Comprehensive Skeletal Dysplasias and Disorders Panel
Test code: MA3301
Is a 251 gene panel that includes assessment of non-coding variants.
Is ideal for patients with a clinical suspicion of disorders involving the skeletal system.
About Comprehensive Skeletal Dysplasias and Disorders
This panel covers a broad spectrum of skeletal disorders including common and rare skeletal dysplasias (eg. achondroplasia, COL2A1 related dysplasias, diastrophic dysplasia, various types of spondylo-metaphyseal dysplasias), various ciliopathies with skeletal involvement (eg. short rib-polydactylies, asphyxiating thoracic dysplasia dysplasias and Ellis-van Creveld syndrome), various subtypes of osteogenesis imperfecta, campomelic dysplasia, slender bone dysplasias, dysplasias with multiple joint dislocations, chondrodysplasia punctata group of disorders, neonatal osteosclerotic dysplasias, osteopetrosis and related disorders, abnormal mineralization group of disorders (eg hypopohosphatasia), osteolysis group of disorders, disorders with disorganized development of skeletal components, overgrowth syndromes with skeletal involvement, craniosynostosis syndromes, dysostoses with predominant craniofacial involvement, dysostoses with predominant vertebral involvement, patellar dysostoses, brachydactylies, some disorders with limb hypoplasia-reduction defects, ectrodactyly with and without other manifestations, polydactyly-syndactyly-triphalangism group of disorders, and disorders with defects in joint formation and synostoses.
Availability
4 weeks
Gene Set Description
Genes in the Comprehensive Skeletal Dysplasias and Disorders Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD
ACAN# Spondyloepimetaphyseal dysplasia, aggrecan type, AD/AR 20 56 Spondyloepiphyseal dysplasia, Kimberley type, Osteochondritis dissecans, short stature, and early-onset osteoarthritis
ACP5 Spondyloenchondrodysplasia with immune dysregulation AR 12 26
ACVR1 Fibrodysplasia ossificans progressiva AD 14 19
ADAMTS10 Weill-Marchesani syndrome AR 8 14
ADAMTS17 Weill-Marchesani-like syndrome AR 6 7
ADAMTSL2*,# Geleophysic dysplasia 3 AR 8 28
AGPS Rhizomelic chondrodysplasia punctata type 3 AR 4 8
AIFM1 Deafness, Combined oxidative phosphorylation deficiency XL 27 31 6, Cowchock syndrome
AKT1 Proteus syndrome, Cowden syndrome AD 5 6
ALPL Odontohypophosphatasia, Hypophosphatasia perinatal AD/AR 78 291 lethal, infantile, juvenile and adult forms
https://blueprintgenetics.com/ ALX3 Frontonasal dysplasia type 1 AR 8 8
ALX4 Frontonasal dysplasia type 2, Parietal foramina AD/AR 15 24
AMER1 Osteopathia striata with cranial sclerosis XL 14 40
ANKH Calcium pyrophosphate deposition disease (familial AD 13 20 chondrocalcinosis type 2), Craniometaphyseal dysplasia autosomal dominant type
ANKRD11* KBG syndrome AD 142 132
ANO5 Gnathodiaphyseal dysplasia, LGMD2L and distal MMD3 AD/AR 64 121 muscular dystrophies
ARHGAP31 Adams-Oliver syndrome AD 3 6
ARSB Mucopolysaccharidosis (Maroteaux-Lamy) AR 118 201
ARSE* Chondrodysplasia punctata X-linked recessive, XL 22 46 brachytelephalangic type (CDPX1)
ATP6V0A2 Cutis laxa, Wrinkly skin syndrome AR 16 56
B3GALT6 Spondyloepimetaphyseal dysplasia with joint laxity, AR 17 27 Ehlers-Danlos syndrome
B3GAT3* Multiple joint dislocations, short stature, craniofacial AR 6 13 dysmorphism, and congenital heart defects
B4GALT7 Ehlers-Danlos syndrome, progeroid form AR 8 9
BGN Spondyloepimetaphyseal dysplasia, X-linked, Meester- XL 8 7 Loeys syndrome
BHLHA9 Syndactyly Malik-Percin type, mesoaxial synostotic, with AR 4 43 phalangeal reduction, Split hand-foot malformation with long bone deficiency (SHFLD3), Gollop-Wolfgang
