DOCSLIB.ORG

(375 Aa) Was Cloned Into the Pym-IRES-Neo Vector and Various Mutations and Deletions of LDB1 Were Created (By Site Directed Mutagenesis) in This Background

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(375 Aa) Was Cloned Into the Pym-IRES-Neo Vector and Various Mutations and Deletions of LDB1 Were Created (By Site Directed Mutagenesis) in This Background Supplementary Material Supplementary Materials and Methods Plasmid construction The HA tagged full length LDB1 cDNA (375 aa) was cloned into the pYM-IRES-Neo vector and various mutations and deletions of LDB1 were created (by site directed mutagenesis) in this background. The shRNA target sequence located in the LID coding sequence of Ldb1 cDNA was altered without changing the amino acid coding sequence of LDB1 protein. The shRNA target sequence is underlined and mutated nucleotides are bolded and underlined: Wild type: cgacgaggacagctttaacaa Mutant: tgatgaagattcattcaataa The dimerization domain of LDB1 (amino acids 1-200) was deleted and the K365R (AAA to CGA) mutation at 3’ end of Ldb1 cDNA was introduced to stabilize the protein thus created. Deletions in the LDB1 DD included sequences encoding amino acids 31 to 43 (Δ1), 58-62 (Δ2), 86 to 97 (Δ3) or 173 to 192 (Δ4/5). DD-only proteins were created by deletion of LDB1 C- terminal sequences encoding amino acids 201-375. Further details of cloning are available upon request. For the LMO2 fusion (2xLMO2), LMO2 cDNAs were tethered in the sense orientation through a flexible linker (22-aa polypeptide [GT(GGGS)4GGGT]) (Wang et al., 2008). Co-immunoprecipitation Protein complexes were precipitated with anti-HA agarose (Sigma, A2095) overnight at 4oC. Agarose was washed 3 times with IP100 buffer (Brand et al., 2004). Bound proteins were eluted with HA peptides (Sigma) and analyzed by western blot. For LDB1/FOG1 experiments, the protein complexes were precipitated overnight at 4oC by antibodies against LDB1 or FOG1 and Dynabeads® Protein G (Life Technologies, 10004D), then washed once with IP500 and two times with IP100 and eluted as described (Brand et al., 2004). 1 RNA-seq library construction, sequencing and computational analysis RNA-seq libraries were constructed for induced MEL WT cells, LDB1 KD cells and LDB1 KD cells expressing either LDB1 FL or LDB1Δ4/5 using TruSeq RNA Sample Prep Kit V2 (Illumina) according to the manufacturers protocol. Three biological replicates of each cell type were sequenced on a HiSeq 2000. Illumina TruSeq adapters from the 51-bp single-end reads were clipped using cutadapt v.1.1 with default parameters (Martin, 2011). Clipped reads were then mapped to the UCSC mm9 assembly with TopHat v1.4.1 (Trapnell et al., 2009) using default parameters with the additional parameter--butterfly-search. The number of uniquely mapped reads for each library ranged from 13 to 55M, with a median of 24M. Reads mapping to repetitive regions defined by the UCSC RepeatMasker track were removed from further analysis. Reads were counted in exons of the Ensembl release 67 GTF for mm9, using HTSeq 0.5.3p9. Differential expression of genes for all pairwise comparisons was assessed with DESeq v1.10.1 (Anders and Huber, 2010). We defined genes repressed by LDB1 KD as those that, in the DESeq analysis, had an adjusted P value < 0.05 and a log2 fold change < -1 in gene expression between LDB1 KD cells and WT. To define rescued genes, we first used the variance-stabilized transformation (VST) in the DESeq package to obtain comparable scaled counts for all experiments. VST-scaled counts for replicates were