DOCSLIB.ORG

Supplementary Figure S1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Figure S1 Supplementary Figure S1 A 100 80 (%) 60 40 Proportion 20 0 Seed HypocotylCotyledon Root Root Seedling Glyceollin I Glyceollin II Glyceollin III B 100 80 60 40 Proportion (%) 20 0 microspores WGE C 100 80 60 40 Proportion (%) 20 0 AgNO3 CuCl2 BTD AVG SA Chemical elicitor DGlyceollin100 I Glyceollin II Glyceollin III 80 60 40 Proportion (%) 20 0 WGE + AGNO3 Elicitor Supplementary Figure S1. Relative proportion of glyceollins from soybean organs treated with purified wall glucan elicitor (WGE) from P. sojae (A), from soybean seeds treated with biotic elicitors (B), chemical elicitors silver nitrate (AgNO3), copper chloride (CuCl2), benzothiadiazole (BTD), aminoethoxyvinyl glycine (AVG), and salicylic acid (SA) at 1 -1 mM (C), seeds with AgNO3 (5 mM) and WGE (20 mg mL ) (D). Dashed line demarcates 50%. Supplementary Figure S2 Supplementary Figure S2. (A) Glyceollin I accumulation dynamics -1 after eliciting imbibed seeds with 5 mg mL WGE or 2.5 mM AgNO3 for the indicated times. (B) Metabolite induction compared to the solvent control (H2O). Two-way ANOVA, Tukey post hoc test (P < 0.001). Supplementary Figure S3 A 2nd quartile 3rd quartile Mean 300 a ) 1 - abc 200 ab cd 100 d Glyceollin gt I (µg d 0 0 1 2.5 5 7.5 10 3rd quartile 2nd quartile Mean B AgNO3 (mM) a 600 ) 1 - 500 abc c d d 400 300 200 Glyceollin gt I (µg 100 e 0 0 5 10 20 40 60 WGE (mg mL-1) Supplementary Figure S3. (A) Glyceollin I concen- trations in imbibing soybean seeds elicited with different concentrations of AgNO3. (B) Elicitation with different concentrations of WGE. Two-way ANOVA, Tukey post hoc test, P < 0.001. Supplementary Figure S4 500000 AgNO3 450000 400000 350000 300000 malonyldaidzin malonylgenistin - 250000 - O O - - Glyceollin I 200000 6″ 6″ malonylononin glycinol Other isoflavonoids 150000 - O - daidzein daidzin 100000 6″ glyceollin II glyceollin genistein glyceollin I glyceollin coumestrol glyceollin III glyceollin prunetin 50000 naringenin 0 0 2 4 6 8 10 12 14 16 18 20 Proportion (µmol/µmol) 500000 WGE ) 450000 mAU 400000 350000 300000 malonyldaidzin malonylgenistin - 250000 - O O - - glyceollin I glyceollin malonylononin Glyceollin I 200000 - 6″ 6″ O - 150000 II glyceollin Other isoflavonoids 6″ glycinol glyceollin III glyceollin Absorbance 283 nm ( 100000 daidzin daidzein naringenin prunetin genistein 50000 coumestrol 0 0 2 4 6 8 10 12 14 16 18 20 500000 AgNO3 + WGE 450000 400000 350000 glycinol glyceollin I glyceollin 300000 malonyldaidzin malonylgenistin - 250000 - O glyceollin II glyceollin O - - 200000 III glyceollin 6″ 6″ malonylononin 1 2 - 150000 O - daidzin 100000 6″ daidzein genistein naringenin prunetin 50000 coumestrol 0 0 2 4 6 8 10 12 14 16 18 20 Time (min) Supplementary Figure S4. Composition of glyceollin I relative to all other isoflavonoids in the seed ethanolic extract demonstated by UPLC-PDA and by pie chart. The amounts of all UPLC-PDA peaks that were not annotated were compounds for which we did not have standards and were quantified based on daidzin equivalents. Supplementary Table S1. UPLC-PDA-MSn identifying features of isoflavonoids. − - + + Peak R t (min) λmax (nm) [M − H] MS/MS fragments (m /z) [M + H] MS/MS fragments (m /z) daidzina 4.39 250 415.10 253.05 [daidzein - H]- 417.12 255.06 [daidzein + H]+ glycinolb 5.47 283 271.06 217 255.07 227.59, 214.99 genistina 5.48 260 431.10 - 433.11 271.07 [genistein + H]+, 255.07 6’’-O-malonyldaidzinb 5.80 251 501.10 253.05 [daidzein - H]- 503.12 255.06 [daidzein + H]+ 6’’-O-malonylgenistinb 7.01 260 517.10 269.05 [genistein - H]- 519.11 271.06 [genistein + H]+ 6’’-O-malonylononinb 7.82 259 515.12 253.05 [daidzein - H]- 267.07 517.13 269.08 [formononetin + H]+ [formononetin - H]- daidzeina 8.04 248 253.05 132.02 255.06 222.06 naringenina 9.41 259 271.06 263.08 273.08 241.05 prunetina 9.90 258 283.06 269.05 [genistein - H]- 285.08 - genisteina 10.28 261 269.05 239.13 271.06 241.05 coumestrola 10.90 342 267.03 253.09 269.04 236.05 glyceollin IIIb 11.10 289 337.11 319.10 339.12 321.11 glyceollin IIb 11.30 283 337.11 319.10 339.12 321.11 glyceollin Ia 11.48 283 337.11 255.07, 319.10 339.12 321.11 aPeak identities were based on MS feature comparisons to authentic standards. bIdentities based on MS feature comparisons to Aisyah et al. 2013 and Simons et al. 2014. Supplementary Table S2. Primers. Gene Primer Sequence PEPC16 qPCf TGCAACTGATTCTTATGTTCCAA PEPC16 qPCr GGCATCTTAACCACCTCACG G4DT qG4f TGGCTTTCGGAGTTGGTATC G4DT qG4r GAACAGCATTTCCCATACCC IFS1 qIF1f CACTCAAACTCGGGATCACA IFS1 qIF1r GACGCAAGTGCAGAAACAAA IFS2 qIF2f GGAGAGGTTGTTGAGGGTGA IFS2 qIF2r GACCCTTGATGTGGTCCTTG I2′H qI2f CCATGCTTTTTGGTGGAACT I2′H qI2r GCCTTCTTCAACACCTCTGG.
