn, 2014). The arm contains a single bone (humerus) and fore arm comprises radius and ulna while the hand comprises eight carpal bones in the wrist, five metacarpal bones in the palm region and fourteen phalanx bones in five fingers (Gough-Palmer et al., 2008). Attached with vertebral column through the pelvic girdle (hip bone or coxal bone), the lower limb has a thigh bone called femur, a knee cap called patella. The leg bones include tibia and fibula whereas the foot consists of seven tarsal bones followed by five metatarsals and fourteen small phalanx bones in the toes (Ross et al., 2006; Stricker and Mundlos, 2014).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 2

Chapter 1 Introduction

Figure 1.1: Cartoon exhibition of human skeletal system in anterior and posterior view. Axial skeleton is distinguished by brown color from appendicular skeleton in green color (http://philschatz.com/anatomy-book/contents/m46374.html).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 3

Chapter 1 Introduction

2. The Skeletal Paraphernalia

The skeleton executes its functions through a magnanimous teamwork of bones, cartilage, ligaments, blood vessels and nerves (Clarke, 2006, 2008; Krakow and Rimoin, 2010).

2.1. Bone

Bone is a highly specialized supporting framework of the body, characterized by its rigidity, hardness, and power of regeneration and repair. Bones are the living connective tissues formed of three types of cells: osteoblasts, osteoclasts and osteocytes in amalgamation with extra cellular matrix (Artner et al., 2003; Kini and Nandeesh, 2012). The extracellular matrix contains collagen fibers consolidated in amorphous ground substances such as proteoglycans and plenty of minerals such as calcium and phosphorous in addition with magnesium, sodium, potassium, hyaluronic acid, citrates and bicarbonates (Artner et al., 2003; Brodsky and Persikov 2005). The fabrication of matrix substances is called osteoid before calcification and becoming hard (Artner et al., 2003).

2.1.1. Histology of Bone

The cells of bone preform different functions: Osteoprogenitor cells are stem cells that divide and give rise to the next type of cells, the osteoblasts. Osteoblasts are involved in enzymatic production of extracellular matrix needed for calcification of osteoid (Whyte, 1994; Mackie2003; Logan and Nusse, 2004). Osteoblasts turn into osteocytes when they are embedded by their self-produced osteoid matrix (Bonewald, 1999; Plotkin et al., 2002). The ossified extracellular matrix launch a thin sheet of preliminary bone called lamellae that interacts with its neighboring osteocytes located in the lacuna (small cavities) through thin cellular filaments, lying in small boney ducts, called canaliculi (Artner et al., 2003; Kini and Nandeesh, 2012). Osteoclasts are derived from monocytes which control the bone resorption and remodeling in addition with the regulation of osteoblasts differentiation, hematopoiesis and immune responses (Boyce et al., 2009).

2.1.2. Bone Anatomy

Anatomically, the bones have two integral parts: the diaphysis and epiphysis. The diaphysis is a cylindrical shaft running from proximal end to the distal ends of the

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 4

Chapter 1 Introduction bone. The wall of diaphysis is composed of cortical bone that surrounds the yellow marrow in a hollow space called medullary cavity (Curry, 2006; Laurin et al., 2011; Kini and Nandeesh, 2012). The wider section at each end of the bone is known as epiphysis which consists of spongy bone heaving red marrows. Diaphysis meets with epiphysis via metaphysis containing the epiphyseal plate. The epiphyseal plate becomes an epiphyseal line in adulthood when the layer of hyaline cartilage is replaced by osseous tissue (Karsenty and Wagner, 2002; Kini and Nandeesh, 2012). The cortical surface of bone is surrounded by a sheath of fibrous connective tissue called periosteum that contains nerve fibers, blood vessels and lymphatic vessels that nourish compact bone. Periosteum is involved in the fortification, sustenance and formation of bone. Moreover, it aids in appositional growth and fracture repair. Tendons and ligaments also attach to bones at the periosteum. The inner surface of bone is encased by a membranous structure called endosteum which surrounds the medullary cavity and protects internal surface of bones and blood vessel canal present in bones (Curry, 2006; Laurin et al., 2011; Kini and Nandeesh, 2012).

2.1.3. Types of Bones

According to their shape, bones are classified into five key groups including long bones, short bones, flat bones, irregular bones and sesamoid bones. Long bones include the bones of upper limbs (humerus, ulna, radius, metacarpals and phalanges) and lower limbs (femur, tibia, fibula, metatarsals and phalanges). These bones are cylindrical in shapes which are longer than they are wide. Long bones support the body weight and function as levers to facilitate body movements through muscle contraction. Short bones (carpals and tarsals) are generally equal in length and width which provide stability and support and assist in limited motions. Flat bones are generally thin and a bit curved in shape which provide large areas of attachment for muscles and protect internal vital organs such as heart, brain, liver, and lungs. Examples of flat bones are skull bones, scapula, sternum and ribs. Irregular bones have a more complex contour that does not suite any geometrical shape such as vertebrae and facial bones. Irregular bones protect the internal vital organs. For instance, irregular bones of the vertebral column protect the spinal cord. The irregular bones of the pelvis protect organs in the pelvic cavity. As the name suggests, sesamoid bones have the shape like sesame seed. Sesamoid bones are found in the tendons of the hands, feet and knees that protect the tendons to overcome compressive

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 5

Chapter 1 Introduction forces thus protecting tendons from wear and tear. The common example of sesamoid bone is the knee patella, also known as the kneecap (Clarke, 2008; Saladin and Kenneth, 2012; Forciea, 2014).

2.2. Cartilage

Cartilage is a resilient tissue composed of chondrocytes embedded in the solid extracellular matrix with plenty of water that has the capability to tolerate mechanical stress. The human skeleton originates from fibrous membranes and cartilages which are subsequently replaced by bones. However, few cartilages remain in adults that are found mostly in the skeletal regions where elasticity is required (Kronenberg, 2003; Rajpar et al., 2009; Geister and Camper, 2015). The cartilage, lacking nerves or blood vessels, and is girded by a layer of dense connective tissue, the perichondrium. Perichondrium resists the outward expansion of cartilage and confines the thickness of cartilage by restricted nutrient supply (Duynstee et al., 2002).

2.2.1. Types of Cartilages

Based on collagenous fiber contents in the matrix, there are three types of cartilage. (i) Cartilage found in the tips of long bones, ribs and fetal skeleton that is finally ossified into bone is called hyaline cartilage that contains very fine collagenous fiber in the matrix. (ii) Cartilage with plenty of elastic collagenous fibers is called elastic cartilage that occurs in ear auricle, ear canal, eustachian tube and epiglottis. (iii) Fibrocartilage is composed of a dense network of collagen fibers and shows resistance to stress and tension. It generally occurs in vertebral discs and knee joints (Artner et al., 2003; Hall, 2005).

3. Skeletal Development

Human skeletal development is a temporally and spatially regulated process which initiates by the condensation and differentiation of multipotent osteochondroprogenitor, mesenchymal cells originating from three distinct sites: the neural crest, paraxial mesoderm, and lateral plate mesoderm (Olsen et al., 2000). The skeletogenic cells migrate to specific sites in the body to take on the future skeletal fate. These osteochondroprogenitor cells may be transformed into chondrocytes (cartilage cells), osteoblasts (bone cells), or articular chondrocytes and synovial cells (joint cells) while some may remain as mesenchymal stem cells during the course of life (Lefebvre and Bhattaram, 2010).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 6

Chapter 1 Introduction

Briefly, the cells originating from neural crest form craniofacial skeleton, paraxial mesodermal mesenchymal cells result in the formation of axial and craniofacial skeleton while appendicular skeleton is formed by the cells of the lateral plate mesoderm (Kronenberg, 2003; Karsenty et al., 2009; Krakow and Rimoin, 2010). In fact, the early skeleton is exclusively cartilaginous which is progressively substituted by bone during fetal and postnatal growth through a process, called endochondral ossification. Conversely, in the process of intramembranous ossification, mesenchymal stem cells differentiate directly into osteoblasts, establishing the ossification centers. Subsequently, osteoblasts are converted into osteocytes when they are entrenched by their autogenic extracellular matrix, called osteoid. Later on, the osteoids combine with calcium to form calcified bone (Aszódi et al., 2000; Opperman, 2000; Karsenty et al., 2009).

Primary skeletal development either via intramembranous ossification or endochondral ossification involves the condensation of mesenchymal cells in specific sites of the body to form a skeletal foundation (Kronenberg, 2003; Karsenty et al., 2009; Krakow and Rimoin, 2010). Except the bones of the brain case, clavicles and pubic bones, all other bones of the body are formed via endochondral ossification (Krakow and Rimoin, 2010). In this process, the mesenchymal cells first differentiate into chondrocytes which undergo proliferation and terminal hypertrophic differentiation to form a cartilage model. These hypertrophic chondrocyte produce a cartilaginous extracellular matrix which is then invaded by osteoblasts, osteoclasts and blood vessels to form primary and secondary centers of ossification (Byers and Brown, 2006; Karsenty et al., 2009; Krakow and Rimoin, 2010). The undifferentiated chondrocytes are encased by the progressively mineralized and matured cartilage template along its length from either ends to form the epiphyseal growth plates (Geister and Camper, 2015).

The growth plate consists of three distinct zones, each containing specific cell types (resting cells, proliferative cells and hypertrophic cells), accompanied by the ossification façade (Kronenberg, 2003; Karsenty et al., 2009; Krakow and Rimoin, 2010; Romereim and Dudley, 2011). Partially differentiated cells from the resting zone entre the proliferative zone to form stakes of discoid chondrocytes after they divide perpendicular to the plane of the growth plate and interpolate over each other (Kronenberg, 2003; Song et al., 2007; Li and Dudley, 2009; Romereim and Dudley,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 7

Chapter 1 Introduction

2011). Ultimately, their volume is increased when the chondrocytes undergo hypertrophic differentiation and finally produce osteoblasts. Recent studies reveal that hypertrophic chondrocytes contribute to the addition of mature bone matrix during their terminal differentiation (Yang et al., 2014; Zhou et al., 2014).

Regulation of chondrocyte proliferation, differentiation, trans-differentiation into osteoblasts, and mineralization controls the growth of each skeletal element and of the individual. During endochondral ossification, the bone forming cells (osteoblasts, osteoclasts) invade the lacunae of the terminal chondrocytes at growth plate. The cartilage matrix is removed by osteoblasts in collaboration with osteoblasts to accrue bone matrix and the endothelial cells vascularize the newly formed bone tissue. Eventually, hematopoietic and stromal cells produce bone marrow. In the process of osteogenesis (bone formation), initially a primary ossification center is established in the diaphysis of fetal long bones while secondary ossification centers are formed in the epiphyses after birth. Finally, both the ossification centers fuse together in early adulthood resulting in the formation of mature bones (Lefebvre and Bhattaram, 2010; Long and Ornitz, 2013).

4. Genetic Regulation of Skeletal Development

Skeletal development is a dynamic and genetically regulated process that involves skeletal patterning via condensation of the skeletogenic cells at the sites of future skeletal elements, followed by cell differentiation into chondrocytes, osteoblasts and osteoclasts to form cartilage and bone. Finally, the skeleton undergoes growth, bone mineralization and bone remodeling throughout the life to maintain an operative and durable skeletal system (Karsenty, 2001; Lefebvre and Bhattaram, 2010). A variety of genes are involved in the process of skeletogenesis which translate into growth factors and their receptors, signaling mediators, transcription factors, extracellular matrix proteins, hormones and enzymes. These genes may operate as differentiation factors to determine the skeletal identity, or patterning factors which specify the number, size, and shape of skeletal elements (Aszódi et al., 2000; Karsenty, 2008; Karsenty et al., 2009).

4.1. Condensation of Mesenchymal Cells and Skeletal Patterning

With the advent of organogenesis, when the three embryonic germ layers (ectoderm, mesoderm, and endoderm) are developed, the skeletogenic cells originate from the

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 8

Chapter 1 Introduction neural tube, notochord, paraxial mesoderm, and lateral plate mesoderm (Lefebvre and Bhattaram, 2010). These osteoprogenitor cells produce a matrix rich in collagen-1, fibronectin, and hyaluronan, and they proliferate or die in a tightly controlled manner (Shum et al., 2003; Li et al., 2007) to form future skeletal elements (Shubin and Alberch, 1986; Hall and Miyake, 2000). The phenomenon of skeletal patterning has been well studied in the developing limb to evaluate the establishment of proximal- distal (P-D), anterior-posterior (A-P) and dorsal-ventral (D-V) axes (Karsenty, 2001; Barham and Clarke, 2008).

Mesenchymal condensation in the limb buds takes place through active congregation of cells which involves a number of regulating factors such as NCAM and N-cadherin for cell–cell adhesion (DeLise et al., 2000). Bone morphogenetic proteins (BMPs), transforming growth factor-β (TGF-β), type I and type II serine/threonine kinase receptors, receptors SMADs (R-SMADs) 1, 5, and 8 and SMAD4 are the key sponsors of chondrogenic mesenchymal condensation (Feng and Derynck 2005; Massague et al., 2005). Identity and maintenance of these cells at the sites of condensation is regulated by group C of Sry-related HMG box transcription factors such as SOX4, SOX11, SOX12 and the osteogenic Runt-domain transcription factor RUNX2 (Eames et al., 2004; Dy et al., 2008; Bhattaram et al., 2010). HOXA13 and HOXD13 regulate mesenchymal condensation in autopod in Eph–ephrin dependent manner (Stadler et al., 2001; Lu et al., 2008).

Human HOX proteins share a common DNA-binding homeodomain that are encoded by family of 39 genes distributed in four gene clusters; HOXA, HOXB, HOXC and HOXD located on chromosome 7p14, 17q21, 12q13 and 2q31, respectively (Quinonez and Innis, 2014). Each gene in a cluster maintains a definite expression pattern along the anteroposterior axis of the trunk, limb, and head (McGinnis, 19992).

Prior to the cells condensations in the limb mesenchyme, Fibroblast growth factor (FGF) signaling activates downstream signaling pathways such as MAPK (mitogen- activated protein kinase), PI3K (phosphoinositide 3-kinase), STAT1 (signal transducer and activator of transcription 1) and PKC (protein kinase C). Fibroblast growth factors (FGFs) constitute a family of about 22 proteins that function by binding to their cell surface tyrosine kinase FGF receptors (FGFR1–FGFR4) (Eswarakumar et al. 2005; Turner and Grose, 2010). The expression and activity of transcription factors involved in skeletal patterning is regulated by a number of morphogens such as

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 9

Chapter 1 Introduction fibroblast growth factors (FGF2, FGF4, FGF8, FGF10), Wnt ligands (WNT7A, WNT10B), Sonic hedgehog (SHH) and retinoic acid (Butterfield et al., 2010). Skeletogenic cells undergo precartilaginous condensation followed by chondrocyte early differentiation to form a multitude of cartilage anlagen leading to the construction of primary skeleton. During the Precartilaginous condensation, skeletogenic cells stop proliferation and express collagen-1 (COL1A1), hyaluronan, N-cadherin (CDH2), tenascin-C (TNC) and other adhesion proteins that allow them to aggregate together (Hall and Miyake, 2000; Shum et al., 2003). Recent studies suggest that precartilaginous condensation involves Tgf-beta and Wnt/beta-catenin signaling (Tuli et al., 2003).

4.2. Chondrocyte Differentiation and Development of Cartilage Growth Plate

Following condensation, the mesenchymal cells undergo early chondrocyte differentiation accompanied by secretion of cartilage extracellular matrix rich in types II, IX, and XI collagen (COL2A1, COL9A1, COL11A1) and proteoglycans such as aggrecan. Peripheral cells of the condensation remain skeletogenic and form the perichondrium, which demarcates the emerging skeletal element from the nearby mesenchyme (Caplan and Pechak, 1987). The early chondrocytes differentiation is governed by a trio of transcription factors including SOX9, SOX5 and SOX6 through regulating the expression of downstream genes that encode a number of cartilage- specific matrix proteins such as collagen II (COL2A1) and aggrecan (Akiyama, 2008; Long and Ornitz, 2013). Molecular studies revealed that expression and functions of SOX genes is controlled by a number of signaling pathways. For instance, BMP signaling, SHH signaling and FGF signaling enhance SOX9 expression while WNT/beta-catenin signaling inhibits chondrogenic activity of SOX trio (Lefebvre and Bhattaram, 2010). Similarly, NOTCH signaling and retinoid signaling via the retinoic acid receptors (RARs) have also been reported to suppress early chondrocyte differentiation (Long and Ornitz, 2013).

After the formation of cartilage primordia, almost all chondrocytes initially undergo proliferation in a staggered manner through progressive maturation steps to form prehypertrophic, hypertrophic, and matrix-mineralizing terminal chondrocytes (Long and Ornitz, 2013). Subsequently, the growth plate is established as a result of growth and shaping of cartilage primordia into a long shaft (diaphysis) flanked by globular ends (epiphyses) (Lefebvre and Bhattaram, 2010). Chondrocytes in the developing

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 10

Chapter 1 Introduction growth plate express various genes at different stages such as matrilin-1 (MATN1) and the fibroblast growth factor receptor 3 (FGFR3) at the proliferative stage, and the parathyroid hormone receptor (PTHR), IHH, and collagen-10 (COL10A1) at the prehypertrophic stage (Long and Ornitz, 2013). Some other molecular markers such as matrix metalloproteinase 13 (MMP13) are expressed by terminal hypertrophic chondrocytes which undergo apoptosis. Simultaneously, the hypertrophic cartilage is invaded by blood vessels (Stickens et al., 2004) and the inner perichondrium cells differentiate into osteoblasts which form the bone color via secreting bone matrix (Caplan and Pechak, 1987). Maturation and hypertrophy of chondrocytes is regulated by various nuclear factors including Runt-domain transcription factors (RUNX2 and RUNX3), MADS-box transcription factors (MEF2C and MEF2D) under the control of histone deacetylase 4 (HDAC4) (Takeda et al., 2001; Vega et al., 2004; Arnold et al., 2007; Tu et al., 2012). In addition, transforming growth factor-beta (TGFβ), growth hormone (GH), insulin-like growth factors (IGF), connective tissue growth factor (CTGF) and C-type natriuretic peptide (NPPC) are also the key players of chondrocyte proliferation and hypertrophy (Pogue et al., 2006; Mackie et al., 2008; Olney, 2009).

The orderly maturation of chondrocytes in the growth plate is essential for proper skeletal development (Kronenberg, 2003) that is regulated by a number of extra cellular signaling pathways. In brief, the chondrocytes proliferation and hypertrophy is regulated by IHH and PTHrP signaling in a negative-feedback mechanism which involves derepression of GLI3 (Long and Ornitz, 2013). On the other hand, the FGF signaling suppresses chondrocyte proliferation and maturation through a systematic interplay between FGF9/FGF18 and their receptor, FGFR3. FGF signaling ultimately activates MAPK pathway and the STAT1 transcription factor to inhibit chondrocyte proliferation and maturation respectively (Murakami et al., 2004; Ornitz, 2005). Moreover, BMP and NOTCH signaling stimulate chondrocytes proliferation and maturation while WNT5A expressed by prehypertrophic chondrocytes promotes hypertrophy (Long and Ornitz, 2013).

4.3. Osteoblast Differentiation and Bone Development

Osteoblasts generate bones either by endochondral or intramembranous ossification (Lefebvre and Bhattaram, 2010). Together with chondrocytes hypertrophy, osteoblasts differentiation is initially induced by IHH within the perichondrium which

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 11

Chapter 1 Introduction is then called periosteum or bone collar (St-Jacques et al., 1999). Osteoblasts differentiation starts with the establishment of a non-mineralized organic matrix (osteoid) accompanied by upregulated expression of collagen-1 (COL1A1) and alkaline phosphatase (ALPL) which facilitate matrix mineralization (Hartmann, 2009; Karsenty et al., 2009; Jensen et al., 2010). Vascularization of the developing bones is triggered by endothelial growth factor (EGF) and matrix metalloproteinases (MMP13, MMP14) help in the degradation of cartilage matrix through osteoclasts (Stickens et al., 2004; Zelzer et al., 2004). Osteoblast differentiation from mesenchymal progenitors involves several transcription factors at definite developmental stages which include SOX9 (Dy et al., 2012), RUNX2 (Otto et al., 1997; Ducy et al., 1999), ATF4 (Elefteriou et al., 2006) and OSX. Some transcription factors such as MAF, TAZ, SATB2, RB, GLI2, DLX5, MSX2 and BAPX1 regulate the expression and activities of RUNX2 during osteoblast differentiation (Karsenty, 2009; Long, 2012a).

Osteoblasts differentiation is regulated by a number of extracellular signaling. IHH (Indian hedgehog) signaling induces osteoblast differentiation via PTCH1 (receptor Patched homolog 1) and SMO (Smoothened) to inhibit GLI3R (GLI3 repressor) and enhance GLI2 activator (GLI2A) expression (Hilton et al., 2005; Joeng and Long, 2009). Downstream of IHH signaling, WNT/beta-catenin signaling pathway plays a critical role in promoting osteoblast differentiation and decides the fate of skeletogenic cells to undergo osteogenesis or chondrogenesis. Binding of WNT to its receptors, FZD and LRP5 or LRP6, up regulates β catenin target genes resulting in stimulation of RUNX2 and OSX (Rodda et al., 2006; Karsenty et al., 2009). Fibroblast growth factor (FGF) signaling performs diverse roles at different stages of osteoblast differentiation. For instance, FGFR1 promotes early osteoblastic differentiation but inhibits osteoblasts maturation. On the other hand, FGFR2 and FGFR3 enhance maturation of osteoblast whereas FGF18 promotes osteoblast proliferation and maturation through FGFR2 (Valverde-Franco et al., 2004; Jacob et al., 2006). Bone morphogenetic proteins (BMP2, BMP3 or BMP4) signaling promotes osteoblast differentiation through phosphorylation of SMAD1, SMAD5, or SMAD8 leading to the up regulation of RUNX2 and OSX which enhance the function of mature osteoblasts (Tsuji et al., 2006; Tan et al., 2007; Kokabu et al., 2012). Mature osteoblasts produce bone-specific proteins, such as osteocalcin (BGP) and bone sialoprotein (BSP), and

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 12

Chapter 1 Introduction mineralize the osteoid matrix. Mature osteoblasts can differentiate further to osteocytes or bone lining cells or undergo apoptosis (Long and Ornitz, 2013).

4.4. Osteoclast Differentiation and Bone Homeostasis

Contrasting chondrocytes and osteoblasts, osteoclasts are multi nucleated cells of hematopoietic lineage which regulate bone remolding and homeostasis (Karsenty et al., 2009). Osteoclasts and monocytes originate from common hematopoietic stem cells. Osteoclast differentiate into pre-osteoclasts, mono-nucleated osteoclasts which then fuse together to form multi-nucleated osteoclast. This process is regulated by several transcription factors including TNFSF11, FOS, TRAF6, NFATC2 and DCSTAMP (Ikeda et al., 2004; Nakashima et al., 2011; Miyamoto, 2012).

5. Hereditary Skeletal Disorders

The discrete genetic pathways involved in growth and remodeling of bones in different stages of life share several reciprocal regulatory genes and proteins, local paracrine regulators, blood stream hormones, and transcription factors (Kronenberg, 2003). Defects in genetic pathways regulating embryonic skeletal development and/or postnatal maintenance of the skeleton result in clinically heterogeneous and genetically diverse group of hereditary skeletal disorders collectively known as osteochondrodysplasias (Krakow and Rimoin, 2010; Warman et al., 2011; Bonafe et al., 2015). Clinical manifestations of skeletal disorders range from neonatal lethality to merely mild growth retardation. In most of skeletal disorders, there is a generalized abnormality in linear skeletal growth and in some disorders there are concomitant abnormalities in organ systems other than skeleton (Krakow and Rimoin, 2010). Hereditary skeletal disorders can be inherited as autosomal dominant, autosomal recessive or X-linked diseases (Olsen, 2009; Warman et al., 2011).

Genetic mutations affecting condensation, proliferation and migration of skeletogenic cells may result in malformations of single bones alone or a group of bones in a specific skeletal part. Such types of skeletal disorders are generally known as dysostoses (Mundlos and Olsen, 1997a, b). These disorders include polydactyl, syndactyly and split hand foot malformation (Schramm et al., 2009). On the other hand, mutations in genes that control differentiation of chondrocytes and osteoblasts or those which regulate bone and cartilage matrix production result in osteochondrodysplasias characterized by abnormal development and growth of

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 13

Chapter 1 Introduction skeletal elements more broadly (Olsen, 2009; Warman et al., 2011). Moreover, mutation in genes that are involved in skeletal development and also have vital roles in non-skeletal systems result in skeletal disorders with associated abnormalities such as cardiac, renal, pulmonary, auditory, visual, neurological and psychological complications (Olsen, 2009; Krakow and Rimoin, 2010).

Importantly, for many skeletal disorders, mutations in the same gene can result in completely different phenotypes, such as mutations in FGFR3 gene can cause achondroplasia, Lacrimoauriculodentodigital syndrome (LADD) and Camptodactyly, tall stature, and hearing loss syndrome (CATSHL) (Rimoin et al., 2004; Warman et al., 2010). In contrast, mutations in different genes can produce similar phenotypes. For instance, mutations in COL9A1, COL9A2, COMP and MANT3 genes can result in multiple epiphyseal dysplasias (Jakkula et al., 2005; Warman et al., 2011). In this way, hereditary skeletal disorders remain a diagnostic challenge because of their variety.

In the year 2010 revision of nosology and classification of hereditary skeletal disorders, 456 different conditions were documented and placed in 40 groups according to their molecular, biochemical, and/or radiographic evaluation. Out of these, 316 were found associated with mutations in one or more of 226 different genes (Warman et al., 2011). In the Bonafe et al. (2015) revision, 436 skeletal disorders were ratified that were grouped under 42 categories while 364 causative genes were documented for hereditary skeletal disorders.

On the basis of clinical manifestations, hereditary skeletal disorders can be divided into: short stature such as achondroplasia, primordial dwarfism and acromesomelic dysplasia (Bartels et al., 2004; Heuertz et al., 2006; Wit et al., 2011), lysosomal storage disorders such as mucopolysaccharidosis (Coutinho et al., 2011), skeletal ciliopathies such as Joubert syndrome and related disorders (Waters and Beales, 2011) and anatomical abnormalities such as limb deformities including polydactyly and split hand-foot malformation (Wilcox et al., 2013; Deng et al., 2015).

5.1. Acromesomelic Dysplasias

Acromesomelic dysplasias represent a group of skeletal disorders characterized by disproportionate shortening of the skeletal elements, mainly affecting middle parts of forearms and forelegs, and distal segments (hands and feet) of the appendicular

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 14

Chapter 1 Introduction skeleton. On the basis of phenotypic and radiologic variability recorded in patients, acromesomelic dysplasias are categorized into three types; acromesomelic dysplasia type Grebe (AMDG), acromesomelic dysplasia type Hunter and Thompson (AMDH) and acromesomelic dysplasia Maroteaux type (AMDM) (Grebe, 1952; Maroteaux et al., 1971; Hunter and Thompson, 1976).

Clinical features of AMDM include disproportionate short stature with noticeable shortening of middle and distal segments of the skeleton (Maroteaux et al., 1971; Langer and Garrett, 1980). Radiographic features of AMDM patients revealed short ulna with hypoplastic distal end. The skull is usually dolichocephalic with shortness of the trunk and reduced vertebral height without any associated facial or mental abnormalities (Langer and Garrett, 1980).

Acromesomelic dysplasia Maroteaux type (AMDM) is caused by mutation in the gene NPR2 located on chromosome 9p21-p12 that encodes natriuretic peptide receptor B (NPR-B) (Bartels et al., 2004). Several studies validated that CNP-NPR2 signaling plays an important role in endochondral ossification and its inactivation resulted in dwarfism in both mouse and human (Yasoda et al., 1998; Chusho et al., 2001; Tsuji and Kunieda, 2005; Teixeira et al., 2008).

Mutations in GDF5 gene result in acromesomelic dysplasia type Hunter and Thompson (AMDH) and acromesomelic dysplasia type Grebe (AMDG) (Thomas et al., 1996; Al-Yahyaee et al., 2003). GDF5 is located on chromosome 20q11.22 that encodes 1339 amino acids protein (growth and differentiation factor 5). Just like other differentiation factors (GDF6 and GDF7), GDF5 is essential for normal bone development in the limb, skull and axial skeleton (Settle et al., 2003).

5.2. Mucopolysaccharidosis

Mucopolysaccharides also known as glycosaminoglycans (GAGs) are long chains of linear polysaccharides molecules that are found in connective tissues, mucus, skin, bone, cartilage and in fluid around the joints (Taylor and Gallo, 2006). GAGs stabilize and support cellular and fibrous components of the tissues while helping water balance of the body (Esko et al., 2009). GAGs are the catabolic products of proteoglycans which enter the lysosome for intracellular degradation. GAGs consist of disaccharide building blocks containiog an amino sugar (N-acetylglucosamine N- acetylgalactosamine) and a uronic acid (glucuronic acid or iduronic acid) or galactose.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 15

Chapter 1 Introduction

Depending on the type of molecule to be degraded (dermatansulfate, heparan sulfate, keratan sulfate, and chondroitin sulfate) there are four different pathways of lysosomal degradation of GAGs catalyzed by 10 different enzymes including four glycosidases, five sulfatases, and one non hydrolytic-transferase (Taylor and Gallo, 2006; Esko et al., 2009). A genetic deficiency of enzymes catalyzing their metabolism leads to abnormal deposits of mucopolysaccharides in tissues and their excretion in urine. This abnormal accumulation of GAGs in the lysosome results in swelling of lysosome which occupies more space in the cytoplasm. As a consequence the other cellular organelles are disturbed and the nuclear outline is deformed which give rise to a group of disorders known as Mucopolysaccharidosis (Neufeld and Muenzer, 2001; Giugliani et al., 2011).

Mucopolysaccharidosises (MPSs) are inherited in an autosomal recessive pattern except MPS II which is X-linked. MPSs are classified into seven well defined syndromes associated with mutations in ten different genes (Khedhiri et al., 2009; Rasalkar et al., 2011). According to their clinical features molecular genetics mapping, MPSs have been classified under seven main groups which are further divided into their subtypes. MPS type V and type VIII are not applicable anymore because MPS type V has been designated as MPS IS (Scheie syndrome) while there is no recognized disease for MPS type VIII (Spranger, 1977; White, 2012).

Mucopolysaccharidosis I is caused by intralysosomal accumulation of Dermatan sulphate and Heparan sulphate due to the deficiency of α-L-iduronidase as a result of mutation in IDUA gene (Narayanan et al., 1987; Coutinho et al., 2011). On the bases of clinical features, there are three subtypes of MPS1 including Hurler Syndrome (MPS IH), Hurler- Scheie syndrome (MPSI H/S) and Scheie Syndrome (MPS IS) which was previously known as MPSV (Narayanan et al., 1987; Bradbur et al., 1989; Giuglian et al., 2010).

Hunter syndrome (MPS II) is an X-linked recessive disorder caused by mutation in IDS gene resulting in the deficiency of an enzyme iduronate-2-sulfatase and subsequent accumulation of heparansulphate and dermatan sulfate (Mossman et al., 1983; Giuglian et al., 2010).

Mucopolysaccharidosis type III is an autosomal recessive disorder characterized by severe neurological symptoms like aggressive behavior, hyperactivity, profound

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 16

Chapter 1 Introduction dementia, and irregular sleep while in some cases some deafness and loss of vision may be observed. The patients may exhibit thickened skin and mild facial abnormalities and growth retardation with noticeable skeletal deformities (Esposito et al., 2000). Alternative name for MPS III is Sanfilippo syndrome and it is caused by the lysosomal accumulation of heparan sulfate (Narayanan et al., 1987). There are four distinct types of MPS III (Sanfilippo syndrome A-D) each caused by deficiency of different enzymes needed to completely break down heparan sulfate sugar chain. Genes involved in pathogenesis of MPS III include SGSH, NAGLU, HGSNAT and GNS causing Sanfilippo syndrome type A, B, C and D respectively (Weber et al., 1999; Coutinho et al., 2008; Elcioglu et al., 2009; Valstar et al., 2010).

Mucopolysaccharidosis type IV/Morquio syndrome is an autosomal recessive lysosomal storage disorder caused by intralysosmal accumulation of Keratan sulfate and chondroitin 6-sulfate. Mucopolysaccharidosis Type IV has two subtypes: MPS IVA and MPS IVB. Morquio A syndrome is an autosomal recessive lysosomal storage disease characterized by intracellular accumulation of keratan sulfate and chondroitin-6-sulfate. Individual affected with Morquio A syndrome lack the enzyme N-acetylgalactosamine-6-sulfate sulfatase due mutation in the GALNS (galactosamine (N-acetyl)-6-sulfate sulfatase) gene present on Chromosome 16q24.3 (Montano et al., 2008). The Key clinical features include short stature, pigeon chest, lumbar kyphosis, genu valgum, dental anomalies, and corneal clouding. Intelligence is normal and there is no direct central nervous system involvement although the skeletal changes may result in neurologic complications. Individuals with Morquio A syndrome show variable severity but patients with the severe phenotype usually do not survive past the second or third decade of life (Montano et al., 2008; Rasalkar et al., 2011). MPS IV B/Morquio B syndrome is caused by mutations in GLB1 gene resulting in the deficiency β-Galactosidase enzyme that is responsible for degradation of keratan sulfate (Santamaria et al., 2007).

Mutations in the gene ARSB result in malfunctioning of arylsulfatase B enzyme which ultimately causes MPS VI (Giugliani et al., 1999). Deficiency of beta-glucuronidase enzyme due to mutations in the GUSB gene result in intralysosomal accumulation of of glucuronic acid-containing glycosaminoglycans which gives rise to MPS VII (Tomatsu et al., 2002) and mutations in HYAL1 or HYAL2 (hyaluronoglucosaminidase 1/2) genes result in the pathogenesis of MPS IX (Triggs et al., 1999).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 17

Chapter 1 Introduction

5.3. Ciliopathic Disorders of the Skeleton

Primary cilia are nonmotile microtubule-based organelles present on the surface of almost all eukaryotic cells (Serra, 2008). Primary cilia are implicated in a wide range of extracellular signals, such as hormones and growth factors, through specific cells surface receptors, and transmit signals into the nucleus (Yuan et al., 2015). Recent studies reveal that cilia play a critical role in several cellular processes such as proliferation, differentiation and migration, suggesting their indispensable roles in embryonic and postnatal development of many vital organs (Eggenschwiler and Anderson, 2007; Goto et al., 2013; Pan et al., 2013). Defects in cilia and cilia related proteins have been linked with a number of human diseases, including renal, visual, hydrocephalus, neurological and skeletal complications (Waters and Beales, 2011; Huber and Cormier-Daire, 2012).

Ciliopathic skeletal disorders include short rib-polydactyly group (SRPs) such as Verma–Naumoff syndrome (SRP type III) (Cavalcanti et al., 2011), Jeune syndrome (ATD) (Beales et al., 2007), Sensenbrenner syndrome (Arts et al., 2011), Majewski syndrome (SRP type II) (Thiel et al., 2011), Weyers acrofacial dysostosis (Ye et al., 2006) and Ellis–van Creveld syndrome (EVC) (Ruiz-Perez and Goodship, 2009).

Another exemplary set of ciliary skeletal disorders comprise a group of Joubert syndrome and related disorders such as Bardet–Biedl syndrome, Meckel–Gruber syndrome and orofaciodigital syndrome (Coene et al., 2009; Waters and Beales, 2011). Joubert syndrome is a neurodevelopmental disorders with wide-ranging phenotypic variability and genetic heterogeneity. The key clinical feature of Joubert syndrome is the occurrence of a peculiar malformation, ‘‘molar tooth sign’’ (MTS), in the mid/hind brain characterized by horizontally oriented and thickened superior cerebellar peduncles and a deepened interpeduncular fossa along with cerebellar vermis hypoplasia (Louie and Gleeson, 2005; Poretti et al., 2014). This cerebellar abnormality subsequently results in low muscles tone (hypotonia), lack of coordinated muscle movements (ataxia) and intellectual disability of variable degree (Joubert et al., 1968; Romani et al., 2013). Other phenotypic anomalies associated with Joubert syndrome include; poor growth, retinal dystrophy or colobomas, nephronophthisis, postaxial polydactyly and other craniofacial deformities such as cleft lip and/or palate, tongue hamartomas (Brancati et al., 2010). Moreover, delayed walking and lack of

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 18

Chapter 1 Introduction expressive speech has also been reported in Joubert syndrome 3 (Valente et al., 2006) and Joubert syndrome 20 (Srour et al., 2012).

Joubert syndrome is a clinically diverse and genetically heterogeneous disorder caused by mutations in more than 27 genes (Romani et al., 2013; Bachmann-Gagescu et al., 2015) with autosomal recessive mode of inheritance (Valente et al., 2008) except Joubert syndrome 10 that is X-linked caused by mutation in OFD1 gene located on chromosome Xp22.2 (Coene et al., 2009). All of the genes associated with the pathogenesis of Joubert syndrome encode proteins involved in normal functioning of primary cilium or basal body (Brancati et al., 2010; Hu et al., 2010).

5.4. Hereditary Limb Malformations

Human limb-bud development is a highly conserved process with pentadactyl pattern. The limb consists of three distinct regions including stylopod (humerus/femur), zeugopod (ulna/radius in arms and tibia/fibula in legs) and the autopod (carpals, meta carpals or tarsals and meta tarsals in hands and foot and phalanges) (Abbasi, 2011). Structural abnormalities in any part of the limb result in a number of limb deformities which may involve absence or reduction of certain skeletal elements, multiplications of digits, and/or variations in the digit morphology (Zuniga et al., 2012). Clinical manifestations of limb deformities include: absence of the entire limb (amelia), abnormally small or less developed limb (micromelia or brachymelia), absent long bones (ectromelia), missing hands and/or feet (acheiria), missing digits (adactyly), fusion of one or more digits (syndactyly), short digits (brachydactyly), fewer digits than five (hypodactyly/oligodactyly), split autopod due to deficiency or missing of the middle digits (ectrodactyly/Split-hand and split-foot malformations) and duplication or multiplication of digits in hands or feet (polydactyly) (Ephraim et al., 2003; Zuniga et al., 2012; Vasluian et al., 2013).

5.4.1. Polydactyly

Polydactyly is the most common congenital limb anomaly characterized by the presence of extra digit in hands and/or feet. The extra digit may be in the form of a removable soft tissue or it may contain a bone without joint but very rarely occur in the form of a complete finger or toe (Biesecker, 2011). Polydactyly can occur as an isolated limb defect or as a part of congenital anomalies such as Meckel syndrome, Bardet-Biedl, and Joubert syndrome (Verma and El-Harouni, 2015). Up to now, more

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 19

Chapter 1 Introduction than 200 conditions have been reported with polydactyl phenotypes (Biesecker, 2011; Wang et al., 2014; Deng et al., 2015; Verma and El-Harouni, 2015). If the extra digit is found on the ulnar side it is known as postaxial polydactyly (Verma and El- Harouni, 2015) while the extra digit present on the radial side is known as preaxial polydactyly (Materna-Kiryluk et al., 2013) and the polydactyly within the middle three digits is known as central or mesoaxial polydactyly (Haber et al., 2007).

Postaxial polydactyly (PAP) is one of the most common congenital limb malformations characterized by extra digit at ulnar side of the hands and/or feet (Schwabe and Mundlos, 2004; Umm-e-Kalsoom et al., 2012). Post axial polydactyly is generally associated with certain syndrome such as Joubert syndrome and related disorders (Parisi and Glass, 2013). Non-syndromic post axial polydactyly is genetically heterogeneous and phenotypically variable limb anomaly that can be broadly divided into two types; postaxial polydactyly type A (PAPA) and postaxial polydactyly type B (PAPB). PAPA involves a well-developed extra digit while PAPB demonstrates a pedunculated postminimus attached with a rudimentary fifth digit (Schwabe and Mundlos, 2004; Kalsoom et al., 2012, 2013). Non-syndromic postaxial polydactyly usually has autosomal dominant mode of inheritance (Radhakrishna et al., 1999) except PAPA5 and PAPA6 that are autosomal recessive (Kalsoom et al., 2012, 2013).

