DOCSLIB.ORG

Investigation of the DNA-Dependent Cyclohexenyl Nucleic Acid

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigation of the DNA-Dependent Cyclohexenyl Nucleic Acid 3828–3836 Nucleic Acids Research, 2005, Vol. 33, No. 12 doi:10.1093/nar/gki695 Investigation of the DNA-dependent cyclohexenyl nucleic acid polymerization and the cyclohexenyl nucleic acid-dependent DNA polymerization Veerle Kempeneers, Marleen Renders, Matheus Froeyen and Piet Herdewijn* Laboratory for Medicinal Chemistry, Rega Institute for Medical Research, Minderbroedersstraat 10, B-3000 Leuven, Belgium Received April 11, 2005; Revised May 27, 2005; Accepted June 17, 2005 ABSTRACT conformations when incorporated in different double- stranded DNA sequences, which proves the flexibility of DNA polymerases from different evolutionary families the cyclohexene ring system (5). Since cyclohexenyl nucle- [Vent (exoÀ) DNA polymerase from the B-family poly- osides lack the 20-OH they can be considered as a DNA mimic. 3 merases, Taq DNA polymerase from the A-family Based on their preference for the H2 conformation they might polymerases and HIV reverse transcriptase from the be considered as an RNA mimic. Hybridization of CeNA with reverse transcriptase family] were examined for their both DNA and RNA has been observed (1,6) and introducing ability to incorporate the sugar-modified cyclohexenyl cyclohexenyl nucleotides into the DNA strand of a DNA/RNA nucleoside triphosphates. All enzymes were able to hybrid increases the thermal stability of the duplex. CeNA is use the cyclohexenyl nucleotides as a substrate. also stable against degradation in serum (1). These observa- Using Vent (exoÀ) DNA polymerase and HIV reverse tions were the basis for the investigation of CeNA in siRNA transcriptase, we were even able to incorporate seven experiments and encouraged us to synthesize the triphosphates of cyclohexenyl nucleosides and test them as a substrate for consecutive cyclohexenyl nucleotides. Using a cyc- different DNA polymerases. lohexenyl nucleic acid (CeNA) template, all enzymes DNA polymerases incorporate their natural substrates with tested were also able to synthesize a short DNA frag- high specificity and fidelity. However, different research ment. Since the DNA-dependent CeNA polymeriza- groups have shown that polymerases can also tolerate a tion and the CeNA-dependent DNA polymerization broad range of modified nucleotides as a substrate. The is possible to a limited extend, we suggest CeNA as an enzymatic incorporation of nucleotide analogs has proven use- ideal candidate to use in directed evolution methods ful for DNA labeling (7), to tag DNA with additional func- for the development of a polymerase capable of tionality (8,9) or for DNA sequencing (10). Efforts made to replicating CeNA. expand the genetic alphabet have led to the investigation of different unnatural base pairs as substrates for polymerases (11,12). Several nucleotides modified at the sugar part or the sugar–phosphate backbone have also been reported to be INTRODUCTION recognized and replicated by DNA polymerases (13–16), CeNA (cyclohexenyl nucleic acid) is a DNA mimic in which RNA polymerases (17,18) and reverse transcriptases the deoxyribose is replaced by a six-membered cyclohexene (19–22). However, the enzymatic synthesis of modified nuc- ring (1–4) (Figure 1). Although CeNA is a larger molecule leic acids of any substantial length has proven to be difficult than DNA (as the oxygen atom of every sugar moiety of the due to the high substrate specificity of natural polymerases. nucleotide is replaced by an ethylene group), the flexibility of Previously several researchers also reported enzymatic DNA the cyclohexene ring system is comparable to that of the synthesis when a non-standard nucleotide was incorporated in natural (deoxy)ribose furanose ring system. A cyclohexenyl the template strand (23–25). 