DOCSLIB.ORG

This Thesis Has Been Submitted in Fulfilment of the Requirements for a Postgraduate Degree (E.G. Phd, Mphil, Dclinpsychol) at the University of Edinburgh

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
This Thesis Has Been Submitted in Fulfilment of the Requirements for a Postgraduate Degree (E.G. Phd, Mphil, Dclinpsychol) at the University of Edinburgh This thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Expanding the genetics of microcephalic primordial dwarfism Jennie Elaine Murray Thesis submitted for the degree of Doctor of Philosophy The University of Edinburgh October 2014 This thesis is composed of original research undertaken by myself, and where the work of others is included their contributions have been duly acknowledged. This work has not been submitted for any other degree or professional qualification. Jennie Murray 2 Acknowledgements Firstly, I would like to say a big thank you to my supervisor, Professor Andrew Jackson, for his fantastic guidance and support over the last 3 years. Your integrity and dedication has been inspiring and, although I still have a long way to go, your input has been invaluable in helping me grow and develop as a clinical scientist. I am also in a huge debt of gratitude to Louise Bicknell for her superb day to day supervision, teaching, mentoring, encouragement, general life coaching and eternal optimism. You always kept me going when things got tough. I am also incredibly grateful for the rapid proof reading of this thesis enabling me to achieve my rather tight deadline. I also want to thank Professors David Fitzpatrick and Mary Porteous for their additional supervision and career guidance which helped me to obtain a clinical fellowship and complete this thesis. Next, I would like to thank Alison Meynert for the huge bioinformatic support she provided and always promptly answering my endless stream of programming questions which made such a large part of this thesis possible; Mike Halachev also for all things bioinformatic and particularly for help with the CNV analysis. I would also like to thank the members of the IGMM computing services; especially Graeme Grimes for getting me started with SQL and John Ireland, Ewan McDowall and Semir Kazazic for always quickly coming to my rescue on the many occasions my minimal computer skills failed me. I am also indebted to Carol-Anne Martin for inducting me into the field of cell biology and imparting some of her immense knowledge base to me as well as patiently teaching me many of the experimental techniques used in this thesis including cell culture, immunoblotting, immunofluorescence and microscopy. A big thank you also to Morad Ansari for all his technical help with performing array- CGH, generous donation of reagents and slides as well as support with AmpliSeq™. Additionally I would like to thank all the other members of my lab, past and present for all their helpful input and discussions during lab meetings and general lab 3 support, in particular Anna Klingseissen for introducing me to the world of zebrafish, Maggie Harley for help with various techniques including cell culture and immunoblotting, Paula Carroll for being ever willing to help at all times, Martin Reijns and James Ding for help with cloning, Rachel Rigby for all things RNA related, Andrea Robertson for being such a lovely desk buddy, providing much needed light relief as well as providing invaluable help in the lab and Karen MacKenzie for lifts to work and regularly letting me vent my frustrations. I would also like to thank Anne Seawright for all her assistance in and around the lab including ensuring there was always milk and coffee in the office! I would also like to express my gratitude to Stephen Brown, Agnes Gallacher and Stewart McKay in technical services for all their support in anything sequencing related; Lizzie Freyer for assistance with flow cytometry; Andrew Wood for insightful discussions and generous donation of antibodies; Craig Nicol for teaching me all things graphical for which I believe this thesis has greatly benefited and Matt Pearson for additional microscopy support. A huge thank you also to all the patients and their families whose selfless contributions to this research in the hope of providing help to future generations has been incredibly humbling and has been a big motivation for me over the last three years. Additionally I’d also like to thank Eilidh Guild and Angela Sandilands for their administrative support, keeping me organised with patient data, samples and reports and also our clinical counterparts in the USA, Mike Bober and Angela Duker for their ongoing collaboration, providing access to patient samples and expert clinical opinion. Finally, I would like to thank my family and friends for their eternal support, always believing in me and always attempting to be interested in what I was doing. And last but certainly not least, my incredible husband Andrew, for all your love, support and encouragement. You have been my absolute rock throughout as you always are in everything I do and therefore this thesis is dedicated to you along with our new beautiful baby daughter, Nina. 4 Abstract Body mass varies considerably between different mammals and this variation is largely accounted for by a difference in total cell number rather than individual cell size. Insights into mechanisms regulating growth can therefore be gained by understanding what governs total cell number at any one point. In addition, control