So far, six disease causing gene loci have been mapped for postaxial polydactyly, which include PAPA1 on chromosome 7p14.1 residing GLI3 gene (Radhakrishna et al., 1999), PAPA2 on chromosome 13q21-q32 (Akarsu et al., 1997; van der Zwaag et al., 2010), PAPA3 on chromosome 19p13.1-13.2 (Zhao et al., 2002), PAPA4 on chromosome 7q22 (Galjaard et al., 2003), PAPA5 on chromosome 13q13.3-q21 (Kalsoom et al., 2012) and PAPA6 on chromosome 4p16.3 containing ZNF141 gene (Kalsoom et al., 2013).

5.4.2. Ectrodactyly or Split-Hand/Foot Malformation (SHFM)

Split-hand/foot malformation (SHFM) is a congenital limb malformation that affects the central rays of the autopod, hands and feet. SHFM is characterized by extremely variable phenotype such as missing digits; aplasia and/or hypoplasia of the phalanges, metacarpals, and metatarsals. Other clinical features include syndactyly presenting a cleft shaped hand or foot consisting fused remnants of radial and ulnar ray fingers

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 20

Chapter 1 Introduction

(Gurrieri and Everman, 2013; Aziz et al., 2014). Monodactyly may occur in severe types of SHFM in which only a single digit remains in hands or feet. SHFMLD (Split- hand/foot malformation with long bone deficiency) involves abnormal tibia and fibula in the lower limb (Klopocki et al., 2012). Split hand foot may occur as an isolated trait or as a part of certain syndrome such as Ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome and Limb–mammary syndrome (LMS) (Rinne et al., 2007).

So far, seven loci associated with SHFM have been described, including SHFM1 on chromosome 7q21.2-q21.3 (Scherer et al., 1994), SHFM2 on Xq26 (Faiyaz ul Haque et al., 1993), SHFM3 on 10q24 (Gurrieri et al., 1996), SHFM4 on 3q28 (Ianakiev et al., 2000), SHFM5 on 2q31 (Boles et al., 1995), SHFM6 on 12q13.11–q13 (Ugur and Tolun, 2008), and another locus on chromosome 8q21.11–q22.3 (Gurnett et al., 2006). For these seven loci, three genes including distal-less homeobox 5/6 (DLX5/6) for SHFM1 (Lo Iacono et al., 2008; Shamseldin et al., 2012), TP63 (tumor protein p63) for SHFM4 (Ianakiev et al., 2000), and a wingless-type MMTV integration site family, member 10B (WNT10B) for autosomal recessive SHFM6 (Ugur and Tolun, 2008) have been identified. SHFM with long bone deficiency (SHFMLD) is caused by micro-duplication of chromosome 17p13.3 harboring BHLHA9 gene (Armour et al., 2011; Klopocki et al., 2012). Recently, Spielmann et al. (2016) reported that mutations in ZAK gene, located on chromosome 2q31.1, result in a syndromic form of ectrodactyly in human and mice.

6. Mapping of Genes Involved in Hereditary Skeletal Disorders

Diagnosis of human hereditary skeletal disorders is challenging due to their nonspecific presentation, variable clinical manifestations, highly overlapping phenotypes and lack of recognition as a discrete clinical entity. Since genetic aberrations are involved in skeletal deformities, identification of disease causing genes and pathogenic sequence variants play an important role in research on and diagnosis of hereditary skeletal disorders (Olsen et al., 2009; Boycott et al., 2013). Genetic mapping is a powerful tool to hunt down the gene responsible for hereditary skeletal disorders (Altshuler et al., 2008). The genetic mapping helps in localizing a gene on a specific chromosome and in identification of exact position the gene on that chromosome (Botstein et al., 1980).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 21

Chapter 1 Introduction

6.1. Linkage Analysis

Homozygosity mapping also known as linkage mapping is generally used to confirm whether the disease transferred from parents to the children is linked to one or more gene (Altshuler et al., 2008). Linkage analysis for identification of disease causing genes is based on the principal that a particular portion of genome of siblings from consanguineous marriages would be homozygous because of identity by descent (IBD). One-sixteenth part of genome of offspring from first cousin marriages is expected to be homozygous (Sheffield et al., 1995; Kong et al., 2008). That particular region of homozygosity is random between different offsprings of these cousin marriages except for a definite disease locus that is exclusively shared and common among all affected siblings (Lander and Botstein, 1987; Browning and Thompson, 2012).

Linkage analysis proceeds by evaluating the likelihood of the observed recombination patterns between a phenotype and a particular marker or a set of markers (Ott, 1989). Linkage mapping is carried out by using a number of molecular markers such as Restriction Fragment Length Polymorphisms (RFLPs), Random Amplified Polymorphic DNA (RAPDs), Amplified Fragment Length Polymorphisms (AFLPs) but microsatellites (Simple tendon Repeats STRs) or Sequence-Tagged Sites (STSs) are the most favorable markers because of their highly polymorphic nature and they are easy and cheap to score cross-species utility in closely related species (Primmer et al., 1996; Davis and Strobeck, 1998; Dawson et al., 2000; Dawson et al., 2005).

6.2. DNA Microarray and Genome-Wide Linkage Analysis

Microarray is a cost effective and time saving approach to perform genome-wide linkage analysis through generating genotypes for all family members’ simultaneously (Hansson et al., 2005; Syvanen, 2005). SNP microarray uses single nucleotide polymorphisms (SNPs) markers because they occur abundantly within the genome, possess stability and exhibit relative ease of scoring (Wang et al., 1998; Syvanen, 2005).

Regions of homozygosity (ROH) detected by SNP microarray indicate uniparental disomy, ancestral homozygosity or parental consanguinity which can lead to the diagnosis of autosomal recessive disease through homozygosity mapping and selection of a candidate gene for sequence analysis (McQuillan et al., 2008; Alkuraya,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 22

Chapter 1 Introduction

2012). Additionally, microarray analysis can detect copy number variations (CNVs) throughout the genome which can add in diagnosis of microdeletion/microduplication syndromes (Manning and Hudgins, 2010; Miller et al., 2010).

7. Mutation Analysis

Identification of disease causing genes and mutations in Mendelian diseases is of great importance to enable molecular diagnosis, carrier testing and understanding of gene functions and biological pathways underlying health and diseases (Oti and Brunner, 2007). DNA sequencing provides a frontline tool for genetic analysis at nucleotide level and thereby mutation detection in genetic disorders (Mahdieh and Rabbani, 2013).

7.1. Sanger Sequencing

Sanger sequencing can determine sequence of small regions (∼1 kb) using a PCR product as a template followed by capillary electrophoresis (Smith et al., 1986). Sequencing template is prepared in PCR using selective chain termination dideoxynucleotides (ddNTPs: ddATP, ddCTP, ddGTP, ddTTP) by DNA polymerase (Sanger et al., 1977; Franca et al., 2002). Sanger sequencing can be used to detect DNA sequence variants (mutations) in hereditary skeletal disorders.

7.2. Next Generation Sequencing

Recently, next generation technologies such as whole genome sequencing (WGS) and whole exome sequencing (WES) have emerged as powerful strategies to pinpoint genomic variants associated with human disease (Hodges et al., 2007; Schuster, 2008; Parla et al., 2011). As only 1% of the whole genome comprises coding sequences (exome) and most of the genetic disorders (85%) have mutations in the coding regions, therefore sequencing the entire coding regions could potentially uncover disease-causing mutations in Mendelian disorders such as skeletal disorders (Ku et al., 2012). Although WGS is more comprehensive, WES is more cost-effective (Sun et al., 2015) and is frequently used for identification of causal mutations in Mendelian diseases (Ng et al., 2010; Santen et al., 2012) and driver mutations in tumors (Agrawal et al., 2011; Varela et al., 2011).

The present study was aimed to establish a genotype-phenotype correlation of congenital skeletal disorders by investigating the disease pathogenesis at molecular

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 23

Chapter 1 Introduction level. The study included identification of the candidate genes and pathogenic sequence variants causing human hereditary skeletal disorders in Pakistani families. The families were ascertained at their residential areas during field visits. After clinical examination of the affected members, blood samples were collected from the available participants for this study. In total, fourteen families were incorporated in this study including six families of mucopolysacharidosis, four families of acromesomelic dysplasia, one family of postaxial polydactyly, one family of Joubert syndrome and three families of split hand/foot malformation.

Classical linkage analysis and SNP microarray were performed for identification of the disease causing genes. Mutations were identified using Sanger sequencing and whole exome sequencing (WES). Pathogenic impacts of the mutations were evaluated using online tools, in silico protein modeling and molecular docking techniques.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 24

Chapter 2 Materials and Methods

MATERIALS AND METHODS

1. Ethical Approval and Human Subjects

Prior to commence the study, ethical approval was obtained from Institutional Review Board (IRB), Quaid-i-Azam University, Islamabad. In total, fourteen families transmitting various forms of hereditary skeletal disorders such as acromesomelic dysplasia, mucopolysacharidosis, Joubert syndrome, polydactyly and split hand/foot malformation were imperiled to clinical and molecular analysis. The families were visited at their dwellings and informed consents were obtained from the available participants or their authorized guardians for genetic analyses and presentation of photographs for publications. Elders of the families were interviewed to collect information about the family history and consanguinity within the families.

According to the standards described by Bennett et al. (1995), pedigrees were drawn to display family relationships and mode of disease transmission within the family. In a pedigree affected female and males were specified by filled circles and squares, respectively. Normal males and females were indicated by blank symbols. Crossed symbols designated the deceased individuals. Double lines between individuals represented consanguineous union. The individual numbers labeled with asterisks indicated the samples available for this study. Roman numerals pointed to generation and individuals within a generation were shown by Arabic numerals. Photographs were taken from affected members of the family to make evident their phenotypes. Clinical and radiographic examinations were performed in the nearby government hospitals. Peripheral blood samples of 4-6 ml were collected from the available participants for the present study in ethylenediaminetetraacetic acid (EDTA) tubes (BD Vacutainer® K3 EDTA, Franklin Lakes NJ, USA) and stored at 4oC.

2. Extraction of Genomic DNA

Genomic DNA from peripheral blood samples was extracted either by a standard phenol-chloroform method or using commercially available kits.

Using Phenol-Chloroform method (Sambrook and Russell, 2001), genomic DNA was extracted by treating a blood sample with prescribed solutions. Solution A was prepared by mixing 10 mM Tris pH 7.5 (BDH, Poole England), 0.32 M Sucrose

(BDH, Poole, England) and 5 mM MgCl2 (Sigma-Aldrich, St Louis, MO, USA). The

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 25

Chapter 2 Materials and Methods solution was autoclaved and finally 1% v/v Triton X-100 (Sigma-Aldrich, St Louis, MO, USA) was added. Solution B contained 10 mM Tris (pH 7.5), 400 mM NaCl (BDH, Poole, England) and 2 mM EDTA (pH 8.0) (BDH, Poole, England). Solution C comprised of solely Phenol (BDH, Poole, England) and solution D contained 24 volumes of chloroform and 1 volume of Iso-amyl alcohol (BDH, Poole, England). 20% SDS (BDH, Poole, England) was used in the extraction protocol.

Equal volumes (750 µL), each of peripheral blood and solution A were taken in a 1.5 mL microcentrifuge tube (Axygen, Union, USA) and kept at room temperature for 10 minutes. The tube was then centrifuged for 1 minute at 13,000 rpm in a microcentrifuge (Eppendorf, Hamburg, Germany). The supernatant was discarded and the pellet was resuspended in 400 μl of solution A. The tube was centrifuged once again and after discarding the supernatant, the pellet was resuspended in 400 μL of solution B, 12 μL of 20% SDS and 6 μL (20 mg/mL) proteinase K and incubated at 37C overnight. On the following day 0.5 mL fresh mixture of equal volumes of solution C plus D was added to the tube, mixed thoroughly and centrifuged for 10 minutes at 13,000 rpm. Two conspicuous layers were observed in microcentrifuge tube after centrifugation. The upper layer was collected in a new microcentrifuge tube and 0.5 mL of solution D was added to the tube. A 10 minutes centrifugation was carried out and the upper layer was once again transferred to a new microcentrifuge tube. After adding 55 μL of 3M sodium acetate and 500 µL of chilled isopropanol, the tube was inverted several times to precipitate the DNA and centrifugation was carried out again at 13,000 rpm for 10 minutes. The supernatant was discarded and the DNA pellet was washed with chilled 70% ethanol (BDH, Poole, England) and dried in a vacuum concentrator 5301 (Eppendorf, Hamburg, Germany) at 30C. After the residual ethanol was evaporated the DNA pellet was dissolved in 100-200 µL of Tris- EDTA buffer (Sigma-Aldrich, St Louis, MO, USA) and incubated at 37C overnight. On the following day the genomic DNA was tested on 1% agarose gel electrophoresis and visualized on UV Trans-illuminator (Biometra, Gottingen, Germany).

Besides, commercially available kits including Gentra puregene (Qiagen Inc. Valencia, CA, USA) and GenEluteTM blood genomic DNA kit (Sigma-Aldrich MO, USA) were used for DNA extraction according to the supplier’s protocols. Genomic DNA was diluted to 40-50 ng/μL for Polymerase chain reaction (PCR) in double distilled PCR water.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 26

Chapter 2 Materials and Methods

3. Genetic Mapping

The families included in this research work were subjected to genotyping using microsatellite markers and/or single nucleotide polymorphic (SNP) markers for identification of genes involved in hereditary skeletal disorders.

3.1. Genotyping using Microsatellite Markers

Highly polymorphic microsatellite markers (average heterozygosity > 75%), flanking the known genes/loci involved in hereditary skeletal disorders, were tested to search for linkage in the families. Genotyping was carried out using 5 to 15 markers linked to each of the candidate gene/locus (Table 2.1). Followed by standard polymerase chain reaction, the separation of amplified products was carried out on 8% non-denaturing polyacrylamide gel electrophoresis. Amplified PCR products were visualized by staining the gel with ethidium bromide and genotypes were assigned by visual inspection.

3.1.1. Polymerase Chain Reaction (PCR)

Polymerase chain reaction (PCR) was carried out in a 200 µL PCR tube containing total volume of 25 µL, which comprised 1 μL DNA (40 ng), 2.5 μL 10 X buffer (100 mM Tris-HCl pH 8.3, 500 mM KCl), 1.5 μL of 25 mM MgCl2 (MBI Fermentas, Pittsburgh PA, USA), 0.5 μL of 10 mM dNTPs (MBI Fermentas, Pittsburgh PA, USA), 0.3 μL of each forward and reverse primer (0.1 μM) and 0.2 μL Taq-DNA polymerase (one unit) (MBI Fermentas, Pittsburgh PA, USA) and 18.1 μL of PCR water. Thermal cycling conditions used included 5 minutes at 95°C for template DNA denaturation, followed by 39 cycles of amplification each consisting of 3 steps: one minute at 95°C for DNA denaturation into single strands, 1 minute at 50-60°C for primer annealing to their complementary sequences on either side of the target sequence and one minute at 72°C for extension of complementary DNA strands from each primer. Finally, 10 minutes extension incubation was achieved at 72°C for Taq- DNA polymerase to synthesize any un-extended strand.

3.1.2. Polyacrylamide Gel Electrophoresis (PAGE)

The PCR products were resolved on 8% non-denaturing polyacrylamide gel. The gel was prepared by mixing 13.5 mL 30% acrylamide solution (29:1 ratio of acrylamide (MERCK, Darmstadt, Germany) and N,N’ Methylene-bisacrylamide (BDH, Poole,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 27

Chapter 2 Materials and Methods

England)), 5 mL 10 X Tris-Borate-EDTA (Tris 0.89 M, Borate 0.89 M, EDTA 0.02 M), 0.4 mL 10% APS (Ammonium persulphate) (Sigma-Aldrich St Louis, MO, USA), 25 L TEMED (N, N, N’, N’-Tetra methylene diamine) (Sigma-Aldrich, St Louis, MO, USA) and 31.13 mL distilled water in a beaker . The gel solution was poured between two glass plates held apart by a spacer of 1.5 mm thickness. A comb was inserted in the gel and allowed to polymerize and dry for half an hour. Before loading in the gel the PCR product was mixed with bromophenol blue dye (0.25% bromophenol blue in 40% sucrose solution) and then electrophoresis was performed at 100 volts for 90-120 minutes in vertical gel electrophoresis apparatus (Whatman, Biometra, Gottingen, Germany) having 1X Tris-Borate-EDTA buffer. The gel was stained with ethidiumbromide (10 µg/mL) solution for visualization on UV Transilluminator (Biometra, Gottingen, Germany). The gel photograph was taken using electrophoresis documentation and analysis system DC 290 (Kodak, Digital Sciences, New York, USA) and genotypes were assigned by visual inspection.

3.2. SNP Microarray

The families which did not show linkage to the known loci, phenotypically related skeletal disorders, were subjected to whole genome SNP microarray. SNP microarray was achieved at Department of Clinical Genetics Leiden University Medical Center (LUMC), The Netherlands. Affymetrix Genome-Wide Human SNP Array 6.0 was used for whole genome linkage analysis that incorporates ~2.6 million markers of genetic variations including SNPs (~750, 000) and (~2 million) probes for CNV detection.

Genomic DNA preparation, labeling and hybridization were performed according to Affymetrix’s recommended protocols (Affymetrix, Santa Clara, CA, USA). In brief, genomic DNA was diluted to 50 ng/µL and digested with Nsp1 restriction enzyme followed by ligation to the adaptors. Adaptor-ligated DNA fragments were amplified by PCR using universal primers that recognize the adaptor sequences. PCR amplification products of Nsp1 enzyme digest were pooled together and purified using magnetic beads. The purified PCR product was then fragmented, labeled and hybridized to the array. Subsequently, the arrays were washed and stained using GenomeWideSNP6_450 protocol (Affymetrix). Finally, the arrays were scanned using GeneChip™ GSC3000 7G Whole-Genome Association System (Affymetrix). After scanning, genotype calling was carried out by means of Genotyping Console

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 28

Chapter 2 Materials and Methods

Software (GTC; Affymetrix, Santa Clara, CA, USA) and data was visualized using Chromosome Analysis Suite 1.0 (ChAS 1.0) (Affymetrix). BENCH Lab CNV (Cartagenia Inc, USA) was used to envisage CNV and LOH regions according to their phenotypic viewpoint. A region was considered homozygous (ROH) which showed Loss of heterozygousity (LOH) in a region containing 1000 consecutive probes and ≥ 2000 kb.

4. Mutation Analysis

When substantial linkage was established in a family, candidate genes within the linkage interval or prospective genes existing in the regions of homozygosity (ROH) from array analysis were sequenced for mutation analysis. Candidate genes were selected from linkage intervals or ROH on the basis of their relevance to the phenotypes observed in the respective skeletal disorder in human or animal models, function of the gene, tissue specific expression and sub-cellular localization of the protein product.

4.1. Sanger Sequencing

Primers from intronic regions of the candidate genes, encompassing exons and exon- intron boundaries, were designed using Primer 3 input (Rozen et al., 2000) online tools (Tab. 2.2-2.5). Firstly, genomic DNA was amplified by PCR in a 0.2 mL PCR tube. Reaction mixture was prepared comprising 5 μL PCR buffer (100 mM Tris-HCl,

500 mM KCl, pH 8.3), 3 μL MgCl2 (25 mM) 1 μL dNTPs (10 mM), 2.5 μL each of both forward and reverse primer (10 pmol), 0.4 μL Taq DNA Polymerase (1 unit) and 1 μL genomic DNA (50 ng/μL). Final volume was raised to 50 μL with distilled water. PCR conditions were kept similar as described above under Polymerase Chain Reaction.

Amplified PCR products were purified using commercially available kits such as PurelinkTM PCR Purification kit (Cat. K3100-02, USA) and Marligen Biosciences (Ijamsville, MD, USA), according to the manufacturer’s protocols. The purified PCR products were subjected to cycle sequencing using either Dye terminator cycle sequencing (DTCS) (Beckman Coulter, Inc. USA) for CEQ8800 DNA sequencer (Beckman Coulter, Inc, USA) or ABI Prism BigDye® Terminator Cycle Sequencing Ready Reaction Kit v3.1 (RR) (PE Applied Biosystems, CA USA) for ABI PRISM® 310 genetic analyzer (Applied Biosystems, Inc, USA). PCR reaction mixture was the

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 29

Chapter 2 Materials and Methods prepared in a reaction tube containing 1 μL (25 ng) of the pre-amplified DNA, 1 μL (10 pmol) of either forward or reverses primer, 1 μL 5X sequencing buffer, 1 μL kit (DTCS or RR) and final volume was adjusted at 10 μL with distilled water. Thermo- cycling conditions for sequencing included initial denaturation at 96oC for 3 minutes, followed by 29 cycles of denaturation at 96oC for 30 seconds, primer annealing at 50- 60oC for 30 seconds, primer extension or polymerization at 72oC for 4 minutes and final extension for 10 minutes at 72oC.

DNA sequencing chromatograms were obtained from CEQ8800 DNA sequencer (Beckman Coulter, Inc, USA) or ABI PRISM® 310 genetic analyzer (Applied Biosystems, Inc, USA). ClustalW multiple alignment was employed for sequence alignment using BioEdit Sequence Alignment 6.0.7 (Ibis, Biosciences, Carlsbad, CA). Reference sequences of the genes under study were obtained from Ensemble Genome browser (http://www.ensemble.org/index.htm) to identify pathogenic sequence variants.

4.2. Whole Exome Sequencing

Whole exome sequencing (WES) was carried out in the Department of Clinical Genetics, Leiden University Medical Center (LUMC), The Netherlands. For WES, genomic DNA was fragmented into 200 to 500 bp fragments by means of Adaptive Focused Acoustics (Covaris Inc., USA) shearing according to the manufacturer's protocol. Exome capture was performed by means of SureSelectXT Human all Exon v5 kit (Agilent) accompanied by Illumina paired end Sequencing library preparation, sequencing on the Illumina HiSEQ2500, generating 2 x 100 bp paired end reads with at least 70x median coverage. The in-house sequence analysis pipeline Modular GATK-Based Variant Calling Pipeline (MAGPIE) (LUMC Sequencing Analysis Support Core, LUMC) based on read alignment using Burrows-Wheeler Alignment (BAM) (Li et al., 2009) and variant calling using Genome Analysis Toolkit (GATK) (McKenna et al., 2010; DePristo et al., 2011) was used for quality control and to generate BAM and VCF files. The variants were annotated using Seatle seq (Ng et al., 2009). Intergenic variants were excluded. Using variant databases (Genome of the Netherlands and the 1000 Genomes Project database), frequent (>5%) variants were excluded. Further filtering for recessive inheritance was performed and finally potentially pathogenic variants were selected for ancillary segregation analysis. Selected variants were verified by Sanger sequencing in all available members of the

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 30

Chapter 2 Materials and Methods family to validate segregation of the variant in accordance with phenotypes. List of primers used for segregation analysis is given in table 2.6.

5. Online Tools for Predicting Pathogenicity of the Mutations

Pathogenic effects of the identified sequence variants were predicted using online tools including Mutation Taster (www.mutationtaster.org), Sorting Intolerant From Tolerant (SIFT) (http://sift.jcvi.org/) and Polymorphism Phenotyping v2 (PolyPhen-2) (http://genetics.bwh.harvard.edu/pph2/). Orthologs of mutated proteins were crisscrossed in other species such as chimpanzee, dog, gorilla, mouse and rat to determine the evolutionary conservation of amino acids altered in the disease causing mutations by using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/).

6.1. In Silico Protein Modeling

Amino acid sequences of the proteins, in which mutations were identified, were retrieved from Ensemble Genome Browser (http://www.ensemble.org/index.htm). BLASTp searches against PDB (Protein Data Bank) were exploited to explore a suitable template with homologous sequences. To investigate the influence of mutation on the structure and function of the protein, 3D structure of normal and mutated proteins were developed using Modeller9V8 tool (Sali and Blundell, 1993) or the threading software I-TASSER (Zhang, 2008). The predicted 3D models were validated via Ramachandran plot and ERRAT (Colovos and Yeates, 1993) tools while WinCoot (Emsley et al., 2010), UCSF Chimera 1.7.0 (Meng et al., 2006), and VEGA ZZ (www.ddl.unimi.it) were used for model refinements and geometry optimizations. However, three dimensional (3D) X-ray structure of human GALNS with the resolution 2.2 Å was retrieved from the protein data bank (http://www.rscb.org./pdb; code 4FDI).

Structures of the mutants were developed by changing the selected residue into desired residue followed by refinement of the structures by subjecting to similar energy minimization protocol that was used for the wild type structure. Both wild and mutants were superimposed and their root mean square deviation (RMSD) and Potential energy were calculated.

6.2. Molecular Docking

Molecular docking study was carried out against 6S-GalNAc as a substrate for GALNS protein to predict the docking score and binding pose of the ligand in the

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 31

Chapter 2 Materials and Methods active site of the protein. All the water molecules were removed from the structure and hydrogen atoms were added. This structure was then energy minimized with amber 99 force field in the MOE Software packages (http://www.chempcomp.com). Both wild and mutants were superimposed and their root mean square deviation (RMSD) and Potential energy were calculated. The predicted three-dimensional structure of the protein and docking pose were visualized by PyMOL Molecular Graphics System, version 1.3 (Schrödinger, LLC). Keeping in view the directionality of hydrogen bonds, docking score was calculated by means of a “full” de-solvation model. The conformational entropy was calculated from the sum of the torsional degrees of freedom using formula:

Where P refers to the protein, L refers to the ligand, V are the pairwise evaluations mentioned above, and ΔS~conf~ denotes the loss of conformational entropy upon binding (Huey et al., 2007).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 32

Chapter 2 Materials and Methods

Table 2.1: List of microsatellite markers used for genetic mapping of the genes/loci involved in hereditary skeletal disorders

Gene/Locus Chromosomal/Genomic Location Markers cM

AHI1 6q23.3: 135,604,669-135,818,902 D6S1265 137.98

D6S976 138.83

D6S2409 140.00

D6S1688 141.74

CREBBP 16p13.3: 3,725,054-3,880,726 D16S753 58.4

D16S3105 59.06

D16S517 60.53

D16S411 61.06

DLX5/DLX6 7q21.3: 97,005,977-97,024,830 D7S821 106.82

D7S479 107.48

D7S554 108.35

D7S2351 109.40

D7S2480 110.44

GALNS 16q24.3: 88,813,733-88,856,965 D16S3074 128.82

D16S3123 129.12

D16S2621 131.01

D16S539 132.01

Continued……..

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 33

Chapter 2 Materials and Methods

Continued from the previous page

Gene/Locus Chromosomal/Genomic Location Markers cM

GDF5 20q11.2: 35,433,347-35,438,243 D20S834 56.41

D20S859 57.05

D20S434 58.30

D20S881 58.9

D20S53 58.9

NPR2 9p21-p12: 35,752,944-35,809,730 D9S1853 55.77

D9S205 55.82

D9S911 56.6

D9S1118 57.01

D9S1845 58.15

D9S1817 59.00

D9S1794 60.25

D9S772 61.8

D9S229 62.66

D9S2148 62.73

D9S773 64.28

D7S2469 61.59

D7S691 62.99

Continued…….

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 34

Chapter 2 Materials and Methods

Continued from the previous page

Gene/Locus Chromosomal/Genomic Location Markers cM

NPR2 9p21-p12: 35,752,944-35,809,730 D7S2428 64.26

D7S2427 66.58

PAPA2 13q21-q32:55,300,000-101,700,000 D13S1492 55.56

D13S242 57.16

D13S1302 64.82

D13S156 68.81

D13S1492 55.56

D13S242 57.16

D13S1302 64.82

D13S156 68.81

D13S162 71.71

D13S160 74.2

D13S1277 76.94

D13S271 78.32

D13S1816 80.17

D13S1234 82.33

D13S71 87.17

D13S1252 92.05

Continued………...

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 35

Chapter 2 Materials and Methods

Continued from the previous page

Gene/Locus Chromosomal/Genomic Location Markers cM

PAPA3 19p13.2-p13.1: 6,900,000-20,000,000 D19S865 28.23

D19S1169 30.9

D19S906 32.65

D19S840 34.46

D19S885 38.85

D19S199 40.3

D19S915 44.26

D19S911 46.95

PAPA4 7q22: 98,000,000-107,400,000 D7S2351 109.40

D7S2504 112.83

D7S2545 113.95

D7S2453 115.66

D7S501 117.34

D7S2456 119.13

PAPA5 13q13.3-q21 (34,900,000-72,800,000) D13S171 30.41

D13S1293 31.70

D13S220 33.13

D13S305 35.17

Continued…………

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 36

Chapter 2 Materials and Methods

Continued from the previous page

Gene/Locus Chromosomal/Genomic Location Markers cM

PAPA5 13q13.3-q21: 34,900,000-72,800,000 D13S218 38.60

D13S1248 40.96

D13S1247 43.84

D13S887 47.47

D13S328 50.18

D13S118 52.00

D13S262 54.17

D13S1261 58.51

D13S1317 60.43

D13S276 61.36

PAPA6 4p16.3: 331,416-370,075 D4S3360 0.00 ZNF141 D4S90 0.00

D4S2936 0.61

D4S111 0.97

D4S3038 0.97

SHH, 7q36/Chr 7: 155,799,979-155,812,272 D7S3058 176.55 LMBR1, D7S550 180.67 RNF32

D7S468 182.48

Continued………...

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 37

Chapter 2 Materials and Methods

Continued from the previous page

Gene/Locus Chromosomal/Genomic Location Markers cM

SHH, 7q36: 155,799,979-155,812,272 D7S559 183.93 LMBR1, D7S2423 185.38 RNF32

D7S22 186.09

TMEM231, 16q21.1-q23.1: 49,524,514-75,590,183 D16S419 66.63

ZNF423, D16S3137 67.57 RPGRIP1L D16S3112 73.22

D16S3057 76.04

D16S688 80.49

D16S3393 84.13

D16S3118 93.55

D16S3142 94.64

TP63 3q28/ Chr 3:189,566,860-189,897,278 D3S3686 202.08

D3S3651 202.71

D3S3628 203.5

D3S3596 204.1

D3S3530 207.05

NOTE: The genes studied for skeletal dysplasias are arranged in alphabetic order. The symbol DxS (x= 1, 2, 3, ….) represents microsatellite marker for the respective chromosome and cM* (centi Morgan ) indicates genetic distance.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 38

Chapter 2 Materials and Methods

Table 2.2: List of primer sequences used to amplify GALNS gene exons

No Primer Name Sequence Ta Product

1 GALNS -1F ACTGGTCACGAGGCAGTC 57.14

GALNS - 1R GGTCATGCAGCACAGTGG 59.81 574

2 GALNS - 2F CAGAAGTGGAGGCGAAAG 57.01 527

GALNS -2R CACCCTCCCTGCAGTAGTAG 57.42

3 GALNS -3F TCTGTCACGCGTCTGTCTAC 57.53 317

GALNS -3R CCACCTAAGTCCCAGAGACC 58.59

4 GALNS -4F CAGTGTCCTGTTAGGATGGG 58.00 234

GALNS -4R AAGGCCAGGAAGTGGATG 58.59

5 GALNS -5F AAGGTGGTATCTGTTGCTGC 57.82 324

GALNS -5R ATGAGTGGCGACTTGAGC 57.36

6 GALNS -6F GAGAACGGGACTTTCTTGG 57.28 196

GALNS -6R ACAGGATGAGGTTGGTGC 56.83

7 GALNS -7F ACCAACCTCATCCTGTGG 56.66 646

GALNS -7R AGTGTCCCATCTCTGGAGTC 56.57

8 GALNS -8F GAATCACAGTATGCCGTTGG 59.00 279

GALNS -8R CTCTTCGCTGACACGCTG 59.4

9 GALNS -9F TTTGTCCCTATGACCAGTCTC 56.00 443

GALNS -9R AGCGGTGAGGATGAGCAC 59.00

Continued……………

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 39

Chapter 2 Materials and Methods

Continued from the previous page

No Primer name Sequence Ta Product

10 GALNS -10F TGCATATCTGTAGACCCAGC 56.31 307

GALNS -10R TCTGGGCTTCACTACTTGG 56.37

11 GALNS -11F CTCACGTGGAGGCATGAG 58.84 398

GALNS -11R GGCCACGTCTGGATAGAG 56.61

12 GALNS -12F CAGGACACAGGCAGACAAG 57.87 369

GALNS -12R ACAGCAGATGCAGGCAAG 58.62

13 GALNS -13F CTGCTCACTGTGGTTCTCAG 57.06 367

GALNS -13R GAGGGCCTCACCACTGAC 59.15

14 GALNS -14F AAACTGCTCGAGGCCAAG 59.11 892

GALNS -14R GAGGAGGGTCCTGAAATCTG 58.66

F = forward or left primer, R = reverse or right primer, bp = base pairs, Ta= annealing temperature in 0C, Product = Size of amplified product in bps

Table 2.3: List of primers used for sequencing GALNT3 gene

NO Primers Name Sequence ta Product

1 GALNT3-2_1 F CATGCCTGTAGGACTGAATAG 55.0 496

GALNT3-2_1 R 5TCAAGGACAGGCTTCAATTC 57.0

2 GALNT3-2_2 F TTGGATTTAATGCTAGAAGCTG 57.0 386

GALNT3-2_2 R 5/-TCTCTCCCCTGCAAAGC 57.0

Continued…………

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 40

Chapter 2 Materials and Methods

Continued from the previous page

NO Primers Name Sequence ta Product

3 GALNT3-3 F AATGTTAGCAATGGTATAGCTG 55.0 355

GALNT3-3 R ATTCAAGCTCTGAGATGGC 55.0

4 GALNT3-4 F TGGAAGGATCATTGCTCTG 57.0 307

GALNT3-4 R CTTTTAAATTAGAGGGAGAGGG 57.0

5 GALNT3-5 F TTCAAAACACAAATTGACTCTG 56.0 529

GALNT3-5 R CTCAGCAACATCATGTATAAGC 55.0

6 GALNT3-6 F GTTTACTCCAATGGGAGAGG 56.0 528

GALNT3-6 R CCTCTTGTTACACTGGCGAC 57.0

7 GALNT3-7 F TGAACTTAAAAGCAACACTTTG 55.0 322

GALNT3-7 R CAAAAGGACGTGTGAACTTG 56.0

8 GALNT3-8_9 F TGATGAAGGCTGTTGAATTG 57.0 694

GALNT3-8_9R TCACACACAGCTTACCCAAG 57.0

9 GALNT3-10 F TTGCAACTGAGCACATGG 57.0 288

GALNT3-10 R CATGTTCCACTCATTTTCCC 57.0

10 GALNT3-11 F TCAGACATGGCTCACCTTAG 57.0 348

GALNT3-11 R AGCTGCTTTTGCATAATTTTC 57.0

F = forward or left primer, R = reverse or right primer, bp = base pairs, Ta= optimal annealing temperature in 0C (degree centigrade), Product = Size of amplified product in bps

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 41

Chapter 2 Materials and Methods

Table 2.4: Primer sequences used for sequencing the coding region of GDF5 gene

NO Primers Name Sequence ta Product

1 GDF5-1F1 CGCAGTGTAGAATGAGTGTC 54.3 569

GDF5-1R1 GGTCCAAAAACAACTGCTCC 59.6

2 GDF5-1F2 ACATCCTGCTCTTCGGAATG 60.2 578

GDF5-1R2 AGAACTGAGGTTTGGGAGCC 60.3

3 GDF5-1F3 TATCGGGAAACAACCTGACC 58.4 670

GDF5-1R3 TCCAGCTGGTTGTGGTCGAG 64.8

4 GDF5-1F4 TACTTAGGGGTGACTCTGAG 51.9 851

GDF5-1R4 AAGAGGAAGAAGAGAGGAGG 54.4

Table 2.5: List of primers used for exon amplification of WNT10B gene

NO Primers Name Sequence ta Product

1 WNT10B-2F GTGTCTGATTGGGCAAGGTT 60.0 404

WNT10B-2R TCTATGGCCTGGGAGACAAG 60.2

2 WNT10B-3F CCAGGGCTCTAAGCAATGAG 60.0 361

WNT10B-3R GCCGCGAAACCATCCCTT 60.3

3 WNT10B-4F TGCCTGTCAACCTTACCTCC 60.4 470

WNT10B-4R TAACCAGGCCTCAAAAGCT 57.6

4 WNT10B-5F TGTGCCTCTGTGTTCTGTCC 59.9 570

WNT10B-5R GAAATCAGAGCAAAGGGCTG 60.0

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 42

Chapter 2 Materials and Methods

Table 2.6: List of primers used for NPR2 gene sequencing

NO Primers Name Sequence ta Product

1 NPR2-1-1F TGTAGGCCAGAGCAGCC 58.64 463

NPR2-1-1R TGTAGGCCAGAGCAGCC 54.46

2 NPR2-1_2F CGACCTGCTGTTAGGTCC 56.90 455

NPR2-1_2R GTGCTGAGCTTTAGGGACAC 57.20

3 NPR2-2F CTCTTTCTTGCTGAAGAGGG 56.87 393

NPR2-2R GGGTTTCTTTAGGGTCTTGTG 57.71

4 NPR2-3F CTTCCCATAATGCCTATCTTG 56.41 254

NPR2-3R GCCAAGACTTGATGCTGAG 57.01

5 NPR2-4_5F ATAGGTAGAAGGGAGACCCC 56.16 598

NPR2-4_5R TGAAAGCTGGATTTTGCAG 57.56

6 NPR2-6_7F GAGAAAAGCAGCGAAACAG 56.37 586

NPR2-6_7R CAGAGGTTGTGTGGCAATG 58.65

7 NPR2-8_9F CTGCAACCCTGCTGTTG 57.26 487

NPR2-8_9R ATGGGGATGAGACAGGATG 58.22

8 NPR2-10_11F TCCACTGCTCTCTAGCATTTC 57.31 535

NPR2-10_11R AACTTTGGGTCTATCCTTCC 54.83

9 NPR2-12F TCTATGCTGGGTGATAGCTG 56.48 196

NPR2-12R CAATCAAAGAACAGTGGAAGTG 57.39

Continued………....

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 43

Chapter 2 Materials and Methods

Continued from the previous page

NO Primers Name Sequence ta Product

10 NPR2-13_14F GTGGACCCAAGATCTGTAGAC 56.09 683

NPR2-13_14R CCATTTCGTACCTTCTGGAC 57.11

11 NPR2-15_16F CTACCCACAGCCTCTTCTTC 56.57 602

NPR2-15_16R ATGAGGCAGAGCCCAAC 57.10

12 NPR2-17_18F TCTCTTCCACTCCTGCTCTC 56.22 500

NPR2-17_18R GGGAGACTGAGTTTCAAAGC 57.54

13 NPR2-19_20F TCAAGCTTGTCTCCCTCTAC 54.63 485

NPR2-19_20R GAAAAGAAGAAAAGGGCAAG 55.89

14 NPR2-21_22F TCACCAATTATTTGATTGCC 56.01 428

NPR2-21_22R AGACATGGTGGCCATTG 56.00

F = forward or left primer, R = reverse or right primer, bp = base pairs, Ta= optimal annealing temperature in 0C (degree centigrade), Product = Size of amplified product in bps

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 44

Chapter 2 Materials and Methods

Table 2.7: Primers used for segregation analysis of the variants detected by whole exome sequencing

NO Primers Name Sequence ta Product

1 HOXD8-1F CAATGAGTTCGTACTTCGTGAA 55.89 289

HOXD8-1R GGGTGGAAGTACTCCTGG 58.00

2 HOXD9-1F GTGTTCTCTGCCTCGTGGTC 60.20 268

HOXD9-1R CAGGCTTAATCCCGTAGTGG 60.56

3 HOXD13-1F GGCCTCTTCCTCCTCCTCA 61.00 388

HOXD13-1R CTTGAGCGCATTCTGCTGTA 60.98

4 WIPF1-1F CATCTAATACATGATCGCATTC 55.67 178

WIPF1-1R TGGCTTCATTTGGCTTG 56.45

5 NR4A2-3_2F CTTGTACCAAATGCCCCTGT 58.22 274

NR4A2-3_2R CGTTTTCCTCTGCTCGATCA 58.56

6 MKS1-13F GGGTGTCCTTTTGCATCTCA

MKS1-13R AACCAAGGCCCAGGATCAA

7 NOG-Ex-1_1-F ACTTGTGTGCCTTTCTTCC 57 646

NOG-Ex-1_1-R ACATCTGTAACTTCCTCCGC 56

8 NOG-Ex-1_2-F CACTACGACCCAGGCTTC 57 591

NOG-Ex-1_2-R GTTCATTGAAAACCCTCGC 59

Continued……….

