DOCSLIB.ORG

Effect of Beta-Agonists on LAM Progression and Treatment

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effect of Beta-Agonists on LAM Progression and Treatment Effect of beta-agonists on LAM progression and treatment Kang Lea,1,2, Wendy K. Steagalla,1,3, Mario Stylianoub, Gustavo Pacheco-Rodrigueza, Thomas N. Darlingc, Martha Vaughana,3, and Joel Mossa,3 aPulmonary Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; bOffice of Biostatistics Research, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; and cDepartment of Dermatology, Uniformed Services University of the Health Sciences, Bethesda, MD 20814 Contributed by Martha Vaughan, December 6, 2017 (sent for review April 6, 2017; reviewed by Kevin Brown and Geraldine Finlay) Lymphangioleiomyomatosis (LAM), a rare disease of women, is (11). Although LAM lesions were originally considered to rep- associated with cystic lung destruction resulting from the pro- resent a benign neoplasm, LAM is now accepted as a cancer with liferation of abnormal smooth muscle-like LAM cells with muta- metastatic dissemination of cancer-like LAM cells (12). tions in the tuberous sclerosis complex (TSC) genes TSC1 and/or LAM cells are characterized by mutations in the tuberous TSC2. The mutant genes and encoded proteins are responsible for sclerosis complex (TSC) TSC1 or TSC2 gene that encodes, re- activation of the mechanistic target of rapamycin (mTOR), which is spectively, hamartin and tuberin (13–15). TSC is a rare genetic inhibited by sirolimus (rapamycin), a drug used to treat LAM. Patients disease that affects multiple organ systems and results from who have LAM may also be treated with bronchodilators for asthma- mutations in one of the same two TSC genes (16). Hamartin and like symptoms due to LAM. We observed stabilization of forced tuberin form a cytosolic complex with Tre2-Bub2-Cdc16 domain expiratory volume in 1 s over time in patients receiving sirolimus and family member 7 (TBC1D7) (17). This complex inhibits the long-acting beta-agonists with short-acting rescue inhalers compared mechanistic target of rapamycin (mTOR) pathway, a promoter with patients receiving only sirolimus. Because beta-agonists increase of cell growth through the GTPase-activating protein (GAP) cAMP and PKA activity, we investigated effects of PKA activation on activity of tuberin toward Ras homolog enriched in brain (Rheb) + − the mTOR pathway. Human skin TSC2 / fibroblasts or LAM lung cells (17). Rheb in its GTP-bound form is a critical activator of incubated short-term with isoproterenol (beta-agonist) showed a mTOR; tuberin converts active Rheb-GTP to inactive Rheb- sirolimus-independent increase in phosphorylation of S6, a down- GDP (18). stream effector of the mTOR pathway, and increased cell growth. Cells mTOR, a serine/threonine kinase, is found in mTORC1 and incubated long-term with isoproterenol, which may lead to beta- mTORC2 complexes (19). mTORC1 comprises regulatory- adrenergic receptor desensitization, did not show increased S6 phos- associated protein of mTOR (Raptor), mammalian lethal with phorylation. Inhibition of PKA blocked the isoproterenol effect on Sec13 protein 8 (mLST8; also known as GβL), proline-rich AKT S6 phosphorylation. Thus, activation of PKA by beta-agonists increased substrate of 40 kDa (PRAS40), and DEP domain-containing phospho-S6 independent of mTOR, an effect abrogated by beta- mTOR-interacting protein (Deptor) (20). mTORC2 is also a agonist–driven receptor desensitization. In agreement, retrospective clinical data from patients with LAM suggested that a combination Significance of bronchodilators in conjunction with sirolimus may be preferable to sirolimus alone for stabilization of pulmonary function. Lymphangioleiomyomatosis (LAM) is a destructive lung disease driven by neoplastic LAM cells with a mutated tumor sup- cyclic AMP | sirolimus | lymphangioleiomyomatosis | pressor gene TSC1 or TSC2, leading to increased activity of the tuberous sclerosis complex | bronchodilators mechanistic target of rapamycin (mTOR), which is inhibited by sirolimus (rapamycin). Beta-agonists may treat asthma-like ymphangioleiomyomatosis (LAM), a rare multisystem dis- symptoms due to LAM. We observed stabilization of forced ex- Lease affecting primarily women, is characterized by cystic lung piratory volume in 1 s in patients receiving sirolimus and long- destruction, which can lead to respiratory