3 nucleoside can adopt two half-chair conformations, the H2 Here, we investigated the recognition of CeNA by DNA 2 0 0 and the H3 conformation, similar to the C3 - and C2 -endo polymerases on different levels. We used cyclohexenyl nuc- conformations found in natural (deoxy)ribose, with a prefer- leoside triphosphates as a substrate for polymerases and 3 ence of the cyclohexenyl monomer for the H2 conformation we checked whether DNA or CeNA polymerization is possible (1). The cyclohexenyl nucleoside is able to adopt different when a CeNA template was used. These assays were *To whom correspondence should be addressed. Tel: þ32 16 337387; Fax: þ32 16 337340; Email: [email protected] Ó The Author 2005. Published by Oxford University Press. All rights reserved. The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2005, Vol. 33, No. 12 3829 (A) Base MATERIALS AND METHODS O DNA polymerase reactions, kinetic measurements, analysis by NMR spectroscopy and mass spectrometry, as well as high- performance liquid chromatography purification, PAGE and O radioactive labeling of oligonucleotides were performed as −O P O described previously (27). Base O Oligodeoxyribonucleotides Oligodeoxyribonucleotides were purchased from Eurogentec. Oligodeoxyribonucleotides containing a cyclohexenyl nucle- O otide were synthesized on an Applied Biosystems 392 DNA −O P O synthesizer at a 1 mmol scale using phosphoramidites that Base were synthesized according to the published procedures (28). O Synthesis of cyclohexenyl nucleoside triphosphate Cyclohexenyl-guanine nucleoside triphosphate and cyclo- O hexenyl-adenine nucleoside triphosphate were synthesized −O P O according to the one-pot synthesis described by Ludwig (29). The nucleoside triphosphates were purified on a DEAE Sephadex-A25 column using a triethylammonium bicarbonate (B) gradient. 31 − − Cyclohexenyl-guanine triphosphate. P NMR (CeGTP) d O P O O P O (ppm) (D2O) À10.331 (d, g-P), À10.402 (d, a-P), À22.778 O O (t, b-P). Exact mass calculated for C12H18N5O11P3 Base O Base [M À H] ¼ 516.00865; found 516.0079. Cyclohexenyl-adenine triphosphate. 31P NMR (CeATP) d 3H conformation 2H conformation (ppm) (D2O) À10.262 (a- and g-P), À22.401 (t, b-P). Exact 2 O 3 mass calculated for C12H18N5O12P3 [M þ H] ¼ 502.02938; found 502.0296. Figure 1. Cyclohexenyl nucleic acid. (A) Chemical structure of CeNA (bases 3 2 DNA polymerase reactions are either adenine, guanine, cytosine or thymine). (B) H2 and H3 conforma- tion of cyclohexenyl nucleosides. Vent (exoÀ) DNA polymerase (New England Biolabs), HIV reverse transcriptase (Amersham Biosciences) and Super Taq performed to investigate whether CeNA replication could be DNA polymerase (HT Biotechnology Ltd) were used in the possible. The in vitro synthesis of CeNA oligomers starting primer extension reactions. For Vent (exoÀ) and Taq DNA from a DNA template or the DNA synthesis starting from a polymerase, the supplied reaction buffers were used. For Vent CeNA template would be the first step toward the generation (exoÀ) DNA polymerase: 20 mM Tris–HCl, pH 8.8, 10 mM of an in vitro replicating system based on an artificial genetic (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100. system. We propose an artificial nucleic acid structure modi- For Taq DNA polymerase: 10 mM Tris–HCl, pH 9, 1.5 mM fied at the sugar moiety, as the base pairing system is too MgCl2, 50 mM KCl, 0.1% Triton X-100, 0.01% (w/v) stabil- crucial for the function of a genetic heritable system. Earlier izer. For HIV reverse transcriptase: 50 mM Tris–HCl, pH 8.3, 25 mM KCl, 5 mM MgCl2, 0.5 mM spermidine and 5 mM directed evolution methods have been used to generate a polymerase capable of using 20-O-methyl-modified nucle- DTT. The reactions were incubated at 55 C for Vent (exoÀ) DNA polymerase and Taq DNA polymerase and incubated at