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 45

Chapter 2 Materials and Methods

Continued from the previous page

NO Primers Name Sequence ta Product

9 EXOSC3-1F ACGGAAAGTCCTCAAGGG 57 463

EXOSC3-1R TCAAAGCAGGGCTACCAC 57

10 EXOSC3-2F TGCTGAAGGTATCTTCCAATG 57 290

EXOSC3-2R AGCCTTCTGGATATGTGAGTG 57

11 EXOSC3-3F GAAAGAACCAATAGTAGCACCTG 57 292

EXOSC3-3R CCTGAAGATTAACCAACTTTCC 57

12 EXOSC3-3F TTCTTTGTAAGGCATAGCCC 57 691

EXOSC3-3R AGCTGTAGCAATTACTAAGGGAG 56

13 ADAMTSL1-14F GATGCAGCCCCTCACAG 58 481

ADAMTSL1-14R ATCATTCTTGGATTTGAGGC 57

14 PRSS3-3F AGTGAGCTTGAGGACCCT 57 388

PRSS3-3R TGGAAATTGTGAGGATGGGG 59

F = forward or left primer, R = reverse or right primer, bp = base pairs, Ta= optimal annealing temperature in 0C (degree centigrade), Product = Size of amplified product in bps

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 46

Chapter 3 Mucopolysaccharidosis

MUCOPOLYSACCHARIDOSIS

Proteoglycans are the proteins that generally occur in the cell membrane and extra cellular matrix. They are attached with long chain heteropolysaccharides, called Glycosaminoglycans (GAGs) or mucopolysaccharides. Proteolytic cleavage of proteoglycans generates GAGs that enter lysosome for further degradation. Genetic deficiency or malfunctioning of lysosomal enzymes required for degradation of GAGs results in a set of hereditary disorders collectively known as mucopolysaccharidosis (MPS) (Neufeld and Muenzer, 2001; Giugliani et al., 2011).

Defects in the in IDUA (α-L-iduronidase) gene result in MPS type I (Hurler Syndrome; MIM# 607014, Hurler-Scheie syndrome; MIM# 607015, and Scheie Syndrome; MIM# 607016) (Narayanan et al., 1987; Bradbur et al., 1989; Giuglian et al., 2010). X-linked MPS type II (Hunter syndrome; MIM# 309900) is caused by mutations in IDS (iduronate-2-sulfatase) gene (Mossman et al., 1983; Giuglian et al., 2010). Mutations in SGSH, NAGLU, HGSNAT and GNS cause MPS III or Sanfilippo syndrome type A, B, C and D (MIM# 252900, 252920, 252930, and 252940) respectively (Weber et al., 1999; Coutinho et al., 2008; Elcioglu et al., 2009; Valstar et al., 2010). GALNS and GLB1 genes are involved in MPS type IV, also known as Morquio syndrome which has further subtypes Morquio syndrome A; MIM# 253000 and Morquio syndrome B; MIM# 253010 (Santamaria et al., 2007; Montano et al., 2008). Mutations in the gene ARSB (arylsulfatase B) cause MPS VI; MIM# 253200 (Giugliani et al., 1999). Deficiency of beta-glucuronidase enzyme due to mutations in the GUSB gene gives rise to MPS VII; MIM 253220 (Tomatsu et al., 2002) and mutations in HYAL1 or HYAL2 genes result in the pathogenesis of MPS IX;MIM# 601492 (Triggs et al., 1999).

Being genetically heterogeneous, mucopolysaccharidosis exhibit a wide range of phenotypic variability. However, they share some overlapping clinical features such as short stature, facial abnormalities, skeletal and dental malformations, and in some syndromes, intellectual disability (Neufeld and Muenzer, 1995). These disorders are generally diagnosed via urine screening methods or enzyme analysis (Tomatsu et al., 2010; Auray-Blais et al., 2011) but molecular diagnosis by genetic mapping and mutation analysis is more beneficial as it can confirm the disease pathogenesis, helps

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 47

Chapter 3 Mucopolysaccharidosis in carrier screening and may predict the disease severity through particular genotypes (Gottwald et al., 2011; Pollard et al., 2013).

This chapter refers to six Pakistani consanguineous families (A, B, C, D, E, F) showing clinical features of autosomal recessive mucopolysaccharidosis. The patients were clinically examined in the local government hospitals and their blood samples were collected for genetic mapping and mutation analysis to investigate the disease pathogenesis at molecular level.

Family A

Family A was recruited from district Upper Dir, Khyber Pakhtonkhwa, Pakistan. It was a four generation pedigree, showing four affected individuals in the fourth generation (Fig. 3.1). Pedigree analysis revealed autosomal recessive mode of inheritance. Affected individuals were born of phenotypically normal parents having first cousin marriages among them.

Blood samples of four affected individuals (IV-4, IV-5, IV-6, IV-7) and nine unaffected individuals (III-1, III-2, III-3, III-4, IV-1, IV-2, IV-3, IV-8, IV-9) were collected for the present study.

Clinical Features

Affected individuals demonstrated clinical features compatible with MPS IV (Morquio syndrome). Ages of affected members were ranging between seven to fourteen years. They shared phenotypic resemblances such as disproportionate short stature with 4-5 SDS below average height of normal population accompanied by petite neck and trunk, pectus carinatum (pigeon chest), dental anomalies, valgus deformities of the knees, and abnormal flexibility of joints. Radiographic analysis revealed constriction and elongation of the pelvic inlet with flared broad iliac wings, hypoplastic acetabular roof, involution and fragmentation of the proximal femoral epiphysis and tibial condyles with widening of joint spaces. Universal platyspondyly characterized by flattened vertebral bodies in thoracolumbar spine with oval shaped vertebrae showing anterior central beaks was noted in X-rays radiographs. Intervertebral discs were wide conical (bullet-shaped). Proximal bases of metacarpals with small and reduced ossified carpal bones were observed in hands of the patient (Fig. 3.2).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 48

Chapter 3 Mucopolysaccharidosis

Genetic Mapping

Complying with clinical features, DNA samples of four affected individuals (IV-4, IV-5, IV-6, IV-7) and nine unaffected individuals (III-1, III-2, III-3, III-4, IV-1, IV-2, IV-3, IV-8, IV-9) were tested for linkage using microsatellite markers flanking Galactosamine-6-Sulfate Sulfatase (GALNS) gene on chromosome 16q24.3. On PAGE, the PCR products from polymorphic microsatellite markers (D16S3063, D16S689, D16S2621, D16S3026, D16S3121) showed homozygosity in affected individuals (IV-4, IV-5, IV-6, IV-7) and heterozygosity in normal individuals (III-1, III-2, III-3, III-4, IV-1, IV-2, IV-3, IV-8, IV-9), thus establishing linkage in the family A to GALNS gene on chromosome 16q24.3 (Fig. 3.3).

Mutation Analysis

Family A, linked to GALNS on chromosome 16q24.3 was then subjected to sequence analysis of this gene. All 14 exons of GASLNS were sequenced. Sequence analysis of GALNS gene detected a homozygous C to G transversion at nucleotide position 1259 (c.1259C>G) in exon 12 of GALNS gene in all affected individuals (IV-4, IV-5, IV-6, IV-7) of the family A. In carrier parents (III-1, III-2, III-3, III-4) and one unaffected member (IV-8) sequencing results showed that the sequence variant was present in heterozygous state. The sequence variant was not found in other normal members of the family (Figure 3.4). This sequence variant resulted in substitution of proline residue by arginine at amino position 420 (Pro420Arg). The possible impact on the structure of GALNS protein due to this mutation examined with SIFT (Sorting Intolerant From Tolerant), (http://blocks.fhcrc.org/sift/SIFT.html) was predicted to be deleterious. PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/) online tool revealed that this mutation was probably damaging with a pathogenicity score of 0.709.

In silico Protein Modeling and Molecular Docking Analysis

The three dimensional (3D) X-ray structure of human GALNS with the resolution 2.2 Å was retrieved from the protein data bank (http://www.rscb.org./pdb; code 4FDI) and molecular docking was carried out against its ligand, N-acetylgalactosamine-6- sulfate (GalNAc-6S, CID 193456) that was retrieved from PubChem (Rivera-Colón et al., 2012). Bearing in mind the nature and position of amino acid within the protein, the effect of mutation on intermolecular interactions was analyzed. In case of p.Pro420Arg, a non-interacting, non-polar amino acid, (Proline 420) was replaced by

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 49

Chapter 3 Mucopolysaccharidosis a larger and more positively charged Arginine. As a result, a guanidium group was introduced in the loop region to develop an intermolecular hydrogen bond with side chain of Ala 291 (Fig. 3. 5) thereby distorting the protein confirmation.

Moreover, the effect of mutation on protein stability was assessed by calculating its potential energy and a slight increase in potential energy was observed in mutated protein (-1570.45 kcal/mol) as equated to normal protein (-1575.30 kcal/mol). With the aim of scrutinizing the impact of mutation on binding capacity of GALNS protein, molecular docking against its ligand (GalNAc-6S) revealed a significant difference in docking score for normal GALNS protein (-18.099) in contrast with its mutant proteins (p. Pro420Arg) (-11.079) (Fig. 3.5).

Family B

Family B was ascertained from tehsil Warri of distract Upper Dir, Khyber Pukhtunkhwa Pakistan. The parents of affected individuals were first cousins to each other. This was a four generation pedigree having three affected males (IV-3, IV-4, IV-5) in the fourth generation. Pedigree analysis revealed autosomal recessive pattern of inheritance (Fig. 3.6).

Blood samples of three affected (IV-3, IV-4, IV-5) and four normal individuals (III-1, III-2, IV-2, IV-3) were collected for the present study.

Clinical Features

Affected individuals in family B exhibited clinical manifestations of MPS including marked skeletal malformations such as disproportionate dwarfism with short neck and trunk, coarse faces, pigeon shaped chest (pectus carinatum), knock-knee deformity (genu valgum) and short claw-like hands. Intelligence was normal and the disease phenotypes became more sever with the course of life (Fig. 3.7).

Genetic Mapping and Mutation Analysis

DNA samples of four normal (III-1, III-2, IV-2, IV-3) and three affected individuals (IV-3, IV-4, IV-5) from family B were used for linkage analysis. Using highly polymorphic microsatellite markers (D16S3074, D16S3063, D16S3023, D16S3026, D16S3121), haplotypes analysis revealed that all affected individuals were homozygous and normal individuals were heterozygous for aforementioned markers (Fig. 3.8). Hence, linkage was established to GALNS gene on chromosome 16q24.3.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 50

Chapter 3 Mucopolysaccharidosis

Subsequently, all 14 exons of the GASLNS gene including exon intron boundaries were sequenced in affected and unaffected members of family B. While analyzing sequencing data, a homozygous missense mutation (c.1259C>G; p.Pro420Arg) was detected in affected members (IV-3, IV-4, IV-5) of family B. The sequence variant was heterozygous in both parents (III-1, III-2) and one normal brother (IV-2) of the patients. The other normal member (IV-3) of the family had a wild type allele as witnessed in fifty ethnically matched control samples (Fig. 3.9).

Using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/), orthologs of GALNS protein were crisscrossed in other species like pig, dog, rabbit and mouse which showed that Pro420 in the GALNS protein was highly conserved among those species (Fig. 3.10).

Family C

Family C was recruited from village Rundaish, district Upper Dir, KPK, Pakistan. This four generation pedigree had two affected individuals in the fourth generation with an autosomal recessive mode of inheritance (Fig. 3.11). First cousin union was observed amongst the parents of affected individuals. No history of the disease was previously reported in that family.

Blood samples of four normal (III-1, III-2, IV-2, IV-4) and two affected (IV-2, IV-3) members of the family were contained within this study.

Clinical Features

Ages of affected individuals (IV-3, IV-4) were noted 15 years and 18 years respectively during the study onset. The disease severity was exhilarating with the course of life. Pectus carinatum (pigeon chest), short stature with petite neck, joints stiffness, knock-knee (genu valgum) with right equinovarus and dental abnormalities were visible in affected individuals (Fig. 3.12). Affected members had normal intelligence without any associated complications.

Molecular Analysis

Linkage analysis was carried out in family C by typing highly polymorphic microsatellite markers flanking to GALNS gene on chromosome 16q24.3. On PAGE, three microsatellite markers (D16S3023, D16S3026, D16S3121) showed homozygosity in affected members and heterozygosity in normal individuals. Two

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 51

Chapter 3 Mucopolysaccharidosis additional markers (D16S3074, D16S3063) were heterozygous for all members of the family (Fig. 3.13). Thus, resounding linkage in family C was established on chromosome 16q24.3 harboring the gene GALNS. Successive sequencing of GALNS gene revealed a homozygous missense mutation (c.1156C>T; p.Arg386Cys) in exon 11 of the gene GALNS (Fig. 3.14).

In silico Protein Modeling and Docking Analysis

Using PolyPhen-2 online tools, the possible pathogenicity score of missense mutation (c.1156C>T; p.Arg386Cys) was calculated to be 1.00 endorsing a damaging effect on the protein product. In silico structural analysis of mutant GALNS protein revealed that substitution of Arginine 386 by Cysteine in case of (p.Arg386Cys), the intermolecular interaction between Arg 386 with Ala 104 and Thr 406 was lost which altered the normal protein folding (Fig. 3.15). Moreover, potential energy of mutated (p.Arg386Cys) GALNS protein was measured -1619.00 kcal/mol that is almost 47.30 kcal/mol lower than normal protein (-1575.30 kcal/mol). These results suggested that missense mutation (c.1156C>T; p.Arg386Cys) deteriorates the protein’s stability.

To investigate the impact of mutations on protein-ligand binding, molecular docking of normal GALNS protein and its mutant counterpart (p.Arg386Cys) was carried out using N-Acetyl-D-galactosamine 6-sulfate (GalNAc-6S) as a ligand (Fig. 3.15). Docking analysis revealed that normal GALNS binds with ligand more preferably than mutant (GALNS, p.Arg386Cys). Docking scores of normal and mutant GALNS were found -18.099 and -15.844 respectively.

Family D

Family D was collected from district Multan, Punjab province of Pakistan. This was a five generation pedigree having only a single living patient in the last generation. Two affected individuals in that family were deceased before the inception of this study. A common trend of first cousin marriages was noticed within the family. Pedigree analysis revealed autosomal recessive nature of disease propagation within family D (Fig. 3.16).

During the present study, blood samples of one affected male (V-1) and eight unaffected members (IV-3, IV-4, IV-5, IV-6, IV-7, V-2, V-3, V-4) were collected for molecular analysis.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 52

Chapter 3 Mucopolysaccharidosis

Clinical Features

Marked clinical features of Morquio syndrome were visible in affected member of the family. Importantly, excretion of keratin sulfate and chondroitin 6-sulfate was detected in urine sample of the patient. Skeletal deformities observed in affected individual included pectus carinatum (pigeon chest), kphoscoliosis (outward and lateral protrusion of spines) and genu valgum (knock-knee) (Fig. 3.17).

Genetic Mapping and Mutation Analysis

Based on clinical phenotypes, DNA samples of eight normal (IV-3, IV-4, IV-5, IV-6, IV-7, V-2, V-3, V-4) and one affected individuals (V-1) from family D were tested for linkage using microsatellite markers. Linkage was searched by typing six markers (D16S486, D16S3077, D16S3123, D16S2621, D16S3023, D16S3026) flanking to GALNS gene on chromosome 16q24.3 (Fig. 3.18).

Sanger sequencing of all exons of the GALNS gene including exon-intron boundaries, affected members in family D showed a novel missense mutation involving T to C transition at nucleotide position 647 (c.647T>C) in exon 7 of the gene. This variant resulted in replacing phenylalanine at amino acid position 216 with serine (p.Phe216Ser). Missense mutation c.647T>C was found in homozygous state in affected member (V-1) and heterozygous in (IV-4, IV-5, V-3) while other family members (IV-3, IV-6, IV-7, V-2, V-4) had a wild type allele (Fig. 3.19).

In silico Structural and Functional Analysis

PolyPhen-2 online tools signified that the aforementioned mutation had a probably damaging effect on GALNS protein with a possibly pathogenic score 0.94. Bearing in mind the nature and position of amino acid within the protein, the effect of mutation on intermolecular interactions was analyzed by structural modeling and molecular docking of normal and mutated protein as described in materials and methods. Structural analysis revealed that in case of (p.Phe216Ser), Ser 216 developed new interactions with Leu34, Val138 and Ile217 which finally altered the three dimensional structure of the protein (Fig. 3.20). Consistently, a significant increase in potential energy was observed in mutant protein (-948.13 kcal/mol) in contrast to normal GALNS protein (-1575.30 kcal/mol). Molecular docking against ligand galactosamine 6-sulfate (GalNAc-6S), discovered that mutant GALNS (Phe216Ser)

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 53

Chapter 3 Mucopolysaccharidosis had a declining bonding affinity towards ligand showing a -17.001 than normal GALNS (-18.099) (Fig. 3.20).

Family E

This family was retrieved from Kohistan vally of district Upper Dir, Khyber Pakhtonkhwa (KPK) province of Pakistan. A four generation pedigree was reputable for the family containing one affected male (IV-1) and one affected female (IV-2) in fourth generation. First cousin marriage was testified among their parents and pedigree analysis revealed autosomal recessive inheritance for the disease phenotypes (Fig. 3. 21). Peripheral blood samples of two affected (IV-1, IV-2) and four healthy individuals (III-1, III-2, IV-3, IV-4) were collected for molecular analysis in this study.

Clinical Features

Marked clinical features of progressive MPS IV (Morquio syndrome) were evident in the patients of family E. Affected individuals exhibited pectus carinatum; a chest deformity characterized by a protrusion of the sternum and ribs, Genu valgum (knock- knee), kphoscoliosis; a combination of outward curvature (kyphosis) and lateral curvature (scoliosis) of the spine. In addition, craniofacial abnormalities such as macrocephaly, coarse faces, broad nose and abnormal dentation were noticeable in affected individuals (Fig. 3. 22).

Linkage Mapping and Mutation Screening

Using microsatellite markers (D16S498, D16S3077, D16S3123, D16S2621, D16S3026, D16S3121), linkage in family E was established on chromosome 16q24.3 harboring GALNS gene (Fig. 3. 23).

Further sequencing of the GALNS gene in family E revealed a frameshift mutation involving insertion of Adenine residue between nucleotide number 360 and 361 (c.360-361InsA; p. Glu121Argfs*37) (Fig. 3.24) that resulted in changing the open reading frame of the protein after amino acid number 120 with the manifestation of a stop codon 37 amino acids ahead the frameshift.

Family F

Family F was collected from district Khuzdar, Baluchistan province of Pakistan. Two affected females were found in the fourth generation. Parents of affected individuals

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 54

Chapter 3 Mucopolysaccharidosis were first cousins to each other and the disease was not previously reported in that family. Pedigree evaluation of the family revealed that the disease was inherited by the patients in autosomal recessive form (Fig. 3.25).

With the intention of genetic mapping and mutation analysis, blood samples of six members of the family, including two affected (IV-2, IV-3) and four normal individuals (III-1, IV-1, IV-4, IV-5), were collected for this study.

Phenotypes of Family F

Both the affected individuals in family F exhibited distinct phenotypes of Mucopolysaccharidosis type 4A (Morquio A syndrome). Clinical manifestations associated with affected individuals included disproportionate short stature, petite neck, pigeon chest, kyphosis, joints laxity, coarse faces and corneal clouding. Intelligence of affected individuals was weaker than normal members of the family. Both the affected individuals were unable to walk and stand upright (Fig. 3.26).

Genetic Mapping and Mutation Analysis

Based on their clinical features DNA samples of two affected (IV-2, IV-3) and four normal individuals (III-1, IV-1, IV-4, IV-5) were tested for linkage mapping by using microsatellite markers (D16S3074, D16S3063, D16S3023, D16S30626, D16S3121) and linkage in family F was established on chromosome 16q24.3 containing GALNS gene (Fig. 3.27).

Sequencing of the GALNS gene in family F revealed a frameshift mutation involving insertion of Adenine between nucleotide number 360 and 361 (c.360-361InsA; p. Glu121Argfs*37) (Fig. 3.28) that altered the open reading frame of the GALNS protein after amino acid number 120 and the polypeptide chain was terminated 37 amino acids after the frameshift.

Discussion

Glycoseaminoglycans (GAGs) comprise a family of long chain heteropolysaccharides which include dermatansulfate, heparan sulfate, keratan sulfate, and chondroitin sulfate (Taylor and Gallo, 2006). GAGs inter the lysozyme for further enzymatic degradation. Depending on the type of molecule to be degraded there are four different pathways of lysosomal degradation of GAGs catalyzed by 10 different enzymes including four glycosidases, five sulfatases, and one

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 55

Chapter 3 Mucopolysaccharidosis nonhydrolytictransferase. Genetic deficiency of enzymes catalyzing their metabolism leads to abnormal deposits of mucopolysaccharides in tissues and their excretion in urine. As a consequence the other cellular organelles are disturbed and the nuclear outline is deformed which give rise to a group of disorders known as Mucopolysaccharidosis (Neufeld and Muenzer, 2001; Giugliani et al., 2011). Mucopolysaccharidosis (MPS) represents a clinically diverse and genetically heterogeneous group of lysosomal storage disorders characterized by intralysosomal accumulation of metabolic intermediates of glycosaminoglycans (GAG) or mucopolysaccharides (Bouzidi et al., 2007; González-Meneses et al., 2010). Mucopolysaccharidosis (MPSs) are genetic disorders inherited in an autosomal recessive pattern except MPS II which is X-linked. On the basis of clinical features, type of GAGs and enzymes involved in their pathogenesis, MPSs are classified into seven well defined syndromes associated with mutations in ten different genes (Khedhiri et al., 2009; Rasalkar et al., 2011).

Morquio A syndrome (Mucopolysaccharidosis IVA, MPS IVA; MIM #253000) is an autosomal recessive, lysosomal storage disorder caused by deficiency of the lysosomal enzyme N-acetylgalactosamine-6-sulfatase (GALNS; E.C. 3.1.6.4; MIM #612222) due to mutations in the GALNS gene (NM 000512.4) present on chromosome 16q24.3 (Baker et al., 1993; Masuno et al., 1993; Montano et al., 2007; Harmatz et al., 2013; Yasuda et al., 2013). To date more than 200 mutations have been reported in the GALNS gene (Morrone et al., 2014a; Morrone et al., 2014b; Stenson et al., 2014) and this mutation heterogeneity is likely held responsible for the clinical variability in Morquio A patients (Tomatsu et al., 2005).

In the present study, six (A, B, C, D, E, F) Pakistani consanguineous families with Marqiuo A syndrome (MPS IV A) were genetically evaluated. The pattern of clinical features observed in affected members in all six families was comparable to that reported previously in several MPS IV A cases from different ethnic origin (Beck et al., 1986; Nelson and Kinirons, 1988a; Nelson and Kinirons, 1988b; Nelson and Kinirons, 1988c; Montaño et al., 2007; Tomatsu et al., 2011). Linkage was established in these families to the GALNS gene on chromosome 16q24.3. Sequence analysis of the GALNS gene revealed two previously reported missense mutations (p.Pro420Arg) in family A and B (Morose et al., 2014), (p.Arg386Cys) in family C (Tomatsu et al., 2004) and a novel missense mutation (p.Phe216Ser) in family D. In

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 56

Chapter 3 Mucopolysaccharidosis family E and F a novel frameshift mutation (p.Glu121Argfs*37) was identified by sequence analysis.

Morquio A syndrome causative gene GALNS contains 14 exons spanning 35 kb on chromosome 16q24.3 and transcribed into 1566 bp cDNA that encodes 522 amino acids protein, a 60 kDa glycopeptide (Masue et al., 1991). Based on X-ray diffraction analysis, Rivera-Colón et al. (2012) demonstrated that GALNS is a homodimeric glycoprotein containing N-terminal domain (amino acids 28–379) enclosing the active site, a second domain (amino acids 380–481) and a C-terminal disc (amino acids 482– 510), which twists back toward domain 1 and delineates a portion of the active site. Comprehensive analysis of the disease causing mutations, reported in the GALNS gene revealed that only 5% mutations occur in the active‐site residues, 65% in the buried residues in the core protein and 27% in surface residues (Rivera-Colón et al., 2012).

To date, more than 200 mutations have been reported in the GALNS gene, which include 75% point mutations (missense/nonsense), small deletions (10 %), splice site mutations (8 %), small insertions (1.7 %), small indel (1 %), gross deletions (1.7 %), gross insertions/duplications (1 %), and complex rearrangements (1 %) (Morrone et al., 2014a; Morrone et al., 2014b; Stenson et al., 2014). These mutations are vastly heterogeneous and most of them are missense mutations that occur throughout the gene (Tomatsu et al., 2005; Montano et al., 2007). This mutational heterogeneity can lead to difficulties in the interpretation of patient genotypes as many patients may carry novel or poorly characterized mutations. Although, some mutations, like nonsense mutations, large deletions and frameshifts have solid impact on GALNS protein activity but interpretation of missense mutations is quite challenging (Tomatsu et al., 2005; Hendriksz et al., 2013). In general, the GALNS mutations have been categorized under four groups: (i) mutations that demolish or alter the packaging of hydrophobic core, (ii) eliminate the salt bridge to disrupt the entire conformation, (iii) changing the active site geometry or (iv) alter the surface of the protein to change lysosomal targeting, hydrogen bonds, or N-glycosylation sites (Sukegawa et al., 2000).

The three-dimensional structure of a protein provides the framework for its dynamics and function. In silico modeling assists in structural and functional elucidation of proteins to determine the effect of mutations on the protein structure and thus its link

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 57

Chapter 3 Mucopolysaccharidosis with disease because function of a protein is critically dependent on a well-defined conformational structure (Dunker et al., 2002). For that reason, several bioinformatics tools are employed for structural and functional analysis of missense mutations in GALNS to determine their effect on structural modifications, alteration in ligand affinity and the manifestation of a positive correlation between mutations in hydrophobic cores and severe phenotype (Sudhakar and Mahalingam, 2011).

To determine the pathogenic significance of missense mutations reported in this study, online analysis tools were used to investigate their effect on structure and function of the protein. Polyphen2 scores of the missense mutations indicated that they have a probably damaging effect on the protein. Furthermore, in silico modeling of normal GALNS protein and its mutants revealed that according to the nature and position of mutation, these substitutions altered the intermolecular interactions within the protein hence distorting the normal structure to a variable extent. The missense mutation (p.Pro420Arg), detected in family A and B, disturbs surface residues in domain 2 of GALNS protein affecting intermolecular interfaces in the core protein (Rivera-Colón et al., 2012). The second mutation (p.Arg386Cys), reported earlier and found in family C here, results in disruption of hydrophobic core of the GALNS protein. Alteration in glycosylation site of GALNS protein may affect the normal folding and endosome/ lysosome trafficking of the protein (Wujek et al., 2004; Pohl et al., 2009). The third missense mutation (p.Phe216Ser), detected in the family D, occurs in N-terminal domain of GALNS that affect the glycosylation site of the protein. Frameshift mutation (p.Glu121Argfs*37), in family E and F results in protein truncation with a premature stop codon 37 amino acids after frameshift.

Calculating the potential energy of wild-type and mutant structures revealed significant differences in the potential energy between normal and mutant proteins that may affect the protein’s function. The results revealed that increase or decrease in potential energy of the protein was directly proportional to the increase and decrease in the intermolecular interaction within the protein. Eventually, the difference between potential energy of the wild-type protein and the mutant is a measure of the effect of mutation on protein stability (Khan and Vihinen, 2010; Zhang et al., 2010; Zhang et al., 2012). Protein stability is a key feature to protein function (Ye et al., 2006; Zhang et al., 2012), and a missense mutation may affect, besides the secondary structure, its stability, leading to misfolding (Dobson, 2003; Koukouritaki et al., 2007;

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 58

Chapter 3 Mucopolysaccharidosis

Zhang et al., 2012). In fact, protein folding involves fine-tuning of the linear unfolded polypeptide into the native 3D structure driven by the potential energy gradient (Ye et al., 2006; Dill et al., 2007). Recent studies revealed that 80% of pathogenic missense mutations are amino acid substitutions that affect the stability of proteins by several kcal/mol (Wang and Moult, 2001). In addition, the missense mutation can also alter the protein flexibility (Young et al., 2001; Karplus and Kuriyan, 2005; Zhang et al., 2010). Generally, small energy values point toward less stable protein and vice versa. The same considerations are valid in the case of predicting the effect on receptor- ligand binding (Cai et al., 2012). Ligand-protein binding affinity of normal and mutant GALNS protein revealed that normal protein had a strong binding affinity than its mutant counterparts. Inconsistencies in binding affinities of mutated proteins be a sign of geometrical constrains and/or energetic effects caused by missense mutations (Akhavan et al., 2005; Jones et al., 2007). Calculating docking scores of normal and mutant proteins, a significant increase was observed in all mutant proteins. This increase in docking scores signifies an increase in conformational entropy and lower binding affinity.

In conclusion, six Pakistani families with Morquio A syndrome were evaluated at clinical and molecular level. Genetic analysis revealed four mutations in these families including two novels (one missense and one frameshift) and two previously reported mutations. In all six families the mutations occurred in homozygous state causing Morquio A syndrome. Further in silico analysis revealed that missense mutations alter the three dimensional structure, stability and binding affinity of the protein. In relation to mutational heterogeneity, substantial phenotypic variability was observed among affected individuals of the six families (Table. 3.1). On the basis of the present results, it is suggested that structural and functional analysis substantiates pathogenicity of missense mutations. Moreover, clinical variability of the diseases phenotypes might be elucidated by means of structural and functional analysis of mutations.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 59

Chapter 3 Mucopolysaccharidosis

Table 3.1: Summary of clinical and mutational spectrum identified in the six families

Family A B C D E F

Patients 4 3 2 1 2 2

Mutations p.P420R p.P420R p.R386C p.F216S p.E121Rfs*37 p.E121Rfs*37

Polyphen2 0.790 0.790 1.00 0.984 N/A N/A

Mutation taster 0.999 0.999 0.999 0.999 1.000 1.000

Effect on P.E +5.15 +5.15 -43.70 +627.17 N/A N/A

Effect on L.B +7.020 +7.020 +2.255 +1.098 N/A N/A

Age of onset 1-2 yrs 1-2 yrs 2 yrs 16 mon 1 yrs 1 yrs

Height in cm 70-82 68-77 90-94 88 106-112 105-111

Prognathism _ _ _ _ + +

Pectus carinatum + + + + + +

Kyphosis + + N/A + N/A N/A

Scoliosis + + N/A + N/A N/A

Platyspondyly + + + + + +

Coxa valga + + N/A + N/A N/A

Genu valgum + + + + + +

Flat feet + + + + + +

Joint laxity + + + + + +

Intellectual disability _ _ _ _ + +

Corneal opacity _ _ _ + + +

Widely Spaced Teeth + + + + + +

Notes: Patients (number of patients in family), P.E (potential energy kcal/mol, + (increase in P.E), _ (decrease in P.E), L.B (Ligand binding affinity, i.e. docking score. + and _ signs means increase or decrease in docking score), N/A (not assessed), yrs (years), mon (months).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 60

Chapter 3 Mucopolysaccharidosis

Figure 3.1: Pedigree drawing of the family A segregating autosomal recessive Morquio A syndrome. Males and females are indicated by squares and spheres respectively. Affected males and females are specified by filled symbols. Crossed signs over a symbol indicate the deceased individuals. Double lines between individuals represent consanguineous union. Roman numerals represent the generation numbers while Arabic numerals are used for denoting the individuals within a generation. The individual numbers labeled with asterisks indicate the samples available for this study.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 61

Chapter 3 Mucopolysaccharidosis

Figure 3.2: Photographs and radiographs of affected individuals in family A. An affected boy (IV-6) and affected girl (IV-7) demonstrating disproportionate short stature with petite neck. Pectus carinatum (pigeon chest), characterized by protrusion of the sternum, can be clearly seen in the affected boy (a). APX-rays radiograph of the chest, arms and pelvis of patient (IV-6) demonstrating distorted appearance of ribs, irregular epiphysial plates and anterior spiking of proximal ends of metaphysic accompanied by narrowed sciatic notch with flattening of acetabulum roof, laterally flared iliac bones with inferior constriction, enlargement of acetabular cavities with rough margins, and poorly formed femoral epiphyses and widened femoral necks with coxa valga (b, c). X-ray of leg and foot (lateral view) of patient (IV-6) showing tapering of the proximal phalanges (d). X-ray of the right knee, exhibiting genu valgus and occurrence of space-occupying lesion in the medial tibia platform (e). X-ray of chest and dorso-lumbar spine in lateral view of affected individual (IV-6) showing kyphosis with flaring and widening of the ribs, flattening of vertebral bodies (platyspondyly) short thick clavicles and protruded sternum (pectus carinatum) (f). Bilateral hypoplastic femoral neck displayed in the AP radiograph of pelvis (g). Radiographic features of lower limbs of patient (IV-6) showing metaphyseal expansion of long bones, and tapering of the proximal phalanges (h). X-rays film of both hands showing small carpals which are reduced in number with bullet-shaped (conical) metacarpals. The planes radius and ulna are disrupted, being forced backward and upward (i).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 62

Chapter 3 Mucopolysaccharidosis

Figure 3.3: Haplotypes demonstrating segregation of Morquio A syndrome in family A. The shaded black alleles symbolize risk haplotype, while the alleles displayed in grey are not co-segregating with the disease. Genetic distances in centi-Morgans (cM) are consistent with the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 3.4: Sequence analysis of a missense mutation (c.1259C>G, p.Pro420Atg) in the gene GALNS in family A. Nucleotide sequence in affected individuals (IV-4, IV- 5, IV-6, IV-7) showing substitution of C by G (a). Nucleotide sequence of the heterozygous carriers (III-1, III-2, III-3, III-4, IV-8) having both C and G in heterozygous state (b). DNA sequences of normal individuals (IV-1, IV-2, IV-3, IV- 9) demonstrating wild type allele (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 63

Chapter 3 Mucopolysaccharidosis

Figure 3.5: In silico structural modeling and of GALNS mutation (p.Pro420Arg) showing intermolecular interactions and docking pose of 6S-GalNAc ligand. Intermolecular hydrogen bonds are represented by dashed lines. Intermolecular interaction of the normal protein having Proline 420 (a) and mutated GALNS protein containing Arginine 420. Extra H-bonding is visible between Arg420 and Ala291 (b). Three dimensional docking pose of 6S-GalNAc ligand in the active site of wild type GALNS (c) and mutant (Pro420Arg) GALNS protein (d).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 64

Chapter 3 Mucopolysaccharidosis

Figure 3.6: Pedigree drawing of the family B segregating autosomal recessive Mucopolysaccharidosis type IVA. Affected males and females are indicated by filled symbols. Crossed symbols indicate the deceased individuals. Double lines between individuals represent consanguineous union. The individual numbers labeled with asterisks indicate the samples available for this study.

Figure 3.7: Clinical features of affected individuals in family B. Three affected individuals (IV-4, IV-5, IV-6) and a normal individual (IV-3) showing disproportionate short stature with short neck (a). Affected individual (IV-5) displaying pigeon chest (b) and affected member (IV-4) presenting corneal clouding and widely spaced teeth (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 65

Chapter 3 Mucopolysaccharidosis

Figure 3.8: Haplotypes indicating segregation of Morquio A syndrome in family B. Affected males and females are shown by filled squares and circles, respectively. Symbols with bars indicate deceased individuals. Double lines between individuals represent consanguineous union. The shaded black alleles symbolize risk haplotype, while the alleles displayed in grey are not co-segregating with the disease. According to the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007), genetic distances are specified in centi-Morgans (cM).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 66

Chapter 3 Mucopolysaccharidosis

Figure 3.9: Chromatograms showing missense mutation (c.1259C>G, p.Pro420Arg) in exon 12 the gene GALNS in family B. Nucleotide sequence in affected individuals (IV-4, IV-5, IV-6, IV-7) showing substitution of C by G (a). Nucleotide sequence of the heterozygous carriers (III-1, III-2, III-3, III-4, IV-8) having both C and G in heterozygous state (b). DNA sequences of normal individuals (IV-1, IV-2, IV-3, IV- 9) demonstrating wild type allele (c).

Figure 3.10: Partial amino acid sequence comparison of human GALNS protein with other orthologs, showing shaded Proline residue (Pro420) which is highly conserved across different species.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 67

Chapter 3 Mucopolysaccharidosis

Figure 3.11: Pedigree drawing of family C exhibiting autosomal recessive Morquio A syndrome. Males and females are indicated by squares and spheres respectively. Affected individuals are specified by shaded symbols. Consanguineous union is demarcated by double line between individuals. Roman numerals show generation number and Arabic numerals represent individuals within a generation.

Figure 3.12: Clinical features of affected individuals in family C. Affected individuals (IV-2 and IV-3) showing pectus carinatum (a, b). X-rays radiographs of bth hands of affected member (IV-2) demonstrating small carpal bones and tapering of the proximal phalanges (c). X-ray of the chest of affected individual (IV-2) showing ‘mild flaring and widening of ribs, flattening of vertebral bodies (platyspondyly) and anterior beaking of all vertebrae, short thick clavicles and pectus carinatum (d).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 68

Chapter 3 Mucopolysaccharidosis

Figure 3.13: Haplotypes of family C showing linkage at chromosome 16q24.3. The shaded black alleles symbolize risk haplotype, while the alleles displayed in grey are not co-segregating with the disease. According to the Rutgers combined linkage- physical map (Build 36.2) (Matise et al., 2007), genetic distances are specified in centi-Morgans (cM).

Figure 3.14: Chromatograms of sequencing GALNS gene in family C. Missense mutation (c.1156C>T; p.Arg386Cys)in exon 11 of GALNS in affected members (IV- 1, IV-2) of family C (a), heterozygous carriers (III-1, III-3) (b) and normal nucleotide sequence in normal members (IV-3, IV-4) of family C (c). The converted nucleotide position is specified by an arrow.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 69

Chapter 3 Mucopolysaccharidosis

Figure 3.15: In silico structural and functional analysis of normal and mutated GALNS protein holding c.1156C>T; p.Arg386Cys mutation. Normal GALNS protein with Arg amino acid residue at protein position 386 that has intermolecular interaction between Arg 386, Ala 104 and Thr 406 (a). Mutant GALNS protein in which Arg386 is substituted by Cys resulting in the loss of intermolecular bonds and alters the normal protein folding (b). Molecular docking pose of normal GALNS protein having ingenious active site (c). Molecular docking showing abolished active site that increases the value of docking score i.e. -15.844 than its corresponding normal protein -18.099 (d).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 70

Chapter 3 Mucopolysaccharidosis

Figure 3.16: Pedigree outline of family D with Morquio A syndrome. Squares and circles represent male and female individuals respectively. Affected individuals are specified by filled squares and circles. Individuals within a generation are denoted by Arabic numerals while Roman numerals are used for clarifying the generation numbers. Consanguineous union is demonstrated with double lines between the individuals.