BMP1 Osteogenesis imperfecta AR 7 21
BMP2 Brachydactyly type A2 AD 5 28
BMPER Diaphanospondylodysostosis AR 6 19
BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly AD/AR 12 23 C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH)
CA2 Osteopetrosis, with renal tubular acidosis AR 9 31
CANT1 Desbuquois dysplasia AR 20 28
CASR Hypocalcemia, Neonatal hyperparathyroidism, Familial AD/AR 104 396 Hypocalciuric hypercalcemia with transient Neonatal hyperparathyroidism
CDC45 Meier-Gorlin syndrome 7 AR 10 19
CDC6 Meier-Gorlin syndrome (Ear-patella-short stature AR 2 2 syndrome)
https://blueprintgenetics.com/ CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CDT1 Meier-Gorlin syndrome (Ear-patella-short stature AR 6 12 syndrome)
CHST14 Ehlers-Danlos syndrome, musculocontractural AR 15 21
CHST3 Spondyloepiphyseal dysplasia with congenital joint AR 18 37 dislocations (recessive Larsen syndrome)
CHSY1 Temtamy preaxial brachydactyly syndrome AR 6 16
CKAP2L Filippi syndrome AR 7 7
CLCN5 Proteinuria, low molecular weight, with hypercalciuric XL 48 272 nephrocalcinosis, Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease
CLCN7 Osteopetrosis AD/AR 15 98
COL10A1 Metaphyseal chondrodysplasia, Schmid AD 21 53
COL11A1 Marshall syndrome, Fibrochondrogenesis, Stickler AD/AR 34 94 syndrome type 2
COL11A2 Weissenbacher-Zweymuller syndrome, Deafness, AD/AR 29 57 Otospondylomegaepiphyseal dysplasia, Fibrochondrogenesis, Stickler syndrome type 3 (non- ocular)
COL1A1 Ehlers-Danlos syndrome, Caffey disease, Osteogenesis AD 352 962 imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4
COL1A2 Ehlers-Danlos syndrome, cardiac valvular form, AD/AR 186 509 Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4
COL27A1 Steel syndrome AR 7 7
COL2A1 Avascular necrosis of femoral head, Rhegmatogenous AD 180 561 retinal detachment, Epiphyseal dysplasia, with myopia and deafness, Czech dysplasia, Achondrogenesis type 2, Platyspondylic dysplasia Torrance type, Hypochondrogenesis, Spondyloepiphyseal dysplasia congenital (SEDC), Spondyloepimetaphyseal dysplasia (SEMD) Strudwick type, Kniest dysplasia, Spondyloperipheral dysplasia, Mild SED with premature onset arthrosis, SED with metatarsal shortening, Stickler syndrome type 1
COL9A1 Stickler syndrome recessive type, Multiple epiphyseal AD/AR 9 6 dysplasia type 6 (EDM6)
COL9A2 Stickler syndrome, Multiple epiphyseal dysplasia type 2 AD/AR 7 12 (EDM2)
COL9A3 Multiple epihyseal dysplasia type 3 (EDM3), Stickler AD/AR 10 14 syndrome recessive type
https://blueprintgenetics.com/ COMP Pseudoachondroplasia, Multiple ephiphyseal dysplasia AD 43 186
CREBBP Rubinstein-Taybi syndrome AD 175 362
CRLF1 Crisponi syndrome, Cold-induced sweating syndrome, AR 21 37 type 1
CRTAP Osteogenesis imperfecta type 2, Osteogenesis imperfecta AR 12 30 type 3, Osteogenesis imperfecta type 4
CSPP1 Jeune asphyxiating thoracic dystrophy, Joubert syndrome AR 32 27
CTSK Pycnodysostosis AR 35 58
CUL7 3-M syndrome, Yakut short stature syndrome AR 26 83
CYP27B1 Vitamin D-dependent rickets AR 23 73
DDR2 Spondylometaepiphyseal dysplasia, short limb-hand type AR 11 9
DHCR24 Desmosterolosis AR 6 9
DLL3 Spondylocostal dysostosis AR 12 26
DLL4 Adams-Oliver syndrome AD 13 14
DLX3 Amelogenesis imperfecta, Trichodontoosseous syndrome AD 5 11
DMP1 Hypophosphatemic rickets AR 5 10
DOCK6 Adams-Oliver syndrome AR 21 21
DVL1 Robinow syndrome AD 17 19
DYM Dyggve-Melchior-Clausen dysplasia, Smith-McCort AR 22 34 dysplasia
DYNC2H1 Short -rib thoracic dysplasia with or without polydactyly AR/Digenic 148 205 type 1, Short -rib thoracic dysplasia with or without polydactyly type 3, Asphyxiating thoracic dysplasia (ATD; Jeune), SRPS type 2 (Majewski)
