DOCSLIB.ORG

29-Volff O16.Indd

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
29-Volff O16.Indd Identification of new gene candidates on the sex chromosomes of the platyfishXiphophorus maculatus by Astrid BÖHNE (1), Christina SCHULTHEIS (2), Qingchun ZHOU (2), Alexander FROSCHAUER (2), Cornelia SCHMIDT (2), Yvonne SELZ (2), Ingo BRAASCH (2), Catherine OZOUF-COSTAZ (3), Agnès DETTAI (3), Béatrice SÉGURENS (4), Arnaud COULOUX (4), Sylvie BERNARD-SAMAIN (4), Stefan CHILMONCZYK (5), Alia GANNOUNI (1), Karim MADANI (1), Frédéric BRUNET (1), Delphine GALIANA-ARNOUX (1), Manfred SCHARTL (2) & Jean-Nicolas VOLFF (1) ABSTRACT. - In order to better understand the molecular and evolutionary mechanisms driving sex determination in fish, bacterial artificial chromosome (BAC) contigs covering the sex determination region of the X and Y sex chromosomes of the platyfish Xiphophorus maculatus have been constructed. Initial analysis of these contigs led to the identification of eleven gene candidates closely linked to the master sex-determining locus and expressed in different types of tissues. These genes are all present on both the X and the Y chromosomes, suggesting a restricted degree of differentiation and probably a young evolutionary age for the platyfish sex chromosomes. Syntenies were detected with several zebrafish chromosomes as well as with two medaka and several tetrapod autosomes, supporting an independent origin of sex chromosomes not only in different vertebrate lineages but also in different fish species. Key words. - Sex chromosomes - Sex determination - Fish - Poeciliid - Xiphophorus. Introduction sex determination (Volff and Schartl, 2001). This is particu- In contrast to the situation observed in mammals and larly true for the genus Xiphophorus, which is also an estab- birds, a huge diversity of sex determination mechanisms lished model for cancer research (Meierjohann et al., 2004). exists in fish (Devlin and Nagahama, 2002; Volff et al., In the platyfish X. maculatus, three types of homomorphic 2007). Closely related fish species can have different mecha- sex chromosomes have been identified: X, Y and W. Natural nisms of sex determination, reflecting a frequent switch females are XX, XW or ZW, whereas males are YY or XY. between sex determination systems during fish evolution. In WW females can be obtained under laboratory conditions. It order to better understand this phenomenon, interspecific is possible to derive strains with either male or female heter- comparative analyses of sex determination genes and sex ogamety and thus to study the link between different systems chromosomes are necessary. Major fish models under inves- within a same genus. Genetic and molecular markers are tigation include the Japanese medaka Oryzias latipes and available, including the Xmrk oncogene, which encodes a related species, the threespine stickleback Gasterosteus receptor tyrosine kinase inducing the formation of melano- aculeatus, the tilapias Oreochromis niloticus and O. aureus, ma. Two pigmentation loci are also linked to the master sex- the pufferfish Takifugu rubripes as well as several salmonids determining locus, as well as a polymorphic locus determin- (for review, Volff et al., 2007). So far, the master sex-deter- ing the onset of sexual maturity (Volff and Schartl, 2001). mining gene has been identified only in O. latipes (Matsuda As a first step towards the positional cloning of the mas- et al., 2002; Nanda et al., 2002). However, this gene, called ter sex-determining gene of the platyfish, a bacterial artificial dmrt1bY or dmy, is present in only a very restricted number chromosome (BAC) genomic library has been constructed of species and is therefore not the universal master sex- (Froschauer et al., 2002). We report here the identification of determining gene in fish. X- and Y-chromosomal genes through BAC clone sequenc- Poeciliids, a family of livebearers originally found in ing, which allowed establishing syntenic relationships Mexico and Central America, are very attractive organisms between the sex-determining region of X. maculatus and for the study of sex determination, sexual selection and many other fish and tetrapod genomes. other biological questions. Various types of sex-determining systems have been described between and even within spe- Methods cies, making this fish family extremely well-suited to deci- Fish pher the molecular and evolutionary basis of the diversity of X. maculatus (population Rio Jamapa, strains WLC1274 (1) Institut de génomique fonctionnelle, Institut fédératif biosciences Gerland Lyon-Sud, Université de Lyon, 69003 France; INRA, CNRS, Université Lyon 1, École normale supérieure, 69364 France. [[email protected]] (2) University of Würzburg, Physiologische Chemie I, Biozentrum, Am Hubland, 97074 