failure, abdominal acting beta-agonists with short-acting rescue inhalers compared tumors [e.g., renal angiomyolipomas (AMLs)], and lymphatic with patients receiving only sirolimus. Human TSC2+/− skin fi- – involvement (e.g., lymphangioleiomyomas, adenopathy) (1 4). broblasts and LAM cells from explanted lungs treated with Depending on organ involvement, patients may exhibit pro- sirolimus and the short-term, but not long-term, beta-agonist gressive dyspnea on exertion, pneumothoraces, chylous pleural isoproterenol showed increased phospho-S6 levels and cell effusions, ascites, and abdominal hemorrhage (5). LAM is often growth due to activation of a cAMP/PKA-dependent pathway. mistakenly diagnosed as another respiratory disease, such as Long-acting beta-agonists affect phospho-S6 content, leading to asthma, emphysema, chronic bronchitis, or chronic obstructive stabilization of lung function in LAM patients. pulmonary disease (6–8). Many patients are treated with bron- chodilators to alleviate asthma-like symptoms due to LAM dis- Author contributions: K.L., W.K.S., G.P.-R., M.V., and J.M. designed research; K.L., W.K.S., ease. In fact, in a study of 235 patients who had LAM, about 49% and G.P.-R. performed research; T.N.D. contributed new reagents/analytic tools; K.L., W.K.S., and M.S. analyzed data; and K.L., W.K.S., G.P.-R., T.N.D., M.V., and J.M. wrote used bronchodilators regularly (9). the paper. LAM is characterized by proliferation of abnormal smooth Reviewers: K.B., National Jewish Health; and G.F., UpToDate/Wolters Kluwer. muscle-like LAM cells in the lung, resulting in parenchymal The authors declare no conflict of interest. cystic destruction. LAM cells are believed to proliferate in axial Published under the PNAS license. lymphatics and lung interstitium, leading to airway and lymphatic 1K.L. and W.K.S. contributed equally to this work. obstruction (2, 10). While LAM cells may be largely parenchy- 2Present address: Department of Biochemistry and Molecular Medicine, School of Medi- mal, Hayashi et al. (11) showed bronchial involvement by LAM cine and Health Sciences, The George Washington University, Washington, DC 20037. cells in explanted lungs of all 30 patients examined. A significant 3To whom correspondence may be addressed. Email: [email protected], vaughanm@ portion of these patients also had markers of chronic in- nih.gov, or [email protected]. flammation (e.g., mononuclear cell infiltration, goblet cell hy- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. perplasia, squamous cell metaplasia, thickening of basal lamina) 1073/pnas.1719960115/-/DCSupplemental. E944–E953 | PNAS | Published online January 16, 2018 www.pnas.org/cgi/doi/10.1073/pnas.1719960115 Downloaded by guest on October 1, 2021 multimer, sharing proteins, such as mLST8 and Deptor, with P = 0.0417; adjusted for initial DLCO, sirolimus treatment, and PNAS PLUS mTORC1, whereas the defining component of mTORC2 is time of visit). A statistical interaction was seen between use of Raptor-independent companion of mTOR (Rictor) (21, 22). The bronchodilators and sirolimus treatment, such that the effect of mTORC1 substrates [e.g., P70 S6 kinase (P70), 4E-binding bronchodilator use on pulmonary function was different in pa- protein 1 (4EBP1), unc-51–like autophagy-activating kinase 1 tients not receiving sirolimus compared with those being treated (ULK1)] regulate cell size, proliferation, and autophagy in a with the drug. In patients not receiving sirolimus, those tak- phosphorylation-dependent fashion (23). Activation of S6 ki- ing bronchodilators tended to have lower percent predicted nases by mTOR promotes phosphorylation of several substrates, FEV1 compared with those not using bronchodilators, whereas including ribosomal protein S6, eukaryotic initiation factor 4B subjects on sirolimus had the opposite pattern (P < 0.001). (eIF4B), programmed cell death 4 (PDCD4), eukaryotic elon- Subjects not on sirolimus and on bronchodilators had lower gation factor 2 kinase (eEF-2K), and S6K1 Aly/REF-like target percent predicted DLCO compared with those not using bron- (SKAR) (23). Phosphorylation of S6, a component of the 40S chodilators, whereas subjects on sirolimus had similar DLCO ribosomal subunit, is associated with increased protein synthesis regardless of bronchodilator use (P = 0.002). Overall, the rate of and cell proliferation (24). mTORC2 regulates metabolism and change of FEV1 