EBP Chondrodysplasia punctata, Male EBP disorder with XL 43 90 neurologic defects (MEND)
EFNB1 Craniofrontonasal dysplasia XL 28 116
EFTUD2 Mandibulofacial dysostosis with microcephaly, Esophageal AD 45 99 atresia, syndromic
EIF2AK3 SED, Wolcott-Rallison type AR 9 80
ENAM Amelogenesis imperfecta AD/AR 8 18
ENPP1 Arterial calcification, Hypophosphatemic rickets AD/AR 22 72
EOGT Adams-Oliver syndrome AR 8 5
EP300 Rubinstein-Taybi syndrome AD 63 101
ESCO2 SC phocomelia syndrome, Roberts syndrome AR 30 31
https://blueprintgenetics.com/ EVC Weyers acrofacial dysostosis, Ellis-van Creveld syndrome AD/AR 58 83
EVC2 Ellis-van Creveld syndrome, Weyers acrodental dysostosis AD/AR 78 75
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
EXT2 Multiple cartilagenious exostoses 2 AD 45 250
EXTL3 Immunoskeletal dysplasia with neurodevelopmental AR 4 8 abnormalities (ISDNA)
EZH2 Weaver syndrome AD 29 41
FAM111A Kenny-Caffey syndrome, type 2 AD 5 9
FAM20A Amelogenesis imperfecta (Enamel-renal syndrome) AR 19 41
FAM20C Hypophosphatemia, hyperphosphaturia, dental anomalies, AR 13 25 intracerebral calcifications and osteosclerosis (Raine syndrome)
FAM83H Amelogenesis imperfecta AD 14 32
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, AD 1465 2679 Geleophysic dysplasia 3
FBN2 Congenital contractural arachnodactyly (Beals syndrome) AD 50 97
FGF23 Tumoral calcinosis, hyperphosphatemic, AD/AR 10 17 Hypophosphatemic rickets
FGFR1 Pfeiffer syndrome, Trigonocephaly, Hypogonadotropic AD/Digenic/Multigenic 72 257 hypogonadism, Osteoglophonic Dwarfism - Craniostenosis, Hartsfield syndrome
FGFR2 Apert syndrome, Pfeiffer syndrome, Jackson-Weiss AD 100 154 syndrome, Lacrimoauriculodentodigital syndrome, Beare- Stevenson cutis gyrata syndrome, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Craniofacial-skeletal-dermatological dysplasia, Crouzon syndrome, Bent bone dysplasia
FGFR3 Lacrimoauriculodentodigital syndrome, Muenke AD/AR 54 77 syndrome, Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN
FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick- XL 133 257 Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects
FLNB Larsen syndrome (dominant), Atelosteogenesis type 1, AD/AR 43 121 Atelosteogenesis type 3, Spondylo-carpal-tarsal dyspasia
https://blueprintgenetics.com/ GALNT3 Tumoral calcinosis, hyperphosphatemic AR 17 35
GDF5 Multiple synostoses syndrome, Fibular hypoplasia and AD/AR 23 53 complex brachydactyly, Acromesomelic dysplasia, Hunter- Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia
GJA1* Oculodentodigital dysplasia mild type, Oculodentodigital AD/AR 31 107 dysplasia severe type, Syndactyly type 3
GLI3 Acrocallosal syndrome, Pallister-Hall syndrome, Grieg AD 70 235 cephalopolysndactyly syndrome, Postaxial polydactyly type A, Preaxial polydactyly type 3, Preaxial polydactyly type 4
GNAS McCune-Albright syndrome, Progressive osseous AD 64 274 heteroplasia, Pseudohypoparathyroidism, Albright hereditary osteodystrophy
GNPAT Rhizomelic chondrodysplasia punctata, rhizomelic AR 8 14
GPC6 Omodysplasia 1 AR 13 9
HDAC8 Cornelia de Lange syndrome XL 41 50
HOXA13 Hand-foot-uterus syndrome, Hand-foot-genital syndrome, AD 8 27 Guttmacher syndrome
HOXD13 Brachydactyly-syndactyly syndrome, Synopolydactyly, AD/AR 18 41 Syndactyly, Synopolydactyly with clefting, Brachydactyly type D
HSPG2 Schwartz-Jampel syndrome, Dyssegmental dysplasia AD/AR 16 60 Silverman-Handmaker type, Dyssegmental dysplasia Rolland-Desbuquis type
IDS* Mucopolysaccharidosis XL 85 637