of cell proliferation and programmed cell death is fundamental to other areas of research such as cancer and stem cell research. Microcephalic Primordial Dwarfism (MPD) is a group of rare Mendelian human disorders in which there is an extreme global failure of growth with affected individuals often only reaching a height of around one metre in adulthood. To date, all identified disease genes follow an autosomal recessive mode of inheritance and encode key regulators of the cell cycle, where mutations impact on overall cell number and result in a substantially reduced body size. MPD therefore provides a valuable model for examining genetic and cellular mechanisms that impact on growth. The overall aims of this thesis were to identify novel disease causing genes, as well as provide further characterisation of known disease causing genes, through the analysis of whole exome sequencing (WES) within a large cohort of MPD patients. Following the design and implementation of an analytical bioinformatics pipeline, deleterious mutations were identified in multiple disease genes including LIG4 and XRCC4. Both genes encode components of the non-homologous end joining machinery, a DNA repair mechanism not previously implicated in MPD. Additionally, the pathogenicity of novel mutations in subunits of a protein complex involved in chromosome segregation was assessed using patient-derived cells. These findings demonstrate WES can be successfully implemented to identify known and novel disease causing genes within a large heterogeneous cohort of patients, expanding the phenotype of known disorders and improving diagnosis as well as providing novel insights into intrinsic cellular mechanisms critical to growth. 5 Table of Contents Acknowledgements………………………………………………………………….3 Abstract……………………………………………………………………….……...5 Table of Contents…………………………………………………………………....6 List of Figures…………………………………………………………………........13 List of Tables………………………………………………………………….........15 Abbreviations…………………………………………………………………........13 Chapter 1: Introduction…………………………………………………………...19 1.1 Overview of microcephalic primordial dwarfism (MPD) .......................... 19 1.1.1 Definition .................................................................................................. 19 1.1.2 Diagnostic criteria ..................................................................................... 20 1.1.3 Aetiology ................................................................................................... 21 1.1.4 Spectrum of phenotypes ............................................................................ 21 1.1.4.1 Seckel syndrome (MIM 210600) ....................................................... 21 1.1.4.2 Microcephalic Osteodysplastic Primordial Dwarfism Type I (MOPDI, MIM 210710) ................................................................................................. 23 1.1.4.3 Microcephalic Osteodysplastic Primordial Dwarfism Type II (MOPDII, MIM 210720) ............................................................................... 24 1.1.4.4 Meier-Gorlin Syndrome ..................................................................... 24 1.1.4.5 Other disorders which overlap MPD ................................................. 25 1.1.4.5.1 Syndromic conditions affecting global growth ........................... 25 1.1.4.5.2 Autosomal recessive primary microcephaly (1° MCPH) ........... 25 1.2 Mechanisms governing body size .................................................................. 26 1.2.1 Signalling pathways promoting cell growth and proliferation .................. 27 1.2.1.1 Mitogen activated
Load more

Recommended publications
  • C3orf70 Is Involved in Neural and Neurobehavioral Development
    pharmaceuticals Article C3orf70 Is Involved in Neural and Neurobehavioral Development Yoshifumi Ashikawa 1, Takashi Shiromizu 1, Koki Miura 1, Yuka Adachi 1, Takaaki Matsui 2, Yasumasa Bessho 2, Toshio Tanaka 3 and Yuhei Nishimura 1,* 1 Department of Integrative Pharmacology, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; [email protected] (Y.A.); [email protected] (T.S.); [email protected] (K.M.); [email protected] (Y.A.) 2 Gene Regulation Research, Graduate School of Biological Sciences, Nara Institute of Science and Technology, Takayama, Nara 630-0192, Japan; [email protected] (T.M.); [email protected] (Y.B.) 3 Department of Systems Pharmacology, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; [email protected] * Correspondence: [email protected] Received: 10 October 2019; Accepted: 15 October 2019; Published: 16 October 2019 Abstract: Neurogenesis is the process by which undifferentiated progenitor cells develop into mature and functional neurons. Defects in neurogenesis are associated with neurodevelopmental and neuropsychiatric disorders; therefore, elucidating the molecular mechanisms underlying neurogenesis can advance our understanding of the pathophysiology of these disorders and facilitate the discovery of novel therapeutic targets. In this study, we performed a comparative transcriptomic analysis to identify common targets of the proneural transcription factors Neurog1/2 and Ascl1 during neurogenesis of human and mouse stem cells. We successfully identified C3orf70 as a novel common target gene of Neurog1/2 and Ascl1 during neurogenesis. Using in situ hybridization, we demonstrated that c3orf70a and c3orf70b, two orthologs of C3orf70, were expressed in the midbrain and hindbrain of zebrafish larvae.