was −1.187 ± 0.077 (mean ± SE) percent cytoskeletal organization by phosphorylating AGC kinases, such predicted FEV1 per year in those without bronchodilator use as Akt and PKC (22, 25, 26). and −1.358 ± 0.104 with bronchodilator use, and the rate of The absence of functional tuberin leads to persistence of Rheb change of DLCO was −1.618 ± 0.065 percent predicted DLCO in its GTP-bound state with mTORC1 activation, as was observed per year without bronchodilator use and −1.563 ± 0.093 with in LAM lung lesions and AMLs. Sirolimus (rapamycin), bound bronchodilator use. These values are not significantly different. to FK506-binding protein 12 (FKBP12), interacts directly with Since the interaction of sirolimus treatment and bronchodila- mTORC1, inhibiting its
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer
    diagnostics Review Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer Shunsuke Kato Department of Clinical Oncology, Juntendo University Graduate School of Medicine, 2-1-1, Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; [email protected]; Tel.: +81-3-5802-1543 Abstract: The prognosis of patients with solid tumours has remarkably improved with the develop- ment of molecular-targeted drugs and immune checkpoint inhibitors. However, the improvements in the prognosis of pancreatic cancer and biliary tract cancer is delayed compared to other carcinomas, and the 5-year survival rates of distal-stage disease are approximately 10 and 20%, respectively. How- ever, a comprehensive analysis of tumour cells using The Cancer Genome Atlas (TCGA) project has led to the identification of various driver mutations. Evidently, few mutations exist across organs, and basket trials targeting driver mutations regardless of the primary organ are being actively conducted. Such basket trials not only focus on the gate keeper-type oncogene mutations, such as HER2 and BRAF, but also focus on the caretaker-type tumour suppressor genes, such as BRCA1/2, mismatch repair-related genes, which cause hereditary cancer syndrome. As oncogene panel testing is a vital approach in routine practice, clinicians should devise a strategy for improved understanding of the cancer genome. Here, the gene mutation profiles of pancreatic cancer and biliary tract cancer have been outlined and the current status of tumour-agnostic therapy in these cancers has been reported. Keywords: pancreatic cancer; biliary tract cancer; targeted therapy; solid tumours; driver mutations; agonist therapy Citation: Kato, S. Tumour-Agnostic Therapy for Pancreatic Cancer and 1.
    [Show full text]
  • DNAJB1–PRKACA Fusion Kinase Interacts with Β-Catenin and the Liver
    DNAJB1–PRKACA fusion kinase interacts with INAUGURAL ARTICLE β-catenin and the liver regenerative response to drive fibrolamellar hepatocellular carcinoma Edward R. Kastenhubera,b, Gadi Lalazarc, Shauna L. Houlihana, Darjus F. Tschaharganehd,e, Timour Baslana, Chi-Chao Chena, David Requenac, Sha Tiana, Benedikt Bosbachf, John E. Wilkinsong, Sanford M. Simonc, and Scott W. Lowea,h,1 aDepartment of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, NY 10065; bLouis V. Gerstner Jr. Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center, New York, NY 10065; cLaboratory of Cellular Biophysics, The Rockefeller University, New York, NY 10065; dHelmholtz University Group “Cell Plasticity and Epigenetic Remodeling,” German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; eInstitute of Pathology, University Hospital, 69120 Heidelberg, Germany; fOncology Target Discovery Program, Pfizer Inc., Pearl River, NY 10965; gDepartment of Pathology, University of Michigan School of Medicine, Ann Arbor, MI 48109; and hHoward Hughes Medical Institute, New York, NY 10065 This contribution is part of the special series of Inaugural Articles by members of the National Academy of Sciences elected in 2017. Contributed by Scott W. Lowe, October 26, 2017 (sent for review September 22, 2017; reviewed by Nabeel M. Bardeesy and David A. Largaespada) A segmental deletion resulting in DNAJB1–PRKACA gene fusion is any known etiological risk factors such as alcoholism, chronic hep- now recognized as the signature genetic event of fibrolamellar hepa- atitis infection, or liver flukes (8). tocellular carcinoma (FL-HCC), a rare but lethal liver cancer that pri- Currently, FL-HCC is diagnosed on the basis of histological marily affects adolescents and young adults.