Figure 3.17: Clinical features of an affected individual in family D. Affected individuals exhibited pectus carinatum (a), twisted legs and kyphosis (b, c) and genu valgus (d).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 71

Chapter 3 Mucopolysaccharidosis

Figure 3.18: Haplotypes representing allelic pattern of GALNS in family D. Black bars show allele at risk while normal allele is represented by blank bars. Arabic numerals (1, 2…) represent position of alleles on gel electrophoresis according to the point of their bands. Genetic distance against each STS marker was obtained from Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 3.19: Sequence analysis of exon 7 of the GALNS gene in family D. The upper panel shows nucleotide sequence in affected member (V-1) having missense mutation c.647T>C (a). Nucleotide sequence of heterozygous carriers (IV-4, IV-5, V-3) having both mutant and wild type alleles (b). The lower panel shows normal sequence in un affected individuals (IV-3, IV-6, IV-7, V-2, V-2, V-4) (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 72

Chapter 3 Mucopolysaccharidosis

Figure 3.20: Bioinformatics analysis of normal and Mutant GALNS protein in family D. Normal GALNS protein showing intermolecular interactions among Ser216, Val134 and Leu228 (a). In mutant GALNS protein (p.Phe216Ser), Ser 216 develops new interactions with Leu34, Val138 and Ile217 (b). Molecular docking of normal GALNS protein, exhibiting the ligand grabbed by His336, Asp39 and Asp 40 in the active site (c). Mutant GALNS revealing crumbled ligand protein interaction (d).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 73

Chapter 3 Mucopolysaccharidosis

Figure 3.21: Pedigree drawing of family E segregating autosomal recessive mucopolysccharidosis type IVA. Affected individuals are represented by shaded symbols while males and females are symbolized by squares and spheres respectively. Cousin marriage is demarcated by double lines between individuals.

Figure 3.22: Photographs of affected individuals in family E. An affected boy (IV-1), showing pectus carinatum, kyphosis and twisted arms (a), affected male (IV-1) demonstrating abnormal dentation (b) and an affected girl (IV-2) showing bulged eyes, broad nose and widely spaced teeth (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 74

Chapter 3 Mucopolysaccharidosis

Figure 3.23: Haplotypes generated by linkage analysis in family E. Diseased alleles are shown by black bars and normal allele is shown by blank bars. Genetic distance of the STS markers is described in centi Morgans (cM).

Figure 3.24: Sequencing chromatograms of exon 4 of the GALNS gene in family E. Frameshift mutation (c.360-361InsA; p. Glu121Argfs*37) is marked in the upper panel (a), nucleotides sequence in heterozygous carriers in the middle (b) and normal wild type sequence in the bottom (c). The sequence change is specified by a downward arrow.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 75

Chapter 3 Mucopolysaccharidosis

Figure 3.25: Pedigree diagram of family F with autosomal recessive MPS IVA. Two affected female individuals are shown by black circles in the fourth generation. Normal males are characterized by squares while circles are used for specifying female individuals. Generation number and individuals in a specific generation are denoted by Roman and Arabic numerals respectively. Double lines between individuals indicate consanguineous marriage. Numbers labeled with asteric represent individuals whose blood samples were available for this study.

Figure 3.26: Clinical presentation of affected individual (IV-2) of family F. A 24 years old woman exhibiting short stature with short hands (a) and short neck with coarse face (b) and corneal clouding accompanied by askew teeth (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 76

Chapter 3 Mucopolysaccharidosis

Figure 3.27: Haplotypes demonstrating allelic pattern of the GALNS gene in family F. Diseased alleles are shown by black bars and normal alleles by blank bars. Arabic numerals (1, 2…) represent position of alleles on gel electrophoresis according to the point of their bands. Genetic distance against each STS marker was obtained from Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 3.28: Nucleotide sequence of exon 4 of the GALNS gene in family F exhibiting frameshift mutation (c.360-361InsA; p. Glu121Argfs*37). The upper panel shows nucleotide sequence in affected members (a). The heterozygous carriers are shown in the middle (b) and normal sequence in the lower panel (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 77

Chapter 4 Acromesomelic Dysplasia

ACROMESOMELIC DYSPLASIA

Acromesomelic dysplasias represent a group of skeletal disorders characterized by disproportionate shortening of skeletal elements, mainly affecting the middle parts of forearms and forelegs with the distal segments (hands and feet) of the appendicular skeleton (Grebe, 1952; Shine, 1972). On the basis of phenotypic and radiologic variability acromesomelic dysplasias are categorized into three types; acromesomelic dysplasia type Grebe (AMDG), acromesomelic dysplasia type Hunter and Thompson (AMDH) and acromesomelic dysplasia Maroteaux type (AMDM) (Grebe, 1952; Maroteaux et al., 1971; Hunter and Thompson, 1976). AMDG and AMDH are caused by mutations in the GDF5 gene, encoding growth and differentiation factor-5 (Thomas et al., 1996; Thomas et al., 1997) or BMPR1B gene which encodes bone morphogenetic protein receptor IB (Graul-Neumann et al., 2014). Acromesomelic dysplasia Maroteaux type is an autosomal recessive disorder that varies from AMDG and AMDH on account of clinical features and molecular genetics (Maroteaux et al., 1971; Langer et al., 1989; Costa et al., 1998). The gene responsible for pathogenesis of AMDM is NPR2 that encodes natriuretic peptide receptor B (Bartels et al., 2004). Several studies validated that CNP-NPR2 signaling plays an important role in endochondral ossification and its inactivation resulted in dwarfism in both mouse and human (Yasoda et al., 1998; Tsuji and Kunieda, 2005; Teixeira et al., 2008).

This chapter describes three consanguineous families of Pakistani origin (G, H, I) with autosomal recessive acromesomelic dysplasia. Linkage in these families was established to NPR2 gene on chromosome 9p13.3. This was followed by sequencing all 22 exons of the NPR2 gene to search for the disease causing sequence variants. Three novel missense mutations were identified in those families.

Family G

Family G was collected from Rabat valley of Lower Dir, KPK, Pakistan. This consanguineous family established a five generation pedigree segregating autosomal recessive acromesomelic dysplasia (4.1). Blood samples of nine individuals including four affected individuals (IV-2, IV-3, IV-4, V-2) and five unaffected individuals (III- 1, IV-1, IV-5, V-1, V-3) were collected for genetic mapping and mutation analysis in the present study.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 78

Chapter 4 Acromesomelic Dysplasia

Clinical Features

There were four affected individuals in family G which included three females (IV-3, IV-4, V-2) and one male (IV-2). Affected members in family G exhibited marked clinical features of acromesomelic dysplasia, type Maroteaux (AMDM) including disproportionate short stature with shortening of the middle and distal segments of the limbs (Table 4.1). Affected individuals were aged 4 to 23 years at the time of this study. Facial appearance and intelligence were normal in all affected individuals. All affected individuals had acromesomelia characterized by shortening of the forearms and forelegs along with the shortening of distal segments (hands and feet). Bowed forearms, with limited extension of elbows, and brachydactyly (short fingers and short toes) were noticeable in affected individuals. Ectodermal features of affected individuals demonstrated loose, redundant skin on fingers with short and stubby nails. Radiographic features of an affected member (IV-2) revealed short and broad metacarpals and phalanges in hands. Bilateral triangular distal epiphysis of the ulna and relative shortening of the radius was evident from the X-rays of forearms. Metaphyseal flaring of long bones and shortening of tibia and fibula was detected by X-rays of the lower limbs (Fig. 4.2).

Genetic Mapping and Mutation Analysis

Based on clinical features, linkage in family G was tested by using STS markers (D9S1853, D9S911, D9S1118, D9S1845, D9S1817, D9S1794, D9S8174, D9S229, D9S773) flanking the NPR2 gene on chromosome 9p13.3. On PAGE, microsatellite markers (D9S1118, D9S1845, D9S1817, D9S1794, D9S8174) showed homozygosity among all affected individuals and heterozygosity in all unaffected members of family G. Thus, linkage in family G was established to the NPR2 gene on chromosome 9p13.3 (Fig. 4.3).

Subsequent sequence analysis of all 22 exons of the NPR2 gene detected a novel missense mutation, involving C to T transition at nucleotide position 2245 (c.2245C>T), in exon 15 of the gene in affected members of family G. This sequence change resulted in substitution of arginine with tryptophan at amino acid position 749 (p.Arg749Trp) (Fig. 4.4). Non-polymorphic nature of the missense mutations, detected in the present study, was verified by sequencing exons 11 of the gene in 200 ethnically matched control individuals and was not identified outside the family.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 79

Chapter 4 Acromesomelic Dysplasia

Family H

Family H was recruited from Dir Kohistan, a remote area of Khyber Pakhtunkhwa, Pakistan. Pedigree of the family consisted of four generation including two affected girls (IV-3, IV-4) and an affected boy (IV-2) in the last generation. Parents of affected individual were normal and were united in a first cousin marital relationship. Pedigree analysis revealed that the pattern of disease segregation in family H was autosomal recessive (Fig. 4.5). Blood samples of three healthy individuals (III-1, III- 2, IV-1) and three affected individuals (IV-2, IV-3, IV-4) were collected for molecular analysis in this study.

Clinical Features Observed in Family H

Affected individuals in family H included one boy (IV-2) and two girls (IV-3, IV-4). Affected individuals exhibited marked clinical features of acromesomelic dysplasia such as disproportionate short stature with other features of dolichocephalic skull, short trunk, long faces, marked bending of fore limbs and brachydactyly in hands and feet (Fig. 4.6). Intelligence was normal and no other cardiovascular, renal, retinal and ectodermal abnormalities were observed in affected individuals of the family H. A summary of clinical features of affected individuals in family H is given in table 4.2.

Genotyping and Mutation Screening

Genotyping in family H was performed using DNA samples of three affected three affected (IV-2, IV-3, IV-4) and three unaffected (III-1, III-2, IV-1). By typing microsatellite markers (D9S205, D9S911, D9S1817, D9S1794, D9S772, D9S8174, D9S229, D9S229, D9S2148), linkage in family H was established on chromosome 9p13.3 (Fig. 4. 7).

Homozygous region identified in family H resided NPR2 gene which was thoroughly sequenced in all available members of the family. Sequencing analysis revealed a novel missense mutation (c.1801C>A; p.Arg601Ser) in exon 11 of NPR2 gene (Fig. 4.8). Using Polyohen2 online tools, the mutation was predicted to be probably damaging with a score of 0.999 (sensitivity: 0.14; specificity: 0.99). Mutation taster also established the pathogenic nature of the mutation with a score of 0.99 because of altered amino acid sequence which may affect protein features and cause splice site changes.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 80

Chapter 4 Acromesomelic Dysplasia

Family I

Family I, segregating autosomal recessive acromesomelic dysplasia was collected from Bahrin, Swat district of KPK, Pakistan. This was a five generation pedigree containing three affected individuals (Fig. 4.9). Affected individuals included two girls in the fifth generation and their father (IV-2). Parents of affected individual (IV- 2) were phenotypically normal. Symptoms of the disease were not previously reported within family I. After intensive clinical examinations and history taking, blood samples of two affected individuals (IV-2, V-3) and two unaffected individuals (IV-1, V-2) were collected for molecular analysis.

Clinical Features

There were three affected individuals in family I which included a thirty eight years old man (IV-2) and his two daughters, aging twelve years (V-3) and nine years (V-4). Affected individuals demonstrated apparent disproportionate short stature characterized by acromesomelic shortening of arms and legs. A clear bending of the fore arms of affected individuals indicated that radius is longer than ulna. Tibia and fibula were fairly shorter in regard to the axial body axis. Hands of affected individuals were quite small exhibiting very short fingers (phalanges). Similarly, feet of affected individuals were noticeably small in size and toes (phalanges) were shorter than normal. All affected individuals had short nails in their fingers and toes. Affected individuals had loose, redundant skin on their hands (Fig. 4.10). All affected individuals had normal intelligence and no hearing impairment, or speech impairment was noted in affected individuals. Lamentably, the family head declined to provide complete body pictures of the affected individuals. Inclusive physical examination of affected individuals revealed clinical features comparable with acromesomelic dysplasia, allowing making molecular diagnosis of AMDM.

Genetic Mapping and Mutation Analysis

In line with, clinical features of affected individuals, linkage in family I was tested by using a set of seven microsatellite markers (D9S251, D9S1118, D9S1845, D9S1817, D9S1794, D9S229, D9S773) flanking NPR2 gene on chromosome 9p13.3. On PAGE, five microsatellite markers (D9S1845, D9S1817, D9S1794, D9S229, D9S773) showed homozygosity in two affected individuals (IV-2, V-3) and heterozygosity in

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 81

Chapter 4 Acromesomelic Dysplasia unaffected individuals (IV-1, V-2). Haplotype analysis accredited linkage in family I on chromosome 9p13.3 (Fig. 4.11).

Once linkage was detected in family I, all 22 exons of the gene, NPR2, were sequenced. Sequence analysis of the NPR2 gene identified a novel missense mutation (c.941T>G; p.Leu314Arg) in exon 3. This sequence variant was found homozygous in both affected individuals (IV-2, V-3) and heterozygous in both healthy individuals (IV-1, V-2) of the family. Exon three of the NPR2 was sequenced in five control samples from outside population which showed wild type sequence (Fig. 4.12).

Mutation taster and Polyphen2 online tools predicted that missense mutation (c.941T>G) is probably disease causing. The variant was neither found in 1000genomes nor ExAc. Amino acid sequence of the human NPR2 was compared with different species: including chimpanzee, monkey, cat and mouse, indicating that amino acid residue (Leu314) is highly conserved (Fig. 4.13).

Discussion

Growth is a dynamic and genetically regulated process of cellular proliferation and differentiation from all tissues (Silventoinen et al., 2003). Genetic aberrations in the process of endochondral ossification affect the developing growth plate which eventually results in different types of osteochondrodysplasias with abnormal size, shape and/or number of skeletal elements (Lango et al., 2010). Categorization of phenotypically discrete skeletal disorders on the basis of common pathology and radiology supports the exploration of disease pathogenesis at molecular level (Warman et al., 2011).

Acromesomelic dysplasia represents a group of autosomal recessive disorders with anomalous growth plates and malformed distal skeletal elements (Bartels et al., 2004; Khan et al., 2016). Clinically, acromesomelic dysplasias are characterized by disproportionate shortening of skeletal elements, mainly affecting the middle parts of forearms and forelegs with the distal segments (hands and feet) of the appendicular skeleton (Grebe, 1952; Shine, 1972). On the basis of phenotypic and radiologic variability acromesomelic dysplasias are categorized into three types; acromesomelic dysplasia type Grebe (AMDG), acromesomelic dysplasia type Hunter and Thompson (AMDH) and acromesomelic dysplasia Maroteaux type (AMDM) (Grebe, 1952; Maroteaux et al.,1971; Hunter and Thompson, 1976).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 82

Chapter 4 Acromesomelic Dysplasia

Acromesomelic dysplasia Maroteaux type (AMDM: MIM 602875) share phenotypic similarities with other types of acromesomelic dysplasias (AMDG: MIM 200700, AMDH: MIM 201250) but in fact they are not identical (Maroteaux et al., 1971; Langer et al., 1989; Costa et al., 1998). Patient diagnosed with AMDG and AMDH have missing or fused skeletal elements in the autopod (hands and feet) while the patients with AMDM contain all their skeletal elements. Furthermore, AMDM is characterized by the involvement of axial skeletal elements characterized by wedging of vertebral bodies in the course of ventral margins being longer than the dorsal margins (Langer and Garrett, 1980). This distinctiveness is confirmed at molecular genetic level, AMDG and AMDH are caused by mutations in the growth and differentiation factor 5 (GDF5; OMIM: 601146) also known as Cartilage derived bone morphogenetic protein-1 (CDMP1) (Thomas et al., 1996; Thomas et al., 1997). In contrast, mutations in the natriuretic peptide receptor NPR-B (NPR2) results in acromesomelic dysplasia Maroteaux type (AMDM) (Bartels et al., 2004).

This chapter of the thesis deals with clinical and molecular evaluation of three Pakistani consanguineous families with acromesomelic dysplasia type Maroteaux (AMDM). A pattern of clinical features observed in affected members in three families was similar to those reported earlier in several cases of the AMDM of different ethnic origin (Maroteaux et al., 1971; Langer and Garrett, 1980; Bartels et al., 2004; Khan et al., 2012). After establishing linkage in the families on chromosome 9p12-21 harboring NPR2 gene, sequence analysis revealed three novel missense mutations (p.Arg749Trp, p.Arg6016Ser, p.Leu314Arg) in family G, H and family I respectively. Polyphen-2 (Polymorphism Phenotyping v2) predicted that the two missense variants were disease causing and had damaging effects on protein products.

NPR2, the causative gene for AMDM, contains 22 exons spanning 16.5 kb on chromosome 9p13.3. The gene encodes a 1047 amino acids protein (Kant et al., 1998). The protein product of NPR2 gene (natriuretic peptide receptor B) is a receptor for C-type natriuretic peptide (CNP). NPR-B is a homodimeric transmembrane protein which has a modular structure consisting of a ligand binding extracellular domain, a trans-membrane unit, intracellular kinase homology domain and a carboxyl-terminal guanylyl cyclase domain (Potter et al., 2006). The CNP and its receptor NPRB are recognized as important regulators of longitudinal growth that are

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 83

Chapter 4 Acromesomelic Dysplasia implicated in endochondral ossification (Yasoda et al., 1998; Teixeira et al., 2008). Remarkable expression of CNP has been reported in the hypertrophic zone of the growth plate where it stimulates proliferation and differentiation of chondrocytes in an autocrine/paracrine manner thereby promoting synthesis of cartilage (Pejchalova et al., 2007). Binding of CNP with NPR-B results in intracellular accumulation of cyclic GMP (cGMP) which in turn activates downstream signaling molecules such as cGMP-dependent protein kinases I and II (cGKI and cGKII), cyclic nucleotide regulated ion channels (cGICs) and cGMP-regulated phosphodiesterases (PDEs) (Olney, 2006; Pejchalova et al., 2007). It has been long established that cGKII is essential for CNP-mediated endochondral ossification (Miyazawa et al., 2002). Likewise, cGKII inhibits the activity of RAF-1, and as a result, MEK1/2 and ERK1/2 are activated. On the other hand, CNP stimulates the FGFR3 pathway through MAPK signaling pathway which facilitates chondrocyte proliferation and differentiation and promotes cartilage matrix synthesis (Vasques et al., 2014).

Genomewide association studies have discovered several genetic loci in the natriuretic peptide system related to human height variabilities (Lanktree et al., 2011; Berndt et al., 2013). To date, 27 homozygous or compound heterozygous mutations in the NPR2 gene have been reported in multiethnic patients of AMDM (Bartels et al., 2004; Olney et al., 2006; Hachiya et al., 2007; Khan et al., 2012; Irfanullah et al., 2016). Moreover, five heterozygous mutations in the gene resulted in nonsyndromic short stature (Vasques et al., 2013; Amano et al., 2014). In contrast, three homozygous gain of function mutations in the NPR2 gene have been reported in in patients with tall stature (Miura et al., 2012; Hannema et al., 2013; Miura et al., 2014).

In conclusion, NPC/NPR-B system plays a key role in normal growth and growth disorders. Apart from AMDM caused by homozygous mutations in NPR2 heterozygous NPR2 mutations are involved in short stature. However, the role of heterozygous mutations in the disease pathogenesis is poorly understood. Novel mutations identified in three families with AMDM phenotypes in this study will improve the existing information to indicate molecular-genetic screening of NPR2 in patients AMDM.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 84

Chapter 4 Acromesomelic Dysplasia

Table 4.1: Clinical features observed in affected individuals of family G

Clinical Features Affected Individuals

IV-2 IV-3 IV-4 V-2

Sex M F F F

Age in Years 24 17 12 9

Skeleton Height in cm 132 120 116 112

Short stature + + + +

Bowing of forearms + + + +

Acromesomelia + + + +

Restricted elbow extension + + + +

Brachydactyly + + + +

Kyphosis + N/A N/A N/A

Radiographic Short tibial and tabular bones + N/A N/A N/A features Short and bowed radius + N/A N/A N/A

Short and broad metacarpals + N/A N/A N/A

Short and broad phalanges + N/A N/A N/A

Skin and Loose and redundant skin on + + + + Nails hands

Short and clumsy nails + + + +

Note: M= male, F= female, + = Observed, N/A = Not Assessed,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 85

Chapter 4 Acromesomelic Dysplasia

Figure 4.1: Pedigree diagram of family G. Generations in the pedigree are denoted by Roman numerals and individuals within a generation are shown by Arabic numerals. Squares and circles are used for symbolizing males and females while affected members are specified by filled shapes. The individuals labeled with asteric means the available participants of the study. Cousin marriages are shown by double lines between individuals.

Figure 4.2: Clinical features of affected individuals in family G. An affected male (VI-2) and affected female (IV-3) with a normal brother (IV-1) showing short stature (a). Hand of affected individual (IV-2) showing short fingers, broad hands and redundant skin (b). Foot of affected individual (IV-2) showing short toes, large halluces and broad phalanges (c). Radiograph of affected individual (IV-2) displaying antero-posterior (AP) pelvis and hips and legs showing shortening of tibia and tabula (d). Radiograph of hands and forearm of an affected member (IV-2) showing shortening and widening of metacarpals and phalanges (e).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 86

Chapter 4 Acromesomelic Dysplasia

Figure 4.3: Haplotypes demonstrating linkage at chromosome 9p13.3 in family G. The shaded black alleles symbolize risk haplotype, while the alleles displayed in grey are not co-segregating with the disease (a). Genetic distances in centi-Morgans (cM) are consistent with the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 4.4: Partial DNA sequence of the NPR2 gene showing missense mutation (c.2245C>T) in family G. The upper panel (a) represents the nucleotide sequences in the affected individuals, the middle panels (b) in the heterozygous carriers and the lower panels (c) in the unaffected individuals of the family G.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 87

Chapter 4 Acromesomelic Dysplasia

Table 4.2: Clinical features of affected individuals in family H

Clinical Features Affected Individuals

IV-2 IV-3 IV-4

Sex Male F F

Age 5 14 8

Craniofacial Dolichocephalic skull + + + Features Long face + + +

Short nose + + +

Skeleton Short stature + + +

Bowing of forearms + + +

Acromesomelia + + +

Restricted elbow extension + + +

Brachydactyly + + +

Kyphosis + N/A N/A

Skin and Loose and redundant skin on + + + Nails hands

Short and clumsy nails + + +

Intelligence Normal + + +

Note: M= Male, F= Female, + = Feature was observed, N/A= Not assessed

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 88

Chapter 4 Acromesomelic Dysplasia

Figure 4.5: Pedigree of family H segregating autosomal recessive AMDM. Affected males and females are shown by filled squares and circles, respectively. Symbols with bars indicate deceased individuals. Double lines between individuals represent consanguineous union. The individuals labeled with asteric means the available participants of the study.

Figure 4.6: Clinical features of affected individuals in family H. Affected individual (IV-2) showing short stature and bowing of the forearms and shortening of legs (a). Affected members (IV-2, IV-3, IV-4) exhibiting short-limb dwarfism, long faces, dolichocephalic skull and shortness of the trunk (b). Photographs of hands of affected individual (IV-3) in dossal (c) and ventral (d) view showing the shortening of the extremities, and the bowing of the forearm. Feet of affected individuals (IV-2, IV-3) showing short toes, large halluces, broad phalanges and brachymetatarsia in second and/or fourth toe (e).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 89

Chapter 4 Acromesomelic Dysplasia

Figure 4.7: Haplotypes demonstrating allelic pattern of NPR2 in family H. The shaded black alleles symbolize risk haplotype, while the alleles displayed in grey are not co-segregating with the disease. Genetic distances in centi-Morgans (cM) are consistent with the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 4.8: Partial DNA sequence of exon 11 of the NPR2 gene in family H demonstrating a novel missense mutation (c.1801C>A). Nucleotide sequences in affected members of the family I where C is substituted by A (a). Nucleotide sequence in the heterozygous carriers having both A and C (b). Normal DNA sequence of exon 11 with a wild type C nucleotide (c). The altered nucleotide residue is manifested by a downward arrow.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 90

Chapter 4 Acromesomelic Dysplasia

Figure 4.9: Pedigree diagram of family I, segregating autosomal recessive AMDM. Two affected girls in the fifth generation are shown by filled circles and an affected male is specified by filled square in fourth generation. Healthy males are represented by blank squares and healthy females are designated with blank circle. Consanguinity is shown by double lines between individuals.

Figure 4.10: Clinical features of affected individuals in family I. Hands of an affected girl (V-3) showing bowed forearm, small hands and brachydactyly (a, b). Hands of affected individual (IV-2) showing small hands, brachydactyly, short and blunt nails and loose and redundant skin on hands (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 91

Chapter 4 Acromesomelic Dysplasia

Figure 4.11: Haplotypes of family I, showing linkage on chromosome 9p13.3. The shaded black alleles symbolize risk haplotype, while the alleles displayed in grey are not co-segregating with the disease. Genetic distances in centi-Morgans (cM) are consistent with the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 92

Chapter 4 Acromesomelic Dysplasia

Figure 4.12: Nucleotides sequence of exon three of the NPR2 gene showing missense mutation (c.941T>G; p. Leu314Arg) in family I. The upper panel displays nucleotides sequence in affected individuals (IV-2, V-3) having homozygous T to G transversion (a). Sequence observed in heterozygous carriers (IV-1, V-2) is illustrated in the middle panel having both, the normal and altered nucleotides (b). Sequence of exon three in normal individuals containing wild type nucleotide (c).

Figure 4.13: Amino acid sequence of NPR2 protein in human and other species showing that amino acid residue (Leu314) is highly conserved.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 93

Chapter 5 Post Axial Polydactyly

POSTAXIAL POLYDACTYLY

Postaxial polydactyly (PAP) is one of the most common congenital malformations with a prevalence rate of 1–2/1000 live births in different populations (Verma and El- Harouni, 2015). PAP can occur as an isolated limb defect or as a part of congenital anomalies such as Meckel syndrome, Down syndrome, Smith-Lemli-Opitz syndrome, Jeune syndrome, short rib-polydactyly syndromes, Ellis-van Creveld syndrome, Bardet-Biedl, and Joubert syndrome (Castilla et al., 1996; Verma and El-Harouni, 2015). Due to their common underlying pathophysiology, overlapping phenotypes and shared genetic causes, it is quite challenging to diagnose these disorders at clinical and molecular level. To date, mutations in almost 70 genes have been identified causing different syndromes with PAP phenotypes (Verma and El-Harouni, 2015) while only 2 genes (GLI3 and ZNF141) were reported involved in developing isolated form of postaxial polydactyly (Al-Qattan, 2012; Kalsoom et al., 2013).

This chapter describes clinical and molecular analysis of two Pakistani consanguineous families (J, K) segregating post axial polydactyly in autosomal recessive manner. SNP microarray and exome sequencing revealed a frameshift mutation in a novel gene KIAA0825 in family J with isolated PAP and another novel mutation in MKS1 gene underlining syndromic form of PAP in the family K.

Family J

Family J, segregating non-syndromic form of postaxial polydactyly, was recruited from Upper Dir district in Khyber Pakhtunkhwa, Pakistan. A five generation pedigree was constructed based on the information provided by the family elders (Fig. 5.1). Peripheral blood samples were collected from two affected (V-1, V-2) and three unaffected members (IV-2, V-3, V-4) of the family after obtaining informed consent from them.

Clinical Features

Affected Individuals (IV-1, IV-2) presented bilateral, well-developed duplication of fifth digit in hands and feet exhibiting post axial polydactyly type A (PAPA). However an affected member (IV-2) had a rudimentary tag in the left hand, a feature of postaxial polydactyly type B (PAPB) (Fig. 5.2). X-rays radiography of affected individual (IV-2) revealed a diphalangeal extra digit in right hand while no additional

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 94

Chapter 5 Post Axial Polydactyly boney structure was observed in the left hand. Carpals and metacarpal bones were normal in size, shape and number. Radiographs of the feet uncovered a diphalangeal sixth digit in right feet and a diphalangeal sixth digit extending from a forked shaped tow headed fifth metatarsal. Affected individuals had normal height, teeth, nail, skin and hairs without any associated craniofacial or neurological abnormalities.

Exclusion Mapping

Linkage in the family to previously reported loci involved in developing nonsyndromic postaxial polydactyly was tested using microsatellite repeats which included four markers (D7S2469, D7S691, D7S2428, D7S2427) mapped to PAPA1 on chromosome 7p14.1, thirteen markers (D13S1492, D13S242, D13S1302, D13S156, D13S162, D13S160, D13S1277, D13S271, D13S1816, D13S1234, D13S71, D13S1252, D13S1323, D13S158) for PAPA2 on 13q21-q32, eight markers (D19S865, D19S1169, D19S906, D19S840, D19S885, D19S199, D19S915, D19S911) for PAPA3 on 19p13.2-p13.1, eight markers (D7S2351, D7S2504, D7S2545, D7S2453, D7S501, D7S2456, D7S2418, D7S486, D7S2487) for PAPA4 on 7q22, fifteen markers (D13S1246, D13S1287, D13S171, D13S1293, D13S220, D13S305, D13S218, D13S1248, D13S1247, D13S1227, D13S887, D13S328, D13S118, D13S262, D13S1492, D13S1261, D13S1317, D13S276) for PAPA5 on 13q13.3-q21 and four markers (D4S3028, D4S3338, D4S415, D4S2967) for PAPA6 on 4p16.3. Markers were amplified by polymerase chain reaction and amplified products were separated on polyacrylamide gel as described in Chapter 2. The gel was photographed using electrophoresis documentation and analysis system DC 290 (Kodak, Digital Sciences, New York, USA) and the results were analyzed by visual inspection. However, genotyping failed to show convincing linkage in the family on any of the above tested loci.

SNP Microarray Analysis

After excluding the aforementioned genes/loci from linkage, DNA samples of four members (IV-1, V-1, V-2, V-3) of family J were used in whole-genome homozygosity mapping. Whole genome SNP array revealed two homozygous regions in the affected members of family J, which included a 29.56Mb region on chromosome 1p31.1-p21.1 and a 10.22Mb on 5q14.3-q15. Genomic position of homozygous region on chromosome 1p31.1-p21.1 (77,190,350-106,774,642) was

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 95

Chapter 5 Post Axial Polydactyly flanked by SNPs rs664015 and rs1330225 and the second homozygous region observed on chromosome 5 (85137318-95357625) was bordered by rs893554 and rs271927 SNPs. Both the affected individuals (V-1, V-2) showed homozygosity and normal individuals (V-3, V-4) heterozygosity in the two mapped regions. The homozygous regions on chromosome 1p31.1-p21.1 contained 160 protein coding genes while chromosome 5q14.3-q15 encompassed 31 protein coding genes (http://atlasgeneticsoncology.org/).

Analysis of Exome Sequencing Data

DNA sample of an affected member (V-1) of family J was used in the whole exome sequencing. Analysis revealed total 53852 variants in the exome of the patient. All genotypes that were reported with a frequency above 0.001 in single nucleotide polymorphism database (dbSNP) (http://www.ncbi.nlm.nih.gov/projects/SNP/), the 1000 genomes project or the 5000 exomes project (http://evs.gs.washinton.edu/EVS/) were removed. The variants occurring in intronic regions, 5/UTRs and 3/UTRs or the variants that were coding synonymous were excluded. The, potentially functional variants including nonsense, missense, splice-site, and indel variants that were homozygous for the minor alleles were screened for quality and against public variant databases. However, before filtering out heterozygous variants, all the previously reported PAP (GLI3, ZNF141, SHH, HOXD13) genes were thoroughly screened for either homozygous or heterozygous variants. Hence, the possibility of compound heterozygous mutation was assertively excluded. Downstream analysis of WES data revealed four potentially functional variants in affected individual (V-2) which included a frameshift mutation (c.594-595InA; p.Glu198Thrfs*21) in KIAA0825, and three missense mutations including c.25T>G; p.Ser9Gly, c.41C>T; p.Ala14Val and c.734T>C; p.Meth245Thr in RPF1, INPP5E and ERCC6, respectively.

Validating Mutations by Sanger Sequencing

Selected variants were tested by Sanger sequencing to validate their segregation according to the phenotypes reported in the family (Table. 5.1). It established segregation of a frameshift mutation (c.594-595insA; p.Gln198Thrfs*21) in the KIAA0825 gene, on chromosome 5, with post axial polydactyly type A phenotypes in the family. The variant was homozygous in the affected individuals, heterozygous in the unaffected carrier and absent in normal members of the family (Fig. 5.3). To

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 96

Chapter 5 Post Axial Polydactyly exclude the non-pathogenic nature of the frameshift variant, it was tested in 200 ethnically matched control samples but it was not found.

Family K

Family K, with post axial polydactyly, speech impairment and poor growth was recruited during a field visit from District Swat in Khyber Pakhtunkhwa, Pakistan. This was a four generation pedigree with autosomal recessive mode of inheritance. The family had six affected individuals including a female (IV-3) and five males (IV- 2, IV8, IV-9, IV-10, IV-11) in fourth generation. First cousin union was observed among the parents of affected individuals. Total fourteen individuals from the family were registered in this study including the aforementioned affected and eight unaffected members (III-1, III-3, III-5, IV-1, IV-4, IV-5, IV-6, IV-7) (Fig. 5.4).

Clinical Features

All six patients, including a female (IV-3) and five males (IV-2, IV-8, IV-9, IV-10, IV-11), were aged between 10 and 20 years. Postaxial polydactyly in hands and feet in combination with camptodactyly of the fingers was observed in four affected members (IV-8, IV-9, IV-10, IV-11). One of the affected individuals (IV-8) exhibited folded sixth digit in his left hand showing postaxial polydactyly between fifth and sixth finger. Four affected individuals (IV-8, IV-9, IV-10, IV-11) had dysarthria characterized by slurred speech while other two (IV-2, IV-3) faced problems in verbal communications. All the patients demonstrated mild to moderate sensorineural hearing loss (Clark, 1981), hypotonia, ataxia, and minor proportionate short stature (- 2SDS below normal) without any craniofacial abnormalities (Fig. 5.5). A comparative IQ scoring for affected and healthy members of the family was acquired using Slosson Intelligence Test Revised (SIT-R) (Campbell and Ashmore, 1995) with some modifications. In comparison with their normal brothers and sisters (IQ=79-94), maximum IQ score of 83 was recorded for patients IV-2 and IV-9, and minimum score of 69 for patient IV-8. The patient (IV-8) showed apparent intellectual disability. He had no self-care skills and no recognizable expressive language. History of psychomotor delay, ocular motor apraxia, cardiovascular diseases and breathing abnormalities was not reported in the patients. Brain imaging (MRI) features in an affected individual (IV-8) revealed hypoplastic cerebellar vermis with elongated superior cerebellar pudencles and deepening of interpeduncular cistern. Molar tooth

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 97

Chapter 5 Post Axial Polydactyly sign was subsequently positive. Normal MRI appearance of the brain parenchyma was noted with no area of abnormal intensity. The interhemispheric fissure was centered on the midline. The cerebrum and cerebellum exhibited normal cortical sulcation. The cerebral ventricles were of normal size and symmetrical. There were no sign of increased intracranial pressure. The cortex and white matter showed normal development and normal signal intensity, especially in the periventricular white matter. No abnormalities were seen in the basal ganglia, internal capsule, corpus callosum or thalamus. The sella turcica and pituitary were normal and parasellar structures were unremarkable. The paranasal sinuses and mastoid air cells showed normal development and pneumatization. No evidence of intracerebral, subdural/extradural hemorrhage was detected. Cavernous, sagittal, straight and transverse sinuses appeared normal. Thus the existence of a clear “molar tooth sign” in the proband allowed making a diagnosis of Joubert syndrome (Fig. 5.5). Renal assessment was performed by measuring creatinine and blood urea nitrogen. Normal blood creatinine (0.7-1.12 mg/dl) and blood urea nitrogen levels (12-16mg/dl) jettisoned the manifestation of any renal complications (Table 5.2). Funduscopic examination revealed no retinal dystrophy in the patient.

Exclusion Mapping

Linkage was tested in family K using microsatellite markers (Table 2.1) flanking to the previously reported genetic loci of nonsyndromic postaxial polydactyly and/or syndromes associated with PAPA phenotypes. These genetic loci included ZNF141 on chromosome 4p16.3, AHI1 on chromosome 6q23.3, GLI3 on chromosome 7p14.1, PAPA4 on chromosome 7q22, PAPA2 on chromosome 13q21-q32, TMEM231, ZNF423, and RPGRIP1L on chromosome 16q21.1-q23.1 and PAPA3 on chromosome 19p13.2-p13.1. However, no convincing linkage was observed to track down the diseases causing gene in family K.

Whole Exome Sequencing

After the family was excluded from linkage, DNA sample of an affected member of the family (IV-8) was used in the whole exome sequencing. Total 51892 variants were found in exome data of the patient. All the variants occurring in intronic regions, 5/UTRs and 3/UTRs or the variants that were coding synonymous were excluded. Owing to the autosomal recessive pattern of inheritance of the disorder in the family,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 98

Chapter 5 Post Axial Polydactyly downstream analysis of the whole exome data revealed four homozygous variants in four different genes including a missense mutation (c.2207C>A; p.Ala736Asp) (accession#NM_001105203.1) in RUSC1, an in-frame deletion (c.1115_1117delCCT; p.S372del) (Accession#NM_001165927.1) in MKS1 a frameshift insertion (c.547- 548dupGC; p.Val184Alafs*64) (Accession#NM_015077.2) in SARM1 and a frameshift deletion (c.272_285delACGACCGCCTGGCA; p.Asn91Ilefs*28) (Accession#NM_181539.4) in KRT26. These homozygous variants were not previously reported in public databases including EVS and dbSNP.

Sanger Sequencing

Analysis of Sanger sequencing data revealed that in consistence with the phenotypes, the only segregating variant was in-frame deletion (c.1115_1117delCCT; p.Ser372del) in the MKS1 (Table 5.3). All affected individuals (IV-2, IV-3, IV-8, IV- 9, IV-10, IV-10) were homozygous for the MKS1 mutation, while healthy family members (III-1, III-3, III-5, IV-4, IV-7) were either heterozygous for the variant or showed wild type allele (Fig. 5.6). Using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/), orthologs of MKS1 protein were crisscrossed with other species like chimpanzee, dog, gorilla, mouse and rat, and it was observed that Ser372 in the MKS1 protein is highly conserved among these species (Fig. 5.6).

In Silico Analysis of the MKS1 Protein

BLASTp searches against PDB database revealed absence of homologous sequences to MKS1 protein. Alternatively, the homology model of wild and mutant B9 domain of MKS1 protein was developed using the I-TASSER software. It was visible from visualizing the predicted model that Ser372 residue resides in the “B9” interacting region of the protein that is the only recognizable functional domain. Structural analysis revealed that p.Ser372del mutation causes alteration in the conformation of mutant protein with two extra α helixes (Fig. 5.7). This structural modulation caused by the aforementioned mutation signifies the role of that mutation in the disease pathogenesis.

Discussion

Postaxial polydactyly (PAP) is a common limb deformity that leads to dreadful cosmetic and functional complications. In addition, polydactyly manifests an

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 99

Chapter 5 Post Axial Polydactyly immediately recognizable indicator for the myriad syndromes that may be associated with this anomaly. The primary etiology of polydactyly appears to be genetic with a limited involvement of environmental factors (Biesecker, 2011). Clinical and molecular evaluation of polydactyly is an important matter in clinical medicine due to its cosmetic and functional implications (Towers and Tickle, 2009).

Genetic mapping and mutation analysis of genes involved in polydactyly can serve as a tool to investigate the molecular machinery of limb development, specifically, that of anterior-posterior specification of the limb and facilitate the dissection of the genetic and signaling pathways that underlie postaxial polydactyly (Butterfield et al., 2010). To date, six loci and only two genes (GLI3 and ZNF141) have been reported in causing non syndromic postaxial polydactyly (Radhakrishna et al., 1999; Kalsoom et al, 2013). An autosomal recessive form of PAP mapped on chromosome 13q13.3- q21.2 is still anticipated for the causative gene (Umm-e-Kalsoom et al., 2012). Moreover, postaxial polydactyly phenotypes have been reported in 36 genetically well-known syndromes including 16 (44%) related to ciliopathies group and 20 (56%) to nonciliopathies group (Verma and El-Harouni, 2015).