    [Show full text]
  • HPV E2, E4, E5 Drive Alternative Carcinogenic Pathways in HPV Positive Cancers
    Oncogene (2020) 39:6327–6339 https://doi.org/10.1038/s41388-020-01431-8 ARTICLE HPV E2, E4, E5 drive alternative carcinogenic pathways in HPV positive cancers 1,2 3 3 4,5 4 6 Shuling Ren ● Daria A. Gaykalova ● Theresa Guo ● Alexander V. Favorov ● Elana J. Fertig ● Pablo Tamayo ● 1,7 1 1 1 1 1 Juan Luis Callejas-Valera ● Mike Allevato ● Mara Gilardi ● Jessica Santos ● Takahito Fukusumi ● Akihiro Sakai ● 1 1 1 6 6 1 1 Mizuo Ando ● Sayed Sadat ● Chao Liu ● Guorong Xu ● Kathleen M. Fisch ● Zhiyong Wang ● Alfredo A. Molinolo ● 1 6 3 1,8 J. Silvio Gutkind ● Trey Ideker ● Wayne M. Koch ● Joseph A. Califano Received: 19 February 2020 / Revised: 19 July 2020 / Accepted: 13 August 2020 / Published online: 26 August 2020 © The Author(s) 2020. This article is published with open access Abstract The dominant paradigm for HPV carcinogenesis includes integration into the host genome followed by expression of E6 and E7 (E6/E7). We explored an alternative carcinogenic pathway characterized by episomal E2, E4, and E5 (E2/E4/E5) expression. Half of HPV positive cervical and pharyngeal cancers comprised a subtype with increase in expression of E2/E4/ E5, as well as association with lack of integration into the host genome. Models of the E2/E4/E5 carcinogenesis show p53 1234567890();,: 1234567890();,: dependent enhanced proliferation in vitro, as well as increased susceptibility to induction of cancer in vivo. Whole genomic expression analysis of the E2/E4/E5 pharyngeal cancer subtype is defined by activation of the fibroblast growth factor receptor (FGFR) pathway and this subtype is susceptible to combination FGFR and mTOR inhibition, with implications for targeted therapy.
    [Show full text]
  • Construction of an Mirna‑Gene Regulatory Network in Colorectal Cancer Through Integrated Analysis of Mrna and Mirna Microarrays
    MOLECULAR MEDICINE REPORTS 18: 5109-5116, 2018 Construction of an miRNA‑gene regulatory network in colorectal cancer through integrated analysis of mRNA and miRNA microarrays JUN HU, XIN YUE, JIANZHONG LIU and DALU KONG Department of Colorectal Cancer Surgery, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin's Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, P.R. China Received December 19, 2017; Accepted August 8, 2018 DOI: 10.3892/mmr.2018.9505 Abstract. The aim of the present study was to identify poten- Introduction tial biomarkers associated with colorectal cancer (CRC). The GSE32323 and GSE53592 mRNA and microRNA (miRNA) Colorectal cancer (CRC) is a common malignancy that ranks expression profiles were selected from the Gene Expression as the second leading cause of cancer-associated mortality in Omnibus database. The differentially expressed genes (DEGs) men and women in the USA (1). Despite improvements in CRC and differentially expressed miRNAs (DEMs) in CRC tissue therapy, CRC remains a major public health problem, and it is samples compared with surrounding control tissue samples estimated that there are 1,000,000 individuals suffering from (DEGs-CC), and DEGs in cells treated with 5-aza-2'-de- CRC worldwide, with the mortality rate is as high as ~50% in oxycitidine compared with untreated cells (DEGs-TC) certain developed countries (2). The tumor stage is the most were identified with the Limma package. The Database for important prognostic indicator for CRC. However, the tumors Annotation, Visualization and Integrated Discovery was used are often diagnosed at an intermediate or late stage, and the to conduct the functional and pathways enrichment analysis.