IDUA Mucopolysaccharidosis AR 105 282
IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia AR 13 23 (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2
IFT140 Short -rib thoracic dysplasia with or without polydactyly, AR 38 63 Asphyxiating thoracic dysplasia (ATD; Jeune)
IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or AR 22 25 without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune)
IFT43 Cranioectodermal dysplasia 3 AR 4 7
IFT80 Short -rib thoracic dysplasia with or without polydactyly, AR 11 11 Asphyxiating thoracic dysplasia (ATD; Jeune)
IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly AD/AR 12 32 type Lueken
IMPAD1 Chondrodysplasia with joint dislocations, GPAPP type AR 5 5
https://blueprintgenetics.com/ INPPL1 Opsismodysplasia AR 16 32
KAT6B Ohdo syndrome, SBBYS variant, Genitopatellar syndrome AD 47 73
KIF22 Spondyloepimetaphyseal dysplasia with joint laxity, type 2 AD 4 4
KIF7 Acrocallosal syndrome, Hydrolethalus syndrome, Al- AR/Digenic 24 44 Gazali-Bakalinova syndrome, Joubert syndrome
KMT2A Wiedemann-Steiner syndrome AD 117 114
LBR Pelger-Huet anomaly, Reynolds syndrome, AD/AR 22 24 Greenberg/HEM skeletal dysplasia, Hydrops-ectopic calcification-moth-eaten skeletal dysplasia
LEMD3 Buschke-Ollendorff syndrome, Osteopoikilosis AD 13 32
LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 AR 12 32 syndrome
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular AD/AR 250 564 dystrophy, Muscular dystrophy, congenital, LMNA- related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type
LMX1B Nail-patella syndrome AD 26 194
LONP1 Cerebral, Ocular, Dental, Auricular, and Skeletal AR 9 18 anomalies (CODAS) syndrome
LRP4 Cenani-Lenz syndactyly syndrome, Sclerosteosis, AD/AR 14 28 Myasthenic syndrome, congenital
LRP5* Van Buchem disease, Osteoporosis-pseudoglioma AD/AR/Digenic 57 196 syndrome, Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis
LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or AR 21 27 megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital
LTBP3 Dental anomalies and short stature, Geleophysic dysplasia AD/AR 15 11 3
MAFB Multicentric carpotarsal osteolysis AD 13 23
MATN3 Spondyloepimetaphyseal dysplasia Matrilin type, Multiple AD/AR 8 25 epiphyseal dysplasia type 5 (EDM5)
MESP2 Spondylocostal dysostosis 2, autosomal recessive AR 18 6
MGP Keutel syndrome AR 5 8
MMP13 Metaphyseal anadysplasia 1, Metaphyseal dysplasia, Spahr AD/AR 7 7 type, Spondyloepimetaphyseal dysplasia, Missouri type
MMP2 Torg-Winchester syndrome, Multicentric osteolysis, AR 8 22 nodulosis, and arthropathy
https://blueprintgenetics.com/ MMP9 Metaphyseal anadysplasia AR 1 7
MSX2* Parietal foramina, Parietal foramina with cleidocranial AD 9 25 dysplasia, Craniosynostosis Boston type
MYCN Feingold syndrome AD 27 41
MYO18B Klippel-Feil syndrome 4, autosomal recessive, with AR 2 4 myopathy and facial dysmorphism
NANS Spondyloepimetaphyseal dysplasiam Genevieve type AR 8 12
NEK1 Short -rib thoracic dysplasia with or without polydactyly, AR/Digenic 22 23 SRPS type 2 (Majewski)
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis- AD 1157 2901 Noonan syndrome
NFIX Marshall-Smithsyndrome AD 49 78
NIPBL Cornelia de Lange syndrome AD 311 425
NKX3-2 Spondylo-megaepiphyseal-metaphyseal dysplasia AR 4 4
NOG Tarsal-carpal coalition syndrome, Multiple synostosis AD 20 63 syndrome, Stapes ankylosis with broad thumb and toes (Teunissen-Cremers syndrome), Symphalangism, proximal, Brachydactyly type B2
NOTCH2* Alagille syndrome, Hajdu-Cheney syndrome AD 37 70
NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal AD/AR 32 75 chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann AD 329 517 syndrome
NSDHL Congenital hemidysplasia with ichthyosiform XL 15 28 erythroderma and limb defects (CHILD syndrome), CK syndrome
OBSL1 3-M syndrome AR 13 33
ORC1 Meier-Gorlin syndrome (Ear-patella-short stature AR 9 10 syndrome)
ORC4 Meier-Gorlin syndrome (Ear-patella-short stature AR 24 6 syndrome)
ORC6 Meier-Gorlin syndrome (Ear-patella-short stature AR 7 6 syndrome)
OSTM1 Osteopetrosis, autosomal recessive 5 AR 5 9
P3H1 Osteogenesis imperfecta AR 18 63
PAPSS2 Brachyolmia 4 with mild epiphyseal and metaphyseal AR 13 20 changes, SEMD PAPPS2 type
PCNT Microcephalic osteodysplastic primordial dwarfism AR 49 88
https://blueprintgenetics.com/ PCYT1A Spondylometaphyseal dysplasia with cone-rod dystrophy AR 12 20
PDE4D Acrodysostosis 2, with or without hormone resistance AD 15 38
PEX7 Refsum disease, Rhizomelic CDP type 1 AR 44 53
PGM3 Immunodeficiency 23 AR 14 15
PHEX Hypophosphatemic rickets XL 263 437
PIK3CA* Cowden syndrome, CLOVES AD 85 56
PISD AR
PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23
PLS3 Osteoporosis and osteoporotic fractures XL 1 17
POLR1C Treacher Collins syndrome AR 17 21
POLR1D Treacher Collins syndrome AD/AR 9 26
POR Disordered steroidogenesis due to cytochrome p450 AR 14 70 oxidoreductase deficiency, Antley-Bixler syndrome
PPIB Osteogenesis imperfecta type 2, Osteogenesis imperfecta AR 8 13 type 3, Osteogenesis imperfecta type 4
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular AD 75 183 adrenocortical disease, Carney complex
PTDSS1 Lenz-Majewski hyperostotic dwarfism AD 5 7
PTH1R Metaphyseal chondrodysplasia Jansen type, Failure of AD/AR 13 43 tooth eruption, Eiken dysplasia, Blomstrand dysplasia
PTHLH Brachydactyly, type E2 AD 5 18
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
PYCR1 Cutis laxa AR type 2B AR 19 38
RAB33B Dyggve-Melchior-Clausen syndrome, Smith-McCort AR 6 7 dysplasia 2
RAD21* Cornelia de Lange syndrome 4 AD 14 11
RBPJ* Adams-Oliver syndrome AD 7 6
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, AR 82 114 Rothmund-Thomson syndrome
RMRP Cartilage-hair hypoplasia, Metaphyseal dysplasia without AR 87 123 hypotrichosis, Anauxetic dysplasia
RNU4ATAC Roifman syndrome, Microcephalic osteodysplastic AR 15 24 primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3
ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40
https://blueprintgenetics.com/ RUNX2 Cleidocranial dysplasia, Metaphyseal dysplasia with AD 21 216 maxillary hypoplasia
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe AR 19 90 spondylometaphyseal dysplasia
SERPINF1 Osteogenesis imperfecta, type VI AR 9 41
SERPINH1 Osteogenesis imperfecta type 3 AR 3 6
SETBP1 Mental retardation, autosomal dominant 29, Schinzel- AD 23 46 Giedion midface retraction syndrome
SF3B4 Acrofacial dysostosis 1, Nager AD 27 38
SH3BP2 Cherubism AD 9 16
SH3PXD2B Frank-ter Haar syndrome AR 8 20
SHOX* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, XL/PAR 25 431 Short stature
SKI Shprintzen-Goldberg syndrome AD 20 23
SLC26A2 Diastrophic dysplasia, Atelosteogenesis type 2, De la AR 73 54 Chapelle dysplasia, Recessive Multiple Epiphyseal dysplasia, Achondrogenesis type 1B
SLC29A3 Histiocytosis-lymphadenopathy plus syndrome, AR 17 25 Dysosteosclerosis
SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38
SLC35D1 Schneckenbecken dysplasia AR 7 7
SLC39A13 Spondylodysplastic Ehlers-Danlos syndrome AR 2 9
SLCO2A1 Hypertrophic osteoarthropathy AD/AR 13 72
SMAD3 Aneurysms-osteoarthritis syndrome, Loeys-Dietz AD 48 82 syndrome