    [Show full text]
  • PRKACA Mediates Resistance to HER2-Targeted Therapy in Breast Cancer Cells and Restores Anti-Apoptotic Signaling
    Oncogene (2015) 34, 2061–2071 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc ORIGINAL ARTICLE PRKACA mediates resistance to HER2-targeted therapy in breast cancer cells and restores anti-apoptotic signaling SE Moody1,2,3, AC Schinzel1, S Singh1, F Izzo1, MR Strickland1, L Luo1,2, SR Thomas3, JS Boehm3, SY Kim4, ZC Wang5,6 and WC Hahn1,2,3 Targeting HER2 with antibodies or small molecule inhibitors in HER2-positive breast cancer leads to improved survival, but resistance is a common clinical problem. To uncover novel mechanisms of resistance to anti-HER2 therapy in breast cancer, we performed a kinase open reading frame screen to identify genes that rescue HER2-amplified breast cancer cells from HER2 inhibition or suppression. In addition to multiple members of the MAPK (mitogen-activated protein kinase) and PI3K (phosphoinositide 3-kinase) signaling pathways, we discovered that expression of the survival kinases PRKACA and PIM1 rescued cells from anti-HER2 therapy. Furthermore, we observed elevated PRKACA expression in trastuzumab-resistant breast cancer samples, indicating that this pathway is activated in breast cancers that are clinically resistant to trastuzumab-containing therapy. We found that neither PRKACA nor PIM1 restored MAPK or PI3K activation after lapatinib or trastuzumab treatment, but rather inactivated the pro-apoptotic protein BAD, the BCl-2-associated death promoter, thereby permitting survival signaling through BCL- XL. Pharmacological blockade of BCL-XL/BCL-2 partially abrogated the rescue effects conferred by PRKACA and PIM1, and sensitized cells to lapatinib treatment. These observations suggest that combined targeting of HER2 and the BCL-XL/BCL-2 anti-apoptotic pathway may increase responses to anti-HER2 therapy in breast cancer and decrease the emergence of resistant disease.
    [Show full text]
  • Personalized Prediction of Acquired Resistance to EGFR-Targeted Inhibitors Using a Pathway-Based Machine Learning Approach
    Cancers 2019, 11, x S1 of S9 Supplementary Materials: Personalized Prediction of Acquired Resistance to EGFR-Targeted Inhibitors Using a Pathway-Based Machine Learning Approach Young Rae Kim, Yong Wan Kim, Suh Eun Lee, Hye Won Yang and Sung Young Kim Table S1. Characteristics of individual studies. Sample Size Origin of Cancer Drug Dataset Platform S AR (Cell Lines) Lung cancer Agilent-014850 Whole Human GSE34228 26 26 (PC9) Genome Microarray 4x44K Gefitinib Epidermoid carcinoma Affymetrix Human Genome U133 GSE10696 3 3 (A431) Plus 2.0 Head and neck cancer Illumina HumanHT-12 V4.0 GSE62061 12 12 (Cal-27, SSC-25, FaDu, expression beadchip SQ20B) Erlotinib Head and neck cancer Illumina HumanHT-12 V4.0 GSE49135 3 3 (HN5) expression beadchip Lung cancer (HCC827, Illumina HumanHT-12 V3.0 GSE38310 3 6 ER3, T15-2) expression beadchip Lung cancer Illumina HumanHT-12 V3.0 GSE62504 1 2 (HCC827) expression beadchip Afatinib Lung cancer * Illumina HumanHT-12 V4.0 GSE75468 1 3 (HCC827) expression beadchip Head and neck cancer Affymetrix Human Genome U133 Cetuximab GSE21483 3 3 (SCC1) Plus 2.0 Array GEO, gene expression omnibus; GSE, gene expression series; S, sensitive; AR, acquired EGFR-TKI resistant; * Lung Cancer Cells Derived from Tumor Xenograft Model. Table S2. The performances of four penalized regression models. Model ACC precision recall F1 MCC AUROC BRIER Ridge 0.889 0.852 0.958 0.902 0.782 0.964 0.129 Lasso 0.944 0.957 0.938 0.947 0.889 0.991 0.042 Elastic Net 0.978 0.979 0.979 0.979 0.955 0.999 0.023 EPSGO Elastic Net 0.989 1.000 0.979 0.989 0.978 1.000 0.018 AUROC, area under curve of receiver operating characteristic; ACC, accuracy; MCC, Matthews correlation coefficient; EPSGO, Efficient Parameter Selection via Global Optimization algorithm.