In this study two Pakistani consanguineous families (J, K) with nonsyndromic and syndromic postaxial polydactyly were evaluated at clinical and molecular levels. Family J with isolated postaxial polydactyly was excluded from previously known gene/loci by classical linkage analysis. Subsequently, SNP array and whole exome sequencing identified a pathogenic frameshift mutation in the KIAA0825 gene. Frameshift mutation (p.Gln198Thrfs*21) resulted in a truncated protein of just 219 amino acids which might be functionally inactive and structurally deteriorated. The effect of mutation was tested by mutation taster which revealed it to be probably pathogenic. The mutation was not found in 1000 genome and ExAc data base. The results suggested that frameshift mutation in the gene KIAA0825 was pathogenic mutation underlying non-syndromic form of postaxial polydactyly in family J.

The gene KIAA0825 is located at chromosome 5q15 (chr5:93486556-93954309) spanning 467753 base pair in size containing 19 coding exons that encodes a 1275 amino acids protein (Nagase et al., 1998; Okazaki et al., 2003; Schmutz et al., 2004). The KIAA0825 is an uncharacterized protein of unknown function. The Human Protein Atlas (http://www.proteinatlas.org/) revealed that KIAA0825 has tissue expression in liver and pancreas, digestive tract (GI-tract), male reproductive system,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 100

Chapter 5 Post Axial Polydactyly breast and female reproductive system, skin and soft tissues, bone marrows, blood and immune system and endocrine glands such as thyroid, parathyroid and adrenal. Further expression and functional studies in cell lines and animal models are required to elucidate the role of KIAA0825 in the pathogenesis of postaxial polydactyly.

Exome sequencing in family K demonstrating postaxial polydactyly, speech impairment, mild to severe hearing impairment, hypotonia, ataxia and poor growth revealed a novel in-frame deletion (c.1115_1117delCCT) in the gene MKS1, which abolishes a highly conserved residue (p.Ser372del). Pathogenicity of this variant was made more likely by the results of in silico modeling. Mutation taster (www.mutationtaster.org) revealed that p.Ser372del is a disease causing mutation with a probability score of 0.9995. The variant was not present in the 1000 genomes database (www.1000genomes.org) but was identified in two individuals in heterozygous state in The Exome Aggregation Consortium (ExAC) database (exac.broadinstitute.org, accessed February 18th 2016), resulting in an estimated allele frequency of 1.661e-05. Hence, it is indicated that this three base pair deletion in the MKS1 is the pathogenic mutation causing a mild Joubert syndrome in family K.

MKS1 (OMIM: 609883) is located on chromosome 17q22 containing 18 exons that encodes a 559 amino acids protein. MKS1 protein is localized to the basal body which is involved in the formation of the primary cilium in ciliated epithelial cells (Kyttälä et al., 2006). Mutations in MKS1 result in Meckel syndrome type 1 (MIM: 615990) (Kyttälä et al., 2006) which has some phenotypic intersections with JS including: occipital encephalocele, renal abnormalities, hepatic defects and intellectual disability (Kyttälä et al., 2006). Hypomorphic mutations in MKS1 have also been described in Bardet-Biedl syndrome type 13 (MIM: 249000) (Xing et al., 2014). Complying with our results, an analogous hypomorphic variant (p.Ser362del) in MKS1 was recently reported to cause Joubert syndrome (Romani et al., 2014), suggesting that these hypomorphic mutations in the MKS1 may give rise to more variable phenotypes through reduced functional performance of the gene.

This study has identified a novel mutation in the MKS1 that causes a mild Joubert syndrome in a consanguineous family. Thus far, two mutations have been reported in the MKS1 gene causing JS phenotypes with retinal dystrophy (Romani et al., 2014). However, the patients reported in this study demonstrated peculiar phenotypes such as deafness, short stature, dysarthria and impairment in verbal production. Moreover,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 101

Chapter 5 Post Axial Polydactyly postaxial polydactyly in the patients of family K is rare JS phenotype in general and to the other JS families having mutations in MKS1 in particular. In conclusion, a novel pathogenic variant in MKS1 was identified that causes a mild form of JS with distinctive clinical features. This study further highlighted the phenotypic variability among the patients with mutations in the MKS1.

The study, presented in this chapter, will support an international network of patients, clinicians and researchers seeking a better understanding of genetic heterogeneity of postaxial polydactyly. It extends the preexisting human genomic database and may help to develop a community-generated knowledge base that will significantly improve diagnosis, management and understanding of polydactyly and related disorders.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 102

Chapter 5 Post Axial Polydactyly

V +/+ +/+ +/+ +/+

V - +/+ +/+ +/+

- - - -

/ / / /

V - - - -

V +/+ +/ - +/+

Members of Family the Members IV +/ +/+ +/+ +/+

=Heterozygous. =Heterozygous.

Protein Protein Alteration p.Glu198Thr fs*21 p.Ser9Gly p.Ala14Val p.Met245Thr

595InA

=homozygous mutant, =homozygous +/

cDNA cDNA Position c.594 c.25T>G c.41C>T c.734T>C

Position

93856333InsT

Genomic DNA DNA Genomic

Chr5: 93856332 Chr5:

identified by WES and patterns WES by segregation family within identified their

Chr7: 84944989A>C Chr7:

Chr9: 139333831G>A Chr9: 50732742A>G Chr10:

mutations

Mutation Frameshift Missense Missense Missense

List of

Table Gene KIAA0825 RPF1 INPP5E ERCC6

Allelic representation: +/+ = homozygous wild type, wild homozygous +/+ = representation: Allelic Chromosome Chr.=

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 103

Chapter 5 Post Axial Polydactyly

Figure 5.1: Pedigree drawing of family J segregating autosomal recessive form of postaxial polydactyly. Males and females are symbolized by squares and circles, respectively. Affected individuals are indicated by black symbols. Consanguineous union is delineated by double lines between individuals. Roman numerals denote generation number and Arabic numerals represent individual members within a generation. Crossed sign over a symbol recounts deceased persons.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 104

Chapter 5 Post Axial Polydactyly

Figure 5.2: Photographs and radiographs of the hands and feet of the patients with bilateral postaxial polydactyly in the family J. Postaxial polydactyly type A in hands of affected individual (V-1) exhibiting an extra digit articulated with fifth metacarpal (a, b). Right hand of affected member (V-2) displaying postaxial polydactyly type B characterized by a rudimentary tissue tag, extending from fifth finger (c). Left hand of affected member (V-2) showing PAPA in the form of a sixth finger outspreading from the fifth metacarpal (d). Both feet of affected member (V-1) showing bilateral postaxial polydactyly type A (e). Right and left foot of affected member (V-2) showing postaxial polydactyly type A (f and g). Radiographs of hands of affected individual (V-2) showing postaxial polydactyly in right hand. The extra finger occurs in the form of a discrete digit having two phalanges. No cypher of extra digit can be observed in the left hand (h). Radiographic features of feet of patient (V-2) revealing diphalengeal extra digit articulated with fifth metatarsal in the left foot. A diphalengeal extra digit with a broad and forked is visible in the right foot (i).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 105

Chapter 5 Post Axial Polydactyly

Figure 5.3: Sequence analysis of KIAA0825 gene in individuals of family J segregating autosomal recessive postaxial polydactyly. Nucleotide sequences of KIAA0825 gene in affected individuals (V-1, V-2) showing insertion of a thymine residue between nucleotide number (g.93856332-93856333InsT), resulting in a frameshift mutation (c.594-595insA; p.Gln198Thrfs*21) (a). Nucleotides sequence of heterozygous carrier (IV-2) showing both mutant and wild type alleles (b). Wilde type DNA sequence observed in normal member of the family (V-3) and other control samples (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 106

Chapter 5 Post Axial Polydactyly

Table 5.2: Clinical information of affected individuals of family K

Individuals IV-2 IV-3 IV-8 IV-9 IV-10 IV-11

Age (in Years) 18 15 20 17 13 10

Sex Male Female Male Male Male Male

Height (in cm) 158 152 156 155 150 86

Normal Height 164 162 167 168 160 94

Hypotonia Mild Mild Sever Mild Mild Mild

Ataxia Mild Mild Sever Mild Mild Mild

Polydactyly/Camptodactyly No No Yes Yes Yes Yes

Polydactyly (Feet) No No Yes Yes Yes Yes

Speech impairment Yes Yes Mild None None None

Hearing impairment Moderate Moderate Mild None None None

Visual impairment No No No No No No

IQ Score 83 79 69 74 78 81

Molar tooth sign (MTS) NAe NA Yes NA NA NA

Blood creatinine mg/dl 0.70 1.00 0.93 1.12 0.85 0.80

Blood urea nitrogen mg/dl 13.00 16.00 13.60 12.00 12.80 13.90

Normal Height= the mean average height of that population with respect to their age and sex. Degree of hearing impairment in (dB): None (10 to 15), Slight (16 to 25),

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 107

Chapter 5 Post Axial Polydactyly

Mild (26 to 40), Moderate (41 to 55), Moderately severe (56 to 70), Severe (71 to 90), Profound (91+). N/A= Not assessed

Table 5.3: Segregation patern of mutations idetified by exome sequencing in family K

Gene KRT26 RUSC1 SARM1 MKS1

Mutation Frameshift Missense Frameshift In-frame del cDNA c.272_285delACG c.2207C>A c.547_548dupGC c.1115_1117del Position ACCGCCTGGCA CCT

Genomic Chr17: 38928082- Chr1:15529 716G>T Chr17: 26708400- Chr17: Position 38928095del 26708401insGC 56285515delAGG

Protein p.Asn91Ilefs*28 p.Ala736Asp p.Val184Alafs*64 p.S372del Position

III-1 +/+ +/+ +/+ +/-

III-3 +/+ +/+ +/+ +/-

III-5 +/- +/- +/+ +/-

IV-1 +/+ +/+ +/+ +/+

IV-2 +/+ +/+ +/+ -/-

IV-3 +/+ +/+ +/+ -/-

IV-4 +/+ -/- +/+ +/-

IV-5 +/+ +/+ +/+ +/+

IV-6 +/+ -/- +/+ +/+

IV-7 +/+ +/+ +/+ +/- Members of the the of family Members IV-8 -/- -/- -/- -/-

IV-9 +/+ +/+ +/+ -/-

IV- +/+ +/+ +/+ -/- 10

IV- +/+ +/+ +/+ -/- 11

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 108

Chapter 5 Post Axial Polydactyly

Homozygous wild type alleles = +/+, Homozygous mutant alleles= -/- and heterozygous alleles= +/-

Figure 5.4: Pedigree of the family K demonstrating autosomal mode of inheritance. Male individuals are represented by squares while females are shown by circles. Affected males and affected females are indicated by filled squares and circles, respectively. Deceased persons in the pedigree are specified by cross line over the symbol. Double line within the pedigree denotes cousin union. Roman numerals show generation and Arabic numerals show number of individuals within a generation. Asterisk (*) over a number represents the individuals who participated in this study.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 109

Chapter 5 Post Axial Polydactyly

Figure 5.5: Clinical features of the affected individuals of the family K. Hand of affected individuals (IV-8) in planer view showing post axial polydactyly, camptodactyly with inability to extend or flexion contracture of the fingers (a). Front view of the right hand of affected individual IV-8 showing camptodactyly, postaxial polydactyly with seven digits due to branching of the sixth distal phalange (b). Both hands of patient IV-8 in dorsal view with camptodactyly demonstrating bended fifth finger and synpolydactyly between fifth and sixth fingers in right hand (c). Both hands of patient IV-9 displaying postaxial polydactyly with deviated extra digit in left hand and a small sixth finger in right hand (d). Hands of patient IV-10 presenting camptodactyly and postaxial polydactyly (e). Feet of affected member (IV-9) with post axial polydactyly (f). Feet of patient (IV-8) showing post axial polydactyly in both feet (g). X-ray radiograph of both hands of patient IV-8 displaying postaxial polydactyly in both hands with fusion and tortuous sixth distal phalanx (h). MRI feature of the midbrain of patient IV-8 with a positive molar tooth sign (i).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 110

Chapter 5 Post Axial Polydactyly

Figure 5.6: Sequence analysis of novel mutation (c.1115_1117delCCT; p.Ser372del) in the MKS1 gene. The upper panel displays wild type allele in normal individuals (a). The middle panel shows homozygous deletion in affected individuals (b) while the lower panel demonstrates heterozygous carrier. The grey color in the sequencing diagram stipulates the site of mutation. Conservation of the deleted amino acid (p.372Ser) in different species (d).

Figure 5.7: In silico protein models of normal and mutated MKS1 protein. Three D structure of complete MKS1 protein (a), Normal “B9” interacting domain of MKS1 having Ser372 (b) and Mutated “B9” interacting domain of MKS1 protein showing two extra α helixes in crimson color (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 111

Chapter 6 Split Hand/Foot Malformation

SPLIT HAND FOOT MALFORMATION

Split hand foot malformation (SHFM) is a rare skeletal disorder that accounts for 8-17 % of all congenital limb deformities with the incidence of around 1/18,000-25,000 live born (Sowińska-Seidler et al., 2014). SHFM is a clinically heterogeneous condition that predominantly affects the central rays of autopod (hands and/or feet) resulting in variable phenotypes. Clinical features of SHFM include aplasia (missing digits), hypoplasia (deficiency of the phalanges, metacarpals, metatarsals) and/or syndactyly of the remaining digits. The clinical picture varies in severity from patient to patient as well between the limbs in the same individual (Duijf et al., 2003; Gurrieri and Everman, 2013; Aziz et al., 2014).

SHFM comprise a genetically diverse group of limb malformations with autosomal dominant, autosomal recessive or X-linked mode of inheritance (Gurrieri and Everman, 2013). To date, six loci associated with SHFM have been described. SHFM1 involves chromosomal rearrangements of the 7q21.3-q22.1 that encompasses several genes including DSS1, DLX5 and DLX6 (Crackower et al., 1996; Duijf et al., 2003; Shamseldin et al., 2012). SHFM2 locus was mapped on Xq26, which harbors FGF13 and TONDU genes involved in limb development (Faiyaz ul Haque et al., 1993). However, no pathogenic mutation has been reported in these genes so far. SHFM3 involves duplication of 325-570 kb region on chromosome 10q24 which is the most frequent cause of autosomal dominant SHFM that accounts for almost 20% cases of SHFM in humans (de Mollerat et al., 2003; Klopocki et al., 2012). Mutations in TP63 in the SHFM4 locus located on chromosome 3q27 have been reported in causing SHFM (Ianakiev et al., 2000). SHFM5 involves deletions of chromosome 2q31 that contains the HOXD gene cluster (HOXD1-HOXD13) (Ramer et al., 1990; Boles et al., 1995; Del Campo et al., 1999). The only autosomal recessive locus SHFM6 for non-syndromic split hand/foot malformation has been mapped to chromosome 12q13.12-q13.13 and mutations in WNT10B gene have been reported in SHFM phenotypes in several families (Ugur and Tolun 2008; Khan et al., 2012; Shamseldin et al., 2012; Aziz et al., 2014). In addition, duplication of 841kb region on chromosome 17p13.1-17p13.3 results in split hand/foot malformation with long bone deficiency (AHFMLD). Recently reported studies revealed that this chromosomal rearrangement implicates tandem duplication of the BHLHA9 gene

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 112

Chapter 6 Split Hand/Foot Malformation

(Lezirovitz et al., 2008; Klopocki et al., 2012). De novo deletion of 1 Mb region on chromosome 19p13.11 has also been reported in a single case with SHFM phenotypes (Aten et al., 2008). Importantly, reduced penetrance is another characteristic of SHFM. Many pedigrees have been described that indicate skipping of generations and extreme variability of phenotypes (Gurrieri and Everman, 2013).

In this chapter, three families (L, M, N) with autosomal recessive split hand/foot malformation were evaluated at clinical and molecular levels. Linkage mapping and mutation analysis in family L and M detected a novel variant in the WNT10B gene located on chromosome 12q13. Next generation sequencing accompanied by SNP microarray in family N identified HOXD8 as a novel gene causing autosomal recessive SHFM.

Family L

Family L segregating split hand/foot malformation in autosomal recessive pattern was collected from District Upper Dir, Khyber Pakhtunkhwa, Pakistan. This was five generation pedigree (Fig. 6.1) containing three affected individuals (IV-1, IV-4, V-2). First cousin marriages were indicated among the parents of affected individuals. After obtaining the informed consent from the patients and their parents, peripheral blood samples of six unaffected (III-1, III-2, IV-2, IV-3, IV-5, V-1) and three affected individuals (IV-1, IV-4, V-2) were collected for the present study.

Clinical Features

Affected individuals in the family showed variable phenotypes ranging from cleft hand and cleft foot deformity characterized by aplasia (absence of central digits) to hypoplasia (deficiency of the phalanges, metacarpals, and metatarsals) in hands and feet (Fig. 6.2). Hands of an affected individual (IV-1) demonstrated dysplastic cleft hand associated with camptodactyly of little finger, hypoplasia of ring finger and central ray radial deficiency in left hand. Right hand of the same affected member was normal and left foot exhibited cleft foot with central deficiency and hallux valgus deformity. Twelve years old boy (V-2) showed sever phenotypes including cleft hand deformity of central type with absence of central and index fingers. Affected individual (V-2) had cleft foot characterized by central deficiency with rudimentary bud of lesser toe. Affected members had normal skin, teeth, face, nails and eyes. Neurological and cardiovascular abnormalities were not detected.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 113

Chapter 6 Split Hand/Foot Malformation

Genetic Mapping

To test linkage in the family, genotyping was performed using microsatellite markers. Twelve STS markers (D12S1034, D12S1042, D12S87, D12S1621, D12S291, D12S1713, D12S1701, D12S339, D12S1635, D12S347, D12S368, D12S1604) flanking split hand /foot malformation locus (SHFM6) were typed using DNA samples of affected and unaffected members of the family. Affected individuals (IV- 1, IV-4, V-2) showed homozygous and unaffected (III-1, III-2, VI-2, VI-3,VI-5, V-1) heterozygous pattern of alleles with six markers (D12S1621, D12S291, D12S1701, D12S339, D12S347, D12S1604). Haplotype analysis established linkage in the family to SHFM6 on chromosome 12q11-q13 (Fig. 6.3).

Mutation Analysis

SHFM6 on chromosome 12q13.11-q13 encompasses WNT10B gene that was previously reported causing SHFM phenotype (Ugur and Tolun, 2008). All coding exons and intron-exon boundaries of the WNT10B gene were sequenced in all affected and unaffected members of the family. Sequence analysis identified a frameshift mutation characterized by seven base pairs duplication (c.300-306dupAGGGCGG) in exon-3 of the WNT10B gene. Duplication of seven nucleotides (c.300- 306dupAGGGCGG) in exon-3 of WNT10B resulted in substitution of amino acid residue leucine (Leu103) by arginine followed by a premature chain termination 52 amino acids downstream (p.Leu103Argfs*53). The mutation was found homozygous in all affected individuals (IV-1, IV-4, V-2) and heterozygous in the obligate carriers (III-1, III-2, IV-5, V-1) of the family. Other unaffected individuals (IV-2, IV-3) had wild type alleles (Fig. 6.4).

Family M

Family M showing autosomal recessive inheritance pattern of cleft foot was recruited from Kohistan valley in District Upper Dir, KPK, Pakistan. This consanguineous family had two affected members (V-1, IV-2) in the fifth generation of the pedigree (6.5). ). Parents of affected individuals were phenotypically normal and their affected children were born of normal pregnancies. Peripheral blood samples of two affected (V-1, V-2) and three unaffected individuals (IV-1, IV-3, V-3) were collected for the present study.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 114

Chapter 6 Split Hand/Foot Malformation

Clinical Features

There were two affected members in the family including a girl (V-1) and a boy (V-2) aged 10 and 13 years, respectively. They manifested with typical deeper notch in the feet. However, hands of both affected members appeared normal and features representing ectrodactyly, syndactyly dysplasia of phalanges and metacarpals were not observed in their hands. An affected individual (V-1) exhibited dysplastic central ray with ectrodactyly and syndactyly in his feet. Another affected member (V-2) displayed bilateral cleft feet with associated toes and metatarsal bone hypoplasia (Fig. 6.6).

Homozygosity Mapping and Mutation Analysis

DNA samples of two affected (V-1, V-2) and three unaffected individuals (IV-1, IV- 3, V-3) of the family were subjected to homozygosity mapping. Using microsatellite markers (D12S2196, D12S339, D12S1635, D12S347, D12S1677, D12S297, D12S368, D12S270, D12S96) linkage in the family was established to SHFM6 locus on chromosome 12q13.11-q13. Haplotypes analysis revealed that linkage interval was flanked by STS marker D12S1635 and D12S270, encompassing a 1.7MB homozygous region on chromosome 12q13.12-q13.13. Both affected individuals (V- 1, V-2) of the family showed homozygous pattern of alleles while unaffected members (IV-1, IV-3, V-3) heterozygous for the SHFM6 locus (Fig. 6.7).

Homozygous region on chromosome 12q13.12-q13.13 encompassed WNT10B gene which was previously reported in split hand foot malformation. All coding exons of the WNT10B including exon-intron boundaries were sequenced in the available members of the family. Subsequent sequence analysis revealed a frameshift mutation (c.300-306dupAGGGCGG; p. Leu103Argfs*52) in exon-3 of the WNT10B (Fig. 6.8).

In Silico Structural Analysis

Normal protein sequence of WNT10B was retrieved from Ensemble genome browser (http://asia.ensembl.org/Homo_sapiens/) and subjected to BLAST search against PDB (Protein Data Bank) database for suitable template search. Using Xenopus levis WNT8 structure (PDB ID: 4F0A) as a template, 3D structures of the normal WNT10B and mutated WNT10B proteins resulted from (p.Leu103Argfs*52) were predicted by Molecular Operating Environment (MOE, Montreal, PQ, Canada; www.chemcomp.com) through structure-based design approach. The structures were

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 115

Chapter 6 Split Hand/Foot Malformation visualized by PSILO® (www.chemcomp.com). Structural analysis revealed that frameshift mutation (c.300-306dupAGGGCGG; p.Leu103Argfs*53) resulted in a truncated WNT10B protein that was 253 amino acids shorter than the normal WNT10B protein. The mutant protein lacks four β sheets, α helixes and loop structures (Fig. 6.9). This protein truncation may obstruct its engagement with Frizzled receptor.

Family N

Family N, segregating split hand/foot malformation in an autosomal recessive manner, was ascertained from Frontier Region (FR) in District Bannu, Khyber Pakhtunkhwa, Pakistan. This was a large consanguineous family comprising of forty seven individuals including thirteen affected. A trend of cousin marriages was common among the family members. In this six generation pedigree, consanguinity was reiterated five times. At least two affected individuals were reported from each cousin marriage (Fig. 6.10).

Peripheral blood samples of nine affected (V-8, V-10, V-12, V-13, V-15, VI-2, VI-5, VI-6, VI-8) and seven unaffected individuals (IV-5, V-1, V-6, V-9, VI-3, VI-7, VI-9) were collected for molecular characterization.

Clinical Features

Affected individuals in the family exhibited variable phenotypes of split hand/foot malformation. Hands were more affected than feet in the affected individuals. Three affected members (V-8, V-12, V-15) manifested with cleft hand deformity characterized by ectrodactyly, syndactyly, clinodactyly and camptodactyly of variable degree. An affected member (VI-6) exhibited complete syndactyly II–V characterized by fusion of the distal phalanges in the right hand. Left hand of the same affected member was short of middle finger in addition to presence of syndactyly III-V. Another affected member (V-13) presented syndactyly III/IV and clinodactyly V in both hands. Feet of still another affected member (V-7) demonstrated wide space between big toe and second toe in addition presence of syndactyly in the remaining toes. He exhibited comparatively long big toe and syndactyly between fourth and fifth toes. X-ray of left hand of the patient (V-7) showed twisted distal phalanges in middle finger and ring finger. Radiographic features of an affected member (V-8) revealed transverse phalanges of the middle finger and ring finger of the right hand and oblique

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 116

Chapter 6 Split Hand/Foot Malformation middle and distal phalange in ring finger and absence of distal phalange in middle finger of the left hand. X-ray of right hand of the patient (VI-6) showed crosswise phalange in the ring finger and middle finger. Radiograph of the left foot of another patient (V-12) revealed marked hallux valgus deformity in the big toe and fusion of the distal phalanges of second and third toes. Moreover, loose and redundant skin was observed on the hands of two affected members (V-7, V-15). All the affected members had normal intelligence, speaking and hearing. Cardiac, renal or ophthalmological abnormalities were not observed in any affected member (Fig. 6.11).

Exclusion Mapping

In the family, genomic DNA of nine affected (V-8, V-10, V-12, V-13, V-15, VI-2, VI-5, VI-6, VI-8) and seven unaffected individuals (IV-5, V-1, V-6, V-9, VI-3, VI-7, VI-9) was used in genotyping using microsatellite markers flanking the previously reported SHFM genes/loci.

Linkage in the family was tested by typing eight markers (D7S524, D7S644, D7S630, D7S627, D7S646, D7S1820, D7S2482, D7S554) flanking SHFM1 on chromosome 7q21, eight markers (D10S547, D10S571, D10S1758, D10S198, D10S1265, D10S1239, D10S1268, D10S254) linked to SHFM3 on chromosome 10q24, seven markers (D3S1602, D3S2436, D3S2398, D3S2747, D3S3054, D3S2455, D3S3043) against SHFM4 on chromosome 3q27, twelve markers (D2S399, D2S1281, D2S376, D2S2302, D2S326, D2S1274, D2S2307, D2S2257, D2S2981, D2S138, D2S2173, D2S324) linked to SHFM5 on chromosome 2q31 and six markers (D12S1621, D12S291, D12S1701, D12S339, D12S347, D12S1604) flanking SHFM6 on chromosome 12q11-q13. In addition, three genetic loci reported in split hand/foot malformation with long bone deficiency (SHFLD) were also targeted for linkage in the family. Highly polymorphic microsatellite markers (D1S2800, D1S1540, D1S2712, D1S2649, D1S235, D1S2680, D1S2850) were used to check linkage at SHFLD1 on chromosome 1q42.2‑q43. Twelve markers (D6S280, D6S1596, D6S1659, D6S456, D6S1031, D6S284, D6S460, D6S1707, D6S968, D6S445, D6S1609, D6S1627) used for testing linkage at SHFLD2 on chromosome 6q14.1 and six markers (D17S596, D17S1529, D17S2181, D17S654, D17S831, D17S1528) for SHFLD3 on chromosome 17p13.3‑p13.1. However, typing markers failed to detect linkage in the family.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 117

Chapter 6 Split Hand/Foot Malformation

Whole Exome Sequencing and Microarray Analysis

After excluding linkage in the family to previously reported genes causing SHFM, DNA of an affected member (VI-2) was used in whole exome sequencing (WES) at Leiden University Medical Center (LUMC), Leiden, The Netherlands. It is pertinent to mention here that I have spent six months at this center and was involved in analysis of the data generated by exome sequencing. Analysis of the exome data revealed total 48,576 variants in DNA of the proband. The variants present in the intronic regions, 5/UTRs and 3/UTRs and those representing synonymous sequences were excluded. This reduced the variants to 1248 for further analysis. In an additional filtering step, all variants reported previously with a frequency above 0.001 in in- house database (e.g., the 1000 genomes project, the Exome Variant Server) were removed. The remaining 607 variants including nonsense, missense, splice-site, and indel variants that were homozygous for the minor alleles were even handedly screened for quality and against public variant databases. Before filtering out heterozygous variants, all the previously reported SHFM genes were thoroughly screened for either homozygous or heterozygous variants. Hence, the possibility of compound heterozygous mutation was assertively excluded. Owing to the autosomal recessive mode of inheritance of the disorder in the family, thirty eight potentially functional homozygous variants were selected for further analysis.

To identify the disease causing variants, microarray analysis was performed using DNA of two affected members (V-12, VI-5) of the family N. They shared three homozygous regions including 6.5Mb on chromosome 2q31.1-q31.3 (Fig. 6.12), 0.3Mb on chromosome 4p16.1, 0.33 Mb on chromosome 13q22.1-q22.3. Filtering the exome data, three possibly pathogenic variants in the common homozygous region on chromosome 2q31.1-q31.3 were found. These variants included an inframe duplication (c.217-222dupCACCCG; p.His73_Pro74dup) in HOXD8 (Accession# NM_019558.3), a missense variant (c.370C>T, p.Pro124Ser) in HOXD9 (Accession#NM_014213.3), and a frameshift variant (c.203-204insA (p.Ala69Glyfs*13) in HOXD13 (Accession#NM_000523.3).

Segregation Analysis by Sanger Sequencing

Segregation of the three variants (c.217-222dupCACCCG; p.His73_Pro74dup) in HOXD8, (c.370C>T, p.Pro124Ser) in HOXD9 and (c.203-204insA (p.Ala69Glyfs*13)

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 118

Chapter 6 Split Hand/Foot Malformation in HOXD13 was validated by Sanger sequencing (Tab. 6.1). Analysis of the sequence data revealed that the frameshift variant (c.203_204insA; p.Ala69Glyfs*13) in HOXD13 represented a synonymous substitution (c.204G>A; p.Ala68Ala) and not an insertion. This polymorphism in HOXD13 was found present in homozygous state in six affected (V-8, V-10, VI-2, VI-5, VI-6, VI-8) and five unaffected individuals (V-6, V-9, VI-3, VI-7, VI-9), heterozygous in an affected individual (IV-5). Four other affected individuals (V-9, V-12, V-13, V-15) showed wild type sequence. Missense variant (c.370C>T; p.Pro124Ser) in HOXD9 was randomly segregating within the family. In seven affected members (V-10, V-12, V-13, VI-2, VI-5, VI-6, VI-8) this variants was homozygous and in two affected (V-8, V-15) and four unaffected members (V-6, VI-3, VI-7, VI-9) it was heterozygous. In two potential carrier (IV-5, V-1) and a healthy individual (V-9) the missense variant was not present. The only variant that was segregating within the family according to the phenotypes was the inframe duplication (c.217-222dupCACCCG; p.His73-Pro74dup) in the HOXD8 gene. It was found homozygous in all affected members (V-8, V-10, V-12, V-13, V- 15, VI-2, VI-5, VI-6, VI-8) of the family and heterozygous in carriers (IV-5, V-1, V- 6, VI-3, VI-7, VI-9). The variant was found missing in a normal individual (V-9) (Fig. 6.13). The variant was not found in 100 ethnically matched control samples. On the basis of these results, it was concluded that inframe duplication (c.217- 222dupCACCCG; p.His73-Pro74dup) in the HOXD8 gene might be involved in the pathogenesis of SHFM in the family N.

Discussion

Split-hand/foot malformation (SHFM) is a clinically diverse and genetically heterogeneous limb malformation that generally affects central rays of the autopod (hands/feet). SHFM can occur as isolated trait or a part of isolated limb anomaly or as a part of syndromes. Generally, SHFM occurs as a sporadic genetic disorder without any family history or genetic defects in the parents (Everman et al., 2006; Sowińska- Seidler et al., 2014). Clinically, the disease severity ranges from simple syndactyly to severe cleft hands and cleft feet characterized by aplasia or hypoplasia of carpals/metacarpals, tarsals/metatarsals and phalangeal bones (Gurrieri and Everman, 2013). Usually, SHFM is confined to the hands/feet, but in some severe cases other parts of the limbs are also involved mainly affecting the tibia and fibula. This

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 119

Chapter 6 Split Hand/Foot Malformation condition is referred to as split hand/foot malformation with long bone deficiency (SHFLD) (Naveed et al., 2006; Klopocki et al., 2014).

Hereditary split hand/foot malformation generally shows autosomal dominant mode of inheritance with reduced penetrance while autosomal recessive and X-linked SHFM are very rare (Sowińska-Seidler et al., 2014). To date, six chromosomal loci associated with isolated SHFM have been described including SHFM1 on 7q21 (Scherer et al., 1994), SHFM2 on Xq32 (Faiyaz ul Haque et al., 1993), SHFM3 on 10q24 (Nunes et al., 195; Gurrieri et al., 1996;), SHFM4 on 3q27 (Ianakiev et al., 2000), SHFM5 on 2q31 (Boles et al., 1995), and SHFM6 on 12q13.11-q13 (Ugur and Tolun, 2008). In addition, three genetic loci have been identified for SHFLD which include SHFLD1 on chromosome 1q42.2‑q43, SHFLD2 on 6q14.1 (Naveed et al., 2007) and SHFLD3 on 17p13.1‑17p.13.3 (Lezirovi et al., 2008).

For the six loci, only three causative genes including DLX5 (MIM 00028) for SHFM1 (Shamseldin et al., 2012), TP63 (tumor protein p63, MIM 603273) for SHFM4 (Ianakiev et al., 2000), and wingless-type MMTV integration site family, member 10B (WNT10B, MIM 601906) for autosomal recessive SHFM6 (Ugur and Tolun, 2008) have been identified. Klopocki et al. (2012) reported that duplication of BHLHA9 gene on chromosome 17p13.3 is associated with SHFLD3.

In the present study three consanguineous families of Pakistani origin (L, M, N), segregating split hand/foot malformation in an autosomal recessive pattern, were evaluated at clinical and molecular levels. A wide range of phenotypic diversity was observed among affected individuals of these families. Variable clinical features were noted in affected individuals in the same family as well. Varied degree of malformations was observed in the left and right hand or foot in the same individual. For instance, an affected member (IV-1) in the family L showed dysplastic cleft hand associated with camptodactyly of little finger, hypoplasia of ring finger and central ray radial deficiency in left hand. Left foot in the same individual exhibited cleft foot with central deficiency and hallux valgus deformity. Amazingly, right hand and foot exhibited normal anatomic features. On the other hand, another affected individual (V-2) in the family L showed severe cleft hand and cleft foot deformity of central type with missing central digits in both hands and feet (Fig. 6.1). In affected individuals of family M, only feet were affected and hands were normal. Clinical features of

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 120

Chapter 6 Split Hand/Foot Malformation affected individuals in family N were quite distinct from those observed in other two families (L and M).

Homozygosity mapping using STS markers established linkage in two families (L and M) at SHFM6 on chromosome 12q13.11-q13, which is the only known locus for autosomal recessive form of SHFM. The SHFM6 on chromosome 12q13.11-q13 encompasses WNT10B gene that was previously reported causing SHFM phenotype (Ugur and Tolun, 2008). Recently, Shamseldin et al. (2012) reported a family with autosomal recessive form of SFHM caused by a mutation in DLX5 gene located on chromosome 7q21 (SHFM1). Homozygosity mapping in family N did not show linkage to the previously known SHFM loci (SHFM1, SHFM3-SHFM6) and SHFLD loci (SHFLD1-SHFLD3).

Sequence analysis of the WNT10B gene in family L and M revealed a novel frameshift mutation (c.300-306dupAGGGCGG; p.Leu103Argfs*53). The same mutation was detected in another family by a colleague in the laboratory. All the three families were recruited from a remote area in Upper Dir, KPK, Pakistan. Although, no close relationship among the three families was observed but the possibility cannot be ruled out that they have descended from a founder population which had maintained genetic idiosyncrasies over multiple generations. Affected individuals from the same populations are characteristically homozygous for the founder mutations (Arcos- Burgos and Muenke, 2002). Persuasively, pathogenic founder mutations occur at comparatively high rates in these populations due to the effects of random genetic drift following the founding tailback (Chong et al., 2012).

The gene WNT10B is a member of WNT gene family, which contains at least 18 other genes. Proteins encoded by these genes bind cell surface frizzled (FZ) and low- density lipoprotein receptor-related proteins resulting in activation of a conserved canonical signaling pathway (Peifer and Polakis, 2000). WNT proteins such as Wnt6, Wnt10a and Wnt10b, proteins act as ligands in several signaling pathways implicated in morphogenesis of the developing limb (Yang 2003; Cawthorn et al., 2012). To date, five disease causing mutations have been identified in WNT10B underlying SHFM6 phenotypes (Ugur and Tolun, 2008; Blattner et al., 2010; Khan et al., 2012; Aziz et al., 2014). Notably, the first pathogenic mutation (p.Arg332Trp) in the WNT10B gene reported by Ugur and Tolun (2008) was prevailing in one normal member of the same family which led the assumptions of the coexistence of another

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 121

Chapter 6 Split Hand/Foot Malformation locus that contributes to the phenotype or the presence of a suppressor mutation in the unaffected individual.

Different clinical features produced by the same frameshift mutation (p.Leu103Argfs*53) in affected individuals of the two families (L and M) call attention to phenotypic variability of SHFM. In most of autosomal dominant cases of SHFM the phenomenon of incomplete penetrance has been described. Wang et al. (2014) reported a chines family with autosomal dominant SHFM in which affected individuals demonstrated cleft foot deformity with normal hands. Wide-ranging of clinical features produced by a single mutation may involve several factors such as reduced penetrance, the role of modifier genes, influence of additional allelic variants and epigenetic mechanisms (Cooper et al., 2013).

After excluding linkage to the putative SHFM loci in family N, exome sequencing and microarray analysis detected three potential variants [(c.217-222dupCACCCG; p.His73_Pro74dup) in HOXD8, (c.370C>T, p.Pro124Ser) in HOXD9, and (c.203- 204insA; p.Ala69Glyfs*13) in HOXD13]. Mutations validation and segregation analysis by Sanger sequencing revealed that the only variant that was consistently segregating with phenotypes across the family was inframe duplication (c.217- 222dupCACCCG; p.His73_Pro74dup) in HOXD8. All affected members of the family carried the mutation in homozygous states while healthy individuals showed either heterozygous or wild type alleles. These findings suggest that inframe duplication (c.217_222dupCACCCG; p.His73_Pro74dup) in HOXD8 gene might be disease causing mutation involved in the pathogenesis of SHFM in family N. The occurrence of variants in HOXD9 and HOXD13 may have no effect on the protein’s activity or may be synergistically involved in the disease causing mechanism with HOXD8. The phenotypic variability among the individuals in the same family also suggests that mutations in the other genes may influence the pathogenesis of a disease causing mutation.

Previously, an autosomal dominant locus for split hand-foot malformation SHFM5 was mapped on chromosome 2q31 that involved the deletion of chromosome 2q24- q31 (Boles et al., 1995). This deletion wiped away the entire HOXD gene cluster (HOXD1-HOXD13) leading to split hand foot malformation phenotypes (Del Campo et al., 1999).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 122

Chapter 6 Split Hand/Foot Malformation

Human HOX genes encode a family of transcription factors that are involved in body patterning during embryonic development (Krumlauf, 1994; Kmita and Duboule, 2003). HOXD genes play a very important role in the early development of vertebrae limbs and defects in these genes are associated with a number of limb deformities (Kmita et al., 2005; Zakany and Duboule, 2007). During early phase of limb budding, telomeric enhancers are recruited to enhance expression of central HOXD genes (HOXD1-HOXD11), which regulate development of the proximal parts of the limb including future arm and forearm (Tarchini and Duboule, 2006; Andrey et al., 2013). Afterwards, HOXD8-HOXD13 transcribe in the distal domain of the limb bud, which trigger the emergence of distal limb segments eventually give rise to digits (Montavon et al., 2008; Woltering and Duboule, 2010). Based on these reported supporting evidences, it can be convincingly suggested that inframe duplication (c.217_222dupCACCCG; p.His73_Pro74dup) detected in the HOXD8 gene is responsible for causing SHFM in the family N. Functional studies are in progress to verify the effect of the mutation on limb development.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 123

Chapter 6 Split Hand/Foot Malformation

Table 6.1: Segregation pattern of mutations detected by whole exome sequencing in HOXD8, HOXD9 and HOXD13 in family N

Members Phenotypes HOXD8 HOXD9 HOXD13

(c.217_222dupCACCCG) (c.370C>T) (c.204G>A)

IV-5 Normal +/- +/+ +/-

V-1 Normal +/- +/+ +/+

V-10 SHFM -/- -/- +/+

V-12 SHFM -/- -/- +/+

V-13 SHFM -/- -/- -/-

V-15 SHFM -/- +/- +/-

V-6 Normal +/- +/- -/-

V-8 SHFM -/- +/- -/-

V-9 Normal +/+ +/+ -/-

VI-2 SHFM -/- -/- -/-

VI-3 Normal +/- +/- -/-

VI-5 SHFM -/- -/- -/-

VI-7 Normal +/- +/- -/-

VI-7 SHFM -/- -/- -/-

VI-8 SHFM -/- -/- -/-

VI-9 Normal +/- +/- -/-

SHFM= Split hand/foot malformation, +/+= homozygous wild type alleles, -/-= homozygous mutant alleles, +/-=hetrozygous alleles

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 124

Chapter 6 Split Hand/Foot Malformation

Figure 6.1: Pedigree drawing of family L segregating autosomal rcessive split hand/foot malformation. Males and females are indicated by squares and circles, respectively. Affected individuals are shown by filled symbols. Roman numerals specified generation number and Arabic numerals showed indviduals in a generation. Cousin marraiges are represented by double lines between individuals.