Load more

Recommended publications
  • Phytoalexins: Current Progress and Future Prospects
    Phytoalexins: Current Progress and Future Prospects Edited by Philippe Jeandet Printed Edition of the Special Issue Published in Molecules www.mdpi.com/journal/molecules Philippe Jeandet (Ed.) Phytoalexins: Current Progress and Future Prospects This book is a reprint of the special issue that appeared in the online open access journal Molecules (ISSN 1420-3049) in 2014 (available at: http://www.mdpi.com/journal/molecules/special_issues/phytoalexins-progress). Guest Editor Philippe Jeandet Laboratory of Stress, Defenses and Plant Reproduction U.R.V.V.C., UPRES EA 4707, Faculty of Sciences, University of Reims, PO Box. 1039, 51687 Reims cedex 02, France Editorial Office MDPI AG Klybeckstrasse 64 Basel, Switzerland Publisher Shu-Kun Lin Managing Editor Ran Dang 1. Edition 2015 MDPI • Basel • Beijing ISBN 978-3-03842-059-0 © 2015 by the authors; licensee MDPI, Basel, Switzerland. All articles in this volume are Open Access distributed under the Creative Commons Attribution 3.0 license (http://creativecommons.org/licenses/by/3.0/), which allows users to download, copy and build upon published articles even for commercial purposes, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. However, the dissemination and distribution of copies of this book as a whole is restricted to MDPI, Basel, Switzerland. III Table of Contents About the Editor ............................................................................................................... VII List of
    [Show full text]
  • ABSTRACT Title of Document: BIOLOGICAL
    ABSTRACT Title of Document: BIOLOGICAL EFFICACY, MECHANISMS OF ACTIONS OF SOY-DERIVED PHYTOALEXIN GLYCEOLLINS IN PREVENTION OF CHRONIC DISEASES Haiqiu Huang, Doctor of Philosophy, 2014 Directed By: Professor Liangli (Lucy) Yu Department of Nutrition and Food Science Cardiovascular disease (CVD) is the leading cause of deaths worldwide. Prostate cancer is the most prevalent cancer in U.S. male population. Diet-induced hypercholesterolemia and chronic inflammation promote the development of both CVD and prostate cancer. Glyceollins are a group of soy phytoalexins possessing a variety of biological activities. This research project focused on characterizing glyceollins’ bioactivities in alleviating cholesterol dysregulation, prevention of prostate cancer, and regulating gut microbiome. The first part of the project aimed to evaluate glyceollins’ cholesterol- lowering effect in-vivo. Male golden Syrian hamsters were fed high-fat diet with or without glyceollins supplementation for 28 days. Glyceollins supplementation led to a significant reduction of plasma VLDL, hepatic cholesterol esters and total lipid content. Consistent with changes in circulating cholesterol, glyceollins supplementation also altered expression of the genes related to cholesterol metabolism in the liver. The second part of the study aimed to evaluate glyceollins’ effect in reducing prostate cancer tumor growth in a xenograft model. An initial delayed appearance of tumor was observed in a PC-3 xenograft model. However, no difference in tumor sizes was observed in a LNCaP xenograft model. Extrapolation analysis of tumor measurements indicated that no difference in sizes was expected for both PC-3 and LNCaP tumors. Glyceollins had no effect on the androgen responsive pathway, its proliferation, cell cycle, or on angiogenesis genes in tumor and xenobiotic metabolism, cholesterol transport, and inflammatory cytokine genes in liver.
