3828–3836 Nucleic Acids Research, 2005, Vol. 33, No. 12 doi:10.1093/nar/gki695 Investigation of the DNA-dependent cyclohexenyl nucleic acid polymerization and the cyclohexenyl nucleic acid-dependent DNA polymerization Veerle Kempeneers, Marleen Renders, Matheus Froeyen and Piet Herdewijn* Laboratory for Medicinal Chemistry, Rega Institute for Medical Research, Minderbroedersstraat 10, B-3000 Leuven, Belgium Received April 11, 2005; Revised May 27, 2005; Accepted June 17, 2005 ABSTRACT conformations when incorporated in different double- stranded DNA sequences, which proves the flexibility of DNA polymerases from different evolutionary families the cyclohexene ring system (5). Since cyclohexenyl nucle- [Vent (exoÀ) DNA polymerase from the B-family poly- osides lack the 20-OH they can be considered as a DNA mimic. 3 merases, Taq DNA polymerase from the A-family Based on their preference for the H2 conformation they might polymerases and HIV reverse transcriptase from the be considered as an RNA mimic. Hybridization of CeNA with reverse transcriptase family] were examined for their both DNA and RNA has been observed (1,6) and introducing ability to incorporate the sugar-modified cyclohexenyl cyclohexenyl nucleotides into the DNA strand of a DNA/RNA nucleoside triphosphates. All enzymes were able to hybrid increases the thermal stability of the duplex. CeNA is use the cyclohexenyl nucleotides as a substrate. also stable against degradation in serum (1). These observa- Using Vent (exoÀ) DNA polymerase and HIV reverse tions were the basis for the investigation of CeNA in siRNA transcriptase, we were even able to incorporate seven experiments and encouraged us to synthesize the triphosphates of cyclohexenyl nucleosides and test them as a substrate for consecutive cyclohexenyl nucleotides. Using a cyc- different DNA polymerases. lohexenyl nucleic acid (CeNA) template, all enzymes DNA polymerases incorporate their natural substrates with tested were also able to synthesize a short DNA frag- high specificity and fidelity. However, different research ment. Since the DNA-dependent CeNA polymeriza- groups have shown that polymerases can also tolerate a tion and the CeNA-dependent DNA polymerization broad range of modified nucleotides as a substrate. The is possible to a limited extend, we suggest CeNA as an enzymatic incorporation of nucleotide analogs has proven use- ideal candidate to use in directed evolution methods ful for DNA labeling (7), to tag DNA with additional func- for the development of a polymerase capable of tionality (8,9) or for DNA sequencing (10). Efforts made to replicating CeNA. expand the genetic alphabet have led to the investigation of different unnatural base pairs as substrates for polymerases (11,12). Several nucleotides modified at the sugar part or the sugar–phosphate backbone have also been reported to be INTRODUCTION recognized and replicated by DNA polymerases (13–16), CeNA (cyclohexenyl nucleic acid) is a DNA mimic in which RNA polymerases (17,18) and reverse transcriptases the deoxyribose is replaced by a six-membered cyclohexene (19–22). However, the enzymatic synthesis of modified nuc- ring (1–4) (Figure 1). Although CeNA is a larger molecule leic acids of any substantial length has proven to be difficult than DNA (as the oxygen atom of every sugar moiety of the due to the high substrate specificity of natural polymerases. nucleotide is replaced by an ethylene group), the flexibility of Previously several researchers also reported enzymatic DNA the cyclohexene ring system is comparable to that of the synthesis when a non-standard nucleotide was incorporated in natural (deoxy)ribose furanose ring system. A cyclohexenyl the template strand (23–25). 3 nucleoside can adopt two half-chair conformations, the H2 Here, we investigated the recognition of CeNA by DNA 2 0 0 and the H3 conformation, similar to the C3 - and C2 -endo polymerases on different levels. We used cyclohexenyl nuc- conformations found in natural (deoxy)ribose, with a prefer- leoside triphosphates as a substrate for polymerases and 3 ence of the cyclohexenyl monomer for the H2 conformation we checked whether DNA or CeNA polymerization is possible (1). The cyclohexenyl nucleoside is able to adopt different when a CeNA template was used. These assays were *To whom correspondence should be addressed. Tel: þ32 16 337387; Fax: þ32 16 337340; Email: [email protected] Ó The Author 2005. Published by Oxford University Press. All rights reserved. The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2005, Vol. 33, No. 12 3829 (A) Base MATERIALS AND METHODS O DNA polymerase reactions, kinetic measurements, analysis by NMR spectroscopy and mass spectrometry, as well as high- performance liquid chromatography purification, PAGE and O radioactive labeling of