averaged to obtain per-treatment values. Then, rescued genes were defined as those LDB1 KD repressed genes with equal or greater expression in LDB1 KD cells expressing LDB1 FL than WT, or, if genes have lower expression in LDB1 KD cells expressing LDB1 FL than WT, whose expression difference between WT and LDB1 FL expressing cells was less than half the expression difference between WT and LDB1 KD cells. More precisely, a gene was defined as rescued if it was an LDB1 KD repressed gene and satisfied the condition: ((WT - LDB1 FL) < 0) OR ((WT - LDB1 FL) < (0.5 * (WT - LDB1 KD)) AND ((WT - LDB1 FL) > 0)), where "WT", "LDB1 FL", and "LDB1 KD" are the averaged, VST- scaled counts for each treatment. Next, of the genes that were rescued by LDB1 FL, we defined a gene to be 4/5-dependent if it was repressed in LDB1 KD cells expressing LDB1Δ4/5 compared to LDB1 KD cells expressing 2 LDB1 FL (that is, log2 fold change < -1 and adjusted P value < 0.05). Otherwise, it was defined as 4/5-independent. Since the transcribed sequence for LDB1 differs between LDB1 delta 4/5 and LDB1 FL, we removed LDB1 from consideration in the downstream RNA-seq rescue and 4/5-dependence analysis. Finally, genes were defined to be LDB1 bound if there was an LDB1 peak in induced MEL cells within 1kb of the start position of the gene, inside gene body or within 1 kb of the end position of the gene ((Soler et al., 2010); BED file downloaded from the PSU genome browser, http://main.genome-browser.bx.psu.edu). The OMIM database was downloaded from a URL provided by omim.org (September 2013). A combination of Ensembl's BioMart (mapping human HGNC to orthologous mouse Ensembl IDs) and the "mousecorr" field in the OMIM database were used to identify human homologs of mouse genes. An OMIM entry was considered orthologous in mouse if one of these methods successfully mapped the HGNC human gene symbol to a mouse Ensembl gene. Primers ChIP primers Alas2 + 2kb Fw AGGGCAGGACTTTGCCTCTAATCT Alas2 + 2kb Rev AGATGTCCCAGTTCCTGCAGGTTT GypA Fw GTCCTCGCAGTTATGCAGAC GypA Rev GGCCTCTATCCGTTGACACA α-globin HS26 Fw TGACCATAGTCAACAGCAGGT α-globin HS26 Rev GCTCGTTCAAGCATCTCCAT A730036l17Rik Fw TCAAAACTCTGCCTCCTCCC A730036l17Rik Rev GATAGGTGAAAAGGCGCCAG Kctd14 Fw CTTAGAGTTCCTCAGGGGCG Kctd14 Rev GGGTACACAACGCTGTCTTG Ubash3a Fw TTTTCTTCACAGCCTCAGCC Ubash3a Rev CCATGTCTTCCTGCTTGCTG CD24a Fw AACAAAGGAAACTTGGGCCG CD24a Rev CTCTGGCACAGCTAGGGTTT Treml1 Fw TGTCAGCCTCGATGGATAGC Treml1 Rev GCTGGGCAGTAGTAGGTTCT Ypel3 Fw CAGCCCTTTCTCTCCTTCCA Ypel3 Rev TCCCAGCCGTTGTCTTTGAT qRT-PCR primers α-globin Fw GCTGAAGCCCTGGAAAGGAT α-globin Rev GGCTTACATCAAAGTGAGGAAAGT Alas2 Fw CCATCTTAAGGCAACCAAGGC 3 Alas2 Rev ACAGCATGAAAGGACAATGGC GypA Fw ATTCATGTCTCAACTTATCACA GypA Rev CCAATGTGTGGTGAGACAGGCT A730036l17Rik Fw GCATTCAGGACTTGCTCTGG A730036l17Rik Rev GTCCTCACACTTGGCTTGTG Kctd14 Fw ATGCCACAGATCTTCGGTGA Kctd14 Rev AGGACCTCCAGGTTTTCTCTG Ubash3a Fw GCCAGTAAAGACGCTGACAC Ubash3a Rev ACCTCTTCCTGGAAAGCTCG CD24a Fw AGTAACGCTACCACCAGAGG CD24a Rev GTTTCCTGGCCTGAGTCTCT Treml1 Fw GATCCACCATCAAGCGAACC Treml1 Rev TCCTGGGAAGACAACTGTGG Ypel3 Fw CATGTGGCTTCAGCCTGG Ypel3 Rev GTACAGGAGCTGGGTCCTTC Neo Fw TCGACGTTGTCACTGAAGCG Neo Rev GGATACTTTCTCGGCAGGAGC Ldb1’UTR Fw GGGGTACTCATGTGGATGCCTGT Ldb1 3’UTR Rev ACCCAGAACCTGGGGTAAGAACG Hprt Fw TGACACTGGTAAAACAATGCAAACT Hprt Rev AACAAAGTCTGGCCTGTATCCAA All other primers have been described (Song et al., 2007; Handoko et al., 2011). Antibodies Antibodies used for western blots were against HA (Roche, 11867423001), Tubulin (Sigma, T5168), LDB1 (Santa Cruz Biotechnology, sc-11198), TAL1 (Santa Cruz Biotechnology, sc- 12984), FOG1 (Santa Cruz Biotechnology, sc-9361), ETO2 (Santa Cruz Biotechnology, sc- 9739), GATA1 (Santa Cruz Biotechnology, sc-265), LMO2 (R&D, AF2726) and appropriate HRP-fused secondary antibodies from Santa Cruz Biotechnology or Goat TrueBlot®: Anti-Goat IgG HRP (Rockland Immunochemicals, 18-8814-33). Antibodies from Santa Cruz Biotechnology were used in ChIP for GATA1 (sc-1233), BRG1 (sc- 10768), Pol II (sc-899), FOG1 (Santa Cruz Biotechnology,sc-9361), MTA2 (sc-9474), HDAC1 (sc-7872), CBP (sc-369) and LAMB1 (sc-6217). Other antibodies were against AcH3 (Millipore, 06-599), H3 (Abcam, ab1791), and HA (Millipore, 05-904). For immuno-staining antibody against LAMB1 (Santa Cruz Biotechnology, sc-6216) and secondary anti-Goat DyLight 594 (Jackson ImmunoResearch, 805-515-180) were been used. 4 Supplementary References Anders S, Huber W. 2010. Differential expression analysis for sequence count data. Genome. Biol. 11: R106. Brand M, Ranish JA, Kummer NT, Hamilton J, Igarashi K, Francastel C, Chi TH, Crabtree GR, Aebersold R, Groudine M. 2004. Dynamic changes in transcription factor complexes during erythroid differentiation revealed by quantitative proteomics. Nat. Struct. Mol Biol. 11: 73-80. Handoko L, Xu H, Li G, Ngan CY, Chew E, Schnapp M, Lee CW, Ye C, Ping JL, Mulawadi F et al. 2011. CTCF-mediated functional chromatin interactome in pluripotent cells. Nat Genet 43: 630-638. Martin M. 2011. Cutadapt removes adaptor sequences from high-throughput sequencing reads. EMBnet. journal 17: 10-12. Soler E, Andrieu-Soler C, de Boer E., Bryne JC, Thongjuea S, Stadhouders R, Palstra RJ, Stevens M, Kockx C, van IW et al. 2010. The genome-wide dynamics of the binding of Ldb1 complexes during erythroid differentiation. Genes Dev 24: 277-289. Song S-H, Hou C, Dean A. 2007. A positive role for NLI/Ldb1 in long-range -globin locus control region function. Mol. Cell 28: 810-822. Trapnell C, Pachter L, Salzberg SL. 2009. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 25: 1105-1111. Wang J, Levasseur DN, Orkin SH. 2008. Requirement of Nanog dimerization for stem cell self-renewal and pluripotency. Proc. Natl. Acad. Sci U. S. A. 105: 6326-6331. Supplementary Figure Legends Figure S1. LDB1 FL fully rescues β-globin expression in induced LDB1 KD MEL cells. (A) Diagram of LDB1 FL cDNA expressed in induced LDB1 KD MEL cells. Colored rectangles: purple, HA tag; green, DD domain; orange, nuclear localization signal (NLS); yellow, LID. (B) Western blot of protein extracts from three induced LDB1 FL-expressing LDB1 KD MEL cell lines with LDB1 or HA antibodies. α-tubulin served as loading control. (C) β-globin and 5 endogenous LDB1 gene expression in three induced LDB1 FL-expressing LDB1 KD MEL cell lines. Induced cells containing an empty vector (Empty) served as a control. Expression in induced WT MEL cells was set to 1. Error bars indicate SEM, N=3 biological replicates. Figure S2. K365R mutation stabilizes LDB1ΔDD. (A) Western blotting of protein extracts from LDB1 KD MEL cells expressing LDB1 FL and LDB1ΔDD with antibodies against HA. α- tubulin served as loading control. (B) Expression level of transgenic RNA measured by real-time PCR with primers to neo-resistant gene. Expression level in LDB1 FL was set to 1. Error bars indicate SEM, N=3. (C) Western blotting of protein extracts from LDB1 KD MEL cells expressing LDB1ΔDD incubated at 30o C overnight or treated with 26S proteasome inhibitor MG132 with antibodies against HA.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Supplementary Figures 1-14 and Supplementary References