Würzburg, Germany. (3) Département systématique et évolution, CNRS UMR7138, Muséum national d'Histoire naturelle, 43 rue Cuvier, 75005 Paris, France. (4) Genoscope, 2 rue Gaston Crémieux, CP 5706, 91057 Evry CEDEX , France. (5) Unité de virologie et immunologie moléculaires, Institut national de la recherche agronomique, Domaine de Vilvert, 78352 Jouy-en-Josas, France. Cybium 2008, 32(2) suppl.: 69-71. Sex chromosomes in Xiphophorus BÖHNE ET AL . and WLC1235) was kept under standard conditions in aquar- reported (Volff et al., 2003; Schultheis et al., 2006); two ium facilities at the Biocenter of the University of Würzburg other genes, irf3 and KIAA1524, are described here for the (Germany) and the IFR128 BioSciences Gerland - Lyon Sud first time. As observed for other platyfish sex chromosomal in Lyon (France). These strains have a male heterogamety genes, irf3 and KIAA1524 are located on both the X and the system (females are XX and males XY). Y (Tab. I). However, the data available did not allow deter- mining with certainty if these genes are functional on both RT-PCR expression analysis types of sex chromosomes. Total RNA was extracted from adult tissues and organs Irf3, for interferon regulatory factor 3, encodes a phos- using the Total RNA Isolation Reagent (Abgene). PCR reac- phoprotein that, when activated, acts as a transcription factor tions were performed in 5% dimethyl sulfoxide (DMSO) on in the innate immune response and regulates interferon pro- cDNA prepared with the RevertAid First Strand cDNA Syn- duction in mammals. Binding to DNA takes place through thesis Kit (Fermentas Life Science). The amount of cDNA the IRF protein domain, also called tryptophan pentad repeat, was equalized according to RT-PCR for the actin gene (25 which is characteristic for the IRF family. Irf3 is activated cycles, annealing temperature 55°C) with primers XmacAct1 through viral and bacterial infections and possibly through (5’-GTAGGTGATGAAGCCCAGAGC-3’) and XmacAct2 cellular stress signals (Grandvaux et al., 2002). (5’-AGGGAGCTCGTAGCTCTTCTC-3’) (not shown). KIAA1524 encodes a protein also called p90 (“90kDa PCR for irf3 (35 cycles) was performed at an annealing tem- companion auto-antigen of p62”; Soo Hoo et al., 2002). Like perature of 65°C with primers IRF_W2_F2 5’-AGCT- p62, a cytoplasmic RNA-binding protein regulating the GGCGAACGGAGAGAAG-3’ and IRF_W2_R2 5’-ACAG- expression of the insulin-like growth factor II mRNA, p90 is CAGCACCGACTCCATG-3’. PCR for KIAA1524/p90 (35 overexpressed in different types of cancer and recognized by cycles) was done at an annealing temperature of 57°C with auto-antibodies. Nothing is known so far concerning the primers P90F2 5’-TCAACATCATCTTGAACGGC-3’ and function of this protein. P90 contains a coiled-coil region P90R1 5’-GAAGTCTGGAAGGGGCGTGG-3’. (Soo Hoo et al., 2002) as well as moderately conserved Sequence analysis domains suggesting a role either as a chromosome segrega- BAC clones were shotgun-sequenced at the Genoscope tion ATPase (cluster of orthologous group COG1196.2) RT- center (http://www.cns.fr/). Gene candidates were identified PCR expression analysis of the sex chromosomal genes irf3 through sequence comparison with public databases (http:// (interferon regulatory factor 3) and KIAA1524 (aka p90 www.ncbi.nlm.nih.gov/BLAST/; BLASTX). Localization of autoantigen) or as an autophagy protein involved in intracel- orthologous genes in other vertebrates was investigated lular degradation in autophagosomes (protein family through BLAST analysis of genome assemblies (http://www. pfam08614.1). irf3 KIAA1524 ncbi.nlm.nih.gov/BLAST/; http://www.ensembl.org/Multi/ Expression of both and was detected by RT-PCR in both male and female adult gonads, as well as in blastview). all other types of tissues and organs tested (Fig. 1). This is Results and discussion similar to the broad expression profile in mammals identified Initial sequencing and analysis of BAC clones covering through expressed sequence tag analysis (data not shown). the sex-determining region of the platyfish uncovered eleven None of the genes displayed a clear sex-specific expression gene candidates (Tab. I). Some of them have already been suggesting a function in sex determination, as reported for Table I. - Gene candidates on the sex chromosomes of the platyfish and their localization in other vertebrate genomes. Dre, Danio rerio; EGF, epidermal growth factor; Gga, Gallus gallus; Hsa, Homo sapiens; Mmu, Mus musculus (mouse); Ola, Oryzias latipes; Scaf, scaf- folds. 70 Cybium 2008, 32(2) suppl. BÖHNE ET AL . Sex chromosomes in Xiphophorus basis of sex-linked differences in resistance to virus infec- tion, disease and environmental stress. Acknowledgements. - This work is funded by grants from the Deutsche Forschungsgemeinschaft (to M.S. and J.-N.V.), the Bio- Future programme of
