
Supplementary Figure S1 A 100 80 (%) 60 40 Proportion 20 0 Seed HypocotylCotyledon Root Root Seedling Glyceollin I Glyceollin II Glyceollin III B 100 80 60 40 Proportion (%) 20 0 microspores WGE C 100 80 60 40 Proportion (%) 20 0 AgNO3 CuCl2 BTD AVG SA Chemical elicitor DGlyceollin100 I Glyceollin II Glyceollin III 80 60 40 Proportion (%) 20 0 WGE + AGNO3 Elicitor Supplementary Figure S1. Relative proportion of glyceollins from soybean organs treated with purified wall glucan elicitor (WGE) from P. sojae (A), from soybean seeds treated with biotic elicitors (B), chemical elicitors silver nitrate (AgNO3), copper chloride (CuCl2), benzothiadiazole (BTD), aminoethoxyvinyl glycine (AVG), and salicylic acid (SA) at 1 -1 mM (C), seeds with AgNO3 (5 mM) and WGE (20 mg mL ) (D). Dashed line demarcates 50%. Supplementary Figure S2 Supplementary Figure S2. (A) Glyceollin I accumulation dynamics -1 after eliciting imbibed seeds with 5 mg mL WGE or 2.5 mM AgNO3 for the indicated times. (B) Metabolite induction compared to the solvent control (H2O). Two-way ANOVA, Tukey post hoc test (P < 0.001). Supplementary Figure S3 A 2nd quartile 3rd quartile Mean 300 a ) 1 - abc 200 ab cd 100 d Glyceollin gt I (µg d 0 0 1 2.5 5 7.5 10 3rd quartile 2nd quartile Mean B AgNO3 (mM) a 600 ) 1 - 500 abc c d d 400 300 200 Glyceollin gt I (µg 100 e 0 0 5 10 20 40 60 WGE (mg mL-1) Supplementary Figure S3. (A) Glyceollin I concen- trations in imbibing soybean seeds elicited with different concentrations of AgNO3. (B) Elicitation with different concentrations of WGE. Two-way ANOVA, Tukey post hoc test, P < 0.001. Supplementary Figure S4 500000 AgNO3 450000 400000 350000 300000 malonyldaidzin malonylgenistin - 250000 - O O - - Glyceollin I 200000 6″ 6″ malonylononin glycinol Other isoflavonoids 150000 - O - daidzein daidzin 100000 6″ glyceollin II glyceollin genistein glyceollin I glyceollin coumestrol glyceollin III glyceollin prunetin 50000 naringenin 0 0 2 4 6 8 10 12 14 16 18 20 Proportion (µmol/µmol) 500000 WGE ) 450000 mAU 400000 350000 300000 malonyldaidzin malonylgenistin - 250000 - O O - - glyceollin I glyceollin malonylononin Glyceollin I 200000 - 6″ 6″ O - 150000 II glyceollin Other isoflavonoids 6″ glycinol glyceollin III glyceollin Absorbance 283 nm ( 100000 daidzin daidzein naringenin prunetin genistein 50000 coumestrol 0 0 2 4 6 8 10 12 14 16 18 20 500000 AgNO3 + WGE 450000 400000 350000 glycinol glyceollin I glyceollin 300000 malonyldaidzin malonylgenistin - 250000 - O glyceollin II glyceollin O - - 200000 III glyceollin 6″ 6″ malonylononin 1 2 - 150000 O - daidzin 100000 6″ daidzein genistein naringenin prunetin 50000 coumestrol 0 0 2 4 6 8 10 12 14 16 18 20 Time (min) Supplementary Figure S4. Composition of glyceollin I relative to all other isoflavonoids in the seed ethanolic extract demonstated by UPLC-PDA and by pie chart. The amounts of all UPLC-PDA peaks that were not annotated were compounds for which we did not have standards and were quantified based on daidzin equivalents. Supplementary Table S1. UPLC-PDA-MSn identifying features of isoflavonoids. − - + + Peak R t (min) λmax (nm) [M − H] MS/MS fragments (m /z) [M + H] MS/MS fragments (m /z) daidzina 4.39 250 415.10 253.05 [daidzein - H]- 417.12 255.06 [daidzein + H]+ glycinolb 5.47 283 271.06 217 255.07 227.59, 214.99 genistina 5.48 260 431.10 - 433.11 271.07 [genistein + H]+, 255.07 6’’-O-malonyldaidzinb 5.80 251 501.10 253.05 [daidzein - H]- 503.12 255.06 [daidzein + H]+ 6’’-O-malonylgenistinb 7.01 260 517.10 269.05 [genistein - H]- 519.11 271.06 [genistein + H]+ 6’’-O-malonylononinb 7.82 259 515.12 253.05 [daidzein - H]- 267.07 517.13 269.08 [formononetin + H]+ [formononetin - H]- daidzeina 8.04 248 253.05 132.02 255.06 222.06 naringenina 9.41 259 271.06 263.08 273.08 241.05 prunetina 9.90 258 283.06 269.05 [genistein - H]- 285.08 - genisteina 10.28 261 269.05 239.13 271.06 241.05 coumestrola 10.90 342 267.03 253.09 269.04 236.05 glyceollin IIIb 11.10 289 337.11 319.10 339.12 321.11 glyceollin IIb 11.30 283 337.11 319.10 339.12 321.11 glyceollin Ia 11.48 283 337.11 255.07, 319.10 339.12 321.11 aPeak identities were based on MS feature comparisons to authentic standards. bIdentities based on MS feature comparisons to Aisyah et al. 2013 and Simons et al. 2014. Supplementary Table S2. Primers. Gene Primer Sequence PEPC16 qPCf TGCAACTGATTCTTATGTTCCAA PEPC16 qPCr GGCATCTTAACCACCTCACG G4DT qG4f TGGCTTTCGGAGTTGGTATC G4DT qG4r GAACAGCATTTCCCATACCC IFS1 qIF1f CACTCAAACTCGGGATCACA IFS1 qIF1r GACGCAAGTGCAGAAACAAA IFS2 qIF2f GGAGAGGTTGTTGAGGGTGA IFS2 qIF2r GACCCTTGATGTGGTCCTTG I2′H qI2f CCATGCTTTTTGGTGGAACT I2′H qI2r GCCTTCTTCAACACCTCTGG.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages6 Page
-
File Size-