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia AD 179 143 syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia
SMARCAL1 Schimke immunoosseous dysplasia AR 20 88
SMC1A Cornelia de Lange syndrome XL 73 87
SMC3 Cornelia de Lange syndrome AD 25 21
SNX10 Osteopetrosis, autosomal recessive 8 AR 3 13
SOST Craniodiaphyseal dysplasia, autosomal dominant, AD/AR 6 14 Sclerosteosis 1, van Buchem disease
SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly AD 47 144 with anonychia (Cooks syndrome)
SP7 Osteogenesis imperfecta, type XII AR 2 3
https://blueprintgenetics.com/ STAMBP Microcephaly-capillary malformation syndrome AR 15 19
TBX15 Cousin syndrome AR 2 4
TBX3 Ulnar-Mammary syndrome AD 6 20
TBX4 Small patella syndrome AD 8 58
TBX6 Spondylocostal dysostosis 5 AD/AR 9 34
TCF12 Craniosynostosis AD 23 56
TCIRG1 Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 48 130
TCOF1 Treacher Collins syndrome AD 50 330
TCTN3 Orofaciodigital syndrome (Mohr-Majewski syndrome), AR 9 12 Joubert syndrome
TGFB1 Diaphyseal dysplasia Camurati-Engelmann AD 15 23
TGFB2 Loeys-Dietz syndrome AD 36 38
TGFB3 Loeys-Dietz syndrome (Reinhoff syndrome), AD 19 26 Arrhythmogenic right ventricular dysplasia
TGFBR1 Loeys-Dietz syndrome AD 40 69
TGFBR2 Loeys-Dietz syndrome AD 58 139
TMEM38B Osteogenesis imperfecta, type XIV AR 2 7
TNFRSF11A Familial expansile osteolysis, Paget disease of bone, AD/AR 8 24 Osteopetrosis, severe neonatal or infantile forms (OPTB1)
TNFRSF11B Paget disease of bone, juvenile AR 8 18
TNFSF11 Osteopetrosis, autosomal recessive 2 AR 3 5
TP63 Rapp-Hodgkin syndrome, Orofacial cleft, ADULT AD 59 122 syndrome, Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome, Ankyloblepharon-ectodermal defects-cleft lip/palate, Split-hand/foot malformation, Limb-mammary syndrome
TRAPPC2* Spondyloepiphyseal dysplasia tarda XL 12 55
TRIP11* Achondrogenesis, type IA AR 11 17
TRPS1 Trichorhinophalangeal syndrome type 1, AD 66 140 Trichorhinophalangeal syndrome type 3
TRPV4 Metatropic dysplasia, Spondyloepiphyseal dysplasia AD 61 78 Maroteaux type, Parastremmatic dwarfism, Hereditary motor and sensory neuropathy, Spondylometaphyseal dysplasia Kozlowski type, Spinal muscular atrophy, Charcot-Marie-Tooth disease, Brachyolmia (autosomal dominant type), Familial Digital arthropathy with brachydactyly
https://blueprintgenetics.com/ TTC21B Short-rib thoracic dysplasia, Nephronophthisis, AR 23 63 Asphyxiating thoracic dysplasia (ATD; Jeune)
TWIST1 Saethre-Chotzen syndrome, Robinow-Sorauf syndrome, AD 28 205 Craniosynostosis
TYROBP Nasu-Hakola disease, Polycystic lipomembranous AR 8 14 osteodysplasia with sclerosing leukoencephalopathy
VDR Vitamin D-dependent rickets AD/AR 17 66
VIPAS39 Arthrogryposis, renal dysfunction, and cholestasis 2 AR 8 13
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic AR 33 43 dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin- Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin- Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune)
WDR34 Short -rib thoracic dysplasia with or without polydactyly, AR 18 21 Asphyxiating thoracic dysplasia (ATD; Jeune)
WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, AR 28 31 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5
WDR60 Short-rib thoracic dysplasia 8 with or without polydactyly AR 12 13
WISP3 Arthropathy, progressive pseudorheumatoid, of childhood, AR 16 69 Spondyloepiphyseal dysplasia tarda with progressive arthropathy
WNT1 Osteoprosis, autosomal dominant, Osteogenesis AD/AR 9 40 imperfecta, type XV
WNT5A Robinow syndrome AD 7 11
XYLT1 Desbuquois dysplasia 2 AR 11 19
*Some regions of the gene are duplicated in the genome. Read more.
# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding disease causing variants covered by the panel
Gene Genomic location HGVS RefSeq RS-number HG19
https://blueprintgenetics.com/ AIFM1 ChrX:129274636 c.697-44T>G NM_004208.3
AIFM1 ChrX:129299753 c.-123G>C NM_004208.3 rs724160014
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
ANKH Chr5:14871567 c.-11C>T NM_054027.4
BMP1 Chr8:22058957 c.*241T>C NM_001199.3 rs786205217
BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2
CANT1 Chr17:77005745 c.-342+1G>A NM_138793.3
CASR Chr3:121994640 c.1378-19A>C NM_001178065.1
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
COL11A1 Chr1:103386637 c.3744+437T>G NM_080629.2
COL11A1 Chr1:103488576 c.1027-24A>G NM_080629.2
COL11A1 Chr1:103491958 c.781-450T>G NM_080629.2 rs587782990
COL1A1 Chr17:48266910 c.2668-11T>G NM_000088.3 rs786205505
COL1A1 Chr17:48267594 c.2451+94G>T NM_000088.3
COL1A1 Chr17:48267611 c.2451+77C>T NM_000088.3 rs72651665
COL1A1 Chr17:48268147 c.2343+31T>A NM_000088.3
COL1A1 Chr17:48272201 c.1354-12G>A NM_000088.3 rs72648337
COL1A1 Chr17:48273368 c.1003-43_1003-32delTGCCATCTCTTC NM_000088.3 rs72645359
COL1A1 Chr17:48273574 c.958-18_958-15delTTCC NM_000088.3 rs72645351
COL1A1 Chr17:48273742 c.904-14G>A NM_000088.3
COL1A1 Chr17:48273743 c.904-15T>A NM_000088.3
COL1A2 Chr7:94025130 c.70+717A>G NM_000089.3 rs72656354
COL1A2 Chr7:94030856 c.226-22_226-11delTTTTTTTTTTTT NM_000089.3
COL2A1 Chr12:48379984 c.1527+135G>A NM_001844.4
CREBBP Chr16:3788684 c.4281-11C>G NM_004380.2 rs587783493
CRTAP Chr3:33160815 c.472-1021C>G NM_006371.4 rs72659360
CTSK Chr1:150778521 c.244-29A>G NM_000396.3
CUL7 Chr6:43010511 c.3897+29G>A NM_001168370.1
DYNC2H1 Chr11:103019205 c.2819-14A>G NM_001080463.1 rs781091611
DYNC2H1 Chr11:103055609 c.6478-16G>A NM_001080463.1 rs376892534
EFNB1 ChrX:68049209 c.-411C>G NM_004429.4
EFNB1 ChrX:68049525 c.-95T>C/G NM_004429.4
EFNB1 ChrX:68049525 c.-95T>C NM_004429.4
https://blueprintgenetics.com/ EFNB1 ChrX:68049525 c.-95T>G NM_004429.4
EP300 Chr22:41537040 c.1879-12A>G NM_001429.3
ESCO2 Chr8:27650167 c.1354-18G>A NM_001017420.2 rs80359865
EVC Chr4:5749725 c.940-150T>G NM_153717.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
FBN2 Chr5:127670560 c.3974-24A>C NM_001999.3
FBN2 Chr5:127670562 c.3974-26T>G NM_001999.3
FBN2 Chr5:127671284 c.3725-15A>G NM_001999.3
FGFR2 Chr10:123099960 c.*139411C>T .
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
GNAS Chr20:57478716 c.2242-11A>G NM_080425.2
HSPG2 Chr1:22211006 c.1654+15G>A NM_005529.5
HSPG2 Chr1:22215993 c.574+481C>T NM_005529.5
IDS ChrX:148564764 c.1181-15C>A NM_000202.5
IDS ChrX:148568762 c.*57A>G NM_006123.4
IDS ChrX:148578704 c.709-657G>A NM_000202.5
IFITM5 Chr11:299504 c.-14C>T NM_001025295.2 rs587776916 Explain PMID almost 23240094 all cases of OI type V
IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3
IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
https://blueprintgenetics.com/ LMX1B Chr9:129377616 c.140-37_140-21delGGCGCTGACGGCCGGGC NM_001174146.1
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
https://blueprintgenetics.com/ NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NIPBL Chr5:36877039 c.-321_-320delCCinsA NM_133433.3 rs724159980
NIPBL Chr5:36877266 c.-94C>T NM_133433.3
NIPBL Chr5:36953718 c.-79-2A>G NM_133433.3
NIPBL Chr5:37022138 c.5329-15A>G NM_133433.3 rs587783968
NIPBL Chr5:37026318 c.5710-13_5710-12delCTinsAA NM_133433.3
NSDHL ChrX:152037789 c.*129C>T NM_015922.2 rs145978994
PEX7 Chr6:137143759 c.-45C>T NM_000288.3 rs267608252
PHEX ChrX:22076478 c.349+11149A>T NM_000444.4
PHEX ChrX:22113485 c.849+1268G>T NM_000444.4
PHEX ChrX:22237137 c.1701-16T>A NM_000444.4
PHEX ChrX:22237393 c.1768+177_1768+180dupGTAA NM_000444.4
PHEX ChrX:22266301 c.*231A>G NM_000444.4
PLS3 ChrX:114856534 c.74-24T>A NM_005032.5
POR Chr7:75544501 c.-5+4A>G NM_000941.2
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTH1R Chr3:46939842 c.544-25_544-23delCTG NM_000316.2
PTH1R Chr3:46942604 c.1049+29C>T NM_000316.2
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
https://blueprintgenetics.com/ RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
SERPINF1 Chr17:1665408 c.-9+2dupT NM_002615.5 rs398122519
SERPINF1 Chr17:1674512 c.439+34C>T NM_002615.5
SERPINF1 Chr17:1675121 c.440-40_440-38delTCG NM_002615.5 rs775552455
SERPINF1 Chr17:1679209 c.787-617G>A NM_002615.5
SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685
SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3
SHOX ChrX:591198 c.-432-3C>A NM_000451.3
SHOX ChrX:591568 c.-65C>A NM_000451.3