Load more

Recommended publications
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Material
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Page 1 / 45 SUPPLEMENTARY MATERIAL Appendix A1: Neuropsychological protocol. Appendix A2: Description of the four cases at the transitional stage. Table A1: Clinical status and center proportion in each batch. Table A2: Complete output from EdgeR. Table A3: List of the putative target genes. Table A4: Complete output from DIANA-miRPath v.3. Table A5: Comparison of studies investigating miRNAs from brain samples. Figure A1: Stratified nested cross-validation. Figure A2: Expression heatmap of miRNA signature. Figure A3: Bootstrapped ROC AUC scores. Figure A4: ROC AUC scores with 100 different fold splits. Figure A5: Presymptomatic subjects probability scores. Figure A6: Heatmap of the level of enrichment in KEGG pathways. Kmetzsch V, et al. J Neurol Neurosurg Psychiatry 2021; 92:485–493. doi: 10.1136/jnnp-2020-324647 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Appendix A1. Neuropsychological protocol The PREV-DEMALS cognitive evaluation included standardized neuropsychological tests to investigate all cognitive domains, and in particular frontal lobe functions. The scores were provided previously (Bertrand et al., 2018). Briefly, global cognitive efficiency was evaluated by means of Mini-Mental State Examination (MMSE) and Mattis Dementia Rating Scale (MDRS). Frontal executive functions were assessed with Frontal Assessment Battery (FAB), forward and backward digit spans, Trail Making Test part A and B (TMT-A and TMT-B), Wisconsin Card Sorting Test (WCST), and Symbol-Digit Modalities test.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Newfound Coding Potential of Transcripts Unveils Missing Members Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.406710; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Newfound coding potential of transcripts unveils missing members of 2 human protein communities 3 4 Sebastien Leblanc1,2, Marie A Brunet1,2, Jean-François Jacques1,2, Amina M Lekehal1,2, Andréa 5 Duclos1, Alexia Tremblay1, Alexis Bruggeman-Gascon1, Sondos Samandi1,2, Mylène Brunelle1,2, 6 Alan A Cohen3, Michelle S Scott1, Xavier Roucou1,2,* 7 1Department of Biochemistry and Functional Genomics, Université de Sherbrooke, Sherbrooke, 8 Quebec, Canada. 9 2 PROTEO, Quebec Network for Research on Protein Function, Structure, and Engineering. 10 3Department of Family Medicine, Université de Sherbrooke, Sherbrooke, Quebec, Canada. 11 12 *Corresponding author: Tel. (819) 821-8000x72240; E-Mail: [email protected] 13 14 15 Running title: Alternative proteins in communities 16 17 Keywords: alternative proteins, protein network, protein-protein interactions, pseudogenes, 18 affinity purification-mass spectrometry 19 20 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.406710; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 21 Abstract 22 23 Recent proteogenomic approaches have led to the discovery that regions of the transcriptome 24 previously annotated as non-coding regions (i.e.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Transdifferentiation of Human Mesenchymal Stem Cells
    Transdifferentiation of Human Mesenchymal Stem Cells Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Tatjana Schilling aus San Miguel de Tucuman, Argentinien Würzburg, 2007 Eingereicht am: Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Martin J. Müller Gutachter: PD Dr. Norbert Schütze Gutachter: Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am: Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbstständig angefertigt und keine anderen als die von mir angegebenen Hilfsmittel und Quellen verwendet habe. Des Weiteren erkläre ich, dass diese Arbeit weder in gleicher noch in ähnlicher Form in einem Prüfungsverfahren vorgelegen hat und ich noch keinen Promotionsversuch unternommen habe. Gerbrunn, 4. Mai 2007 Tatjana Schilling Table of contents i Table of contents 1 Summary ........................................................................................................................ 1 1.1 Summary.................................................................................................................... 1 1.2 Zusammenfassung..................................................................................................... 2 2 Introduction.................................................................................................................... 4 2.1 Osteoporosis and the fatty degeneration of the bone marrow..................................... 4 2.2 Adipose and bone
    [Show full text]
  • 1 SUPPLEMENTAL DATA Figure S1. Poly I:C Induces IFN-Β Expression