otides as a substrate (26). However, we prefer to establish the enzymatic synthesis of a novel nucleic acid structure in which 37 C for HIV reverse transcriptase. the five-membered ring is replaced by a six-membered ring. If indicated, the reaction buffer was supplemented with By introducing a larger difference in the sugar moiety, we 1 mM MgCl2. An overview of the primers and templates eventually hope to establish a full self-autonomic system used in the primer extension reactions is given in Table 1. (and not a polymerase that recognizes both CeNA and DNA). Hereto, we first want to investigate the substrate capa- Kinetic experiments city of CeNA by natural polymerases, to identify candidate The single completed hit model described by Creighton et al. polymerases that in future experiments will be used for the (30,31) was used to relate the intensity of the bands on the gel directed evolution of a CeNA polymerase. The replication of a to the kinetic parameters for DNA polymerase incorporation. third type of nucleic acid could lead to numerous advances in For incorporation kinetics of a first cyclohexenyl nucleotide, a various domains. The bulk production of CeNA for diagnostic DNA primer and DNA template were used (hybrid P1T5 for or therapeutic purposes would become available and poly- dATP and CeATP incorporation kinetics, hybrid P1T2 for merases that recognize non-canonical substrates can play a dGTP and CeGTP incorporation kinetics). For dNTP incorp- role in different techniques used in molecular biology. oration kinetics 0.0005 U/ml Vent (exoÀ) DNA polymerase 3830 Nucleic Acids Research, 2005, Vol. 33, No. 12 Table 1. Sequences of the primers and templates used in the polymerase incorporation experiments Ј 0 0 Primers 5 CAGGAAACAGCTATGAC 3 P1 0 0 Ј 5 CAGGAAACAGCTATGACT* 3 P2 0 0 Templates 3 GTCCTTTGTCGATACTGTTTTTTT 5 T1 0 0 3 GTCCTTTGTCGATACTGCTTTT 5 T2 0 0 3 GTCCTTTGTCGATACTGCCTTT 5 T3 0 0 3 GTCCTTTGTCGATACTGT*T*T*T*T*T* 7 T4 0 0 3 GTCCTTTGTCGATACTGTCCCC 5 T5 0 0 3 GTCCTTTGTCGATACTGATCCCC 5 T6 T* indicates a CeT nucleotide.
Load more

Recommended publications
  • In Vitro and in Vivo Models Analyzing Von Hippel-Lindau Disease-Specific Mutations
    [CANCER RESEARCH 64, 8595–8603, December 1, 2004] In vitro and In vivo Models Analyzing von Hippel-Lindau Disease-Specific Mutations W. Kimryn Rathmell,1,3 Michele M. Hickey,1,2 Natalie A. Bezman,1 Christie A. Chmielecki,3 Natalie C. Carraway,3 and M. Celeste Simon1,2 1Abramson Family Cancer Research Institute and the Department of Cell and Molecular Biology, and 2Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, Pennsylvania; and 3Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina ABSTRACT transport and droplet formation (8, 9). Unregulated expression of the full complement of hypoxia response genes is surmised to contribute Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene much of the clinical and pathological phenotype of renal cell carci- cause tissue-specific tumors, with a striking genotype-phenotype correla- noma, which is characterized as a highly vascular, glycolytic, lipid- tion. Loss of VHL expression predisposes to hemangioblastoma and clear cell renal cell carcinoma, whereas specific point mutations predispose to rich tumor that can be associated with polycythemia (10, 11). Detailed pheochromocytoma, polycythemia, or combinations of hemangioblas- studies of the effects of VHL loss have identified the regulation of the toma, renal cell carcinoma, and/or pheochromocytoma. The VHL protein hypoxia response pathway via the proteasomal degradation of HIF1␣ (pVHL) has been implicated in many cellular activities including the and HIF2␣ as a major activity of the VHL protein (pVHL; refs. hypoxia response, cell cycle arrest, apoptosis, and extracellular matrix 12–15). The pVHL acts as the substrate receptor for an E3 ubiquitin Ϫ Ϫ remodeling.