SLC26A2 Chr5:149340544 c.-26+2T>C NM_000112.3 rs386833492
SLC29A3 Chr10:73122778 c.*413G>A NM_018344.5
SOX9 Chr17:70117348 c.-185G>A NM_000346.3
STAMBP Chr2:74077998 c.1005+358A>G NM_006463.4
TBX3 Chr12:115122148 NM_016569.3
TBX6 Chr16:30097525 c.*21C>T NM_004608.3 rs758420111
TCF12 Chr15:57554272 c.1468-20T>A NM_207036.1
TCIRG1 Chr11:67806587 c.-5+1G>C/T NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>C NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>T NM_006019.3
TCIRG1 Chr11:67816893 c.1887+132T>C NM_006019.3
TCIRG1 Chr11:67816903 c.1887+142T>A NM_006019.3
TCIRG1 Chr11:67816907 c.1887+146G>A NM_006019.3
TCIRG1 Chr11:67816910 c.1887+149C>T NM_006019.3
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TRPS1 Chr8:116427335 c.2824-23T>G NM_014112.2
TWIST1 Chr7:19157199 c.-255G>A NM_000474.3
TWIST1 Chr7:19157207 c.-263C>A NM_000474.3
https://blueprintgenetics.com/ WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1
WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1
WISP3 Chr6:112381431 c.103-763G>T NM_198239.1
WISP3 Chr6:112386227 c.643+27C>G NM_198239.1 rs200472841
Test Strengths
This panel includes a pathogenic intronic variant that is often missed by exome sequencing: IFITM5 c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). The remainder of IFITM5 is not covered at this time.
The strengths of this test include:
CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements
Test Limitations
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ADAMTSL2 (NM_014694:11-19), B3GAT3 (NM_001288722:5), POLR1C (NM_001318876:9), SHOX (NM_006883:6). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not d etect the following:
Complex inversions Gene conversions Balanced translocations Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Low level heteroplasmy in mtDNA (>90% are detected at 5% level) Indels larger than 50bp
https://blueprintgenetics.com/ Single exon deletions or duplications Variants within pseudogene regions/duplicated segments Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section and see our Analytic Validation.
Test Performance
The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.
Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).
Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.
The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Seattle, WA, are equivalent.
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
https://blueprintgenetics.com/
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
https://blueprintgenetics.com/ SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X
Bioinformatics
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.
https://blueprintgenetics.com/ Clinical Interpretation
We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.
The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling the following criteria are not Sanger confirmed: the variant quality score is above the internal threshold for a true positive call, and visual check-up of the variant at IGV is in-line with the variant call. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.
Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation variant databases used to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.
ICD Codes
Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.
Sample Requirements
Blood (min. 1ml) in an EDTA tube Extracted DNA, min. 2 μg in TE buffer or equivalent Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient's name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
https://blueprintgenetics.com/ Read more about our sample requirements here.
For Patients
Other
GeneReviews - 3M Syndrome GeneReviews - Cranioectodermal dysplasia GeneReviews - Craniometaphyseal Dysplasia GeneReviews - FGFR-Related Craniosynostosis Syndromes GeneReviews - Osteogenesis Imperfecta GeneReviews - Rhizomelic Chondrodysplasia Punctata Type 1 GeneReviews - Robinow Syndrome GeneReviews - Weill-Marchesani Syndrome Little People of America Lyhytkasvuiset Ry NORD - 3M Syndrome NORD - Acromesomelic Dysplasia NORD - Chondrodysplasia Punctata NORD - Craniofrontonasal Dysplasia NORD - Dystrophy, Asphyxiating Thoracic NORD - Hypophosphatasia NORD - Meier-Gorlin Syndrome NORD - Meier-Gorlin Syndrome NORD - Osteogenesis Imperfecta NORD - Primary Craniosynostosis NORD - Robinow Syndrome NORD - Weill-Marchesani Syndrome Osteogenesis Imperfecta Foundation RhizoKids International Robinow Syndrome Foundation Walking With Giants Foundation Meier-Gorlin Syndrome
https://blueprintgenetics.com/