    [Show full text]
  • Supplementary Data Vigneswaran Et Al Supplementary Data
    Vigneswaran et al Supplementary Data Vigneswaran et al Supplementary Data Figure S1: Yki is required for EGFR-PI3K-driven glial neoplasia in Drosophila (A) Optical projections of whole brain-nerve cord complexes from 3rd instar larvae approximately 130 hrs old. Dorsal view; anterior up. CD8-GFP (green) labels glial cell bodies. Compared to repo>dEGFRλ;dp110CAAX, warts knockdown (repo>wartsdsRNA; dEGFRλ;dp110CAAX) increased neoplastic brain overgrowth and yki knockdown (repo>ykidsRNA;dEGFRλ;dp110CAAX) decreased neoplastic brain overgrowth. (B) 3 µm optical projections of brain hemispheres, age-matched 3rd instar larvae. Frontal sections; anterior up; midline to left. Repo (red) labels glial cell nuclei; CD8-GFP (green) labels glial cell bodies; anti-HRP (blue) counter-stains for neurons and neuropil. (middle) repo>dEGFRλ;dp110CAAX showed increased glial cell numbers (red nuclei) compared to (upper left) wild-type. Compared to repo>dEGFRλ;dp110CAAX, (right) warts knockdown increased neoplastic glial cell numbers (red nuclei), whereas (lower left) yki knockdown reduced neoplastic glial cell numbers (red nuclei). (C, D) Low levels of Yki protein (red) was observed in wild-type central brain glia (white arrows, left panel in C) compared to high levels of cytoplasmic and nuclear Yki protein in dEGFRλ;dp110CAAX neoplastic glia (white arrows, left panel in D); Repo (blue) labels glial cell nuclei; CD8-GFP (green) labels glial cell bodies. Vigneswaran et al Supplementary Data Figure S2: YAP/TAZ expression confined to RTK-amplified tuMor cells and Maintained in patient-derived xenografts (A) On the left, immunohistochemical (IHC) staining in representative normal brain parenchyma in the cortex where YAP expression and TAZ expression was limited to vascular cells and was not detectable in normal neuronal and glial cells.
    [Show full text]
  • Dependent Protein Kinase (PRKACA) Gene in Japanese Patients with Several Adrenal Adenomas Secreting Cortisol
    Endocrine Journal 2014, 61 (8), 825-832 RAPID COMMUNICATION Somatic mutations of the catalytic subunit of cyclic AMP- dependent protein kinase (PRKACA) gene in Japanese patients with several adrenal adenomas secreting cortisol Yasuyo Nakajima1)*, Takashi Okamura1)*, Tamae Gohko1), Tetsurou Satoh1), Koshi Hashimoto1), Nobuyuki Shibusawa1), Atsushi Ozawa1), Sumiyasu Ishii1), Takuya Tomaru1), Kazuhiko Horiguchi1), Shuichi Okada1), Daisuke Takata2), Nana Rokutanda2), Jun Horiguchi2), Yoshito Tsushima3), Tetsunari Oyama4), Izumi Takeyoshi2) and Masanobu Yamada1) 1) Department of Medicine and Molecular Science, Gunma University Graduate School of Medicine, Maebashi 371-8511, Japan 2) Department of Thoracic and Visceral Organ Surgery, Gunma University Graduate School of Medicine, Maebashi 371-8511, Japan 3) Department of Diagnostic Radiology and Nuclear Medicine, Gunma University Graduate School of Medicine, Maebashi 371- 8511, Japan 4) Department of Diagnostic Pathology, Gunma University Graduate School of Medicine, Maebashi 371-8511, Japan Abstract. Somatic mutations of the catalytic subunit of the cyclic AMP-dependent protein kinase (PRKACA) gene have recently been identified in about 35% of cortisol-producing adenomas (CPAs), with the affected patients showing overt Cushing’s syndrome. Since we recently reported higher prevalence of mutations of the KCNJ5 gene and associations with autonomous cortisol secretion in Japanese aldosterone-producing adenomas than in Western countries, there might be different features of CPAs between Japan and the West. We therefore investigated mutations of the PRKACA gene in Japanese patients with several adrenal tumors secreting cortisol, including overt Cushing’s syndrome, subclinical Cushing’s syndrome, and aldosterone-producing adenomas (APAs) co-secreting cortisol operated on at Gunma University Hospital. Of the 13 patients with CPA who showed overt Cushing’s syndrome, 3 (23%) had recurrent somatic mutations of the PRKACA gene, p.L206R (c.617 T>G), and there were no mutations in subclinical Cushing’s syndrome.