    [Show full text]
  • Imperial Life Sciences
    PRICE LIST 2020/21 Genomics Reagents & Consumables Cell & Imaging Advanced Molecular Diagnostics Imperial Life Sciences One Company Complete Solutions + 91 124 4559 800 - 99 [email protected] Imperial life Sciences (P) Ltd Price list 2020-21 (consumables) M/S NEW ENGLAND BIOLABS INC U Price Rs. (2020- Part No Description - without units Unit Size 21) E6442L NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2 384 rxns 2,47,940.00 E6442S NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2 96 rxns 68,908.00 E7850L NEBNext rRNA Depletion Kit (Bacteria) 24 rxns 1,39,104.00 E7850S NEBNext rRNA Depletion Kit (Bacteria) 6 rxns 38,254.00 E7850X NEBNext rRNA Depletion Kit (Bacteria) 96 rxns 5,00,388.00 E7860L NEBNext rRNA Depletion Kit (Bacteria) with RNA Sample Purification Beads 24 rxns 1,44,900.00 E7860S NEBNext rRNA Depletion Kit (Bacteria) with RNA Sample Purification Beads 6 rxns 39,284.00 E7860X NEBNext rRNA Depletion Kit (Bacteria) with RNA Sample Purification Beads 96 rxns 5,21,640.00 M0460T T7 RNA Polymerase (High Concentration) 50,000 units 72,643.00 M0467S Salt-T4 DNA Ligase 20,000 units 8,243.00 M0467L Salt-T4 DNA Ligase 100,000 units 32,973.00 M0470T Hi-T7 RNA Polymerase (High Concentration) 50,000 units 87,584.00 M2622L Hi-T4 DNA Ligase 100,000 units 32,973.00 M2622S Hi-T4 DNA Ligase 20,000 units 8,243.00 R0739L BsmBI-v2 1,000 units 38,254.00 R0739S BsmBI-v2 200 units 9,402.00 B0201S T4 Polynucleotide Kinase Reaction Buffer 4.0 ml 3,091.00 B0202S T4 DNA Ligase Reaction Buffer
    [Show full text]
  • Saccharomyces Cerevisiae Aspartate Kinase Mechanism and Inhibition
    In compliance with the Canadian Privacy Legislation some supporting forms may have been removed from this dissertation. While these forms may be included in the document page count, their removal does not represent any loss of content from the dissertation. Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry FUNGAL ASPARTATE KINASE MECHANISM AND INHIBITION By DAVID C. BAREICH, B.Sc. A Thesis Submitted to the School of Graduate Studies in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy McMaster University © Copyright by David C. Bareich, June 2003 1 Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry FUNGAL ASPARTATE KINASE MECHANISM AND INHIBITION Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry DOCTOR OF PHILOSOPHY (2003) McMaster University (Biochemistry) Hamilton, Ontario TITLE: Saccharomyces cerevisiae aspartate kinase mechanism and inhibition AUTHOR: David Christopher Bareich B.Sc. (University of Waterloo) SUPERVISOR: Professor Gerard D. Wright NUMBER OF PAGES: xix, 181 11 Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry ABSTRACT Aspartate kinase (AK) from Saccharomyces cerevisiae (AKsc) catalyzes the first step in the aspartate pathway responsible for biosynthesis of L-threonine, L-isoleucine, and L-methionine in fungi. Little was known about amino acids important for AKsc substrate binding and catalysis. Hypotheses about important amino acids were tested using site directed mutagenesis to substitute these amino acids with others having different properties. Steady state kinetic parameters and pH titrations of the variant enzymes showed AKsc-K18 and H292 to be important for binding and catalysis. Little was known about how the S. cerevisiae aspartate pathway kinases, AKsc and homoserine kinase (HSKsc), catalyze the transfer of the y-phosphate from adenosine triphosphate (ATP) to L-aspartate or L-homoserine, respectively.
    [Show full text]
  • Artificial Human Telomeres from DNA Nanocircle Templates
    Artificial human telomeres from DNA nanocircle templates Ulf M. Lindstro¨ m*, Ravi A. Chandrasekaran*, Lucian Orbai*, Sandra A. Helquist*, Gregory P. Miller*, Emin Oroudjev†, Helen G. Hansma†, and Eric T. Kool*‡ *Department of Chemistry, Stanford University, Stanford, CA 94305-5080; and †Department of Physics, University of California, Santa Barbara, CA 93106 Edited by Peter B. Dervan, California Institute of Technology, Pasadena, CA, and approved October 9, 2002 (received for review July 3, 2002) Human telomerase is a reverse-transcriptase enzyme that synthe- sizes the multikilobase repeating hexamer telomere sequence (TTAGGG)n at the ends of chromosomes. Here we describe a designed approach to mimicry of telomerase, in which synthetic DNA nanocircles act as essentially infinite catalytic templates for efficient synthesis of long telomeres by DNA polymerase enzymes. Results show that the combination of a nanocircle and a DNA polymerase gives a positive telomere-repeat amplification proto- col assay result for telomerase activity, and similar to the natural enzyme, it is inhibited by a known telomerase inhibitor. We show that artificial telomeres can be engineered on human chromo- somes by this approach. This strategy allows for the preparation of synthetic telomeres for biological and structural study of telomeres and proteins that interact with them, and it raises the possibility of telomere engineering in cells without expression of telomerase itself. Finally, the results provide direct physical support for a recently proposed rolling-circle mechanism for telomerase- independent telomere elongation. rolling-circle replication ͉ primer extension ͉ telomerase ͉ TRAP assay he telomerase enzyme synthesizes the multikilobase repeat- Ting hexamer telomere sequence (TTAGGG)n at the ends of chromosomes (1–3).