    SUPPORTING INFORMATION Spatial Cross-Talk Between Oxidative Stress and DNA Replication in Human Fibroblasts Marko Radulovic,1,2 Noor O Baqader,1 Kai Stoeber,3† and Jasminka Godovac-Zimmermann1* 1Division of Medicine, University College London, Center for Nephrology, Royal Free Campus, Rowland Hill Street, London, NW3 2PF, UK. 2Insitute of Oncology and Radiology, Pasterova 14, 11000 Belgrade, Serbia 3Research Department of Pathology and UCL Cancer Institute, Rockefeller Building, University College London, University Street, London WC1E 6JJ, UK †Present Address: Shionogi Europe, 33 Kingsway, Holborn, London WC2B 6UF, UK TABLE OF CONTENTS 1. Supplementary Figures 1-14 and Supplementary References. Figure S-1. Network and joint spatial razor plot for 18 enzymes of glycolysis and the pentose phosphate shunt. Figure S-2. Correlation of SILAC ratios between OXS and OAC for proteins assigned to the SAME class. Figure S-3. Overlap matrix (r = 1) for groups of CORUM complexes containing 19 proteins of the 49-set. Figure S-4. Joint spatial razor plots for the Nop56p complex and FIB-associated complex involved in ribosome biogenesis. Figure S-5. Analysis of the response of emerin nuclear envelope complexes to OXS and OAC. Figure S-6. Joint spatial razor plots for the CCT protein folding complex, ATP synthase and V-Type ATPase. Figure S-7. Joint spatial razor plots showing changes in subcellular abundance and compartmental distribution for proteins annotated by GO to nucleocytoplasmic transport (GO:0006913). Figure S-8. Joint spatial razor plots showing changes in subcellular abundance and compartmental distribution for proteins annotated to endocytosis (GO:0006897). Figure S-9. Joint spatial razor plots for 401-set proteins annotated by GO to small GTPase mediated signal transduction (GO:0007264) and/or GTPase activity (GO:0003924).
    [Show full text]
  • Supplementary Table 4
    Li et al. mir-30d in human cancer Table S4. The probe list down-regulated in MDA-MB-231 cells by mir-30d mimic transfection Gene Probe Gene symbol Description Row set 27758 8119801 ABCC10 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 15497 8101675 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 18536 8158725 ABL1 c-abl oncogene 1, receptor tyrosine kinase 21232 8058591 ACADL acyl-Coenzyme A dehydrogenase, long chain 12466 7936028 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 18102 8056005 ACVR1 activin A receptor, type I 20790 8115490 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 15688 7979904 ADAM21 ADAM metallopeptidase domain 21 14937 8054254 AFF3 AF4/FMR2 family, member 3 23560 8121277 AIM1 absent in melanoma 1 20209 7921434 AIM2 absent in melanoma 2 19272 8136336 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 18013 7954777 ALG10 asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) 30049 7954789 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 28807 7962579 AMIGO2 adhesion molecule with Ig-like domain 2 5576 8112596 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 23414 7922121 ANKRD36BL1 ankyrin repeat domain 36B-like 1 (pseudogene) 29782 8098246 ANXA10 annexin A10 22609 8030470 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 14426 8107421 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 12042 8099760 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 30227 8059854 ARL4C ADP-ribosylation factor-like 4C 32785 8143766 ARP11 actin-related Arp11 6497 8052125 ASB3 ankyrin repeat and SOCS box-containing 3 24269 8128592 ATG5 ATG5 autophagy related 5 homolog (S.
