Anti-CIP2A / KIAA1524 Antibody (ARG59463)

Total Page:16

File Type:pdf, Size:1020Kb

Anti-CIP2A / KIAA1524 Antibody (ARG59463) Product datasheet [email protected] ARG59463 Package: 50 μg anti-CIP2A / KIAA1524 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes CIP2A / KIAA1524 Tested Reactivity Hu, Ms Predict Reactivity Bov Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name CIP2A / KIAA1524 Antigen Species Human Immunogen Synthetic peptide corresponding to aa. 854-889 of Human KIAA1524. (EVQKAQLEGRLEEKESLVKLQQEELNKHSHMIAMIH) Conjugation Un-conjugated Alternate Names p90; Cancerous inhibitor of PP2A; CIP2A; p90 autoantigen; Protein CIP2A Application Instructions Application table Application Dilution WB 0.1 - 0.5 µg/ml Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 102 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer 0.9% NaCl, 0.2% Na2HPO4, 0.05% Sodium azide and 5% BSA. Preservative 0.05% Sodium azide Stabilizer 5% BSA Concentration 0.5 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C or below. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol KIAA1524 Gene Full Name KIAA1524 Function Oncoprotein that inhibits PP2A and stabilizes MYC in human malignancies. Promotes anchorage- independent cell growth and tumor formation. [UniProt] Cellular Localization Membrane; Single-pass membrane protein. Cytoplasm. Note=Slightly concentrates in the perinuclear region (PubMed:12118381). [UniProt] Images ARG59463 anti-CIP2A / KIAA1524 antibody WB image Western blot: 50 µg of Mouse testis and 40 µg of HeLa whole cell lysate stained with ARG59463 anti-CIP2A / KIAA1524 antibody at 0.5 µg/ml dilution. www.arigobio.com 2/2 Powered by TCPDF (www.tcpdf.org).
Recommended publications
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Material
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Page 1 / 45 SUPPLEMENTARY MATERIAL Appendix A1: Neuropsychological protocol. Appendix A2: Description of the four cases at the transitional stage. Table A1: Clinical status and center proportion in each batch. Table A2: Complete output from EdgeR. Table A3: List of the putative target genes. Table A4: Complete output from DIANA-miRPath v.3. Table A5: Comparison of studies investigating miRNAs from brain samples. Figure A1: Stratified nested cross-validation. Figure A2: Expression heatmap of miRNA signature. Figure A3: Bootstrapped ROC AUC scores. Figure A4: ROC AUC scores with 100 different fold splits. Figure A5: Presymptomatic subjects probability scores. Figure A6: Heatmap of the level of enrichment in KEGG pathways. Kmetzsch V, et al. J Neurol Neurosurg Psychiatry 2021; 92:485–493. doi: 10.1136/jnnp-2020-324647 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Appendix A1. Neuropsychological protocol The PREV-DEMALS cognitive evaluation included standardized neuropsychological tests to investigate all cognitive domains, and in particular frontal lobe functions. The scores were provided previously (Bertrand et al., 2018). Briefly, global cognitive efficiency was evaluated by means of Mini-Mental State Examination (MMSE) and Mattis Dementia Rating Scale (MDRS). Frontal executive functions were assessed with Frontal Assessment Battery (FAB), forward and backward digit spans, Trail Making Test part A and B (TMT-A and TMT-B), Wisconsin Card Sorting Test (WCST), and Symbol-Digit Modalities test.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Newfound Coding Potential of Transcripts Unveils Missing Members Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.406710; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Newfound coding potential of transcripts unveils missing members of 2 human protein communities 3 4 Sebastien Leblanc1,2, Marie A Brunet1,2, Jean-François Jacques1,2, Amina M Lekehal1,2, Andréa 5 Duclos1, Alexia Tremblay1, Alexis Bruggeman-Gascon1, Sondos Samandi1,2, Mylène Brunelle1,2, 6 Alan A Cohen3, Michelle S Scott1, Xavier Roucou1,2,* 7 1Department of Biochemistry and Functional Genomics, Université de Sherbrooke, Sherbrooke, 8 Quebec, Canada. 9 2 PROTEO, Quebec Network for Research on Protein Function, Structure, and Engineering. 10 3Department of Family Medicine, Université de Sherbrooke, Sherbrooke, Quebec, Canada. 11 12 *Corresponding author: Tel. (819) 821-8000x72240; E-Mail: [email protected] 13 14 15 Running title: Alternative proteins in communities 16 17 Keywords: alternative proteins, protein network, protein-protein interactions, pseudogenes, 18 affinity purification-mass spectrometry 19 20 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.406710; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 21 Abstract 22 23 Recent proteogenomic approaches have led to the discovery that regions of the transcriptome 24 previously annotated as non-coding regions (i.e.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Transdifferentiation of Human Mesenchymal Stem Cells
    Transdifferentiation of Human Mesenchymal Stem Cells Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Tatjana Schilling aus San Miguel de Tucuman, Argentinien Würzburg, 2007 Eingereicht am: Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Martin J. Müller Gutachter: PD Dr. Norbert Schütze Gutachter: Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am: Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbstständig angefertigt und keine anderen als die von mir angegebenen Hilfsmittel und Quellen verwendet habe. Des Weiteren erkläre ich, dass diese Arbeit weder in gleicher noch in ähnlicher Form in einem Prüfungsverfahren vorgelegen hat und ich noch keinen Promotionsversuch unternommen habe. Gerbrunn, 4. Mai 2007 Tatjana Schilling Table of contents i Table of contents 1 Summary ........................................................................................................................ 1 1.1 Summary.................................................................................................................... 1 1.2 Zusammenfassung..................................................................................................... 2 2 Introduction.................................................................................................................... 4 2.1 Osteoporosis and the fatty degeneration of the bone marrow..................................... 4 2.2 Adipose and bone