    [Show full text]
  • DNA Polymerases Drive DNA Sequencing-By-Synthesis Technologies: Both Past and Present
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE REVIEW ARTICLEprovided by Frontiers - Publisher Connector published: 24 June 2014 doi: 10.3389/fmicb.2014.00305 DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present Cheng-Yao Chen* Protein Engineering Group, Illumina, San Diego, CA, USA Edited by: Next-generation sequencing (NGS) technologies have revolutionized modern biological and Andrew F.Gardner, New England biomedical research. The engines responsible for this innovation are DNA polymerases; Biolabs, USA they catalyze the biochemical reaction for deriving template sequence information. In fact, Reviewed by: DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Suleyman Yildirim, Walter Reed Army Institute of Research, USA Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized Andreas Marx, University of in Sanger’s dideoxy chain-terminating DNA sequencing chemistry. From these humble Konstanz, Germany beginnings followed an explosion of organism-specific, genome sequence information *Correspondence: accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic Cheng-Yao Chen, Protein Engineering bacteria/archaea were modified and tested in today’s standard capillary electrophoresis Group, Illumina, 5200 Illumina Way, San Diego, CA 92122, USA (CE) and NGS sequencing platforms.These enzymes were selected for their efficient incor- e-mail: [email protected] poration of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage φ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate- labeled nucleoside polyphosphates.
    [Show full text]
  • Trapping DNA Polymerases Using Triplex-Forming Oligodeoxyribonucleotides*
    Gene, 149 (1994) 1277136 0 1994 Elsevier Science B.V. All rights reserved. 0378-l 119/94/$07.00 127 GENE 08089 Trapping DNA polymerases using triplex-forming oligodeoxyribonucleotides* (DNA polymerization;termination; triplex) George M. Samadashwily and Sergei M. Mirkin Department of Genetics, Unioersitr of I/his at Chicago, Chicago, IL 60612, USA Received by J.W. Larrick: 22 March 1994; Accepted: 25 March 1994; Received at publishers: 16 May 1994 SUMMARY Triplexes (triple helices) formed within DNA templates prior to or during DNA synthesis cause DNA polymerase to terminate [Samadashwily et al., EMBO J. 13 (1993) 4975549831. Here, we show that triplex-forming oligodeoxyribo- nucleotides (oligos) efficiently trap DNA polymerases at target DNA sequences within single-stranded (ss) templates. This was observed for all studied DNA polymerases, including Sequenase and the thermophilic Taq and Vent polymer- ases. The termination rate depends on the fine structure of a triplex, as well as on ambient conditions such as temperature and the concentration of magnesium ions. Inhibition of DNA synthesis was observed not only when triplexes blocked the path of DNA polymerase, but also when a polymerization primer was involved in triplex formation. Escherichia coli ss-binding (SSB) protein helps DNA polymerase overcome the triplex barrier, but with an efficiency dramatically dependent on the triplex configuration. These results describe a novel method for blocking DNA replication at target homopurine-homopyrimidine sequences by means of triplex-forming oligos in direct analogy with similar results during transcription. INTRODUCTION images of chemically similar strands in target DNAs (Mirkin et al., 1987; Beal and Dervan, 1991).