Figure 6.2: Clinical features of affected members in family L. Hands of an affected member (VI-4) showing dysplastic cleft hand associated with camptodactyly of little finger, hypoplasia of ring finger and central ray radial deficiency (a, b). Patient (IV-4) demonstrating cleft foot with central deficiency and hallux valgus deformity (c). Cleft hand deformity of central type with absence of central and index fingers in the right hand and cleft left hand deformity associated with absence of index and middle fingers and thumb adduction in patient V-2 (c). Patient V-2 showing cleft foot characterized by central deficiency with rudimentary bud of lesser toe (d).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 125

Chapter 6 Split Hand/Foot Malformation

Figure 6.3: Haplotype of family L at SHFM6 locus on chromosome 12q13.12. The shaded black alleles represent risk haplotype,while the alleles shown in white are not co-segregating with the disease. Genetic distances in centi-Morgans (cM) are according to the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 6.4: Nucleotied sequence of exon 3 of WNT10B gene in the family L. The upper panel represents homozygous frameshift mutation (c.300-306dupAGGGCGG) in affected individuals (a). The middle pannel shows sequence of heterozygous carriers having both mutant and normal alleles (b). Nucleotide sequence in normal inviduals is shown in the lower pannel having wild type sequence (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 126

Chapter 6 Split Hand/Foot Malformation

Figure 6.5: Pedigree diagram of family M segregating SHFM in an autsomoal recessive manner. The squares represent male individulas and spheres represent female individuals while filled symbols specify affected individuals. Double lines within a generation show consanguinous marriage. Roman numerals indicate generation numbers and Arabic numerals describe individuals in a specific generation.

Figure 6.6: Clinical features observed in affeceted individuals of family M. Feet of an affected individual (V-1) demonstraring marked cleft foot and syndactyly between second and third as well as absence of fourth and fifth digit (a, b). Cleft foot characterized by central deficiency with rudimentary bud of lesser toe in patient V-2.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 127

Chapter 6 Split Hand/Foot Malformation

Figure 6.7: Haplotypes generated by typing markers in family M pattern of SHFM6 locus. The risk haplotypes are represented by shaded black alleles while the alleles not co-segregating with the disease are shown in white. Genetic distances in centi- Morgans (cM) are according to the Rutgers combined linkage-physical map (Build 36.2) (Matise et al., 2007).

Figure 6.8: Nucleotied sequence of exon 3 of WNT10B gene demonstrating segregation of frameshift mutation (c.300-306dupAGGGCGG) in family M. The upper panel represents homozygous mutant alleles in affected individuals (a). The middle pannel shows sequence in heterozygous carriers (b). Nucleotide sequence in normal inviduals is shown in the lower pannel having wild type sequence (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 128

Chapter 6 Split Hand/Foot Malformation

Figure 6.9: In silico modeling and conservation analysis of frameshift mutation (p. Leu103Argfs*52) in WNT10B protein. Truncated protein resulted from (p. Leu103Argfs*52) mutation lacking 255 amino acids (a). Normal WNT10B protein (b). The maroon color ribbons demonstrate α helixes and red strips show β sheets while loops are represented by blue coils.

Conservation of amino acid residue leusine103 in human and other species. Normal amino acids are highlighted in green while mutated R is shown in red color (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 129

Chapter 6 Split Hand/Foot Malformation

Figure 6.10: Pedigree drawing of family N segregating split hand/foot malaformation in an autsomal recessive pattern. The disease appears for the first time in fourth generation and number of affected individuals increases in succeeding generations. Double lines between individuals in a generation shows that consangiuinty occured five times within the family. Filled squares and spheres show that males and females are equally affected. Asteric sign with the individuals represent persons whose blood samples were collected for the present study.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 130

Chapter 6 Split Hand/Foot Malformation

Figure 6.11: Phenotypes of affected individuals in family N. Hands of patient V-15 demonstrating cleft hands with deviated thumb and index finger in both hands as well as syndactyly between the remaining three fingers in right hand and absence of digit III-IV in left hand with loose and redundant skin on hands (a). Hands of patient V-12 demonstrating cleft hands characterized by deviated index finger and clinodactyly with syndactyly of the remaining fingers (b). Hands of patient V-13, in dorsal view, showing syndactyly III/IV and clinodactyly V in both hands (c). Hands of patient V-8 showing cleft hands characterized by deviated thumb and index fingers with clinodactyly and syndactyly of the other three digits (d). Hands of patient VI-6 showing complete syndactyly of type II–V with bony fusion of the distal phalanges in the right hand and absence of middle finger and syndactyly in the left hand with loose, redundant skin on hands (e). Feet of patient V-8 showing comparatively long big toe and syndactyly between fourth and fifth toe (f). Feet of patient (V-7) showing wide space between big toe and second toe in addition with syndactyly in the remaining toes (g). Radiographs of hands of patient (V-8) showing transverse phalanges of the middle finger and ring finger of the right hand and oblique middle and distal phalange in ring finger and absence of distal phalange in middle finger (h, i). Radiograph of left hand of patient (V-7) showing twisted distal phalanges in middle and ring fingers (j). X-ray of right hand of patient (VI-6) showing crosswise phalange in the ring finger and middle finger (k). Radiograph of the left foot of patient (V-12) showing marked hallux valgus deformity in the big toe and fusion of the distal phalanges of second and third toe (l). Right foot of patient V-12 demonstrating clinodactyly (m).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 131

Chapter 6 Split Hand/Foot Malformation

Figure 6.12: Ideogram of chromosome 2 displaying the genetic contents of homozygous region on 2q31.1-q31.3 identified by SNP array in family N. There were 35 genes in the homozygous region. HOXD gene cluster is highlighted by pink color while HOXD13, HOXD9 and HOXD8 are bold in which possibly functional variants were detected.

Figure 6.13: Partial DNA sequence of the HOXD8 gene showing six nucleotides duplication (c.217-222dupCACCCG) in family N. Nucleotide sequence in affected individuals having homozygous (c.217-222dupCACCCG) duplication (a). Heterozygous carriers with both mutant and normal alleles (b). Wild type sequence in one normal individual (V-9) of family N (c).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 132

Chapter 7 Conclusion

CONCLUSION

Hereditary skeletal disorders comprise a genetically heterogeneous and clinically diverse group of conditions characterized by abnormal growth, shape, or integrity of bones and cartilage. Severity of hereditary skeletal disorders ranges from neonatal lethality to mild short stature. Hereditary skeletal disorders arise from conflicts in the complex processes of skeletal development, growth and homeostasis that can be inherited as autosomal dominant, autosomal recessive or X-linked disorders (McCarthy, 2011; Warman et al., 2011).

Hereditary skeletal disorders are reasonably common with a prevalence rate of 1/5,000 live births worldwide (Rasmussen et al., 1996; Unger, 2002). Autosomal recessive forms of skeletal disorders are quite frequent in consanguineous families. It is estimated that the risk for autosomal recessive disorders increases by 1.7-2.8% in the offspring from first cousins (Bennett et al., 2002). Consanguineous marriages, particularly first-cousin marriages are very common in Pakistan. According to Pakistan Demographic and Health Survey (PDHS, 2014) more than half of all marriages (56-61%) are between first cousins. For that reason, recessive genetic disorders are common in Pakistan due to the high rate of consanguinity. It is estimated that almost 700 children are born with genetic disabilities due to cousin marriages every year in Pakistan (Khan, 2015). The trends of cousin marriages are common in Pakistani population due to ethnic, religious, cultural and tribal diversities among different communities (Hamamy et al., 2011; Schulpen et al., 2006). After all, cousin marriages are favored due to higher compatibility between husband and wife as well as their family members because they share several social and economic links before and after marriage. In this way, marrying within the family strengthens family ties and sustains family solidarity (Sandridge et al., 2010). In addition, premarital negotiations are conducted more easily and comparatively less costly. Sometimes, cousin marriages are favored to maintain the kindred legitimacy and integrate the property within the family (Hamamy and Bittles 2008; Hamamy, 2012).

Skeletal disorders represent a wide range of phenotypic heterogeneity and remain a diagnostic challenge because of their variety. A collaborative analysis of clinical, radiological, and molecular genetic findings is often necessary to refine diagnosis of skeletal disorders. Molecular assessment of genetic skeletal disorders is even more

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 133

Chapter 7 Conclusion challenging as mutations in a single gene can cause several phenotypes. In contrast, a similar phenotype can be caused by mutations of different genes (Jackson et al., 2012; Kannu et al., 2012).

The standard procedure for proper diagnosis of skeletal disorders implicates a focused history taking about the onset time of the disease, prenatal history of the patient and complete history of the family to assess the inheritance pattern of the disease. After that, a careful physical examination of growth parameters such as height, weight, and head circumference in addition with auxiliary signs such as craniofacial dysmorphism, joints laxity, chest and vertebral abnormalities can narrow down the spectrum of possible diseases. Moreover, laboratory data such as blood and urine tests and assessments of other clinical parameters such as vision, hearing, hair, nail and skin are also important for evaluating skeletal disorders (Cho and Jin, 2015). In the next step, an intensive radiographic analysis can assist in differential diagnosis of skeletal disorders as most of the diseases have distinctive radiological features in growing bones and cartilages. Finally, molecular genetic testing by identification of disease causing gene and mutations is often necessary to refine diagnosis because there are so many conditions with multifarious phenotypes and various dissimilarities even in the same disease (Ikegawa, 2006). Genetic diagnosis of skeletal disorders is important to figure out the disease pathogenesis, expected complications, and to allow specific genetic counseling. Due to complex phenotypes associated with several skeletal disorders, a multidisciplinary approach is required with step by step clinical, physical, radiological and molecular examinations to reach an exact diagnosis of skeletal disorders.

The present study was aimed to identify the candidate genes and pathogenic sequence variants causing hereditary skeletal disorders in Pakistani families. The main purpose of the study was to establish a genotypic and phenotypic co-relation of congenital bone disorders by investigating the disease pathogenesis at molecular level. In total, fourteen families (A-N) with different types of skeletal disorders were incorporated in this study.

Affected individuals in six families (A-F) exhibited clinical features of mucopolysaccharidosis (Morquio syndrome) with autosomal recessive mode of inheritance. First cousin marriages were observed among the parents of affected individuals in all the six families. Complying with the phenotypes, linkage in six

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 134

Chapter 7 Conclusion families was established to the GALNS gene on chromosome 16q24.3. Sequence analysis of GALNS detected a previously reported missense mutation (c.1259C>G; p.Pro420Arg) in two families (A and B), a missense mutation (c.1156C>T, p.Arg386Cys) in family C and a novel missense mutation (c.647T>C; p.Phe216Ser) in family D. Sanger sequencing analysis of the GALNS revealed a novel frameshift mutation (c.360-361InsA; p.Glu121Argfs*37) in two families (E and F). Affected individuals in family E and F demonstrated severe phenotypes of Morquio syndrome (MPS IVA) with apparent intellectual disability. Being a purely skeletal disorder, neurological involvement is very rare in Morquio A syndrome but in few cases of MPS IVA, intellectual disability has been reported (Davison et al., 2013). These results suggest that intellectual disability in affected individuals of family E and family F may be caused by severe spinal involvement due to extensive loss of function frameshift mutation.

Although, frameshift mutations have a solid impact on GALNS protein, but interpretation of missense mutations on protein’s activity is quite challenging (Tomatsu et al., 2005; Hendriksz et al., 2013). In silico modeling assists in structural and functional elucidation of proteins to determine the effect of mutations on the protein structure and thus its link with disease, because function of a protein is critically dependent on a well-defined conformation (Dunker et al., 2002). In silico analysis of missense mutations reported in this study revealed that these mutations resulted either in the formation of additional intramolecular interactions or loss of preexisting intramolecular interactions in GALNS protein. Eventually, an increase or decrease in potential energy was observed in the mutant GALNS protein equaled to normal GALNS. These results demonstrated that increase or decrease in potential energy of the GALNS protein is directly proportional to the number of intramolecular interactions. An increase in potential energy is an indication of protein stability and decrease in potential energy signifies an unstable protein. However, together with the stability of a protein, a proper flexibility is equally important for normal functioning of a protein (Karplus and Kuriyan, 2005; Zhang et al., 2010). Molecular docking analysis was performed to investigate the effects of missense mutations on the ligand binding affinity of the GALNS protein. Docking score was calculated by number of rotatable bonds within the protein. A greater number of rotatable bonds resulted in a high docking score signifying loose intermolecular interaction between GALNS

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 135

Chapter 7 Conclusion protein and its ligand. Inconsistencies in binding affinities of mutated proteins be a sign of geometrical constrains and/or energetic effects caused by missense mutations (Akhavan et al., 2005; Jones et al., 2007).

In three consanguineous families (G-I) with short limb short stature, three novel missense mutations (p.Arg749Trp, p.Arg6016Ser, p.Leu314Arg) were identified in the NPR2 gene confirming molecular diagnosis of autosomal recessive acromesomelic dysplasia Maroteaux type (AMDM). But prior to genetic analysis, complete family history in addition with clinical and radiological examinations of affected individuals in three families were accomplished. The protein product of NPR2 gene (natriuretic peptide receptor B) is a receptor for C-type natriuretic peptide (CNP). The CNP and its receptor NPRB are recognized as important regulators of longitudinal growth that are implicated in endochondral ossification (Yasoda et al., 1998; Teixeira et al., 2008). In brief, NPC/NPR-B system plays a key role in normal growth and growth disorders. Apart from AMDM caused by homozygous mutations in NPR2, heterozygous NPR2 mutations are involved in idiopathic short stature. In addition, gain of function mutations in the NPR2 gene have been reported in overgrowth syndrome and tall stature (Hannema et al., 2013; Miura et al., 2014). Novel mutations identified in two families with AMDM phenotypes in this study will improve the existing information to indicate NPR2 molecular-genetic screening in patients AMDM.

Affected individuals in family J demonstrated phenotypes of autosomal recessive nonsyndromic postaxial polydactyly type A/B (PAPA/B). After the known PAPA loci were excluded, genome-wide SNP microarray and whole exome sequencing discovered a frame shift mutation in a novel gene, KIAA0825, located on chromosome 5q15. KIAA0825 encodes a protein that is functionally uncharacterized. Further expression and functional studies in cell lines and animal models are required to elucidate the role of KIAA0825 in the pathogenesis of postaxial polydactyly. Most of the genes involved in the pathogenesis of polydactyly have been identified by genetic mapping and mutation detection. After genetic defects have been identified, the particular genes are then functionally characterized to elucidate their role in the limb morphogenesis and pathogenesis (Duboc and Logan, 2009; Goetz and Anderson 2010; Biesecker, 2011; Verma and El-Harouni, 2015). On the other hand, genetic machinery involved in limb development and anterior-posterior patterning is not fully

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 136

Chapter 7 Conclusion understood. Recent technologies such as whole genome microarray and next generation sequencing are the powerful tools to accelerate the process of gene identification in rare disorders (Ng et al., 2009; Parla et al., 2011). Hence, it is anticipated that the list of genes incorporated in the anterior-posterior patterning of the developing limb will be extended in the next few years which may include several novel genes to establish a rich catalog of genes involved in polydactyly phenotypes.

Exome sequencing in family K demonstrating postaxial polydactyly, speech impairment, mild to severe hearing impairment, hypotonia, ataxia and poor growth revealed a novel in-frame deletion (c.1115_1117delCCT) in the gene MKS1, which abolishes a highly conserved residue (p.Ser372del). In silico protein modeling of the normal and mutated MKS1 proteins revealed that this mutation causes alteration in the conformation of MKS1 protein which signifies its role in the disease pathogenesis. Mutations in MKS1 are involved in Meckel syndrome type 1 (MIM: 615990) (Kyttälä et al., 2006; Weatherbee et al., 2009) but recent studies have accentuated that hypomorphic MKS1 can cause Bardet-Biedl syndrome type 13 (MIM: 249000) (Xing et al., 2014) and Joubert syndrome (Romani et al., 2014), suggesting that these hypomorphic mutations in the MKS1 may give rise to more variable phenotypes through reduced functional performance of the gene. Importantly, patients reported in this study demonstrated peculiar phenotypes such as deafness, short stature, dysarthria and impairment in verbal production. In conclusion, this study highlights the phenotypic peculiarity of this family compared to the JS phenotypes in general and to the other JS families having mutations in MKS1 in particular.

In the sixth chapter of the thesis, three consanguineous families with autosomal recessive split hand/foot malformation were described at clinical and molecular levels. Linkage analysis followed by Sanger sequencing of the gene WNT10B detected a novel frameshift mutation is family L and M. Both of these families were recruited from district Upper Dir, KPK, Pakistan. Along with, family L and family M, the same mutation was found in another SHFM family from Upper Dir in our laboratory. Although, there was no close relationship between those families but it is suggested that they descended from a founder population which maintained genetic idiosyncrasies over multiple generations.

Family N with autosomal recessive SHFM was not linked to previously known SHFM loci. Subsequent whole exome sequencing and microarray analysis spotted a

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 137

Chapter 7 Conclusion potentially pathogenic mutation in HOXD8 on chromosome 2q31.1. HOXD genes encode transcription factors that are involved in the determination of the animal body plan, where they organize structures along both the axial and appendicular axes. During mouse limb development, HOXD genes are transcribed in two waves: early on, when the arm and forearm are specified, and later, when the digits are formed. Andrey et al. (2013) have reported that HOXD8 to HOXD11 are the main targets of this early phase of transcriptional regulation. In addition, Sarfarazi et al. (1995) localized syndactyly type II locus to chromosome 2q31 with recognizing a tight linkage to HOXD8 intragenic marker. Besides, an autosomal dominant locus for split hand-foot malformation SHFM5 was previously mapped on chromosome 2q31 that involves the deletion of chromosome 2q24-q31 (Boles et al., 1995). This deletion wipes away the HOXD gene cluster leading to split hand foot malformation phenotypes. Based on these supporting evidences it is proposed that mutations in HOXD8 gene cause autosomal recessives SHFM in a large Pakistani consanguineous family. However, further functional studies are ensuing to confirm these findings.

In summary, this dissertation describes fourteen Pakistani consanguineous families with hereditary skeletal disorders. Four mutations (two new and two previously reported) in the GALNS gene were identified in six families with MPS IVA (Morquio syndrome). Three novel mutations in the NPR2 gene were identified in three families with AMDM. A novel mutation in MKS1 gene was associated with JS in family K while a novel mutation in WNT10B was found in two families with SHFM. In addition, a novel gene KIAA0825 was determined underlying postaxial polydactyly in a consanguineous family. Another novel gene HOXD8 was linked with autosomal recessive split hand/foot malformation in a large consanguineous family.

As a final point, this study may support an international network of patients, clinicians and researchers seeking a better understanding of genetic heterogeneity of skeletal disorders and provides further insight in molecular pathogenesis and targets for treatment. It extends the preexisting human genomic database and may help to develop a community-generated knowledge base that will significantly improve diagnosis, management and understanding of hereditary skeletal disorders. Our understanding of the molecular basis of skeletal disorders may allow us to categorize them on the basis of the underlying genetic defects and helps in carrier testing in the patients and their family to facilitate proper genetic counseling.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 138

References

REFERENCES

Abbasi AA (2011). Evolution of vertebrate appendicular structures: insight from genetic and palaeontological data. Dev Dyn 240:1005-1016

Agrawal N, Frederick MJ, Pickering CR, Bettegowda C, Chang K, Li RJ, Fakhry C, Xie TX, Zhang J, Wang J, Zhang N, El-Naggar AK, Jasser SA, Weinstein JN, Treviño L, Drummond JA, Muzny DM, Wu Y, Wood LD, Hruban RH, Westra WH, Koch WM, Califano JA, Gibbs RA, Sidransky D, Vogelstein B, Velculescu VE, Papadopoulos N, Wheeler DA, Kinzler KW, Myers JN (2011). Exome sequencing of head and neck squamous cell carcinoma reveals inactivating mutations in NOTCH1. Science 333:1154-1157

Aguirre WE, Walker K, Gideon S (2014). Tinkering with the axial skeleton: vertebral number variation in ecologically divergent threespine stickleback populations. Biol J Linn Soc Lond 313:204–219

Akarsu AN, Ozbas F, Kostakoglu N (1997). Mapping of the second locus of postaxial polydactyly type A(PAP-A2) to chromosome 13q21-q32. Am J Hum Genet 61(suppl.):A265

Akhavan S, Miteva MA, Villoutreix BO, Venisse L, Peyvandi F, Mannucci PM, Guillin MC, Bezeaud A (2005). A critical role for Gly25 in the B chain of human thrombin. J Thromb Haemost 3:139-145.

Akiyama H (2008). Control of chondrogenesis by the transcription factor Sox9. Mod. Rheumatol 18:213-219

Alkuraya FS (2010). Homozygosity mapping: one more tool in the clinical geneticist’s toolbox. Genet Med 12:236-239

Al-Qattan MM (2012). A novel frameshift mutation of the GLI3 gene in a family with broad thumbs with/without big toes, postaxial polydactyly and variable syndactyly of the hands/feet. Clin Genet 82:502-504

Altshuler D, Daly MJ, Lander ES (2008). Genetic mapping in human disease. Science 322: 881-888

Al-Yahyaee SA, Al-Kindi MN, Habbal O, Kumar DS (2003). Clinical and molecular

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 139

References analysis of Grebe acromesomelic dysplasia in an Omani family. Am J Med Genet A 121:9-14

Amano N, Mukai T, Ito Y, Narumi S, Tanaka T, Yokoya S, Ogata T, Hasegawa T (2014). Identification and functional characterization of two novel NPR2 mutations in Japanese patients with short stature. J Clin Endocrinol Metab 99:E713–E718

Andrey G, Montavon T, Mascrez B, Gonzalez F, Noordermeer D, Leleu M, Trono D, Spitz F, Duboule D (2013). A switch between topological domains underlies HOXD genes collinearity in mouse limbs. Science 340:1195-1206

Arcos-Burgos M, Muenke M (2002). Genetics of population isolates. Clin Genet 61:233–247

Armour CM, Bulman DE, Jarinova O, Rogers RC, Clarkson KB, DuPont BR, Dwivedi A, Bartel FO, McDonell L, Schwartz CE, Boycott KM, Everman DB, Graham GE (2011). 17p13.3 microduplications are associated with split- hand/foot malformation and long-bone deficiency (SHFLD). Eur J Hum Genet 19:1144-1151

Arnold MA, Kim Y, Czubryt MP, Phan D, McAnally J, Qi X, Shelton JM, Richardson JA, Bassel-Duby R, Olson EN (2007). MEF2C transcription factor controls chondrocyte hypertrophy and bone development. Dev Cell 12: 377-389

Artner J, Katarina G, Peter P (2003). Atlas of human skeletal anatomy. WWW. JourajArtner.com

Arts HH, Bongers EM, Mans DA, van Beersum SE, Oud MM, Bolat E, Spruijt L, Cornelissen EA, Schuurs-Hoeijmakers JH, de Leeuw N, Cormier-Daire V, Brunner HG, Knoers NV, Roepman R. (2011). C14ORF179 encoding IFT43 is mutated in Sensenbrenner syndrome. J Med Genet 48:390-395

Aszódi A, Bateman JF, Gustafsson E, Boot-Handford R, Fässler R (2000). Mammalian skeletogenesis and extracellular matrix: what can we learn from knockout mice? Cell Struct Funct 25:73-84.

Aten E, den Hollander N, Ruivenkamp C, Knijnenburg J, van Bokhoven H, den Dunnen J (2008). Split hand-foot malformation, tetralogy of Fallot, mental

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 140

References

retardation and a 1 Mb 19p deletion – evidence for further heterogeneity? Am J Med Genet A 152A(8):2053-2056

Auray-Blais C, Bhérer P, Gagnon R, Young SP, Zhang HH, An Y, Clarke JT, Millington DS (2011) Efficient analysis of urinary glycosaminoglycans by LC- MS/MS in mucopolysaccharidosis type I, II and VI. Mol Genet Metab 102:49- 56

Aziz A, Irfanullah, Khan S, Zimri FK, Muhammad N, Rashid S, Ahmad W (2014). Novel homozygous mutations in the WNT10B gene underlying autosomal recessive split hand/foot malformation in three consanguineous families. Gene 534:265-271

Bachmann-Gagescu R, Dempsey JC, Phelps IG, O'Roak BJ, Knutzen DM, Rue TC, Ishak GE, Isabella CR, Gorden N, Adkins J, Boyle EA, de Lacy N, O'Day D, Alswaid A, Ramadevi A R, Lingappa L, Lourenço C, Martorell L, Garcia- Cazorla À, Ozyürek H, Haliloğlu G, Tuysuz B, Topçu M; University of Washington Center for Mendelian Genomics, Chance P, Parisi MA, Glass IA, Shendure J, Doherty D (2015). Joubert syndrome: a model for untangling recessive disorders with extreme genetic heterogeneity. J Med Genet 52:514-22

Baker E, Guo XH, Orsborn AM, Sutherland GR, Callen DF, Hopwood JJ, Morris CP (1993). The morquio Asyndrome (mucopolysaccharidosis IVA) gene maps to 16q24.3. Am J Hum Genet 52:96-98

Ballock RT, O’Keefe RJ (2003). The biology of the growth plate. J Bone Joint Surg Am 85:715-726

Bartels CF, Bükülmez H, Padayatti P, Rhee DK, van Ravenswaaij-Arts C, Pauli RM, Mundlos S, Chitayat D, Shih LY, Al-Gazali LI, Kant S, Cole T, Morton J, Cormier-Daire V, Faivre L, Lees M, Kirk J, Mortier GR, Leroy J, Zabel B, Kim CA, Crow Y, Braverman NE, van den Akker F, Warman ML (2004) Mutations in the transmembrane natriuretic peptide receptor NPR-B impair skeletal growth and cause acromesomelic dysplasia, type Maroteaux. Am J Hum Genet 75:27-34

Beales PL, Bland E, Tobin JL, Bacchelli C, Tuysuz B, Hill J, Rix S, Pearson CG, Kai M, Hartley J, Johnson C, Irving M, Elcioglu N, Winey M, Tada M, Scambler PJ

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 141

References

(2007). IFT80, which encodes a conserved intraflagellar transport protein, is mutated in Jeune asphyxiating thoracic dystrophy. Nat Genet 39:727-729

Beck M, Glössl J, Grubisic A, Spranger J (1986). Heterogeneity of Morquio disease. Clin Genet. 29:325-331

Bennett RL, Motulsky AG, Bittles A, Hudgins L, Uhrich S, Doyle DL, Silvey K, Scott CR, Cheng E, McGillivray B, Steiner RD, Olson D (2002). Genetic counseling and screening of consanguineous couples and their offspring: recommendations of the National Society of Genetic Counselors. J Genet Couns 11:97-119

Bennett RL, Steinhaus KA, Uhrich SB, O’Sullivan CK, Resta RG, Lochner-Doyle D, Markel DS, Vincet V, Hamanishi J (1995). Recommendations for standardized human pedigree nomenclature. Pedigree standardization task force of the national society of genetic counselors. Am J Hum Genet 56:745-752

Bhattaram P, Penzo-Méndez A, Sock E, Colmenares C, Kaneko KJ, Vassilev A, Depamphilis ML, Wegner M, Lefebvre V (2010). Organogenesis relies on Soxc transcription factors for the survival of neural and mesenchymal progenitors. Nat Commun 1:9

Biesecker LG (2011). Polydactyly: how many disorders and how many genes? 2010 update. Dev Dyn 240:931-942

Blattner A, Huber AR, Röthlisberger B (2010). Homozygous nonsense mutation in WNT10B and sporadic split-hand/foot malformation (SHFM) with autosomal recessive inheritance. Am J Med Genet A 152:2053-2056

Blottner D, Salanova M, Püttmann B, Schiffl G, Felsenberg D, Buehring B, Rittweger J (2006). Human skeletal muscle structure and function preserved by vibration muscle exercise following 55 days of bed rest. Eur J Appl Physiol 97:261-71

Boles RG, Pober BR, Gibson LH, Willis CR, McGrath J, Roberts DJ, Yang-Feng TL (1995). Deletion of chromosome 2q24-q31 causes characteristic digital anomalies: case report and review. Am J Med Genet 55:155-160

Bonafe L, Cormier-Daire V, Hall C, Lachman R, Mortier G, Mundlos S, Nishimura G, Sangiorgi L, Savarirayan R, Sillence D, Spranger J, Superti-Furga A,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 142

References

Warman M, Unger S (2015). Nosology and classification of genetic skeletal disorders: 2015 revision. Am J Med Genet Part A 9999A:1-24

Bonewald LF (1999). Establishment and characterization of an osteocyte-like cell line, MLO-Y4. J Bone Miner Metab 17:61-65

Bouzidi H, Khedhiri S, Laradi S, Ferchichi S, Daudon MA (2007). Miled Mucopolysaccharidosis IVA (Morquio syndrome of A): Aspects clinique, biologique et Thérapeutique. Ann Biol Clin 65:11-15

Boyce BF, Yao Z, Xing L (2009). Osteoclasts have multiple roles in bone in addition to bone resorption. Crit Rev Eukaryot Gene 19(3):171-180

Boycott KM, Vanstone MR, Bulman DE, MacKenzie AE (2013). Rare-disease genetics in the era of next-generation sequencing: discovery to translation. Nat Rev Genet 14:681-691

Bradbury JA, Martin L, Strachan IM (1987). Acquired Brown's syndrome associated with Hurler-Scheie's syndrome. Br J Ophthalmol 73:305-308

Brancati F, Dallapiccola B, Valente EM (2010). Joubert syndrome and related disorders. Orphanet J Rare Dis 5:20

Brodsky B, Persikov AV (2005). Molecular structure of the collagen triple helix. Adv Protein Chem 70:301-339

Browning BL, Browning SR (2011). A fast, powerful method for detecting identity by descent. Am J Hum Genet 88:173–182

Browning SR, Thompson EA (2012). Detecting Rare Variant Associations by Identity-by-Descent Mapping in Case-Control Studies. Genetics 190:1521-1531

Butterfield NC, McGlinn E, Wicking C (2010). The molecular regulation of vertebrate limb patterning. Curr Top Dev Biol 90:319–341

Byers PD, Brown RA (2006). Cell columns in articular cartilage physes questioned: a review. Osteoarthritis Cartilage 14:3-12

Cai J, Cai LQ, Hong Y, Zhu YS (20112). Functional characterisation of a natural androgen receptor missense mutation (N771H) causing human androgen insensitivity syndrome. Andrologia 44 Suppl 1:523-529

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 143

References

Campbell CA, Ashmore RJ (1995). Test review: The Slosson Intelligence Test- Revised (SIT-R). Measur Evaluat Couns Develop 28:116-118

Caplan AI, Pechak DG (1987). The cellular and molecular embryology of bone formation: In Peck WA (ed). Bone and mineral research. Elsevier, New York (5): 117-183

Castilla EE, Lugarinho da Fonseca R, da Graca Dutra M, Bermejo E, Cuevas L, Martinez-Frias ML (1996). Epidemiological analysis of rare polydactylies. Am J Med Genet 65:295–303

Cavalcanti DP, Huber C, Sang KH, Baujat G, Collins F, Delezoide AL, Dagoneau N, Le Merrer M, Martinovic J, Mello MF, Vekemans M, Munnich A, Cormier- Daire V (2011). Mutation in IFT80 in a fetus with the phenotype of Verma– Naumoff provides molecular evidence for Jeune–Verma– Naumoff dysplasia spectrum. J Med Genet 48:88–92

Cawthorn WP, Bree AJ, Yao Y, Du B, Hemati N, Martinez-Santibañez G, MacDougald OA (2012). Wnt6, Wnt10a and Wnt10b inhibit adipogenesis and stimulate osteoblastogenesis through a β-catenin-dependent mechanism. Bone 50:477-489

Cho SY, Jin DK (2015). Guidelines for genetic skeletal dysplasias for pediatricians. Ann Pediatr Endocrinol Metab 20:187-191

Chong JX, Ouwenga R, Anderson RL, Waggoner DJ, Ober O (2012). A Population- Based Study of Autosomal-Recessive Disease-Causing Mutations in a Founder Population. Am J Hum Genet 91:608-620

Chusho H, Tamura N, Ogawa Y, Yasoda A, Suda M, Miyazawa T, Nakamura K, Nakao K, Kurihara T, Komatsu Y, Itoh H, Tanaka K, Saito Y, Katsuki M, Nakao K (2001) Dwarfism and early death in mice lacking C-type natriuretic peptide. Proc Natl Acad Sci USA 98:4016-4021

Clark, JG (1998). Uses and abuses of hearing loss classification. Asha 23:493-500

Clarke B (2008). Normal bone anatomy and physiology. Clin J Am Soc Nephrol 3:S131–S139

Clarke MM Jr (2006). The new bone biology: pathologic, molecular, clinical correlates. Am J Med Genet A 140:2646-2706

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 144

References

Coene KL, Roepman R, Doherty D, Afroze B, Kroes HY, Letteboer SJ, Ngu LH, Budny B, van Wijk E, Gorden NT, Azhimi M, Thauvin-Robinet C, Veltman JA, Boink M, Kleefstra T, Cremers FP, van Bokhoven H, de Brouwer AP (2009). OFD1 is mutated in X-linked Joubert syndrome and interacts with LCA5-encoded lebercilin. Am J Hum Genet 85:465-481

Colovos C, Yeates TO (1993). Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci 2:1511-1519

Cooper DN, Krawczak M, Polychronakos C, Tyler-Smith C, Kehrer-Sawatzki H (2013). Where genotype is not predictive of phenotype: towards an understanding of the molecular basis of reduced penetrance in human inherited disease. Hum Genet 132:1077-1130

Costa T, Ramsby G, Cassia F, Peters KR, Soares J, Correa J, Quelce-Salgado A, Tsipouras P (1998). Grebe syndrome: clinical and radiographic findings in affected individuals and heterozygous carriers. Am J Med Genet 75:523-529

Coutinho MF, Lacerda L, Prata MJ, Ribeiro H, Lopes L, Ferreira C, Alves S (2008). Molecular characterization of Portuguese patients with mucopolysaccharidosis IIIC: two novel mutations in the HGSNAT gene. Clin Genet 74:194-195

Coutinho MF, Lacerda LU, Alves S (2011). Glycosaminoglycan Storage Disorders: a review. Biochem Res Int 5:1-16

CrackowerMA, Motoyama J, Tsui LC (1998). Defect in the maintenance of the apical ectodermal ridge in the Dactylaplasia mouse. Dev Biol 201:78-89

Curry JD (2006). "The Structure of Bone Tissue" Bones: Structure and Mechanics Princeton U. Press Princeton NJ Pp:12-14

Davis CS, Strobeck C (1998). Isolation, variability, and cross-species amplification of polymorphic microsatellite loci in the family Mustelidae. Molecular Ecology. 7:1776-1778

Davison JE, Kearney S, Horton J, Foster K, Peet AC, Hendriksz CJ (2013). Intellectual and neurological functioning in Morquio syndrome (MPS IVa). J Inherit Metab Dis 36:323-328

Dawson DA, Hanotte O, Greig C, Stewart IRK, Burke T (2000). Polymorphic

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 145

References microsatellites in the blue tit Parus caeruleus and their cross-species utility in 20 songbird families. Mol Ecol 9:1941-1944

Dawson DA, Hunter FM, Pandhal J, Buckland R, Parham A, Jones IL, Bradshaw M, Jehle R, Burke T (2005). Assessment of 17 new whiskered auklet (Aethia pygmaea) microsatellite loci in 42 seabirds identifies 5-15 polymorphic markers for each of nine Alcinae species. Molecular Ecology Notes 5:289-297 de Mollerat XJ, Gurrieri F, Morgan CT, Sangiorgi E, Everman DB, Gaspari P, Amiel J, Bamshad MJ, Lyle R, Blouin JL, Allanson JE, Le Marec B,Wilson M, Braverman NE, Radhakrishna U, Delozier- Blanchet C, Abbott A, Elghouzzi V, Antonarakis S, Stevenson RE, Munnich A, Neri G, Schwartz CE (2003). A genomic rearrangement resulting in a tandem duplication is associated with split handsplit foot malformation 3 (SHFM3) at 10q24. Hum Mol Genet 12:1959-1971

Del Campo M, Jones MC, Veraksa AN, Curry CJ, Jones KL, Mascarello JT, Ali- Kahn-Catts Z, Drumheller T, McGinnis W (1999). Monodactylous limbs and abnormal genitalia are associated with hemizygosity for the human 2q31 region that includes the HOXD cluster. Am J Hum Genet 65:104-110

DeLise AM, Fischer L, Tuan RS (2000). Cellular interactions and signaling in cartilage development. Osteoarthritis Cartilage 8: 309-334

Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P (1996). Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84:911-921

Deng H, Tan T, Yuan L (2015). Advances in the molecular genetics of nonsyndromic polydactyly. Expert Rev Mol Med 17:e18

DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ (2011). A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 43:491-498

Dill KA, Ozkan SB, Weikl TR, Chodera JD, Voelz VA (2007). The protein folding problem: when will it be solved? Curr Opin Struct Biol 17:342-346

Dobson CM (2003). Protein folding and misfolding. Nature 426:884-890

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 146

References

Duboc V, Logan MP (2009). Building limb morphology through integration of signalling modules. Curr Opin Genet Dev 19:497–503.

Ducy P, Starbuck M, Priemel M, Shen J, Pinero G, Geoffroy V, Amling M, Karsenty G (1999). A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev 13:1025-1036

Duijf PH, van Bokhoven H, Brunner HG (2003). Pathogenesis of split-hand/split-foot malformation. Hum Mol Genet 12:R51-R60

Dunker AK, Brown CJ, Lawson JD, Iakoucheva LM, Obradović Z (2002). Intrinsic disorder and protein function. Biochemistry 41:6573-6582

Duynstee ML, Verwoerd-Verhoef HL, Verwoerd CD, Van Osch GJ (2002). The dual role of perichondrium in cartilage wound healing. Plast Reconstr Surg. 110:1073-1079

Dy P, Penzo-Méndez A, Wang H, Pedraza CE, Macklin WB, Lefebvre V (2008). The three SoxC proteins—Sox4, Sox11 and Sox12—exhibit overlapping expression patterns and molecular properties. Nucl Acids Res 36:3101-3117

Dy P, Wang W, Bhattaram P, Wang Q, Wang L, Ballock RT, Lefebvre V (2012). Sox9 directs hypertrophic maturation and blocks osteoblast differentiation of growth plate chondrocytes. Dev Cell 22:597-609

Eames BF, Helms JA (2004). Conserved molecular program regulating cranial and appendicular skeletogenesis. Dev Dyn 231:4 -13

Eggenschwiler JT, Anderson KV (2007). Cilia and developmental signaling. Ann rev cell dev boil 23:345–373

Elcioglu NH, Pawlik P, Colak B, Beck M, Wollnik B (2009). A novel loss-of- function mutation in the GNS gene causes Sanfilippo syndrome type D. Genet Counsel 20:133-139

Elefteriou F, Benson MD, Sowa H, Starbuck M, Liu X, Ron D, Parada LF, Karsenty G (2006). ATF4 mediation of NF1 functions in osteoblast reveals a nutritional basis for congenital skeletal dysplasiae. Cell Metab 4:441-451

Elliott AM, Evans JA (2008). The association of split hand foot malformation (SHFM) and congenital heart defects. Birth Defects Res 82:425-434

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 147

References

Emsley P, Lohkamp B, Scott WG, Cowtan K (2010). Features and development of Coot. Acta Crystallogr. D 66:486-501

Ephraim PL, Dillingham TR, Sector M, Pezzin LE, Mackenzie EJ (2003). Epidemiology of limb loss and congenital limb deficiency: a review of the literature. Arch Phys Med Rehabil 84:747-761

Esko JD, Kimata K, Lindahl U (2009). Proteoglycans and sulfated glycosaminoglycans In: Varki A, Cummings RD, Esko JD, Freeze HH, Stanley P, Bertozzi CR, Hart GW, Etzler ME (eds). Essentials of Glycobiology. (2nd) Cold Spring Harbor (NY) 16:29-35

Esposito S, Balzano N, Daniele A, Villani GRD, Perkins K, Weber B, Hopwood JJ, Di Natale P (2000). Heparan N-sulfatase gene: two novel mutations and transient expression of 15 defects. Biochim Biophys Acta 1501:1-11

Eswarakumar VP, Lax I, Schlessinger J (2005). Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 16:139–149.