    [Show full text]
  • Isoflavonoid Biosynthesis 21321.Pdf
    Isoflavonoid Biosynthesis https://www.kegg.jp/kegg-bin/highlight_pathway?scale=1.0&map=map00943&keyword=flavonoids Isoflavonoids are biologically active compounds, such as phytoestrogens, produced by pea family plants. While flavonoids (in the narrow sense) have the 2- phenylchromen-4-one backbone, isoflavonoids have the 3-phenylchromen-4-one backbone with no hydroxyl group substitution at position 2. Isoflavonoids are derived from the flavonoid biosynthesis pathway via liquiritigenin or naringenin. (Flavonoid Biosynthesis) -> [1,2] 1) Liquiritigenin -> [1,2,3] 1) flavone synthesis I & II -> 7,4’Dihydroxyflavone OR 2) flavonoid 6-hydroxylase -> 6,7,4’-Trihydroxyflavanone -> 2- hydroxyisoflavone synthase -> 2,6,7,4’-tetrahydroxyisoflavanone -> 6- Hydroxydaidzein -> Glycitein -> isoflavone 7-O-glucosyltransferase -> Glycitein 7-O-glucoside -> isoflavone 7-O-glucoside-6’’-O-malonyltransferase -> Glycitein 7-O-glucoside-6”-O-malonate OR 3) 2-hydroxyisoflavanone synthase -> 2,7,4’Trihydroxyisoflavanone -> [1,2] 1) Feedback Loop 2,7,4’-trihydroxyisoflavanone 4’-O-methyltransferase / isoflavone 4’-O-methyltransferase -> 2,7-Dihydroxy-4’-methoxyisoflavanone -> 2- hydroxyisoflavanone dehydratase -> Formononetin OR 2) 2-hydroxyisoflavone dehydratase -> Daidzein -> [1,2,3,4,5] 1) isoflavone/4’-methoxyisoflavone 2’-hydroxylase -> 2’Hydroxydaidzein -> 2’Hydroxydaidzein reductase -> 2’-Hydroxydihydrodaidzein -> 3,9-Dihydroxypterocarpan -> 3,9-dihydroxypterocarpan 6a-monooxygenase -> 3,6,9- Trihydroxypterocarpan -> [1,2] 1) trihydroxypterocarpan dimethylallyltransferase
    [Show full text]
  • Identification and Characterization of the Isoflavonoid-Specific Prenyltransferase Gene Family to Prevent Stem and Root Rot in Soybean
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 9-30-2016 12:00 AM Identification and Characterization of the Isoflavonoid-Specific Prenyltransferase Gene Family to Prevent Stem and Root Rot in Soybean Arjun Sukumaran The University of Western Ontario Supervisor Dr. Sangeeta Dhaubhadel The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Master of Science © Arjun Sukumaran 2016 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Biology Commons, Genetics and Genomics Commons, Plant Biology Commons, and the Plant Pathology Commons Recommended Citation Sukumaran, Arjun, "Identification and Characterization of the Isoflavonoid-Specific Prenyltransferase Gene Family to Prevent Stem and Root Rot in Soybean" (2016). Electronic Thesis and Dissertation Repository. 4130. https://ir.lib.uwo.ca/etd/4130 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. i Abstract Soybean is one of the most predominantly grown legumes worldwide, however, one deterrent to maximizing its yield is the pathogen, Phytophthora sojae, which causes stem and root rot disease. Many strategies have been implemented to combat this pathogen such as use of pesticides and certain agricultural practices. However, these have been largely ineffective in completely preventing P. sojae infection. An alternative strategy would be to improve the innate resistance of soybean by promoting increased glyceollin production. Glyceollins are soybean-specific antimicrobial agents which are derived from the isoflavonoid branch of the general phenylpropanoid pathway.