    [Show full text]
  • 1 SUPPLEMENTAL DATA Figure S1. Poly I:C Induces IFN-Β Expression
    SUPPLEMENTAL DATA Figure S1. Poly I:C induces IFN-β expression and signaling. Fibroblasts were incubated in media with or without Poly I:C for 24 h. RNA was isolated and processed for microarray analysis. Genes showing >2-fold up- or down-regulation compared to control fibroblasts were analyzed using Ingenuity Pathway Analysis Software (Red color, up-regulation; Green color, down-regulation). The transcripts with known gene identifiers (HUGO gene symbols) were entered into the Ingenuity Pathways Knowledge Base IPA 4.0. Each gene identifier mapped in the Ingenuity Pathways Knowledge Base was termed as a focus gene, which was overlaid into a global molecular network established from the information in the Ingenuity Pathways Knowledge Base. Each network contained a maximum of 35 focus genes. 1 Figure S2. The overlap of genes regulated by Poly I:C and by IFN. Bioinformatics analysis was conducted to generate a list of 2003 genes showing >2 fold up or down- regulation in fibroblasts treated with Poly I:C for 24 h. The overlap of this gene set with the 117 skin gene IFN Core Signature comprised of datasets of skin cells stimulated by IFN (Wong et al, 2012) was generated using Microsoft Excel. 2 Symbol Description polyIC 24h IFN 24h CXCL10 chemokine (C-X-C motif) ligand 10 129 7.14 CCL5 chemokine (C-C motif) ligand 5 118 1.12 CCL5 chemokine (C-C motif) ligand 5 115 1.01 OASL 2'-5'-oligoadenylate synthetase-like 83.3 9.52 CCL8 chemokine (C-C motif) ligand 8 78.5 3.25 IDO1 indoleamine 2,3-dioxygenase 1 76.3 3.5 IFI27 interferon, alpha-inducible
    [Show full text]
  • C6cc08797c1.Pdf
    Electronic Supplementary Material (ESI) for Chemical Communications. This journal is © The Royal Society of Chemistry 2017 Supplementary Information for Competition-based, quantitative chemical proteomics in breast cancer cells identifies new target profiles for sulforaphane James A. Clulow,a,‡ Elisabeth M. Storck,a,‡ Thomas Lanyon-Hogg,a,‡ Karunakaran A. Kalesh,a Lyn Jonesb and Edward W. Tatea,* a Department of Chemistry, Imperial College London, London, UK, SW7 2AZ b Worldwide Medicinal Chemistry, Pfizer, 200 Cambridge Park Drive, MA 02140, USA ‡ Authors share equal contribution * corresponding author, email: [email protected] Table of Contents 1 Supporting Figures..........................................................................................................................3 2 Supporting Tables.........................................................................................................................17 2.1 Supporting Table S1. Incorporation validation for the R10K8 label in the 'spike-in' SILAC proteome of the MCF7 cell line........................................................................................................17 2.2 Supporting Table S2. Incorporation validation for the R10K8 label in the 'spike-in' SILAC proteome of the MDA-MB-231 cell line ...........................................................................................17 2.3 Supporting Table S3. High- and medium- confidence targets of sulforaphane in the MCF7 cell line..............................................................................................................................................17
    [Show full text]
  • 29-Volff O16.Indd
    Identification of new gene candidates on the sex chromosomes of the platyfishXiphophorus maculatus by Astrid BÖHNE (1), Christina SCHULTHEIS (2), Qingchun ZHOU (2), Alexander FROSCHAUER (2), Cornelia SCHMIDT (2), Yvonne SELZ (2), Ingo BRAASCH (2), Catherine OZOUF-COSTAZ (3), Agnès DETTAI (3), Béatrice SÉGURENS (4), Arnaud COULOUX (4), Sylvie BERNARD-SAMAIN (4), Stefan CHILMONCZYK (5), Alia GANNOUNI (1), Karim MADANI (1), Frédéric BRUNET (1), Delphine GALIANA-ARNOUX (1), Manfred SCHARTL (2) & Jean-Nicolas VOLFF (1) ABSTRACT. - In order to better understand the molecular and evolutionary mechanisms driving sex determination in fish, bacterial artificial chromosome (BAC) contigs covering the sex determination region of the X and Y sex chromosomes of the platyfish Xiphophorus maculatus have been constructed. Initial analysis of these contigs led to the identification of eleven gene candidates closely linked to the master sex-determining locus and expressed in different types of tissues. These genes are all present on both the X and the Y chromosomes, suggesting a restricted degree of differentiation and probably a young evolutionary age for the platyfish sex chromosomes. Syntenies were detected with several zebrafish chromosomes as well as with two medaka and several tetrapod autosomes, supporting an independent origin of sex chromosomes not only in different vertebrate lineages but also in different fish species. Key words. - Sex chromosomes - Sex determination - Fish - Poeciliid - Xiphophorus. Introduction sex determination (Volff and Schartl, 2001). This is particu- In contrast to the situation observed in mammals and larly true for the genus Xiphophorus, which is also an estab- birds, a huge diversity of sex determination mechanisms lished model for cancer research (Meierjohann et al., 2004).
    [Show full text]