    [Show full text]
  • Sperm and Seminal Plasma Proteomics: Molecular Changes Associated with Varicocele-Mediated Male Infertility
    Review Article Male reproductive health and infertility pISSN: 2287-4208 / eISSN: 2287-4690 World J Mens Health Published online Jul 26, 2019 https://doi.org/10.5534/wjmh.190018 Sperm and Seminal Plasma Proteomics: Molecular Changes Associated with Varicocele-Mediated Male Infertility Manesh Kumar Panner Selvam , Ashok Agarwal American Center for Reproductive Medicine, Cleveland Clinic, Cleveland, OH, USA Male infertility is a rising problem and the etiology at the molecular level is unclear. Use of omics has provided an insight into the underlying cellular changes in the spermatozoa of infertile men. Proteomics is one the promising omics techniques for biomarker screening that can provide complete information on molecular processes associated with male infertility. Vari- cocele is a pressing issue in the field of male infertility and the search for an appropriate diagnostic and therapeutic biomark- er is still ongoing. In this review, we discuss the reports on proteomic profiles of sperm and seminal plasma in male infertility and provide an in-depth insight into varicocele studies associated with male infertility. Keywords: Proteomics; Seminal plasma; Sperm; Varicocele This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. INTRODUCTION metabolites and endocrine factors are associated with varicocele pathophysiology (Fig. 1). The mechanisms Currently, infertility is one of the top most concerns associated with the pathophysiology of varicocele have related to male reproductive dysfunction and male been reviewed in detail by Agarwal et al [7] and Cho et infertility contributes to nearly 50% of overall infertil- al [6].
    [Show full text]
  • Resveratrol Inhibits Cell Cycle Progression by Targeting Aurora Kinase a and Polo-Like Kinase 1 in Breast Cancer Cells
    3696 ONCOLOGY REPORTS 35: 3696-3704, 2016 Resveratrol inhibits cell cycle progression by targeting Aurora kinase A and Polo-like kinase 1 in breast cancer cells RUBICELI MEDINA-AGUILAR1, LAURENCE A. Marchat2, ELENA ARECHAGA OCAMPO3, Patricio GARIGLIO1, JAIME GARCÍA MENA1, NICOLÁS VILLEGAS SEPÚlveda4, MACARIO MartÍNEZ CASTILLO4 and CÉSAR LÓPEZ-CAMARILLO5 1Department of Genetics and Molecular Biology, CINVESTAV-IPN, Mexico D.F.; 2Molecular Biomedicine Program and Biotechnology Network, National School of Medicine and Homeopathy, National Polytechnic Institute, Mexico D.F.; 3Natural Sciences Department, Metropolitan Autonomous University, Mexico D.F.; 4Department of Molecular Biomedicine, CINVESTAV-IPN, Mexico D.F.; 5Oncogenomics and Cancer Proteomics Laboratory, Universidad Autónoma de la Ciudad de México, Mexico D.F., Mexico Received December 4, 2015; Accepted January 8, 2016 DOI: 10.3892/or.2016.4728 Abstract. The Aurora protein kinase (AURKA) and the MDA-MB-231 and MCF-7 cells. By western blot assays, we Polo-like kinase-1 (PLK1) activate the cell cycle, and they confirmed that resveratrol suppressed AURKA, CCND1 and are considered promising druggable targets in cancer CCNB1 at 24 and 48 h. In summary, we showed for the first time therapy. However, resistance to chemotherapy and to specific that resveratrol regulates cell cycle progression by targeting small-molecule inhibitors is common in cancer patients; thus AURKA and PLK1. Our findings highlight the potential use of alternative therapeutic approaches are needed to overcome resveratrol as an adjuvant therapy for breast cancer. clinical resistance. Here, we showed that the dietary compound resveratrol suppressed the cell cycle by targeting AURKA Introduction and PLK1 kinases. First, we identified genes modulated by resveratrol using a genome-wide analysis of gene expression Cancer development results from the interaction between in MDA-MB-231 breast cancer cells.