    [Show full text]
  • Effects of Early Social Deprivation on Epigenetic
    RESEARCH ARTICLE Effects of early social deprivation on epigenetic statuses and adaptive behavior of young children: A study based on a cohort of institutionalized infants and toddlers 1,2,3 1 2,3 Oxana Yu. NaumovaID *, Sergey Yu. Rychkov , Sergey A. KornilovID , Veronika 4,5,6 2 2 2 V. OdintsovaID , Varvara O. Anikina , Maria Yu. SolodunovaID , Irina A. ArintcinaID , 2 2 2,3 1 Marina A. Zhukova , Irina V. OvchinnikovaID , Olga V. BurenkovaID , Olga V. Zhukova , a1111111111 Rifkat J. Muhamedrahimov2, Elena L. Grigorenko2,3,7* a1111111111 a1111111111 1 Human Genetics Laboratory, Vavilov Institute of General Genetics RAS, Moscow, Russian Federation, 2 Department of Psychology, Saint-Petersburg State University, Saint Petersburg, Russian Federation, a1111111111 3 Department of Psychology, University of Houston, Houston, Texas, United States of America, a1111111111 4 Department of Biological Psychology, VU University, Amsterdam, Netherlands, 5 National Medical Research Center for Obstetrics, Gynecology and Perinatology, Moscow, Russian Federation, 6 Federal Research Institute for Health Organization and Informatics, Moscow, Russia, 7 Baylor College of Medicine, Houston, Texas, United States of America * [email protected] (EG); [email protected] (OYN) OPEN ACCESS Citation: Naumova OY., Rychkov SY., Kornilov SA, Odintsova VV, Anikina VO, Solodunova MY., et al. (2019) Effects of early social deprivation on Abstract epigenetic statuses and adaptive behavior of young Early social deprivation (i.e., an insufficiency or lack of parental care) has been identified as children: A study based on a cohort of institutionalized infants and toddlers. PLoS ONE 14 a significant adverse early experience that may affect multiple facets of child development (3): e0214285.
    [Show full text]
  • AP3S1 Antibody Cat
    AP3S1 Antibody Cat. No.: 6391 AP3S1 Antibody Immunohistochemistry of AP3S1 in human kidney tissue Immunofluorescence of AP3S1 in human kidney tissue with AP3S1 antibody at 2.5 μg/mL. with AP3S1 antibody at 20 μg/mL. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine: (100%) AP3S1 antibody was raised against a 19 amino acid synthetic peptide near the center of human AP3S1. IMMUNOGEN: The immunogen is located within the first 50 amino acids of AP3S1. TESTED APPLICATIONS: ELISA, IF, IHC-P, WB October 2, 2021 1 https://www.prosci-inc.com/ap3s1-antibody-6391.html AP3S1 antibody can be used for detection of AP3S1 by Western blot at 1 - 2 μg/mL. Antibody can also be used for immunohistochemistry starting at 2.5 μg/mL. For immunofluorescence start at 20 μg/mL. APPLICATIONS: Antibody validated: Western Blot in mouse samples; Immunohistochemistry in human samples and Immunofluorescence in human samples. All other applications and species not yet tested. At least three isoforms of AP3S1 are known to exist; this antibody will detect the two SPECIFICITY: larger isoforms. AP3S1 antibody is predicted to not cross-react with other AP3 protein family members. POSITIVE CONTROL: 1) Cat. No. 1405 - Mouse Kidney Tissue Lysate 2) Cat. No. 10-401 - Human Kidney Tissue Slide Properties PURIFICATION: AP3S1 Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: AP3S1 Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL AP3S1 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Chemical Agent and Antibodies B-Raf Inhibitor RAF265
    Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation.
    [Show full text]
  • Supplementary Material Table of Contents
    Supplementary M aterial Table of Contents 1 - Online S u pplementary Methods ………………………………………………...… . …2 1.1 Study population……………………………………………………………..2 1.2 Quality control and principal component analysis …………………………..2 1.3 Statistical analyses………………………………………… ………………...3 1.3.1 Disease - specific association testing ……………………………… ..3 1.3.2 Cross - phenotype meta - analysis …………………………………… .3 1.3.3 Model search ……………………………………………………… .4 1.3.4 Novelty of the variants …………………………………………… ..4 1.3.5 Functional Enrichment Analy sis ………………………………… ...4 1.3.6 Drug Target Enrichment Analysis ………………………………… 5 2 - Supplementary Figures………………………………………...………………… . …. 7 3 - Members of the Myositis Genetics Consortium (MYOGEN) ……………………. ..16 4 - Members of the Scleroderma Genetics Consortium ………………… ……………...17 5 - Supplementary References………………………………………………………… . .18 6 - Supplementary Tables………………………………………………………… . ……22 1 Online supplementary m ethods Study population This study was conducted using 12,132 affected subjects and 23 ,260 controls of European des cent population and all of them have been included in previously published GWAS as summarized in Table S1. [1 - 6] Briefly, a total of 3,255 SLE cases and 9,562 ancestry matched controls were included from six countrie s across Europe and North America (Spain, Germany, Netherlands, Italy, UK, and USA). All of the included patients were diagnosed based on the standard American College of Rheumatology (ACR) classification criteria. [7] Previously described GWAS data from 2,363 SSc cases and 5,181 ancestry
    [Show full text]
  • Single Cell Derived Clonal Analysis of Human Glioblastoma Links
    SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]