oligonucleotides were performed as −O P O described previously (27). Base O Oligodeoxyribonucleotides Oligodeoxyribonucleotides were purchased from Eurogentec. Oligodeoxyribonucleotides containing a cyclohexenyl nucle- O otide were synthesized on an Applied Biosystems 392 DNA −O P O synthesizer at a 1 mmol scale using phosphoramidites that Base were synthesized according to the published procedures (28). O Synthesis of cyclohexenyl nucleoside triphosphate Cyclohexenyl-guanine nucleoside triphosphate and cyclo- O hexenyl-adenine nucleoside triphosphate were synthesized −O P O according to the one-pot synthesis described by Ludwig (29). The nucleoside triphosphates were purified on a DEAE Sephadex-A25 column using a triethylammonium bicarbonate (B) gradient. 31 − − Cyclohexenyl-guanine triphosphate. P NMR (CeGTP) d O P O O P O (ppm) (D2O) À10.331 (d, g-P), À10.402 (d, a-P), À22.778 O O (t, b-P). Exact mass calculated for C12H18N5O11P3 Base O Base [M À H] ¼ 516.00865; found 516.0079. Cyclohexenyl-adenine triphosphate. 31P NMR (CeATP) d 3H conformation 2H conformation (ppm) (D2O) À10.262 (a- and g-P), À22.401 (t, b-P). Exact 2 O 3 mass calculated for C12H18N5O12P3 [M þ H] ¼ 502.02938; found 502.0296. Figure 1. Cyclohexenyl nucleic acid. (A) Chemical structure of CeNA (bases 3 2 DNA polymerase reactions are either adenine, guanine, cytosine or thymine). (B) H2 and H3 conforma- tion of cyclohexenyl nucleosides. Vent (exoÀ) DNA polymerase (New England Biolabs), HIV reverse transcriptase (Amersham Biosciences) and Super Taq performed to investigate whether CeNA replication could be DNA polymerase (HT Biotechnology Ltd) were used in the possible. The in vitro synthesis of CeNA oligomers starting primer extension reactions. For Vent (exoÀ) and Taq DNA from a DNA template or the DNA synthesis starting from a polymerase, the supplied reaction buffers were used. For Vent CeNA template would be the first step toward the generation (exoÀ) DNA polymerase: 20 mM Tris–HCl, pH 8.8, 10 mM of an in vitro replicating system based on an artificial genetic (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100. system. We propose an artificial nucleic acid structure modi- For Taq DNA polymerase: 10 mM Tris–HCl, pH 9, 1.5 mM fied at the sugar moiety, as the base pairing system is too MgCl2, 50 mM KCl, 0.1% Triton X-100, 0.01% (w/v) stabil- crucial for the function of a genetic heritable system. Earlier izer. For HIV reverse transcriptase: 50 mM Tris–HCl, pH 8.3, 25 mM KCl, 5 mM MgCl2, 0.5 mM spermidine and 5 mM directed evolution methods have been used to generate a polymerase capable of using 20-O-methyl-modified nucle- DTT. The reactions were incubated at 55 C for Vent (exoÀ) DNA polymerase and Taq DNA polymerase and incubated at otides as a substrate (26). However, we prefer to establish the enzymatic synthesis of a novel nucleic acid structure in which 37 C for HIV reverse transcriptase. the five-membered ring is replaced by a six-membered ring. If indicated, the reaction buffer was supplemented with By introducing a larger difference in the sugar moiety, we 1 mM MgCl2. An overview of the primers and templates eventually hope to establish a full self-autonomic system used in the primer extension reactions is given in Table 1. (and not a polymerase that recognizes both CeNA and DNA). Hereto, we first want to investigate the substrate capa- Kinetic experiments city of CeNA by natural polymerases, to identify candidate The single completed hit model described by Creighton et al. polymerases that in future experiments will be used for the (30,31) was used to relate the intensity of the bands on the gel directed evolution of a CeNA polymerase. The replication of a to the kinetic parameters for DNA polymerase incorporation. third type of nucleic acid could lead to numerous advances in For incorporation kinetics of a first cyclohexenyl nucleotide, a various domains. The bulk production of CeNA for diagnostic DNA primer and DNA template were used (hybrid P1T5 for or therapeutic purposes would become available and poly- dATP and CeATP incorporation kinetics, hybrid P1T2 for merases that recognize non-canonical substrates can play a dGTP and CeGTP incorporation kinetics). For dNTP incorp- role in different techniques used in molecular biology. oration kinetics 0.0005 U/ml Vent (exoÀ) DNA polymerase 3830 Nucleic Acids Research, 2005, Vol. 33, No. 12 Table 1. Sequences of the primers and templates used in the polymerase incorporation experiments Ј 0 0 Primers 5 CAGGAAACAGCTATGAC 3 P1 0 0 Ј 5 CAGGAAACAGCTATGACT* 3 P2 0 0 Templates 3 GTCCTTTGTCGATACTGTTTTTTT 5 T1 0 0 3 GTCCTTTGTCGATACTGCTTTT 5 T2 0 0 3 GTCCTTTGTCGATACTGCCTTT 5 T3 0 0 3 GTCCTTTGTCGATACTGT*T*T*T*T*T* 7 T4 0 0 3 GTCCTTTGTCGATACTGTCCCC 5 T5 0 0 3 GTCCTTTGTCGATACTGATCCCC 5 T6 T* indicates a CeT nucleotide.