    SUPPLEMENTAL DATA Figure S1. Poly I:C induces IFN-β expression and signaling. Fibroblasts were incubated in media with or without Poly I:C for 24 h. RNA was isolated and processed for microarray analysis. Genes showing >2-fold up- or down-regulation compared to control fibroblasts were analyzed using Ingenuity Pathway Analysis Software (Red color, up-regulation; Green color, down-regulation). The transcripts with known gene identifiers (HUGO gene symbols) were entered into the Ingenuity Pathways Knowledge Base IPA 4.0. Each gene identifier mapped in the Ingenuity Pathways Knowledge Base was termed as a focus gene, which was overlaid into a global molecular network established from the information in the Ingenuity Pathways Knowledge Base. Each network contained a maximum of 35 focus genes. 1 Figure S2. The overlap of genes regulated by Poly I:C and by IFN. Bioinformatics analysis was conducted to generate a list of 2003 genes showing >2 fold up or down- regulation in fibroblasts treated with Poly I:C for 24 h. The overlap of this gene set with the 117 skin gene IFN Core Signature comprised of datasets of skin cells stimulated by IFN (Wong et al, 2012) was generated using Microsoft Excel. 2 Symbol Description polyIC 24h IFN 24h CXCL10 chemokine (C-X-C motif) ligand 10 129 7.14 CCL5 chemokine (C-C motif) ligand 5 118 1.12 CCL5 chemokine (C-C motif) ligand 5 115 1.01 OASL 2'-5'-oligoadenylate synthetase-like 83.3 9.52 CCL8 chemokine (C-C motif) ligand 8 78.5 3.25 IDO1 indoleamine 2,3-dioxygenase 1 76.3 3.5 IFI27 interferon, alpha-inducible
    [Show full text]
  • C6cc08797c1.Pdf
    Electronic Supplementary Material (ESI) for Chemical Communications. This journal is © The Royal Society of Chemistry 2017 Supplementary Information for Competition-based, quantitative chemical proteomics in breast cancer cells identifies new target profiles for sulforaphane James A. Clulow,a,‡ Elisabeth M. Storck,a,‡ Thomas Lanyon-Hogg,a,‡ Karunakaran A. Kalesh,a Lyn Jonesb and Edward W. Tatea,* a Department of Chemistry, Imperial College London, London, UK, SW7 2AZ b Worldwide Medicinal Chemistry, Pfizer, 200 Cambridge Park Drive, MA 02140, USA ‡ Authors share equal contribution * corresponding author, email: [email protected] Table of Contents 1 Supporting Figures..........................................................................................................................3 2 Supporting Tables.........................................................................................................................17 2.1 Supporting Table S1. Incorporation validation for the R10K8 label in the 'spike-in' SILAC proteome of the MCF7 cell line........................................................................................................17 2.2 Supporting Table S2. Incorporation validation for the R10K8 label in the 'spike-in' SILAC proteome of the MDA-MB-231 cell line ...........................................................................................17 2.3 Supporting Table S3. High- and medium- confidence targets of sulforaphane in the MCF7 cell line..............................................................................................................................................17
    [Show full text]
  • Targeted Degradation of the Myc Oncogene Using Pp2a
    TARGETED DEGRADATION OF THE MYC ONCOGENE USING PP2A- B56ALPHA SELECTIVE SMALL MOLECULE MODULATORS OF PROTEIN PHOSPHATASE 2A AS A THERAPEUTIC STRATEGY FOR TREATING MYC- DRIVEN CANCERS BY CAROLINE C. FARRINGTON Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Thesis Advisor: Dr. Goutham Narla, M.D., Ph.D. Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY May 2020 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Caroline Farrington candidate for the degree of Pharmacology * Committee Chair Dr. Ruth Keri, Ph.D Committee Member and Thesis Advisor Dr. Goutham Narla, M.D., Ph.D Committee Member Dr. Amar Desai Ph.D Committee Member Dr. Marvin Nieman Committee Member Dr. David Wald M.D., Ph.D Date of Defense January 17, 2020 *We also certify that written approval has been obtained for any proprietary material contained therein. Dedication “To laugh often and much; to win the respect of intelligent people and the affection of children; to earn the appreciation of honest critics and endure the betrayal of false friends; to appreciate beauty; to find the beauty in others; to leave the world a bit better whether by a healthy child, a garden patch, or a redeemed social condition; to know that one life has breathed easier because you lived here. This is to have succeeded.” - Ralph Waldo Emerson This work is primarily dedicated to my mother who raised me with the somewhat disillusioned mother’s belief that I have more talent in my pinky than others have in their whole body and, more importantly, that I have a lot to give back to others and share with the world.
    [Show full text]