    [Show full text]
  • Glyceollin) in Soybeans and Pullulan from Sucrose
    South Dakota State University Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange Electronic Theses and Dissertations 2020 Developing Microbial Based Process to Produce High Value Natural Antimicrobial (Glyceollin) in Soybeans and Pullulan from Sucrose Andrea Zavadil South Dakota State University Follow this and additional works at: https://openprairie.sdstate.edu/etd Part of the Agronomy and Crop Sciences Commons, Environmental Microbiology and Microbial Ecology Commons, and the Plant Biology Commons Recommended Citation Zavadil, Andrea, "Developing Microbial Based Process to Produce High Value Natural Antimicrobial (Glyceollin) in Soybeans and Pullulan from Sucrose" (2020). Electronic Theses and Dissertations. 5002. https://openprairie.sdstate.edu/etd/5002 This Thesis - Open Access is brought to you for free and open access by Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. For more information, please contact [email protected]. DEVELOPING MICROBIAL BASED PROCESS TO PRODUCE HIGH VALUE NATURAL ANTIMICROBIAL (GLYCEOLLIN) IN SOYBEANS AND PULLULAN FROM SUCROSE BY ANDREA ZAVADIL A thesis submitted in partial fulfillment of the requirements for the Master of Science Major in Biological Sciences Specialization in Microbiology South Dakota State University 2020 ii THESIS ACCEPTANCE PAGE Andrea Zavadil This thesis is approved as a creditable and independent investigation by a candidate for the master’s degree and is acceptable for meeting the thesis requirements for this degree. Acceptance of this does not imply that the conclusions reached by the candidate are necessarily the conclusions of the major department.
    [Show full text]
  • Glyceollins Trigger Anti-Proliferative Effects Through Estradiol-Dependent
    Lecomte et al. Cell Communication and Signaling (2017) 15:26 DOI 10.1186/s12964-017-0182-1 RESEARCH Open Access Glyceollins trigger anti-proliferative effects through estradiol-dependent and independent pathways in breast cancer cells Sylvain Lecomte1,2, Frederic Chalmel1,3, François Ferriere1,2, Frederic Percevault1,2, Nicolas Plu4, Christian Saligaut1,2, Claire Surel4, Marie Lelong1,2, Theo Efstathiou4 and Farzad Pakdel1,2* Abstract Background: Estrogen receptors (ER) α and β are found in both women and men in many tissues, where they have different functions, including having roles in cell proliferation and differentiation of the reproductive tract. In addition to estradiol (E2), a natural hormone, numerous compounds are able to bind ERs and modulate their activities. Among these compounds, phytoestrogens such as isoflavones, which are found in plants, are promising therapeutics for several pathologies. Glyceollins are second metabolites of isoflavones that are mainly produced in soybean in response to an elicitor. They have potentially therapeutic actions in breast cancer by reducing the proliferation of cancer cells. However, the molecular mechanisms driving these effects remain elusive. Methods: First, to determine the proliferative or anti-proliferative effects of glyceollins, in vivo and in vitro approaches were used. The length of epithelial duct in mammary gland as well as uterotrophy after treatment by E2 and glyceollins and their effect on proliferation of different breast cell line were assessed. Secondly, the ability of glyceollin to activate ER was assessed by luciferase assay. Finally, to unravel molecular mechanisms involved by glyceollins, transcriptomic analysis was performed on MCF-7 breast cancer cells. Results: In this study, we show that synthetic versions of glyceollin I and II exert anti-proliferative effects in vivo in mouse mammary glands and in vitro in different ER-positive and ER-negative breast cell lines.