Everman DB, Morgan CT, Lyle R, LaughridgeME, BamshadMJ, Clarkson KB, Colby R, Gurrieri F, Innes AM, Roberson J, Schrander-Stumpel C, van Bokhoven H, Antonarakis SE, Schwartz CE (2006). Frequency of genomic rearrangements involving the SHFM3 locus at chromosome 10q24 in syndromic and nonsyndromic split-hand/foot malformation. Am J Med Genet A 140:1375–1383

Faiyaz ul Haque M, Uhlhaas S, Knapp M, Schüler H, Friedl W, Ahmad M, Propping P (1993). X chromosomal split-hand/split-foot anomaly maps to Xq26. Hum Genet 91:17-19

Feng XH, Derynck R (2005). Specificity and versatility in TGF-b signaling through Smads. Annu Rev Cell Dev Biol 21:659-693

Fernández KS, de Alarcón PA (2013). Development of the hematopoietic system and disorders of hematopoiesis that present during infancy and early childhood. Pediatric clinics of North America 60:1273-1289

Forciea B (2014). The Skeletal system. In: An eText of Human Anatomy and Physiology. Pp:117-177

Franca LT, Carrilho E, Kist TB (2002). A review of DNA sequencing techniques. Q Rev Biophys 35:169-200

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 148

References

Galjaard RJ, Smits AP, Tuerlings JH, Bais AG, Bertoli Avella AM, Breedveld G, de Graaff E, Oostra BA, Heutink P (2003). A new locus for postaxial polydactyly type A/B on chromosome 7q21-q34. Eur J Hum Genet 11:409-415

Geister KA, Camper SA (2015). Advances in Skeletal Dysplasia Genetics. Annu Rev Genomics Hum Genet 16:199-227

Giugliani R, Carvalho CG, Herber S, de Camargo Pinto LL (2011) Recent Advances in Treatment Approaches of Mucopolysaccharidosis VI. Curr Pharm Biotechnol 12:956-962

Giugliani R, Federhen A, Rojas MV, Vieira T, Artigalás O, Pinto LL, Azevedo AC, Acosta A, Bonfim C, Lourenço CM, Kim CA, Horovitz D, Bonfim D, Norato D, Marinho D, Palhares D, Santos ES, Ribeiro E, Valadares E, Guarany F, de Lucca GR, Pimentel H, de Souza IN, Correa J Neto, Fraga JC, Goes JE, Cabral JM, Simionato J, Llerena JJr, Jardim L, Giuliani L, da Silva LC, Santos ML, Moreira MA, Kerstenetzky M, Ribeiro M, Ruas N, Barrios P, Aranda P, Honjo R, Boy R, Costa R, Souza C, Alcantara FF, Avilla SG, Fagondes S, Martins AM (2010). Mucopolysaccharidosis I, II, and VI: Brief review and guidelines for treatment. Genet Mol Biol 33:589-604

Goetz SC, Anderson KV (2010). The primary cilium: a signalling centre during vertebrate development. Nat Rev Genet 11:331-344

Goltzman D, Ornitz DM, Henderson JE (2004). Defective bone mineralization and osteopenia in young adult FGFR3– / – mice. Hum Mol Genet 13:271-284

González-Meneses López A, Barcia Ramírez A, Díaz Rodríguez JL (20101). Action protocol in mucopolysaccharidosis. Protoc diagn ter pediatr 1: 24-36.

Goto H, Inoko A, Inagaki M (2013). Cell cycle progression by the repression of primary cilia formation in proliferating cells.CMLS 70:3893-3905

Gottwald I, Hughes J, Stewart F, Tylee K, Church H, Jones SA (2011). Attenuated mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) due to homozygosity for the p.Y201C mutation in the ARSB gene. Mol Genet Metab 103:300–302

Gough-Palmer AL, Maclachlan J, Routh A (2008). Paws for thought: comparative radiologic anatomy of the mammalian forelimb. RadioGraphics 28:501-510

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 149

References

Graul-Neumann LM, Deichsel A, Wille U, Kakar N, Koll R, Bassir C, Ahmad J, Cormier-Daire V, Mundlos S, Kubisch C, Borck G, Klopocki E, Mueller TD, Doelken SC, Seemann P (2014). Homozygous missense and nonsense mutations in BMPR1B cause acromesomelic chondrodysplasia-type Grebe. Eur J Hum Genet 22:726-733

Grebe H (1952) Die Achondrogenesis: ein einfach rezessives Erbmerkmal. Folia Hered. Path 2:23-28

Grebe H (1964). Syndaktylien In: Humangenetik (ed): Ein kurzes Handbuch in funf Banden Georg Thieme Verlag: Stuttgart pp:297-304

Gurrieri F, Everman DB (2013). Clinical, genetic, and molecular aspects of split- hand/foot malformation: an update. Am J Med Genet A 161A:2860–2872

Gurrieri F1, Prinos P, Tackels D, Kilpatrick MW, Allanson J, Genuardi M, Vuckov A, Nanni L, Sangiorgi E, Garofalo G, Nunes ME, Neri G, Schwartz C, Tsipouras P (1996). A split hand-split foot (SHFM3) gene is located at 10q24– 25. Am J Med Genet 62:427-436

Haber LL, Adams HB, Thompson GH, Duncan LS, Didomenico LA, McCluskey WP (2007). Unique case of polydactyly and a new classification system. J Pediatr Orthop 27:326-328

Hall BK (2005). Cartilages. Chapter 3 In: Bones and cartilage developmental and evolutionary skeletal biology ISBN 0-12-31906-06. Pp:33-45

Hall BK, Miyake T (2000). All for one and one for all: condensations and the initiation of skeletal development. Bioesssays 22:138-47

Hamamy H (2012). Consanguineous marriages, Preconception consultation in primary health care settings. J Community Genet 3:185-192

Hamamy H, Antonarakis SE, Cavalli-Sforza LL, Temtamy S, Romeo G, Ten Kate LP, Bennett RL, Shaw A, Megarbane A, van DC, Bathija H, Fokstuen S, Engel E, Zlotogora J, Dermitzakis E, Bottani A, Dahoun S, Morris MA, Arsenault S, Aglan MS, Ajaz M, Alkalamchi A, Alnaqeb D, Alwasiyah MK, Anwer N, Awwad R, Bonnefin M, Corry P, Gwanmesia L, Karbani GA, Mostafavi M, Pippucci T, Ranza-Boscardin E, Reversade B, Sharif SM, Teeuw ME, Bittles

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 150

References

AH (2011). Consanguineous marriages, pearls and perils: Geneva International Consanguinity Workshop report. Genet Med 13:841-847

Hamamy H, Bittles AH (2009) Genetic clinics in Arab communities: meeting individual, family and community needs. Public Health Genomics Sep 3. Public Health Genomics 12(1):30-40

Hannema SE, van Duyvenvoorde HA, Premsler T, Yang RB, Mueller TD, Gassner B, Oberwinkler H, Roelfsema F, Santen GW, Prickett T, Kant SG, Verkerk AJ, Uitterlinden AG, Espiner E, Ruivenkamp CA, Oostdijk W, Pereira AM, Losekoot M, Kuhn M, Wit JM (2013) An activating mutation in the kinase homology domain of the natriuretic peptide receptor- 2 causes extremely tall stature without skeletal deformities. J Clin Endocrinol Metab 98:E1988-E1998

Hansson B, Akesson M, Slate J, Pemberton JM (2005). Linkage mapping reveals sex- dimorphic map distances in a passerine bird. P R Soc B. 272:2289-2298

Harmatz P, Mengel KE, Giugliani R, Valayannopoulos V, Lin SP, Parini R, Guffon N, Burton BK, Hendriksz CJ, Mitchell J, Martins A, Jones S, Guelbert N, Vellodi A, Hollak C, Slasor P, Decker C (2013). The Morquio A Clinical Assessment Program: baseline results illustrating progressive, multisystemic clinical impairments in Morquio A subjects. Mol Genet Metab 109:54-61

Hartmann C (2007). Skeletal development - wnts are in control. Mol Cells 24:177- 184

Helms JA, Schneider RA (2003). Cranial skeletal biology. Nature 423:326-331

Hendriksz CJ, Harmatz P, Beck M, Jones S, Wood T, Lachman R, Gravance CG, Orii T, Tomatsu S (2013). Review of clinical presentation and diagnosis of mucopolysaccharidosis IVA. Mol Genet Metab 110:54-64

Heuertz S, Le Merrer M, Zabel B, Wright M, Legeai-Mallet L, Cormier-Daire V, Gibbs L, Bonaventure J (2006). Novel FGFR3 mutations creating cysteine residues in the extracellular domain of the receptor cause achondroplasia or severe forms of hypochondroplasia. Eur J Hum Genet 14:1240-1247

Hilton MJ, Tu X, Cook J, Hu H, Long F (2005). Ihh controls cartilage development by antagonizing Gli3, but requires additional effectors to regulate osteoblast and vascular development. Development 132:4339-4351

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 151

References

Hodges E, Xuan Z, Balija V, Kramer M, Molla MN, Smith SW, Middle CM, Rodesch MJ, Albert TJ, Hannon GJ, McCombie WR (2007). Genome-wide in situ exon capture for selective resequencing. Nat Genet 39:1522-1527

Hu Q, Milenkovic L, Jin H, Scott MP, Nachury MV, Spiliotis ET, Nelson WJ (2010). A septin diffusion barrier at the base of the primary cilium maintains ciliary membrane protein distribution. Science 329:436-439

Huber C, Cormier-Daire V (2012). Ciliary disorder of the skeleton. Am J Med Genet C Semin Med Genet 160C:165-174

Huey, Ruth, Garrett M. Morris, Arthur J. Olson, and David S. Goodsell (2007). A Semiempirical Free Energy Force Field with ChargeBased Desolvation. J Comp Chem 28:1145-1152

Hunter AGW, Thompson MW (1976). Acromesomelic dwarfism: description of a patient and comparison with previously reported cases. Hum Genet, 34:107-113

Ianakiev P, Kilpatrick MW, Toudjarska I, Basel D, Beighton P, Tsipouras P (2000). Split-hand/split-foot malformation is caused by mutations in the p63 gene on 3q27. Am J Hum Genet 67:59-66

Ikeda F, Nishimura R, Matsubara T, Tanaka S, Inoue J, Reddy SV, Hata K, Yamashita K, Hiraga T, Watanabe T, Kukita T, Yoshioka K, Rao A, Yoneda T (2004). Critical roles of c-Jun signaling in regulation of NFAT family and RANKL-regulated osteoclast differentiation. J Clin Invest 114:475-484

Ikeda T1, Kamekura S, Mabuchi A, Kou I, Seki S, Takato T, Nakamura K, Kawaguchi H, Ikegawa S, Chung UI (2004). The combination of SOX5, SOX6, and SOX9 (the SOX trio) provides signal sufficient for induction of permanent cartilage. Arthritis Rheum 50:3561-3573

Ikegawa S (2006). Genetic analysis of skeletal dysplasia: recent advances and perspectives in the post-genome-sequence era. J Hum Genet 51:581-586

Irfanullah, Umair M, Khan S, Ahmad W (2015). Homozygous sequence variants in the NPR2 gene underlying Acromesomelic dysplasia Maroteaux type (AMDM) in consanguineous families. Ann Hum Genet 79:238-244

Jackson GC, Mittaz-Crettol L, Taylor JA, Mortier GR, Spranger J, Zabel B, Le Merrer M, Cormier-Daire V, Hall CM, Offiah A, Wright MJ, Savarirayan R,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 152

References

Nishimura G, Ramsden SC, Elles R, Bonafe L, Superti-Furga A, Unger S, Zankl A, Briggs MD (2012). Pseudoachondroplasia and multiple epiphyseal dysplasia: a 7-year comprehensive analysis of the known disease genes identify novel and recurrent mutations and provides an accurate assessment of their relative contribution. Hum Mutat 33:144-157

Jacob AL, Smith C, Partanen J, Ornitz DM (2006). Fibroblast growth factor receptor 1 signaling in the osteo-chondrogenic cell lineage regulates sequential steps of osteoblast maturation. Dev Biol 296:315-328

Jakkula E, Mäkitie O, Czarny-Ratajczak M, Jackson GC, Damignani R, Susic M, Briggs MD, Cole WG, Ala-Kokko L (2005). Mutations in the known genes are not the major cause of MED; distinctive phenotypic entities among patients with no identified mutations. Eur J Hum Genet 13:292-301

Jensen ED, Gopalakrishnan R, Westendorf JJ (2010). Regulation of gene expression in osteoblasts. Biofactors 36:25-32

Joeng KS, Long F (2009). The Gli2 transcriptional activator is a crucial effector for Ihh signaling in osteoblast development and cartilage vascularization. Development 136:4177-4185

Jones R, Ruas M, Gregory F, Moulin S, Delia D, Manoukian S, Rowe J, Brookes S, Peters G (2007). A CDKN2A mutation in familial melanoma that abrogates binding of p16INK4a to CDK4 but not CDK6. Cancer Res 67:9134-9141

Joubert M, Eisenring JJ, Andermann F (1968). Familial dysgenesis of the vermis: a syndrome of hyperventilation, abnormal eye movements and retardation. Neurology 18:302-303

Kalsoom UE, Klopocki E, Wasif N, Tariq M, Khan S, Hecht J, Krawitz P, Mundlos S, Ahmad W (2013). Whole exome sequencing identified a novel zinc-finger gene ZNF141 associated with autosomal recessive postaxial polydactyly type A. J Med Genet 50:47-53

Kannu P, Bateman J Savarirayan R (2012). Clinical phenotypes associated with type II collagen mutations. J. Paediatr. Child Health 48, E38-E43

Kant SG, Polinkovsky A, Mundlos S, Zabel B, Thomeer RT, Zonderland HM, Shih

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 153

References

L, van Haeringen A, Warman ML (1998). Acromesomelic dysplasia maroteaux type maps to human chromosome 9. Am J Hum Genet 63:155-162

Karplus M, Kuriyan J (2005). Molecular dynamics and protein function. Proc Natl Acad Sci U S A 102:6679-6685

Karsenty G (2003). The complexities of skeletal biology. Nature 423: 316-318

Karsenty G (2009). Transcriptional control of osteoblast differentiation. In: Pourquie O (ed). The skeletal system. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Pp:205-218

Karsenty G Wagner EF (2002). Reaching a genetic and molecular understanding of skeletal development. Dev Cell 2:389-406

Karsenty G, Kronenberg HM, Settembre C (2009). Genetic control of bone formation. Annu Rev Cell Dev Biol 25:629-648

Khaddour R, Smith U, Baala L, Martinovic J, Clavering D, Shaffiq R, Ozilou C, Cullinane A, Kyttälä M, Shalev S, Audollent S, d'Humières C, Kadhom N, Esculpavit C, Viot G, Boone C, Oien C, Encha-Razavi F, Batman PA, Bennett CP, Woods CG, Roume J, Lyonnet S, Génin E, Le Merrer M, Munnich A, Gubler MC, Cox P, Macdonald F, Vekemans M, Johnson CA, Attié-Bitach T; SOFFOET (Société Française de Foetopathologie) (2007). Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online. Hum Mutat 28:523-524

Khan MA (2015). Clinical Genetics and Genetic Counselling in Pakistan. Aslamkhan., 2015. J Genes & Cells 1(2): 31-33

Khan S, Ali RH, Abbasi S, Nawaz M, Muhammad N, Ahmad W (2012a) Novel mutations in natriuretic peptide receptor-2 gene underlie acromesomelic dysplasia, type Maroteaux. BMC Med Genet 13:44

Khan S, Basit S, Khan MA, Muhammad N, Ahmad W (2016). Genetics of human isolated acromesomelic dysplasia. Eur J Med Genet 59:198-203

Khan S, Basit S, Zimri FK, Ali N, Ali G, Ansar M, Ahmad W (2012b). A novel homozygous missense mutation in WNT10B in familial split-hand/foot malformation. Clin Genet 82:48-55

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 154

References

Khan S, Vihinen M (2010). Performance of protein stability predictors. Human Mutation 31:675-684

Khedhiri S, Chkioua L, Bouzidi H, Dandana A, Ben Turkia H, Miled A, Laradi S (2009). Mucopolysaccharidoses type I and IVA: clinical features and consanguinity in Tunisia. Pathol Biol 57:392-397

Kini U, Nandeesh BN (2012). Physiology of Bone Formation, Remodeling, and Metabolism. In: Fogelman I, Gnanasegaran, Van der Wall H (eds). Radionuclide and Hybrid Bone Imaging. Springer-Verlag Berlin Heidelberg Pp: 29-57

Klopocki E, Lohan S, Doelken SC, Stricker S, Ockeloen CW, Soares Thiele de Aguiar R, Lezirovitz K, Mingroni Netto RC, Jamsheer A, Shah H, Kurth I, Habenicht R, Warman M, Devriendt K, Kordass U, Hempel M, Rajab A, Mäkitie O, Naveed M, Radhakrishna U, Antonarakis SE, Horn D, Mundlos S (2012). Duplications of BHLHA9 are associated with ectrodactyly and tibia hemimelia inherited in non-Mendelian fashion. J Med Genet 49:119-125

Kmita M Duboule D (2003). Organizing axes in time and space; 25 years of colinear tinkering. Science 301:331-333

Kmita M, Tarchini B, Zàkàny J, Logan M, Tabin CJ, Duboule D (2005) Early developmental arrest of mammalian limbs lacking HoxA/HoxD gene function. Nature 435:1113-1116

Kokabu S, Gamer L, Cox K, Lowery J, Tsuji K, Raz R, Economides A, Katagiri T, Rosen V. (2012). BMP3 suppresses osteoblast differentiation of bone marrow stromal cells via interaction with Acvr2b. Mol Endocrinol 26:87-94

Kong A, Masson G, Frigge ML, Gylfason A, Zusmanovich P, Thorleifsson G, Olason PI, Ingason A, Steinberg S, Rafnar T, Sulem P, Mouy M, Jonsson F, Thorsteinsdottir U, Gudbjartsson DF, Stefansson H, Stefansson K (2008). Detection of sharing by descent, long-range phasing and haplotype imputation. Nature Genetics 40:1068-1075

Kornak U, Mundlos S (2003). Genetic disorders of the skeleton: a developmental approach. Am J Hum Genet 73:447-474

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 155

References

Koukouritaki SB, Poch MT, Henderson MC, Siddens LK, Krueger SK, VanDyke JE, Williams DE, Pajewski NM, Wang T, Hines RN (2007). Identification and functional analysis of common human flavin-containing monooxygenase 3 genetic variants. J Pharmacol Exp Ther 320:266-273

Krakow D, Rimoin DL (2010). The skeletal dysplasias. Genet Med 12(6):327-341

Kronenberg HM (2003). Developmental regulation of the growth plate. Nature 423:332-336

Ku CS, Cooper DN, Polychronakos C, Naidoo N, Wu M, Soong R (2012). Exome sequencing:Dual role as a discovery and diagnostic tool. Ann Neurol 71:5-14

Kyttälä M, Tallila J, Salonen R, Kopra O, Kohlschmidt N, Paavola-Sakki P, Peltonen L, Kestilä M (2006). MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome. Nat Genet 38:155-157

Lander ES, Botstein D (1987). Homozygosity mapping: A way to map human recessive traits with the DNA of inbred children. Science 236:1567-1570

Langer LO Jr, Cervenka J, Camargo M (1989) A severe autosomal recessive acromesomelic dysplasia, the Hunter-Thompson type, and comparison with the Grebe type. Hum Genet 81:323-328

Langer LO, Garrett RT (1980). Acromesomelic dysplasia. Radiology 137:349-335

Lango Allen H, Estrada K, Lettre G, Berndt SI, Weedon MN, Rivadeneira F, Willer CJ, Jackson AU, Vedantam S, Raychaudhuri S, Ferreira T, Wood AR, Weyant RJ, Segrè AV, Speliotes EK, Wheeler E, Soranzo N, Park JH, Yang J, Gudbjartsson D, Heard-Costa NL, Randall JC, Qi L, Vernon Smith A, Mägi R, Pastinen T, Liang L, Heid IM, Luan J, Thorleifsson G, Winkler TW, Goddard ME, Sin Lo K, Palmer C, Workalemahu T, Aulchenko YS, Johansson A, Zillikens MC, Feitosa MF, Esko T, Johnson T, Ketkar S, Kraft P, Mangino M, Prokopenko I, Absher D, Albrecht E, Ernst F, Glazer NL, Hayward C, Hottenga JJ, Jacobs KB, Knowles JW, Kutalik Z, Monda KL, Polasek O, Preuss M, Rayner NW, Robertson NR, Steinthorsdottir V, Tyrer JP, Voight BF, Wiklund F, Xu J, Zhao JH, Nyholt DR, Pellikka N, Perola M, Perry JR, Surakka I, Tammesoo ML, Altmaier EL, Amin N, Aspelund T, Bhangale T, Boucher G, Chasman DI, Chen C, Coin L, Cooper MN, Dixon AL, Gibson Q, Grundberg E,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 156

References

Hao K, Juhani Junttila M, Kaplan LM, Kettunen J, König IR, Kwan T, Lawrence RW, Levinson DF, Lorentzon M, McKnight B, Morris AP, Müller M, Suh Ngwa J, Purcell S, Rafelt S, Salem RM, Salvi E, Sanna S, Shi J, Sovio U, Thompson JR, Turchin MC, Vandenput L, Verlaan DJ, Vitart V, White CC, Ziegler A, Almgren P, Balmforth AJ, Campbell H, Citterio L, De Grandi A, Dominiczak A, Duan J, Elliott P, Elosua R, Eriksson JG, Freimer NB, Geus EJ, Glorioso N, Haiqing S, Hartikainen AL, Havulinna AS, Hicks AA, Hui J, Igl W, Illig T, Jula A, Kajantie E, Kilpeläinen TO, Koiranen M, Kolcic I, Koskinen S, Kovacs P, Laitinen J, Liu J, Lokki ML, Marusic A, Maschio A, Meitinger T, Mulas A, Paré G, Parker AN, Peden JF, Petersmann A, Pichler I, Pietiläinen KH, Pouta A, Ridderstråle M, Rotter JI, Sambrook JG, Sanders AR, Schmidt CO, Sinisalo J, Smit JH, Stringham HM, Bragi Walters G, Widen E, Wild SH, Willemsen G, Zagato L, Zgaga L, Zitting P, Alavere H, Farrall M, McArdle WL, Nelis M, Peters MJ, Ripatti S, van Meurs JB, Aben KK, Ardlie KG, Beckmann JS, Beilby JP, Bergman RN, Bergmann S, Collins FS, Cusi D, den Heijer M, Eiriksdottir G, Gejman PV, Hall AS, Hamsten A, Huikuri HV, Iribarren C, Kähönen M, Kaprio J, Kathiresan S, Kiemeney L, Kocher T, Launer LJ, Lehtimäki T, Melander O, Mosley TH Jr, Musk AW, Nieminen MS, O'Donnell CJ, Ohlsson C, Oostra B, Palmer LJ, Raitakari O, Ridker PM, Rioux JD, Rissanen A, Rivolta C, Schunkert H, Shuldiner AR, Siscovick DS, Stumvoll M, Tönjes A, Tuomilehto J, van Ommen GJ, Viikari J, Heath AC, Martin NG, Montgomery GW, Province MA, Kayser M, Arnold AM, Atwood LD, Boerwinkle E, Chanock SJ, Deloukas P, Gieger C, Grönberg H, Hall P, Hattersley AT, Hengstenberg C, Hoffman W, Lathrop GM, Salomaa V, Schreiber S, Uda M, Waterworth D, Wright AF, Assimes TL, Barroso I, Hofman A, Mohlke KL, Boomsma DI, Caulfield MJ, Cupples LA, Erdmann J, Fox CS, Gudnason V, Gyllensten U, Harris TB, Hayes RB, Jarvelin MR, Mooser V, Munroe PB, Ouwehand WH, Penninx BW, Pramstaller PP, Quertermous T, Rudan I, Samani NJ, Spector TD, Völzke H, Watkins H, Wilson JF, Groop LC, Haritunians T, Hu FB, Kaplan RC, Metspalu A, North KE, Schlessinger D, Wareham NJ, Hunter DJ, O'Connell JR, Strachan DP, Wichmann HE, Borecki IB, van Duijn CM, Schadt EE, Thorsteinsdottir U, Peltonen L, Uitterlinden AG, Visscher PM, Chatterjee N, Loos RJ, Boehnke M, McCarthy MI, Ingelsson E, Lindgren CM, Abecasis GR, Stefansson K,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 157

References

Frayling TM, Hirschhorn JN (2010). Hundreds of variants clustered in genomic loci and biological pathways affect human height. Nature 467:832-838

Lanktree MB, Guo Y, Murtaza M, Glessner JT, Bailey SD, Onland-Moret NC, Lettre G, Ongen H, Rajagopalan R, Johnson T, Shen H, Nelson CP, Klopp N, Baumert J, Padmanabhan S, Pankratz N, Pankow JS, Shah S, Taylor K, Barnard J, Peters BJ, Maloney CM, Lobmeyer MT, Stanton A, Zafarmand MH, Romaine SP, Mehta A, van Iperen EP, Gong Y, Price TS, Smith EN, Kim CE, Li YR, Asselbergs FW, Atwood LD, Bailey KM, Bhatt D, Bauer F, Behr ER, Bhangale T, Boer JM, Boehm BO, Bradfield JP, Brown M, Braund PS, Burton PR, Carty C, Chandrupatla HR, Chen W, Connell J, Dalgeorgou C, Boer Ad, Drenos F, Elbers CC, Fang JC, Fox CS, Frackelton EC, Fuchs B, Furlong CE, Gibson Q, Gieger C, Goel A, Grobbee DE, Hastie C, Howard PJ, Huang GH, Johnson WC, Li Q, Kleber ME, Klein BE, Klein R, Kooperberg C, Ky B, Lacroix A, Lanken P, Lathrop M, Li M, Marshall V, Melander O, Mentch FD, Meyer NJ, Monda KL, Montpetit A, Murugesan G, Nakayama K, Nondahl D, Onipinla A, Rafelt S, Newhouse SJ, Otieno FG, Patel SR, Putt ME, Rodriguez S, Safa RN, Sawyer DB, Schreiner PJ, Simpson C, Sivapalaratnam S, Srinivasan SR, Suver C, Swergold G, Sweitzer NK, Thomas KA, Thorand B, Timpson NJ, Tischfield S, Tobin M, Tomaszewski M, Verschuren WM, Wallace C, Winkelmann B, Zhang H, Zheng D, Zhang L, Zmuda JM, Clarke R, Balmforth AJ, Danesh J, Day IN, Schork NJ, de Bakker PI, Delles C, Duggan D, Hingorani AD, Hirschhorn JN, Hofker MH, Humphries SE, Kivimaki M, Lawlor DA, Kottke-Marchant K, Mega JL, Mitchell BD, Morrow DA, Palmen J, Redline S, Shields DC, Shuldiner AR, Sleiman PM, Smith GD, Farrall M, Jamshidi Y, Christiani DC, Casas JP, Hall AS, Doevendans PA, Christie JD, Berenson GS, Murray SS, Illig T, Dorn GW 2nd, Cappola TP, Boerwinkle E, Sever P, Rader DJ, Reilly MP, Caulfield M, Talmud PJ, Topol E, Engert JC, Wang K, Dominiczak A, Hamsten A, Curtis SP, Silverstein RL, Lange LA, Sabatine MS, Trip M, Saleheen D, Peden JF, Cruickshanks KJ, März W, O'Connell JR, Klungel OH, Wijmenga C, Maitland-van der Zee AH, Schadt EE, Johnson JA, Jarvik GP, Papanicolaou GJ; Hugh Watkins on behalf of PROCARDIS, Grant SF, Munroe PB, North KE, Samani NJ, Koenig W, Gaunt TR, Anand SS, van der Schouw YT; Meena Kumari on behalf of the Whitehall

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 158

References

II Study and the WHII 50K Group, Soranzo N, Fitzgerald GA, Reiner A, Hegele RA, Hakonarson H, Keating BJ (2011). Metaanalysis of dense genecentric association studies reveals common and uncommon variants associated with height. Am J Hum Genet 88:6-18

Laurin M, Canoville A, Germain D (2011). Bone microanatomy and lifestyle: A descriptive approach. Comptes Rendus Palevol 10:381-402

Laurin M, Canoville A, Germain D (2011). Bone microanatomy and lifestyle: a descriptive approach. Comptes rendus Palevol 10:381-402

Le Merrer M, Roubin M, Amiel J, Gigarel N, Cormier-Daire V, Maroteaux P, Munnich A (1999). Prenatal short limbs detected in fetal echography screening: what is the benefit? Presented at the Fourth International Skeletal Dysplasia Meeting Baden-Baden, Germany:68

Lee NK, Sowa H, Hinoi E, Ferron M, Ahn JD, Confavreux C, Dacquin R, Mee PJ, McKee MD, Jung DY, Zhang Z, Kim JK, Mauvais-Jarvis F, Ducy P, Karsenty G (2007). Endocrine Regulation of Energy Metabolism by the Skeleton. Cell 130:456-469

Lefebvre V, Bhattaram P (2010). Vertebrate skeletogenesis. Curr Top Dev Biol 90:291-317

Lezirovitz K,Maestrelli SR, Cotrim NH, Otto PA, Pearson PL,Mingroni- Netto RC (2008). A novel locus for split-hand/foot malformation associated with tibial hemimelia (SHFLD syndrome) maps to chromosome region 17p13.1-17p13.3. Hum Genet 123:625–631

Li H, Durbin R (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754-1760

Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R (2009). 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078-2079

Li Y, Dudley AT (2009). Noncanonical frizzled signaling regulates cell polarity of growth plate chondrocytes. Development 136:1083-1092

Li Y, Toole BP, Dealy CN, Kosher RA (2007). Hyaluronan in limb morphogenesis. Dev Biol 305:411-420

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 159

References

Lo Iacono N, Mantero S, Chiarelli A, Garcia E, Mills AA, Morasso MI, Costanzo A, Levi G, Guerrini L, Merlo GR (2008). Regulation of Dlx5 and Dlx6 gene expression by p63 is involved in EEC and SHFM congenital limb defects. Development 135:1377-1388

Logan CY, Nusse R (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20:781-810

Long F (2012). Building strong bones: Molecular regulation of the osteoblast lineage. Nat Rev Mol Cell Biol 13:27-38

Long F, Ornitz DM (2013). Development of the Endochondral Skeleton. Cold Spring Harb Perspect Biol 5: a008334.

Loomis CA, Kimmel RA, Tong CX, Michaud J, Joyner AL (1998). Analysis of the genetic pathway leading to formation of ectopic apical ectodermal ridges in mouse engrailed-1mutant limbs. Development 125:1137-1148

Louie CM, Gleeson JG (2005). Genetic basis of Joubert syndrome and related disorders of cerebellar development. Hum Mol Genet 14(S2): R235-R242

Lu P, Yu Y, Perdue Y,Werb Z (2008). The apical ectodermal ridge is a timer for generating distal limb progenitors. Development 135:1395-1405

Mackie EJ (2003). Osteoblasts: novel roles in orchestration of skeletal architecture. Int J Biochem Cell Biol 35:1301-1305

Mackie EJ, Ahmed YA, Tatarczuch L, Chen KS, Mirams M (2008). Endochondral ossification: how cartilage is converted into bone in the developing skeleton. Int J Biochem Cell Biol 40:46-62

Mahdieh N, Rabbani B (2013). An Overview of Mutation Detection Methods in Genetic Disorders. Iran J Pediatr 23:375-388

Malik S, Schott J, Ali SW, Oeffner F, Amin-ud-Din M, Ahmad W, Grzeschik KH, Koch MC (2005). Evidence for clinical and genetic heterogeneity of syndactyly type I: the phenotype of second and third toe syndactyly maps to chromosome 3p21.31. Eur J Hum Genet 13:1268-1274

Mancini F, Romani M, Micalizzi A, Valente EM (2014). Molecular genetics of Joubert syndrome. In: eLS.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 160

References

Manning M, Hudgins L; Professional Practice and Guidelines Committee (2010). Array-based technology and recommendations for utilization in medical genetics practice for detection of chromosomal abnormalities. Genet Med 12:742-745

Maroteaux P, Martinelli B, Campailla E (1971). Acromesomelic dwarfism. Presse Med 79:1839-1842

Massague J, Seoane J,Wotton D (2005). Smad transcription factors. Genes Dev 19: 2783-2810

Masue M, Sukegawa K, Orii T, Hashimoto T (1991). N-acetylgalactosamine-6- sulfate sulfatase in human placenta: purification and characteristics. J Bioche 110:965-970

Masuno M, Tomatsu S, Nakashima Y, Hori T, Fukuda S, Masue M, Sukegawa K, Orii T (1993). Mucopolysaccharidosis IV A: assignment of the human Nacetylgalactosamine- 6-sulfate sulfatase (GALNS) gene to chromosome 16q24. Genomics 16:777-778

Materna-Kiryluk A, Jamsheer A, Wisniewska K, Wieckowska B, Limon J, Borszewska-Kornacka M, Sawulicka-Oleszczuk H, Szwalkiewicz-Warowicka E, Latos-Bielenska A (2013) Epidemiology of isolated preaxial polydactyly type I: data from the Polish Registry of Congenital Malformations (PRCM). BMC Pediatrics 13:26

Matise TC, Chen F, Chen W, De La Vega FM, Hansen M, He C, Hyland FC, Kennedy GC, Kong X, Murray SS, Ziegle JS, Stewart WC, Buyske S (2007) A second-generation combined linkage physical map of the human genome. Genome Res 17:1783-1786

McCarthy EF (2011). Genetic diseases of bones and joints. Semin Diagn Pathol. 28:26-36

McGinnis W (1992). Homeobox genes and axial patterning, Cell 68:283–302.

Mcinnes RR, Michaud JL (2008). Skeletal dysplasias and the growth plate. Clin Genet 73:24-30

McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010). The

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 161

References

Genome Analysis Toolkit: a MapReduce framework for analyzing next- generation DNA sequencing data. Genome Res 20:1297-1303.