    [Show full text]
  • Taq DNA Polymerase
    Polymerase Chain Reaction (PCR) • PCR is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested. • As a result, it now becomes possible to analyze and characterize DNA fragments found in minute quantities in different samples. Polymerase Chain Reaction (PCR) • PCR carry out for – DNA cloning – sequencing, – DNA-based phylogeny, or – functional analysis of genes; – the diagnosis of diseases; – genetic fingerprints and – the detection and diagnosis of infectious diseases. PROCEDURE ….. PCR Reagents • Template DNA (e.g., plasmid DNA, genomic DNA). • Forward and reverse PCR primers. • MgCl2 (25 mM). • dNTPs (a mixture of 2.5 mM dATP, dCTP, dGTP, and dTTP). • PCR buffer: 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 25°C. PCR Reagents • Thermal stable DNA polymerase – DNA polymerases without 3′ → 5′ proofreading activity • Taq DNA polymerase • Tth DNA polymerase • Tfl DNA polymerase – DNA polymerases with 3′ → 5′ proofreading activity: • Pwo DNA polymerase • Pfu DNA polymerase • Tli DNA polymerase • Vent DNA polymerase PCR Reagents • Optional: PCR additives /cosolvents (optional; e.g., • betaine, glycerol, DMSO, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, Tween-20, Triton X-100, β-mercaptoethanol, or tetramethylammonium chloride). Polymerase Chain Reaction (PCR) • Initialization step: 94–96 °C (or 98 °C if extremely thermostable polymerases are used), for 1–9 minutes. – the complete separation of the DNA strands and unfolding secondary structures – This stage also required for DNA polymerases that require heat activation by hot-start PCR. Polymerase Chain Reaction (PCR) • Denaturation step: 94–98 °C for 20–30 seconds.
    [Show full text]
  • Diacetylchitobiase Gene from Vibrio Parahaemolyticus: Sequence Analysis, Protein Secretion, and Secretion System Development
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1996 The yC toplasmic N,n'-Diacetylchitobiase Gene From Vibrio Parahaemolyticus: Sequence Analysis, Protein Secretion, and Secretion System Development. Michael Hongli Wu Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Wu, Michael Hongli, "The yC toplasmic N,n'-Diacetylchitobiase Gene From Vibrio Parahaemolyticus: Sequence Analysis, Protein Secretion, and Secretion System Development." (1996). LSU Historical Dissertations and Theses. 6171. https://digitalcommons.lsu.edu/gradschool_disstheses/6171 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.
    [Show full text]
  • Structural Studies of Terpenoid Biosynthesis And
    STRUCTURAL STUDIES OF TERPENOID BIOSYNTHESIS AND BACTERIAL CELL DIVISION A Dissertation by DONG YANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY August 2006 Major Subject: Biochemistry STRUCTURAL STUDIES OF TERPENOID BIOSYNTHESIS AND BACTERIAL CELL DIVISION A Dissertation by DONG YANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, James C. Sacchettini Committee Members, James C. Hu Patricia J. Liwang Terry L. Thomas Head of Department, Gregory D. Reinhart August 2006 Major Subject: Biochemistry iii ABSTRACT Structural Studies of Terpenoid Biosynthesis and Bacterial Cell Division. (August 2006) Dong Yang, B.S., Zhe Jiang University Chair of Advisory Committee: Dr. James C. Sacchettini The objective of this work is to investigate the structures of two nucleotide binding proteins: mevalonate kinase (MVK) and FtsZ. MVK is the key enzyme involved in terpenoid biosynthesis. In this study, we solved the crystal structures of the M. jannaschii MVK apoprotein, as well as the protein in complex with ligands. Its fold was analyzed and firmly established within the GHMP kinase family, in which homoserine kinase (HSK), phosphomevalonate kinase and galactokinase also belong. Structural analysis in combination with enzyme kinetics studies revealed the mechanism of this enzyme upon substrate binding, catalysis and inhibition. In particular, the phosphate-binding loop was found to be critically involved in the binding of nucleotides and terpenoids, via the interaction with a di-phosphate moiety from the ligand.