    [Show full text]
  • GPCR Signaling Inhibits Mtorc1 Via PKA Phosphorylation of Raptor
    RESEARCH ARTICLE GPCR signaling inhibits mTORC1 via PKA phosphorylation of Raptor Jenna L Jewell1,2,3*, Vivian Fu4,5, Audrey W Hong4,5, Fa-Xing Yu6, Delong Meng1,2,3, Chase H Melick1,2,3, Huanyu Wang1,2,3, Wai-Ling Macrina Lam4,5, Hai-Xin Yuan4,5, Susan S Taylor4,7, Kun-Liang Guan4,5* 1Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, United States; 2Harold C Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, United States; 3Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, United States; 4Department of Pharmacology, University of California, San Diego, La Jolla, United States; 5Moores Cancer Center, University of California San Diego, La Jolla, United States; 6Children’s Hospital and Institutes of Biomedical Sciences, Fudan University, Shanghai, China; 7Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, United States Abstract The mammalian target of rapamycin complex 1 (mTORC1) regulates cell growth, metabolism, and autophagy. Extensive research has focused on pathways that activate mTORC1 like growth factors and amino acids; however, much less is known about signaling cues that directly inhibit mTORC1 activity. Here, we report that G-protein coupled receptors (GPCRs) paired to Gas proteins increase cyclic adenosine 3’5’ monophosphate (cAMP) to activate protein kinase A (PKA) and inhibit mTORC1. Mechanistically, PKA phosphorylates the mTORC1 component Raptor on Ser 791, leading to decreased mTORC1 activity. Consistently, in cells where Raptor Ser 791 is mutated to Ala, mTORC1 activity is partially rescued even after PKA activation. Gas-coupled GPCRs *For correspondence: stimulation leads to inhibition of mTORC1 in multiple cell lines and mouse tissues.
    [Show full text]
  • Ser 15 of WEE1B Is a Potential PKA Phosphorylation Target in G2/M Transition in One-Cell Stage Mouse Embryos
    MOLECULAR MEDICINE REPORTS 7: 1929-1937, 2013 Ser 15 of WEE1B is a potential PKA phosphorylation target in G2/M transition in one-cell stage mouse embryos CHAO LIU1,2, YANCHUN LIU1, YANG LIU2, DIDI WU1, ZHIDONG LUAN2, ENHUA WANG3 and BINGZHI YU1,3 1Department of Biochemistry and Molecular Biology, China Medical University, Shenyang; 2Department of Developmental Biology, Liaoning Medical University, Jinzhou; 3Institute of Pathology and Pathopysiology, China Medical University, Shenyang, Liaoning, P.R. China Received December 17, 2012; Accepted March 28, 2013 DOI: 10.3892/mmr.2013.1437 Abstract. The WEE1 kinase family has been shown to be the Introduction major kinase family responsible for phosphorylating Tyr 15 on cyclin-dependent kinase 1 (CDK1). WEE1 homolog 2 (WEE2, M phase-promoting factor (MPF) is a universal regulator of M also known as WEE1B) was first identified in Xenopus laevis phase in the eukaryotic cell cycle (1,2). Its activation induces and more recently in humans and mice, and is responsible for entry into M phase and its subsequent inactivation is necessary phosphorylating the CDK1 inhibitory site and maintaining to exit from M phase. The activity of MPF in higher eukary- meiotic arrest in oocytes. However, the mechanism by which otic cells is primarily regulated by the formation of a complex WEE1B is regulated in one-cell stage mouse embryos remains between the catalytic cyclin-dependent kinase 1 (CDK1, to be elucidated. In the present study, we examined the role previously known as CDC2) subunit and the regulatory of WEE1B-Ser 15 in G2/M transition of one-cell stage mouse CCNB1 (previously known as cyclin B) subunit, and further embryos.
    [Show full text]