    [Show full text]
  • Genetic Regulation of the Elicitation of Glyceollin Biosynthesis in Soybean
    Graduate Theses, Dissertations, and Problem Reports 2019 GENETIC REGULATION OF THE ELICITATION OF GLYCEOLLIN BIOSYNTHESIS IN SOYBEAN Md. Asraful Jahan West Virginia University, [email protected] Follow this and additional works at: https://researchrepository.wvu.edu/etd Part of the Agricultural Science Commons, Genetics Commons, Molecular Genetics Commons, Plant Breeding and Genetics Commons, and the Plant Pathology Commons Recommended Citation Jahan, Md. Asraful, "GENETIC REGULATION OF THE ELICITATION OF GLYCEOLLIN BIOSYNTHESIS IN SOYBEAN" (2019). Graduate Theses, Dissertations, and Problem Reports. 3782. https://researchrepository.wvu.edu/etd/3782 This Dissertation is protected by copyright and/or related rights. It has been brought to you by the The Research Repository @ WVU with permission from the rights-holder(s). You are free to use this Dissertation in any way that is permitted by the copyright and related rights legislation that applies to your use. For other uses you must obtain permission from the rights-holder(s) directly, unless additional rights are indicated by a Creative Commons license in the record and/ or on the work itself. This Dissertation has been accepted for inclusion in WVU Graduate Theses, Dissertations, and Problem Reports collection by an authorized administrator of The Research Repository @ WVU. For more information, please contact [email protected]. Genetic Regulation of the Elicitation of Glyceollin Biosynthesis in Soybean Md. Asraful Jahan Dissertation submitted to the Davis College of Agriculture, Natural Resources and Design at West Virginia University in partial fulfillment of requirements for the degree of Doctor of Philosophy in Genetics and Developmental Biology Nikola Kovinich, Ph.D., Committee Chair Daniel G.
    [Show full text]
  • Enhanced Biosynthesis of the Natural Antimicrobial Glyceollins in Soybean Seedlings by Priming and Elicitation
    Enhanced biosynthesis of the natural antimicrobial glyceollins in soybean seedlings by priming and elicitation Kalli, S., Araya-Cloutier, C., Lin, Y., de Bruijn, W. J. C., Chapman, J., & Vincken, J. P. This is a "Post-Print" accepted manuscript, which has been Published in "Food Chemistry" This version is distributed under a non-commercial no derivatives Creative Commons (CC-BY-NC-ND) user license, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited and not used for commercial purposes. Further, the restriction applies that if you remix, transform, or build upon the material, you may not distribute the modified material. Please cite this publication as follows: Kalli, S., Araya-Cloutier, C., Lin, Y., de Bruijn, W. J. C., Chapman, J., & Vincken, J. P. (2020). Enhanced biosynthesis of the natural antimicrobial glyceollins in soybean seedlings by priming and elicitation. Food Chemistry, 317, [126389]. https://doi.org/10.1016/j.foodchem.2020.126389 You can download the published version at: https://doi.org/10.1016/j.foodchem.2020.126389 Enhanced biosynthesis of the natural antimicrobial glyceollins in soybean seedlings by priming and elicitation Sylvia Kallia, Carla Araya-Cloutiera, Yiran Lina, Wouter J.C. de Bruijna, John Chapmanb, and Jean-Paul Vinckena,* a Laboratory of Food Chemistry, Wageningen University, P.O. Box 17, 6700 AA Wageningen, The Netherlands. b Unilever R&D Vlaardingen, Olivier van Noortlaan 120, 3133 AT, Vlaardingen, The Netherlands. * Correspondence to: [email protected] 1 Highlights • Priming prior to Rhizopus-elicitation enhances the production of glyceollins. • Priming with reactive oxygen species was superior to wounding in glyceollin production.
    [Show full text]
  • TEDX List of Potential Endocrine Disruptors 2011.10.10
    TEDX List of Potential Endocrine Disruptors 2011.10.10 CHEMICAL NAME ALTERNATIVE CAS # TEDX# YEAR CITATION DATE NAME(S) ADDED (YYYYMMD D) 4-nitrophenol p-nitrophenol 100-02-7 H21269 2006 Li C, Taneda S, Suzuki AK, Furuta C, Watanabe G, Taya K. 2006. Estrogenic 20110505 and anti-androgenic activities of 4-nitrophenol in diesel exhaust particles. Toxicol Appl Pharmacol 217(1):1-6. 4-nitrophenol p-nitrophenol 100-02-7 H23999 2009 Li X, Li C, Suzuki AK, Taneda S, Watanabe G, Taya K. 2009. 4-Nitrophenol 20110505 isolated from diesel exhaust particles disrupts regulation of reproductive hormones in immature male rats. Endocrine 36(1):98-102. 4-nitrophenol p-nitrophenol 100-02-7 W14938 2010 Mi Y, Zhang C, Li CM, Taneda S, Watanabe G, Suzuki AK, Taya K. 2010. 20110505 Protective effect of quercetin on the reproductive toxicity of 4-nitrophenol in diesel exhaust particles on male embryonic chickens. J Reprod Dev 56(2): 195-199. dibutyltin DBT; di-n-butyltin 1002-53-5 H16880 2005 Atanasov AG, Nashev LG, Tan S, Baker ME, Odermatt A. 2005. Organotins 20110616 disrupt the 11<beta>-hydroxysteroid dehydrogenase type 2-dependent local inactivation of glucocorticoids. Environ Health Perspect 113(11):1600-1606. 4-(imidazol-1-yl)phenol 10041-02-8 W08346 2000 Schultz TW, Sinks GD, Cronin MTD. 2000. Effect of substituent size and 20110505 dimensionality on potency of phenolic xenoestrogens evaluated with a recombinant yeast assay. Environ Toxicol Chem 19(11):2637-2642. styrene 100-42-5 H25131 1984 Mutti A, Falzoi M, Romanelli A, Franchini I. 1984. Regional alterations of brain 20110505 catecholamines by styrene exposure in rabbits.