    [Show full text]
  • Allosteric Regulation of Mammalian and Bacterial Fructose-1,6-Bisphosphatases Justin Keith Hines Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2007 Allosteric regulation of mammalian and bacterial fructose-1,6-bisphosphatases Justin Keith Hines Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Biochemistry Commons Recommended Citation Hines, Justin Keith, "Allosteric regulation of mammalian and bacterial fructose-1,6-bisphosphatases" (2007). Retrospective Theses and Dissertations. 15778. https://lib.dr.iastate.edu/rtd/15778 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Allosteric regulation of mammalian and bacterial fructose-1,6-bisphosphatases by Justin Keith Hines A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Biochemistry Program of Study Committee: Richard Honzatko, Major Professor Herbert Fromm Alan DiSpirito Reuben Peters Robert Angelici Iowa State University Ames, Iowa 2007 Copyright © Justin Keith Hines, 2007. All rights reserved. 2008 ii TABLE OF CONTENTS LIST OF ABBREVIATIONS v ABSTRACT vii CHAPTER I. GENERAL INTRODUCTION 1 Literature Review 1 Thesis Organization 8 References 10 CHAPTER II: NOVEL
    [Show full text]
  • Accurate and Efficient One-Pot Reverse Transcription and Amplification of 2’ Fluoro-Modified Nucleic Acids by Commercial DNA Polymerases
    Accurate and efficient one-pot reverse transcription and amplification of 2’ fluoro-modified nucleic acids by commercial DNA polymerases Arianna S. Thompson, Susanna E. Barrett, Aurora G. Weiden, Ananya Venkatesh, Madison K. C. Seto, Simone Z. P. Gottlieb and Aaron M. Leconte* W.M. Keck Science Department of Claremont McKenna, Pitzer, and Scripps Colleges, Claremont, California 91711, United States of America Corresponding Author *Telephone: 909-607-9353. Email: [email protected] Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding This work was supported by the National Science Foundation (CHE-1752924 CAREER award to A.M.L.). Notes The authors declare no competing financial interests. ABSTRACT: DNA is a foundational tool in biotechnology and synthetic biology but is limited by sensitivity to DNA-modifying enzymes. Recently, researchers have identified DNA polymerases that can enzymatically synthesize long oligonucleotides of modified-DNA (M-DNA) that are resistant to DNA-modifying enzymes. Most applications require M-DNA to be reverse transcribed, typically using a RNA reverse transcriptase, back into natural DNA for sequence analysis or further manipulation. Here, we tested commercially available DNA-dependent DNA polymerases for their ability to reverse transcribe and amplify M-DNA in a one-pot reaction. Three of the six polymerases chosen (Phusion, Q5, and Deep Vent) were able to reverse transcribe and amplify synthetic 2’F M-DNA in a single reaction with < 5 10-3 errors per base pair. We further used Q5 DNA polymerase to reverse transcribe and amplify M-DNA synthesized by two candidate M-DNA polymerases (SFP1 and SF4-6), allowing for quantification of the frequency, types, and locations of errors made during M-DNA synthesis.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,034,568 B2 Kurn Et Al
    US008O34568B2 (12) United States Patent (10) Patent No.: US 8,034,568 B2 Kurn et al. (45) Date of Patent: Oct. 11, 2011 (54) ISOTHERMAL NUCLEICACID 5,427,930 A 6/1995 Birkenmeyer et al. AMPLIFICATION METHODS AND 5.437,990 A 8/1995 Burg et al. 5,455,166 A 10, 1995 Walker COMPOSITIONS 5,480,784. A 1/1996 Kacian et al. 5,491,063 A 2f1996 Fisher et al. (75) Inventors: Nurith Kurn, Palo Alto, CA (US); 5,508,178 A 4/1996 Rose et al. Shenglong Wang, San Ramon, CA (US) 5,510,270 A 4/1996 Fodor et al. 5,545,522 A 8, 1996 Van Gelder et al. 5,554,516 A 9, 1996 Kacian et al. (73) Assignee: NuGEN Technologies, Inc., San Carlos, 5,554,517 A 9/1996 Davey et al. CA (US) 5,556,752 A 9, 1996 Lockhart et al. 5,556,771 A 9, 1996 Shen et al. (*) Notice: Subject to any disclaimer, the term of this 5,565,322 A 10, 1996 Heller patent is extended or adjusted under 35 5,578,832 A 11/1996 Trulson et al. 5,589,339 A 12/1996 Hampson et al. U.S.C. 154(b) by 0 days. 5,595,891 A 1/1997 Rose et al. 5,616,478 A 4/1997 Chetverin et al. (21) Appl. No.: 12/370,534 5,627,275 A 5, 1997 Ro11 5,641,658 A 6/1997 Adams et al. (22) Filed: Feb. 12, 2009 5,648,211 A 7/1997 Fraiser et al.
    [Show full text]