McQuillan R1, Leutenegger AL, Abdel-Rahman R, Franklin CS, Pericic M, Barac- Lauc L, Smolej-Narancic N, Janicijevic B, Polasek O, Tenesa A, Macleod AK, Farrington SM, Rudan P, Hayward C, Vitart V, Rudan I, Wild SH, Dunlop MG, Wright AF, Campbell H, Wilson JF (2008). Runs of homozygosity in European populations. Am J Hum Genet 83:359-372

Meng EC1, Pettersen EF, Couch GS, Huang CC, Ferrin TE (2006). Tools for integrated sequence- structure analysis with UCSF Chimera. BMC Bioinformatics 7:339

Miller DT, Adam MP, Aradhya S, Biesecker LG, Brothman AR, Carter NP, Church DM, Crolla JA, Eichler EE, Epstein CJ, Faucett WA, Feuk L, Friedman JM, Hamosh A, Jackson L, Kaminsky EB, Kok K, Krantz ID, Kuhn RM, Lee C, Ostell JM, Rosenberg C, Scherer SW, Spinner NB, Stavropoulos DJ, Tepperberg JH, Thorland EC, Vermeesch JR, Waggoner DJ, Watson MS, Martin CL, Ledbetter DH (2010). Consensus statement: chromosomal microarray is a first-tier clinical diagnostic test for individuals with developmental disabilities or congenital anomalies. Am J Hum Genet 86:749- 764

Miura K, Kim OH, Lee HR, Namba N, Michigami T, Yoo WJ, Choi IH, Ozono K, Cho TJ (2014). Overgrowth syndrome associated with a gain-of-function mutation of the natriuretic peptide receptor 2 (NPR2) gene. Am J Med Genet A164A:156-163

Miura K, Namba N, Fujiwara M, Ohata Y, Ishida H, Kitaoka T, Kubota T, Hirai H, Higuchi C, Tsumaki N, Yoshikawa H, Sakai N, Michigami T, Ozono K (2012). An overgrowth disorder associated with excessive production of CGMP due to a gain-of-function mutation of the natriuretic peptide receptor 2 gene. PLoS One 7:e42180

Miyazawa T, Ogawa Y, Chusho H, Yasoda A, Tamura N, Komatsu Y, Pfeifer A, Hofmann F, Nakao K (2002). Cyclic GMP-dependent protein kinase II plays a critical role in C-type natriuretic peptide-mediated endochondral ossification. Endocrinology 143:3604-3610

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 162

References

Montaño AM, Sukegawa K, Kato Z, Carrozzo R, Di Natale P, Christensen E, Orii KO, Orii T, Kondo N, Tomatsu S (2007b). Effect of ‘attenuated’ mutations in mucopolysaccharidosis IVA on molecular phenotypes of N- acetylgalactosamine-6-sulfate sulfatase. J Inherit Metab Dis 30:758-767

Montano AM, Tomatsu S, Brusius A, Smith M, Orii T (2008). Growth charts for patients affected with Morquio A disease. Am J Med Genet 146:1286-1295

Montaño AM, Tomatsu S, Gottesman GS, Smith M, Orii T (2007b). International Morquio A Registry: clinical manifestation and natural course of Morquio A disease. J Inherit Metab Dis 30:165-174

Montavon T, Le Garrec JF, Kerszberg M, Duboule D (2008). Modeling Hox gene regulation in digits: reverse collinearity and the molecular origin of thumbness. Genes Dev 22:346-359

Morrone A, Tylee KL, Al-Sayed M, Brusius-Facchin AC, Caciotti A, Church HJ (2014 a). Molecular testing of 163 patients with Morquio A (Mucopolysaccharidosis IVA) identifies 39 novel GALNS mutations. Mol Genet Metab 112:160-170

Morrone A1, Caciotti A, Atwood R, Davidson K, Du C, Francis-Lyon P, Harmatz P, Mealiffe M, Mooney S, Oron TR, Ryles A, Zawadzki KA, Miller N (2014b). Morquio A syndrome-associated mutations: a review of alterations in the GALNS gene and a new locus-specific database.Hum Mut 35:1271-1279

Mossman J, Blunt S, Stephens R, Jones Ee, Pembrey M (1983). Hunter's disease in a girl: association with X: 5 chromosomal translocation disrupting the Hunter gene. Arch Dis Child 58:911-915

Mundlos S, Horn D (2014). Limb Malformations. An Atlas of Genetic Disorders of Limb Development. ISBN: 978-3-540-95927-4

Mundlos S, Olsen BR (1997a). Heritable diseases of the skeleton. Part I. Molecular insights into skeletal development-transcription factors and signaling pathways. FASEB J 11:125-132

Mundlos S, Olsen BR (1997b). Heritable diseases of the skeleton. Part II. Molecular insights into skeletal development-matrix components and their homeostasis. FASEB J 11:227-233

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 163

References

Murakami S, Balmes G, McKinney S, Zhang Z, Givol D, De Crombrugghe B (2004). Constitutive activation of MEK1 in chondrocytes causes Stat1-independent achondroplasia-like dwarfism and rescues the Fgfr3-deficient mouse phenotype. Genes Dev 18:290-305

Nagase T, Ishikawa K, Suyama M, Kikuno R, Hirosawa M, Miyajima N, Tanaka A, Kotani H, Nomura N, Ohara O (1998). Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res 5:355-364

Nakao K1, Ogawa Y, Suga S, Imura H (1992). Molecular biology and biochemistry of the natriuretic peptide system. II. Natriuretic peptide receptors. J Hypertens 10:1111-1114

Nakashima T1, Hayashi M, Fukunaga T, Kurata K, Oh-Hora M, Feng JQ, Bonewald LF, Kodama T, Wutz A, Wagner EF, Penninger JM, Takayanagi H (2011). Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature Med 17:1231-1234

Narayanan HS, Mohan KS, Jayasimha N, Rao BS (1987). A clinical and biochemical study of the mucopolysaccharidoses. Indian J Psychiatry 29:123-126

Naveed M, Al-Ali MT, Murthy SK, Al-Hajali S, Al-Khaja N, Deutsch S, Bottani A, Antonarakis SE, Nath SK, Radhakrishna U (2006). Ectrodactyly with aplasia of long bones (OMIM; 119100) in a large inbred Arab family with an apparent autosomal dominant inheritance and reduced penetrance: clinical and genetic analysis. Am J Med Genet 140A:1440‑1446

Naveed M1, Nath SK, Gaines M, Al-Ali MT, Al-Khaja N, Hutchings D, Golla J, Deutsch S, Bottani A, Antonarakis SE, Ratnamala U, Radhakrishna U (2007). Genomewide linkage scan for split‑hand/foot malformation with long‑bone deficiency in a large Arab family identifies two novel susceptibility loci on chromosomes 1q42.2‑q43 and 6q14.1. Am J Hum Genet 80:105‑111

Nelson J, Kinirons M (1988). Clinical findings in 12 patients with MPS IV A (Morquio_s disease). Further evidence for heterogeneity. Part II: Dental findings. Clin Genet 33:121-125

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 164

References

Nelson J, Thomas PS (1988). Clinical findings in 12 patients with MPS IV A (Morquio_s disease). Further evidence for heterogeneity. Part III: Odontoid dysplasia. Clin Genet 33:126-130

Nelson J1, Broadhead D, Mossman J (1988). Clinical findings in 12 patients with MPS IV A (Morquio_s disease). Further evidence for heterogeneity. Part I: Clinical and biochemical findings. Clin Genet 33:111-120

Netter FH (1987). Musculoskeletal system: anatomy, physiology, and metabolic disorders. Ciba-Geigy Corporation, Summit. ISBN 0914168886 pp:129-130

Neufeld EF, Muenzer J (1995) The mucopolysaccharidoses. In: Beaudet AL, Sly WS, Scriver C (eds) The metabolic basis of inherited disease. McGraw Hill, New York pp:2465-2493

Neufeld EF, Muenzer J (2001). The mucopolysaccharidoses.In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds). The metabolic and molecular basis of inherited disease. McGraw-Hill 3:3421-3452

Ng SB, Buckingham KJ, Lee C, Bigham AW, Tabor HK, Dent KM, Huff CD, Shannon PT, Jabs EW, Nickerson DA, Shendure J, Bamshad MJ (2010). Exome sequencing identifies the cause of amendelian disorder. Nat Genet 42:30-35

Ng SB, Turner EH, Robertson PD, Flygare SD, Bigham AW, Lee C, Shaffer T, Wong M, Bhattacharjee A, Eichler EE, Bamshad M, Nickerson DA, Shendure J (2009). Targeted capture and massively parallel sequencing of 12 human exomes. Nature 461:272-276

Nunes ME, Schutt G, Kapur RP, Luthardt F, Kukolich M, Byers P, Evans JP (1995). A second autosomal split hand/split foot locus maps to chromosome 10q24- q25. Hum Mol Genet 4:2165-2170

Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S, Nikaido I, Osato N, Saito R, Suzuki H, Yamanaka I, Kiyosawa H, Yagi K, Tomaru Y, Hasegawa Y, Nogami A, Schönbach C, Gojobori T, Baldarelli R, Hill DP, Bult C, Hume DA, Quackenbush J, Schriml LM, Kanapin A, Matsuda H, Batalov S, Beisel KW, Blake JA, Bradt D, Brusic V, Chothia C, Corbani LE, Cousins S, Dalla E, Dragani TA, Fletcher CF, Forrest A, Frazer KS, Gaasterland T, Gariboldi M,

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 165

References

Gissi C, Godzik A, Gough J, Grimmond S, Gustincich S, Hirokawa N, Jackson IJ, Jarvis ED, Kanai A, Kawaji H, Kawasawa Y, Kedzierski RM, King BL, Konagaya A, Kurochkin IV, Lee Y, Lenhard B, Lyons PA, Maglott DR, Maltais L, Marchionni L, McKenzie L, Miki H, Nagashima T, Numata K, Okido T, Pavan WJ, Pertea G, Pesole G, Petrovsky N, Pillai R, Pontius JU, Qi D, Ramachandran S, Ravasi T, Reed JC, Reed DJ, Reid J, Ring BZ, Ringwald M, Sandelin A, Schneider C, Semple CA, Setou M, Shimada K, Sultana R, Takenaka Y, Taylor MS, Teasdale RD, Tomita M, Verardo R, Wagner L, Wahlestedt C, Wang Y, Watanabe Y, Wells C, Wilming LG, Wynshaw-Boris A, Yanagisawa M, Yang I, Yang L, Yuan Z, Zavolan M, Zhu Y, Zimmer A, Carninci P, Hayatsu N, Hirozane-Kishikawa T, Konno H, Nakamura M, Sakazume N, Sato K, Shiraki T, Waki K, Kawai J, Aizawa K, Arakawa T, Fukuda S, Hara A, Hashizume W, Imotani K, Ishii Y, Itoh M, Kagawa I, Miyazaki A, Sakai K, Sasaki D, Shibata K, Shinagawa A, Yasunishi A, Yoshino M, Waterston R, Lander ES, Rogers J, Birney E, Hayashizaki Y; FANTOM Consortium; RIKEN Genome Exploration Research Group Phase I & II Team (2002). Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature 420:563-573

Olney RC (2006). C-type natriuretic peptide in growth: a new paradigm. Growth Horm IGF Res 16(suppl A):S6-S14

Olney RC (2009). Mechanisms of impaired growth: effect of steroids on bone and cartilage. Horm Res 72(Suppl 1): 30-35

Olney RC, Bükülmez H, Bartels CF, Prickett TC, Espiner EA, Potter LR, Warman ML (2006). Heterozygous mutations in natriuretic peptide receptor-B (NPR2) are associated with short stature. J Clin Endocrinol Metab 91:1229-1232

Olsen BR (2009). Genetics of human skeletal disease. In: O Pourquié (Ed.) The Skeletal System. Cold Spring Harbor Laboratory Press, NY, USA:317-340

Olsen BR, Reginato AM, Wang W (2000). Bone development. Annual Review of Cell and Developmental Biology 16:191-220

Opperman LA (2000) Cranial sutures as intramembranous bone growth sites. Dev Dyn 219:472-485

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 166

References

Ornitz DM (2005). FGF signaling in the developing endochondral skeleton. Cytokine Growth Factor Rev 16:205-213

Ornitz DM, Marie PJ (2002). FGF signaling pathways in endochondral and intramembranous bone development and human genetic disease. Genes Dev 16:1446-1465

Oti M, Brunner HG (2007). The modular nature of genetic diseases. Clin Genet 71:1- 1.

Ott J (1989). Computer-simulation methods in human linkage analysis. Proc Nat Acad Sci USA 86:41754178

Otto F1, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89:765-771

Pan J, Seeger-Nukpezah T, Golemis EA (2013). The role of the cilium in normal and abnormal cell cycles: emphasis on renal cystic pathologies. Cell Mol Life Sci 70:1849-1874

Parisi M, Glass I (2013). Joubert Syndrome and Related Disorders. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Fong CT, Mefford HC, Smith RJH, Stephens K, editors. SourceGeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle:1993-2015

Parla JS, Iossifov I, Grabill I, Spector MS, Kramer M, McCombie WR (2011). A comparative analysis of exome capture. Genome Biol 12:R97

Peifer M, Polakis P (2000). Wnt signaling in oncogenesis and embryogenesis—a look outside the nucleus. Science 287:1606-1609

Pejchalova K, Krejci P, Wilcox WR (2007). C-natriuretic peptide: an important regulator of cartilage. Mol Genet Metab 92: 210-215

Plotkin LI, Manolagas SC, Bellido T (2002). Transduction of cell survival signals by connexin-43 hemichannels. J Biol Chem 277:8648-8657

Pogue R, Lyons K (2006). BMP signaling in the cartilage growth plate. Curr Top Dev Biol 76:1-48

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 167

References

Pohl S, Marschner K, Storch S, Braulke T (2009). Glycosylation- and phosphorylation-dependent intracellular transport of lysosomal hydrolases. Biol Chem 390:521-527

Pollard LM, Jones JR, Wood TC (2013). Molecular characterization of 355 mucopolysaccharidosis patients reveals 104 novel mutations. J Inherit Metab Dis 36:179-87

Poretti A, Boltshauser E, Valente EM (2014). The molar tooth sign is pathognomonic for Joubert syndrome. Pediatr Neurol 50:e15

Potter LR, Abbey-Hosch S, Dickey DM (2006). Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocr Rev 27: 47-72

Primmer CR, Moller AP, Ellegren H (1999). A wide-range survey of cross-species microsatellite amplification in birds. Mol Ecol 5:365-378

Quinonez SC, Innis JW (2014). Human HOX gene disorders. Mol Genet Metab 111:4-15

Radhakrishna U, Bornholdt D, Scott HS, Patel UC, Rossier C, Engel H, Bottani A, Chandal D, Blouin JL, Solanki JV, Grzeschik KH, Antonarakis SE (1999). The phenotypic spectrum of GLI3 morphopathies includes autosomal dominant preaxial polydactyly type-IV and postaxial polydactyly type-A/B; No phenotype prediction from the position of GLI3 mutations. Am J Hum Genet 65:645-655

Radhakrishna U, Wild A, Grzeschik KH, Antonarakis SE (1997). Mutation in GLI3 in postaxial polydactyly type A. Nat Genet 17:269-271

Rajpar MH1, McDermott B, Kung L, Eardley R, Knowles L, Heeran M, Thornton DJ, Wilson R, Bateman JF, Poulsom R, Arvan P, Kadler KE, Briggs MD, Boot- Handford RP (2009). Targeted induction of endoplasmic reticulum stress induces cartilage pathology. PLOS Genet 5:e1000691

Ramer JC, Mowrey PN, Robins DB, Ligato S, Towfighi J, Ladda RL (1990). Five children with del (2)(q31q33) and one individual with dup (2)(q31q33) from a single family: review of brain, cardiac, andlimb malformations. Am J Med Genet 37:392-400

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 168

References

Rasalkar DD, Chu WC, Hui J, Chu CM, Paunipagar BK, Li CK (2011). Pictorial review of mucopolysaccharidosis with emphasis on MRI features of brain and spine. Br J Radiol 84:469-477

Rasmussen SA, Bieber FR, Benacerraf BR, Lachman RS, Rimoin DL, Holmes LB (1996). Epidemiology of osteochondrodysplasias: changing trends due to advances in prenatal diagnosis. Am J Med Genet 61:49-58

Rimoin D, Cohn LD, Eyre D (2004). Clinical–molecular correlations in the skeletal dysplasias. Pediatr Radiol 24:425-426

Rinne T, Brunner HG, van Bokhoven H (2007). p63-associated disorders. Cell Cycle 6:262-268

Rivera-Colón Y, Schutsky EK, Kita AZ, Garman SC (2012). The structure of human GALNS reveals the molecular basis for mucopolysaccharidosis IV A. J Mol Biol 423:736-751

Rodan GA (2003). The development and function of the skeleton and bone metastases. Cancer. 2003 Feb 1;97(3 Suppl):726-32

Rodda SJ, McMahon AP (2006). Distinct roles for hedgehog and canonical wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 133:3231-3244

Romani M, Micalizzi A, Kraoua I, Dotti MT, Cavallin M, Sztriha L, Ruta R, Mancini F, Mazza T, Castellana S, Hanene B, Carluccio MA, Darra F, Máté A, Zimmermann A, Gouider-Khouja N, Valente EM (2014). Mutations in B9D1 and MKS1 cause mild Joubert syndrome: expanding the genetic overlap with the lethal ciliopathy Meckel syndrome. Orphanet J Rare Dis 9:72

Romani M, Micalizzi A, Valente EM (2013). Joubert syndrome: congenital cerebellar ataxia with the molar tooth. Lan Neurol 12:894-905

Romereim SM, Dudley AT (2011). Cell polarity: the missing link in skeletal morphogenesis? Organogenesis 7:217-228

Ross, Lawrence M, Lamperti, Edward D (2006). Thieme Atlas of Anatomy: General Anatomy and Musculoskeletal System. Thieme. ISBN 1-58890-419-9

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 169

References

Rozen S, Skaletsky H (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365-386

Ruiz-Perez VL, Goodship JA (2009). Ellis–van Creveld syndrome and Weyers acrodental dysostosis are caused by cilia-mediated diminished response to hedgehog ligands.AmJ Med Genet Part C 151C:341-351

Saladin, Kenneth (2012). Anatomy and Physiology: The Unity of Form and Function. New York: McGrawHill. p. 217. ISBN 9780073378251.

Sali A, Blundell TL (1993). Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol 234:779-815

Sambrook J, Russell D (2001). Molecular cloning: A laboratory manual cold spring harb protoc (3rd ed) pp:476-484

Sandridge AL, Takeddin J, Al-Kaabi E, Frances Y (2010) Consanguinity in Qatar: knowledge, attitude and practice in a population born between 1946 and 1991. J Biosoc Sci 42:59-82

Sanger F, Nicklen S, Coulson AR (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467

Santamaria R, Chaba A, Callahan JW, Grinberg D, Vilageliu L (2007). Expression and characterization of 14 GLB1mutant alleles found in GM1-gangliosidosis and morquio B patients. J Lipid Res 48:2275-2282

Santen GW1, Aten E, Sun Y, Almomani R, Gilissen C, Nielsen M, Kant SG, Snoeck IN, Peeters EA, Hilhorst-Hofstee Y, Wessels MW, den Hollander NS, Ruivenkamp CA, van Ommen GJ, Breuning MH, den Dunnen JT, van Haeringen A, Kriek M (2012). Mutations in SWI/SNF chromatin remodeling complex gene ARID1B cause Coffin-Siris syndrome. Nat Genet 44:379-380

Sarfarazi M, Akarsu AN, Sayli BS (1995). Localization of the syndactyly type II (synpolydactyly) locus to 2q31 region and identification of tight linkage to HOXD8 intragenic marker. Hum Mol Gene 4:1453-1458

Savarirayan R, Rimoin DL (2002). The skeletal dysplasias. Best Pract Res Clin Endocrinol Metab 16:547-560

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 170

References

Sawai H, Komori S, Ida A, Henmi T, Bessho T, Koyama K (1999). Prenatal diagnosis of thanatophoric dysplasia by mutational analysis of the fibroblast growth factor receptor 3 gene and a proposed correction of previously published PCR results. Prenat Diagn 19:21-24

Scherer SW1, Poorkaj P, Allen T, Kim J, Geshuri D, Nunes M, Soder S, Stephens K, Pagon RA, Patton MA, Berg MA, Donlon T, Rivera H, Pfeiffer RA, Naritomi K, Hughes H, Genuardi M, Gurrieri F, Neri G, Lovrein E, Magenis E, Tsui LC, Evans JP (1994). Fine mapping of the autosomal dominant split hand/split foot locus on chromosome 7 band q21.3-q22.1. Am J Hum Genet 55:12-20

Schmutz J1, Martin J, Terry A, Couronne O, Grimwood J, Lowry S, Gordon LA, Scott D, Xie G, Huang W, Hellsten U, Tran-Gyamfi M, She X, Prabhakar S, Aerts A, Altherr M, Bajorek E, Black S, Branscomb E, Caoile C, Challacombe JF, Chan YM, Denys M, Detter JC, Escobar J, Flowers D, Fotopulos D, Glavina T, Gomez M, Gonzales E, Goodstein D, Grigoriev I, Groza M, Hammon N, Hawkins T, Haydu L, Israni S, Jett J, Kadner K, Kimball H, Kobayashi A, Lopez F, Lou Y, Martinez D, Medina C, Morgan J, Nandkeshwar R, Noonan JP, Pitluck S, Pollard M, Predki P, Priest J, Ramirez L, Retterer J, Rodriguez A, Rogers S, Salamov A, Salazar A, Thayer N, Tice H, Tsai M, Ustaszewska A, Vo N, Wheeler J, Wu K, Yang J, Dickson M, Cheng JF, Eichler EE, Olsen A, Pennacchio LA, Rokhsar DS, Richardson P, Lucas SM, Myers RM, Rubin EM (2004). The DNA sequence and comparative analysis of human chromosome 5. Nature 431:268-274.

Schramm T, Gloning KP, Minderer S, Daumer-Haas C, Hörtnagel K, Nerlich A, Tutschek B (2009). Prenatal sonographic diagnosis of skeletal dysplasias. Ultrasound Obstet Gynecol 34:160-170

Schulpen TW, van Wieringen JC, van Brummen PJ, van Riel JM, Beemer FA, Westers P, Huber J (2006). Infant mortality, ethnicity, and genetically determined disorders in The Netherlands. Eur J Public Health 16:291-294

Schuster SC (2008). Next-generation sequencing transforms today's biology. Nat Methods 5:16-18

Schwabe GC, Mundlos S (2004). Genetics of congenital hand anomalies. Handchir Mikrochir Plast Chir 36:85-97

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 171

References

Serra R (2008). Role of intraflagellar transport and primary cilia in skeletal development. Anat Rec 291:1049-1061

Settle SH Jr1, Rountree RB, Sinha A, Thacker A, Higgins K, Kingsley DM (2003). Multiple joint and skeletal patterning defects caused by single and double mutations in the mouse Gdf6 and Gdf5 genes. Dev Biol 254:116-130

Shamseldin HE, Faden MA, Alashram W, Alkuraya FS (2012). Identification of a novel DLX5 mutation in a family with autosomal recessive split hand and foot malformation. J Med Genet 49:16-20

Sheffield VC, Nishimura DY, Stone EM (1995). Novel approaches to linkage mapping. Curr Opin Genet Dev 5:335-341

Shine I (1972) Serendipity in St. Helena: A Genetical and Medical Study of an Isolated Community. Human Biology 44:363-365

Shubin NH, Alberch PA (1986). Morphogenic approach to the origin and basic organization of the tetrapod limb. Evol Biol 20:319-387

Shum L, Coleman CM, Hatakeyama Y, Tuan RS (2003). Morphogenesis and dysmorphogenesis of the appendicular skeleton. Birth Defects Res. C Embryo Today 69:102-122

Silventoinen K, Sammalisto S, Perola M, Boomsma DI, Cornes BK, Davis C, Dunkel L, De Lange M, Harris JR, Hjelmborg JV, Luciano M, Martin NG, Mortensen J, Nisticò L, Pedersen NL, Skytthe A, Spector TD, Stazi MA, Willemsen G, Kaprio J (2003). Heritability of adult body height: a comparative study of twin cohorts in eight countries. Twin Res 6:399-408

Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Connell CR, Heiner C, Kent SB, Hood LE (1986). Fluorescence detection in automated DNA sequence analysis. Nature 321:674-679

Song B, Haycraft CJ, Seo HS, Yoder BK, Serra R (2007). Development of the postnatal growth plate requires intraflagellar transport proteins. Dev Biol 305:202- 216

Sowińska-Seidler A, Socha M, Jamsheer A (2014). Split-hand/foot malformation - molecular cause and implications in genetic counseling. J Appl Genet 55:105- 115

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 172

References

Spielmann M, Kakar N, Tayebi N, Leettola C, Nürnberg G, Sowada N, Lupiáñez DG, Harabula , Flöttmann R, Horn D, Chan WL, Wittler L, Yilmaz R, Altmüller J, Thiele H, van Bokhoven H, Schwartz CE, Nürnberg P, Bowie JU, Ahmad J, Kubisch C, Mundlos S, Borck G (2016). Exome sequencing and CRISPR/Cas genome editing identify mutations of ZAK as a cause of limb defects in humans and mice. Genome Res 26:183-191

Spranger JW (1977). Catabolic disorders of complex carbohydrates. Postgrad Med J 53:441-449

Stadler HS, Higgins KM, Capecchi MR (2001). Loss of Eph-receptor expression correlates with loss of cell adhesion and chondrogenic capacity in Hoxa13 mutant limbs. Development 128:4177-4188

Stenson PD, Mort M, Ball EV, Shaw K, Phillips A, Cooper DN (2014). The Human Gene Mutation Database: building a comprehensive mutation repository for clinical and molecular genetics, diagnostic testing and personalized genomic medicine. Hum Genet 133:1-9

Stickens D, Behonick DJ, Ortega N, Heyer B, Hartenstein B, Yu Y, Fosang AJ, Schorpp-Kistner M, Angel P, Werb Z (2004). Altered endochondral bone development in matrix metalloproteinase 13-deficient mice. Development 131: 5883-5895

St-Jacques B, Hammerschmidt M, McMahon AP (1999). Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes Dev 13:2072-2086

Stricker S, Mundlos S (2014). Development of the Limbs. In: Mundlos S, Horn D (eds). Limb Malformations: An Atlas of Genetic Disorders of Limb Development. ISBN 978-3-540-95928-1 Pp: 2-9

Sudhakar SC, Mahalingam K (2011). Structural and functional analysis of N- acetylgalactosamine-6-sulfate sulfatase using bioinformatics tools: insight into Mucopolysaccharidosis IVA. J Pharm Res 4:3958-3962

Sukegawa K, Nakamura H, Kato Z, Tomatsu S, Montano AM, Fukao T, Toietta G, Tortora P, Orii T, Kondo N (2000). Biochemical and structural analysis of

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 173

References

missense mutations in N-acetylgalactosamine-6-sulfate sulfatase causing mucopolysaccharidosis IVAphenotypes. Hum Mol Genet 9:1283-1290

Sun Y, Ruivenkamp CA, Hoffer MJ, Vrijenhoek T, Kriek M, van Asperen CJ, den Dunnen JT, Santen GW (2015). Next-generation diagnostics: gene panel, exome, or whole genome? Hum Mutat. 36:648-655

Syvanen AC (2005). Toward genome-wide SNP genotyping. Nat Genet, 37: S5-S10

Szymanska K, Berry I, Logan CV, Cousins SR, Lindsay H, Jafri H, Raashid Y, Malik-Sharif S, Castle B, Ahmed M, Bennett C, Carlton R, Johnson CA (2012). Founder mutations and genotype-phenotype correlations in Meckel- Gruber syndrome and associated ciliopathies. Cilia 1:18

Taichman RS (2005). Blood and bone: Two tissues whose fates are intertwined to create the hematopoietic stem cell niche. Blood 105:2631-2639

Takeda S, Bonnamy JP, Owen MJ, Ducy P, Karsenty G (2001). Continuous expression of Cbfa1 in nonhypertrophic chondrocytes uncovers its ability to induce hypertrophic chondrocyte differentiation and partially rescues Cbfa1- deficient mice. Genes Dev 15:467-481

Tan X, Weng T, Zhang J, Wang J, Li W, Wan H, Lan Y, Cheng X, Hou N, Liu H, Ding J, Lin F, Yang R, Gao X, Chen D, Yang X (2007). Smad4 is required for maintaining normal murine postnatal bone homeostasis. J Cell Sci 120:2162- 2170

Tarchini B, Duboule D (2006) Control of Hoxd genes’ collinearity during early limb development. Dev Cell 10:93-103

Taylor KR, Gallo RL (2006). Glycosaminoglycans and their proteoglycans: host associated molecular patterns for initiation and modulation of inflammation. FASEB J 20:9-22

Teixeira CC, Agoston H, Beier F (2008) Nitric oxide, C-type natriuretic peptide and cGMP as regulators of endochondral ossification. Dev Biol 319:171-178

Thiel C, Kessler K, Giessl A, Dimmler A, Shalev SA, von der Haar S, Zenker M, ZahnleiterD, Sto¨ ss H, Beinder E, Abou Jamra R, EkiciAB, Schro¨der-Kress N, Aigner T, Kirchner T, Reis A, Brandsta¨tter JH, Rauch A (2011).

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 174

References

NEK1mutations cause short-rib polydactyly syndrome type Majewski. Am J Hum Genet 88:106-114

Thomas JT, Kilpatrick MW, Lin K, Erlacher L, Lembessis P, Costa T, Tsipouras P, Luyten FP (1997). Disruption of human limb morphogenesis by a dominant negative mutation in CDMP1. Nat Genet 17:58-64

Thomas JT, Lin K, Nandedkar M, Camargo M, Cervenka J, Luyten FP (1996). A human chondrodysplasia due to a mutation in TGF-b superfamily member. Nat. Genet. 12:315-317

Tomatsu S, Montano AM, Lopez P, Trandaﬁrescu GG, Gutierrez MA, Oikawa H, Nishioka H, Vieira MB, Orii T, Noguchi A (2006). Determinant factors of spectrum of missense variants in mucopolysaccharidosis IVA gene. Mol Genet Metab 89:139-149

Tomatsu S, Montaño AM, Nishioka T, Gutierrez MA, Peña OM, Tranda Firescu GG, Lopez P, Yamaguchi S, Noguchi A, Orii T (2005). Mutation and polymorphism spectrum of the GALNS gene in mucopolysaccharidosis IVA (Morquio A). Hum Mutat 26:500-512

Tomatsu S, Montaño AM, Oguma T, Dung VC, Oikawa H, Gutiérrez ML, Yamaguchi S, Suzuki Y, Fukushi M, Barrera LA, Kida K, Kubota M, Orii T (2010). Validation of disaccharide compositions derived from dermatan sulfate and heparin sulfate in mucopolysaccharidoses and mucolipidoses II and III by tandem mass spectrometry. Mol Genet Metab 99:124-131

Tomatsu S, Montaño AM, Oikawa H, Smith M, Barrera L, Chinen Y, Thacker MM, Mackenzie WG, Suzuki Y, Orii T (2011). Mucopolysaccharidosis type IVA (Morquio A disease): clinical review and current treatment. Curr Pharm Biotechnol 12:931-945

Tomatsu S, Nishioka T, Montaño AM, Gutierrez MA, Pena OS, Orii KO, Sly WS, Yamaguchi S, Orii T, Paschke E, Kircher SG, Noguchi A (2004). Mucopolysaccharidosis IVA: identification of mutations and methylation study in GALNS gene. J Med Genet 41:e98

Tomatsu S, Orii KO, Vogler C, Grubb JH, Snella EM, Gutierrez MA, Dieter T, Sukegawa K, Orii T, Kondo N, Sly WS (2002). Missense models

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 175

References

[Gus(tm(E536A)Sly), Gus(tm(E536Q)Sly), and Gus (tm(L175F)Sly)] of murine mucopolysaccharidosis type VII produced by targeted mutagenesis. Proc Nat Acad Sci 99:14982-14987

Towers M, Tickle C (2009). Growing models of vertebrate limb development. Development. 136:179-190

Triggs-Raine B, Salo TJ, Zhang H, Wicklow BA, Natowicz MR (1999). Mutations in HYAL1, a member of a tandemly distributed multigene family encoding disparate hyaluronidase activities, cause a newly described lysosomal disorder, mucopolysaccharidosis IX. Proc Nat Acad Sci 96:6296-6300

Tsuji K, Bandyopadhyay A, Harfe BD, Cox K, Kakar S, Gerstenfeld L, Einhorn T, Tabin CJ, Rosen V (2006). BMP2 activity, although dispensable for bone formation, is required for the initiation of fracture healing. Nat Genet 38:1424- 1429

Tsuji T, Kunieda T (2005). A loss-of-function mutation in natriuretic peptide receptor 2 (Npr2) gene is responsible for disproportionate dwarfism in cn/cn mouse. J Biol Chem 280:14288-14292

Tu X, Joeng KS, Long F (2012). Indian hedgehog requires additional effectors besides Runx2 to induce osteoblast differentiation. Dev Biol 362:76-82

Tuli R, Tuli S, Nandi S, Huang X, Manner PA, Hozack WJ, Danielson KG, Hall DJ, Tuan RS (2003). Transforming growth factor-betamediated chondrogenesis of human mesenchymal progenitor cells involves N-cadherin and mitogen- activated protein kinase and wnt signaling cross-talk. J Biol Chem 278:41227- 41236

Turner N, Grose R (2010). Fibroblast growth factor signalling: From development to cancer. Nat Rev Cancer 10:116-129

Ugur SA, Tolun A (2008). Homozygous WNT10B mutation and complex inheritance in split-hand/foot malformation. Hum Mol Genet 17:2644-2653

Umm-e-Kalsoom, Basit S, Kamran-ul-Hassan Naqvi S, Ansar M, Ahmad W (2012). Genetic mapping of an autosomal recessive postaxial polydactyly type A to chromosome 13q13.3-q21.2 and screening of the candidate genes. Hum Genet 131:415-422

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 176

References

Unger SA (2002). genetic approach to the diagnosis of skeletal dysplasia. Clin Orthop Relat Res:32-38

Vajo Z, Francomano CA, Wilkin DJ (2000). The molecular and genetic basis of fibroblast growth factor receptor 3 disorders: the achondroplasia family of skeletal dysplasias, Muenke craniosynostosis, and Crouzon syndrome with acanthosis nigricans. Endocr Rev 21:23-39

Valente EM, Brancati F, Dallapiccola B (2008). Genotypes and phenotypes of Joubert syndrome and related disorders. Eur J Med Genet 51:1-23

Valente EM1, Brancati F, Silhavy JL, Castori M, Marsh SE, Barrano G, Bertini E, Boltshauser E, Zaki MS, Abdel-Aleem A, Abdel-Salam GM, Bellacchio E, Battini R, Cruse RP, Dobyns WB, Krishnamoorthy KS, Lagier-Tourenne C, Magee A, Pascual-Castroviejo I, Salpietro CD, Sarco D, Dallapiccola B, Gleeson JG; International JSRD Study Group (2006). AHI1 gene mutations cause specific forms of Joubert syndrome-related disorders. Ann Neurol 59:527-534

Valstar MJ, Neijs S, Bruggenwirth HT, Olmer R, Ruijter GJ, Wevers RA, van Diggelen OP, Poorthuis BJ, Halley DJ, Wijburg FA (2010). Mucopolysaccharidosis type IIIA: clinical spectrum and genotype-phenotype correlations. Ann Neurol 68:876-887 van der Zwaag PA, Dijkhuizen T, Gerssen-Schoorl KB, Colijn AW, Broens PM, Flapper BC, van Ravenswaaij-Arts CM (2010). An interstitial duplication of chromosome 13q31.3q32.1 further delineates the critical region for postaxial polydactyly type A2. Eur J Med Genet 53:45-49

Varela I, Tarpey P, Raine K, Huang D, Ong CK, Stephens P, Davies H, Jones D, Lin ML, Teague J, Bignell G, Butler A, Cho J, Dalgliesh GL, Galappaththige D, Greenman C, Hardy C, Jia M, Latimer C, Lau KW, Marshall J, McLaren S, Menzies A, Mudie L, Stebbings L, Largaespada DA, Wessels LF, Richard S, Kahnoski RJ, Anema J, Tuveson DA, Perez-Mancera PA, Mustonen V, Fischer A, Adams DJ, Rust A, Chan-on W, Subimerb C, Dykema K, Furge K, Campbell PJ, Teh BT, Stratton MR, Futreal PA (2011). Exome sequencing identifies frequent mutation of the SWI/SNF complex gene PBRM1 in renal carcinoma. Nature 469:539-542

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 177

References

Vasluian E, van der Sluis CK, van Essen AJ, Bergman JE, Dijkstra PU, Reinders- Messelink HA, de Walle HE (2013). Birth prevalence for congenital limb defects in the northern Netherlands: a 30-year population-based study. BMC Muscul Dis 14:323

Vasques GA, Amano N, Docko AJ, Funari MF, Quedas EP, Nishi MY, Arnhold IJ, Hasegawa T, Jorge AA (2013). Heterozygous mutations in natriuretic peptide receptor-B (NPR2) gene as a cause of short stature in patients initially classified as idiopathic short stature. J Clin Endocrinol Metab 98:E1636–E1644

Vasques GA, Arnhold JP, Jorge AL (2014). Role of the natriuretic peptide system in normal growth and growth disorders. Horm Res Paediatr 82:222-229

Vega RB1, Matsuda K, Oh J, Barbosa AC, Yang X, Meadows E, McAnally J, Pomajzl C, Shelton JM, Richardson JA, Karsenty G, Olson EN (2004). Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell 119:555-566

Ventruto V, Theo G, Celona A, Fioretti G, Pagano L, Stabile M, Cavaliere ML (1980). A and B postaxial polydactyly in two members of the same family. Clin Genet 18:342-347

Verma PK, El-Harouni AA (2015). Review of literature: genes related to postaxial polydactyly. Front Pediatr 3:8

Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M, Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lipshutz R, Chee M, Lander ES (1998). Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 280:1077-82.

Wang X, Xin Q, Li L, Li J, Zhang C, Qiu R, Qian C, Zhao H, Liu Y, Shan S, Dang J, Bian X, Shao C, Gong Y, Liu Q (2014). Exome sequencing reveals a heterozygous DLX5 mutation in a Chinese family with autosomal-dominant split-hand/foot malformation. Eur J Hum Genet 22:1105-1110

Wang Z, Moult J (2001). SNPs, protein structure, and disease. Hum Mutat 17:263- 270.

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 178

References

Warmann ML, Cormier-Daire V, Hall C, Krakow D, Lachman R, Lemerrer M, Mortier G, Mundlos S, Nishimura G, Rimoin DL, Robertson S, Savarirayan R, Sillence D, Spranger J, Unger S, Zabel B, Superti-Furga A (2011). Nosology and classification of genetic skeletal disorders: 2010 Revision. Am J Med Genet 155:943-968

Waters AM, Beales PL (2011). Ciliopathies: an expanding disease spectrum. Pediatr Neph 26:1039-1056

Weatherbee SD1, Niswander LA, Anderson KV (2009). A mouse model for Meckel syndrome reveals Mks1 is required for ciliogenesis and hedgehog signaling. Hum Molec Genet 18:4565-4575

Weber B, Xiao-Hui Guo, Wim J Kleijer, Jacques JP, van de Kamp, Ben JHM, Poorthuis, John J, Hopwood (1999). Sanfilippo type B syndrome (mucopolysaccharidosis III B): allelic heterogeneity corresponds to the wide spectrum of clinical phenotypes. Eur J Hum Genet 7:34-44

White KK (2012). Mucopolysaccharidoses: Etiology, Classification, Deformities Unique to Each Type, Treatment Modalities and Indications for Surgical Intervention. Spine Deformity Preview Issue, 114e118

Whyte MP (1994). Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocr Rev 15:439-461

Wilcox WR, Coulter CP, Schmitz ML (2013). Congenital limb deficiency disorders. Clin Perinatol 42:281-300

Wit JM, Kiess W, Mullis P, Valverde-Franco G, Liu H, Davidson D, Chai S, Valderrama-Carvajal H (2011). Genetic evaluation of short stature. Best Pract Res Clin Endocrinol Met 25:1-17

Woltering JM, Duboule D (2010) The origin of digits: expression patterns versus regulatory mechanisms. Dev Cell 18:526-532

Wujek P, Kida E, Walus M, Wisniewski KE, Golabek AA (2004). N-glycosylation is crucial for folding, trafficking, and stability of human tripeptidyl-peptidase I. J Biol Chem 279:12827-12839

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 179

References

Xing DJ, Zhang HX, Huang N, Wu KC, Huang XF, Huang F, Tong Y, Pang CP4, Qu J, Jin ZB. (2014). Comprehensive molecular diagnosis of Bardet-Biedl syndrome by high-throughput targeted exome sequencing. PLoS One 9:e90599

Xing L, Boyce BF (2005). Regulation of apoptosis in osteoclasts and osteoblastic cells. Biochem Biophys Res Commun 328:709-720

Yang G, Zhu L, Hou N, Lan Y, Wu XM, Zhou B, Teng Y, Yang X (2014). Osteogenic fate of hypertrophic chondrocytes. Cell Res 24:1266-1269

Yang L, Tsang KY, Tang HC, Chan D, Cheah KS (2014). Hypertrophic chondrocytes can become osteoblasts and osteocytes in endochondral bone formation. PNAS 111:12097-12102

Yang Y, Niswander L (1995). Interaction between the signaling molecules WNT7a and SHH during vertebrate limb development: dorsal signals regulate anteroposterior patterning. Cell (1995) 80:939–947.

Yasoda A, Ogawa Y, Suda M, Tamura N, Mori K, Sakuma Y, Chusho H, Shiota K, Tanaka K, Nakao K (1998). Natriuretic peptide regulation of endochondral ossification. Evidence for possible roles of the C-type natriuretic peptide/guanylyl cyclase-B pathway. J Biol Chem 273:11695-11700

Yasuda E, Fushimi K, Suzuki Y, Shimizu K, Takami T, Zustin J, Patel P, Ruhnke K, Shimada T, Boyce B, et al (2013). Pathogenesis of Morquio A syndrome: an autopsied case reveals systemic storage disorder. Mol Genet Metab 109:301- 311

Ye XSG, Fan M, Shi L, JabsEW, Huang S, Guo R, Bian Z (2006). A novel heterozygous deletion in the EVC2 gene causes Weyers acrofacial dysostosis. Hum Genet 119:199-205

Ye Y, Li Z, Godzik A (2006). Modeling and analyzing three-dimensional structures of human disease proteins. Pac Symp Biocomput: 439-450

Young MA, Gonfloni S, Superti-Furga G, Roux B, Kuriyan J (2001). Dynamic coupling between the SH2 and SH3 domains of c-Src and Hck underlies their inactivation by C-terminal tyrosine phosphorylation. Cell 105:115-126

Yuan X, Serra RA, Yang S (2015). Function and regulation of primary cilia and intraflagellar transport proteins in the skeleton. Ann N Y Acad Sci 1335:78-99

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 180

References

Zakany J, Duboule D (2007). The role of Hox genes during vertebrate limb development. Curr. Opin Genet Dev 17:359-366

Zelzer B, Olsen BR (2003). The genetic basis for skeletal diseases. Nature 423: 343- 348

Zhang Y (2008). I-TASSER server for protein 3D structure prediction. BMC Bioinformatics. 9:40

Zhang Z, Miteva MA, Wang L, Alexov E (2012). Analyzing effects of naturally occurring missense mutations. Comput Math Methods Med: 805827

Zhang Z, Sui P, Dong A, Hassell J, Cserjesi P, Chen YT, Behringer RR, Sun X (2010). Preaxial polydactyly: interactions among ETV, TWIST1 and HAND2 control anterior-posterior patterning of the limb. Development 137:3417-3426

Zhang Z, Teng S, Wang L, Schwartz CE, Alexov E (2010). Computational analysis of missense mutations causing Snyder-Robinson syndrome. Hum Mutat 31:1043- 1049

Zhao H, Tian Y, Breedveld G, Huang S, Zou Y, Y J, Chai J, Li H, Li M, Oostra BA, Lo WH, Heutink P (2002). Postaxial polydactyly type A/B (PAPA/B) is linked to chromosome 19p13.1-13.2 in a Chinese kindred. Eur J Hum Genet 10:162- 166

Zhou H, Mak W, Zheng Y, Dunstan CR, Seibel MJ (2008). Osteoblasts directly control lineage commitment of mesenchymal progenitor cells through Wnt signaling. J Biol Chem 283:1936-1945

Zhou X, von der Mark K, Henry S, Norton W, Adams H, de Crombrugghe B (2014). Chondrocytes transdifferentiate into osteoblasts in endochondral bone during development, postnatal growth and fracture healing in mice. PLoS Genet 10:e1004820

Zuniga A, Zeller R, Probst S (2012). The molecular basis of human congenital limb malformations WIREs Dev Biol 1:803-822

Genetic Mapping and Mutation Analysis of Genes Causing Human Hereditary Skeletal Disorders 181