    [Show full text]
  • Total Synthesis of Natural Product Pterocarpans Useful As Selective Estrogen Receptor Modulators
    A Dissertation entitled Total Synthesis of Natural Product Pterocarpans Useful as Selective Estrogen Receptor Modulators by Neha Malik Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Medicinal Chemistry ___________________________________________ Paul W. Erhardt, Ph.D., Committee Chair ___________________________________________ L. M. V. Tillekeratne, Ph.D., Committee Member ___________________________________________ Ronald E. Viola, Ph.D., Committee Member ___________________________________________ Amanda Bryant-Friedrich, Ph.D., Committee Member ___________________________________________ Jeffrey G. Sarver, Ph.D., Committee Member ___________________________________________ Patricia R. Komuniecki, Ph.D., Dean College of Graduate Studies The University of Toledo December 2013 Copyright 2013, Neha Malik This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of Total Synthesis of Natural Product Pterocarpans Useful as Selective Estrogen Receptor Modulators by Neha Malik Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Medicinal Chemistry The University of Toledo December 2013 Breast cancer is one of the leading causes of cancer deaths in women worldwide. Inhibition of estrogen receptors is an important strategy for the treatment of estrogen dependent breast cancer. Estrogen mimicking plant compounds
    [Show full text]
  • Prenylated Isoflavonoids from Soya and Licorice
    Prenylated isoflavonoids from soya and licorice Analysis, induction and in vitro estrogenicity Rudy Simons Thesis committee Thesis supervisor: Prof. Dr. Ir. Harry Gruppen Professor of Food Chemistry Wageningen University Thesis co-supervisor : Dr. Ir. Jean-Paul Vincken Assistent Professor, Laboratory of Food Chemistry Wageningen University Other members : Prof. Dr. Renger Witkamp Wageningen University Dr. Nigel Veitch Royal Botanic Gardens, Kew, United Kingdom Prof. Dr. Robert Verpoorte Leiden University Dr. Henk Hilhorst Wageningen University This research was conducted under the auspices of the Graduate School VLAG ( Voeding, Levensmiddelentechnologie, Agrobiotechnologie en Gezondheid ) Prenylated isoflavonoids from soya and licorice Analysis, induction and in vitro estrogenicity Rudy Simons Thesis submitted in fulfilment of the requirements of the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr. M.J. Kropff in the presence of the Thesis Committee appointed by the Academic Board To be defended in public on Tuesday 28 June 2011 at 1.30 p.m. in the Aula. Rudy Simons Prenylated isoflavonoids from soya and licorice Analysis, induction and in vitro estrogenicity Ph.D. thesis, Wageningen University, Wageningen, the Netherlands (2011) With references, with summaries in Dutch and English ISBN: 978-90-8585-943-7 ABSTRACT Prenylated isoflavonoids are found in large amounts in soya bean ( Glycine max ) germinated under stress and in licorice ( Glycyrrhiza glabra ). Prenylation of isoflavonoids has been associated with modification of their estrogenic activity. The aims of this thesis were (1) to provide a structural characterisation of isoflavonoids, in particular the prenylated isoflavonoids occurring in soya and licorice, (2) to increase the estrogenic activity of soya beans by a malting treatment in the presence of a food-grade fungus, and (3) to correlate the in vitro agonistic/antagonistic estrogenicity with the presence of prenylated isoflavonoids.
    [Show full text]
  • Dr. Duke's Phytochemical and Ethnobotanical Databases List of Chemicals for Pesticide
    Dr. Duke's Phytochemical and Ethnobotanical Databases List of Chemicals for Pesticide Chemical Dosage (+)-(1S,10R)-1,10-DIMETHYLBICYCLO(4.4.
    [Show full text]