    [Show full text]
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
    [Show full text]
  • Clinical Validation of the Tempus Xt Next-Generation Targeted Oncology Sequencing Assay
    www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 24), pp: 2384-2396 Research Paper Clinical validation of the tempus xT next-generation targeted oncology sequencing assay Nike Beaubier1, Robert Tell1, Denise Lau1, Jerod R. Parsons1, Stephen Bush1, Jason Perera1, Shelly Sorrells1, Timothy Baker1, Alan Chang1, Jackson Michuda1, Catherine Iguartua1, Shelley MacNeil1, Kaanan Shah1, Philip Ellis1, Kimberly Yeatts1, Brett Mahon1, Timothy Taxter1, Martin Bontrager1, Aly Khan1, Robert Huether1, Eric Lefkofsky1 and Kevin P. White1 1Tempus Labs Inc., Chicago, IL 60654, USA Correspondence to: Nike Beaubier, email: [email protected] Kevin P. White, email: [email protected] Keywords: tumor profiling, next-generation sequencing assay validation Received: August 03, 2018 Accepted: February 03, 2019 Published: March 22, 2019 Copyright: Beaubier et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT We developed and clinically validated a hybrid capture next generation sequencing assay to detect somatic alterations and microsatellite instability in solid tumors and hematologic malignancies. This targeted oncology assay utilizes tumor- normal matched samples for highly accurate somatic alteration calling and whole transcriptome RNA sequencing for unbiased identification of gene fusion events. The assay was validated with a combination of clinical specimens and cell lines, and recorded a sensitivity of 99.1% for single nucleotide variants, 98.1% for indels, 99.9% for gene rearrangements, 98.4% for copy number variations, and 99.9% for microsatellite instability detection. This assay presents a wide array of data for clinical management and clinical trial enrollment while conserving limited tissue.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Plasma Cells in Vitro Generation of Long-Lived Human
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology , 32 of which you can access for free at: 2012; 189:5773-5785; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication November 2012; doi: 10.4049/jimmunol.1103720 http://www.jimmunol.org/content/189/12/5773 In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco, Sophie Stephenson, Matthew A. Care, Darren Newton, Nicholas A. Barnes, Adam Davison, Andy Rawstron, David R. Westhead, Gina M. Doody and Reuben M. Tooze J Immunol cites 65 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/11/16/jimmunol.110372 0.DC1 This article http://www.jimmunol.org/content/189/12/5773.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. The Journal of Immunology In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco,*,1 Sophie Stephenson,*,1 Matthew A.
    [Show full text]
  • Blueprint Genetics Comprehensive Skeletal Dysplasias and Disorders
    Comprehensive Skeletal Dysplasias and Disorders Panel Test code: MA3301 Is a 251 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of disorders involving the skeletal system. About Comprehensive Skeletal Dysplasias and Disorders This panel covers a broad spectrum of skeletal disorders including common and rare skeletal dysplasias (eg. achondroplasia, COL2A1 related dysplasias, diastrophic dysplasia, various types of spondylo-metaphyseal dysplasias), various ciliopathies with skeletal involvement (eg. short rib-polydactylies, asphyxiating thoracic dysplasia dysplasias and Ellis-van Creveld syndrome), various subtypes of osteogenesis imperfecta, campomelic dysplasia, slender bone dysplasias, dysplasias with multiple joint dislocations, chondrodysplasia punctata group of disorders, neonatal osteosclerotic dysplasias, osteopetrosis and related disorders, abnormal mineralization group of disorders (eg hypopohosphatasia), osteolysis group of disorders, disorders with disorganized development of skeletal components, overgrowth syndromes with skeletal involvement, craniosynostosis syndromes, dysostoses with predominant craniofacial involvement, dysostoses with predominant vertebral involvement, patellar dysostoses, brachydactylies, some disorders with limb hypoplasia-reduction defects, ectrodactyly with and without other manifestations, polydactyly-syndactyly-triphalangism group of disorders, and disorders with defects in joint formation and synostoses. Availability 4 weeks Gene Set Description
    [Show full text]
  • With a Learning Disability; Guidance for General Practice
    Improving identification of people with a learning disability: guidance for general practice NHS England and Improvement Publishing Approval Reference: 001030 Version 1 NHS England and NHS Improvement Contents Introduction .................................................................................... 2 Actions for practices ....................................................................... 4 Appendix 1: List of codes that indicate a learning disability ........... 7 Appendix 2: List of codes that may indicate a learning disability . 14 Appendix 3: List of outdated codes .............................................. 20 Appendix 4: Learning disability identification check-list ............... 22 1 | Contents Introduction 1. The NHS Long Term Plan1 commits to improve uptake of the existing annual health check in primary care for people aged over 14 years with a learning disability, so that at least 75% of those eligible have a learning disability health check each year. 2. There is also a need to increase the number of people receiving the annual seasonal flu vaccination, given the level of avoidable mortality associated with respiratory problems. 3. In 2017/18, only 44.6% of patients with a learning disability received a flu vaccination and only 55.1% of patients with a learning disability received an annual learning disability health check.2 4. In June 2019, NHS England and NHS Improvement announced a series of measures to improve coverage of annual health checks and flu vaccination for people with a learning disability. One of the commitments was to improve the quality of registers for people with a learning disability3. Clinical coding review 5. Most GP practices have developed a register of their patients known to have a learning disability. This has been developed from clinical diagnoses, from information gathered from learning disabilities teams and social services and has formed the basis of registers for people with learning disability developed for the Quality and Outcomes Framework (QOF).
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Craniosynostosis Precision Panel Overview Indications Clinical Utility
    Craniosynostosis Precision Panel Overview Craniosynostosis is defined as the premature fusion of one or more cranial sutures, often resulting in abnormal head shape. It is a developmental craniofacial anomaly resulting from a primary defect of ossification (primary craniosynostosis) or, more commonly, from a failure of brain growth (secondary craniosynostosis). As well, craniosynostosis can be simple when only one suture fuses prematurely or complex/compound when there is a premature fusion of multiple sutures. Complex craniosynostosis are usually associated with other body deformities. The main morbidity risk is the elevated intracranial pressure and subsequent brain damage. When left untreated, craniosynostosis can cause serious complications such as developmental delay, facial abnormality, sensory, respiratory and neurological dysfunction, eye anomalies and psychosocial disturbances. In approximately 85% of the cases, this disease is isolated and nonsyndromic. Syndromic craniosynostosis usually present with multiorgan complications. The Igenomix Craniosynostosis Precision Panel can be used to make a directed and accurate diagnosis ultimately leading to a better management and prognosis of the disease. It provides a comprehensive analysis of the genes involved in this disease using next-generation sequencing (NGS) to fully understand the spectrum of relevant genes involved. Indications The Igenomix Craniosynostosis Precision Panel is indicated for those patients with a clinical diagnosis or suspicion with or without the following manifestations: ‐ Microcephaly ‐ Scaphocephaly (elongated head) ‐ Anterior plagiocephaly ‐ Brachycephaly ‐ Torticollis ‐ Frontal bossing Clinical Utility The clinical utility of this panel is: - The genetic and molecular confirmation for an accurate clinical diagnosis of a symptomatic patient. - Early initiation of treatment in the form surgical procedures to relieve fused sutures, midface advancement, limited phase of orthodontic treatment and combined 1 orthodontics/orthognathic surgery treatment.
    [Show full text]