DOCSLIB.ORG

Overview of Thermostable DNA Polymerases for Classical PCR Applications: from Molecular and Biochemical Fundamentals to Commercial Systems

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Overview of Thermostable DNA Polymerases for Classical PCR Applications: from Molecular and Biochemical Fundamentals to Commercial Systems Appl Microbiol Biotechnol (2013) 97:10243–10254 DOI 10.1007/s00253-013-5290-2 MINI-REVIEW Overview of thermostable DNA polymerases for classical PCR applications: from molecular and biochemical fundamentals to commercial systems Kay Terpe Received: 22 July 2013 /Revised: 20 September 2013 /Accepted: 22 September 2013 /Published online: 1 November 2013 # Springer-Verlag Berlin Heidelberg 2013 Abstract During the genomics era, the use of thermostable before becoming standard. Time and temperature of denaturing DNA polymerases increased greatly. Many were identified and can deactivate the polymerase more or less depending on the described—mainly of the genera Thermus, Thermococcus and used enzyme. Factors like DNA origin, primer and product Pyrococcus. Each polymerase has different features, resulting length as well as guanine–cytosine content should have a direct from origin and genetic modification. However, the rational influence on the choice of polymerase (Wu et al. 1991). Salt, choice of the adequate polymerase depends on the application magnesium and deoxyribonucleotide triphosphate (dNTP) con- itself. This review gives an overview of the most commonly centrations can greatly affect the PCR (Ling et al. 1991; used DNA polymerases used for PCR application: KOD, Pab Owczarzy et al. 2008). Additives like BSA (Al-Soud and (Isis™), Pfu, Pst (Deep Vent™), Pwo, Taq, Tbr, Tca, Tfi, Tfl, Rådström 2001), dimethylsulfoxide (Chester and Marshak Tfu, Tgo, Tli (Vent™), Tma (UITma™), Tne, Tth and others. 1993), formamide (Sarkar et al. 1990), betaine (Henke et al. 1997; Rees et al. 1993), ethylene glycol and 1,2-propanediol Keywords Thermostable DNA polymerase . Polymerase (Zhang et al. 2009), and others (Al-Soud and Rådström 2000; chain reaction (PCR) . Extension rate . Error rate . Half-life Varadaraj and Skinner 1994) are in use to optimize specificity time . Extension temperature and PCR amplification. Most of these important factors are recommended for calculations of the theoretical annealing tem- perature. Basis of this calculation is the melting temperature. Introduction Many formulas are used addicted in similar but not identical results (Table 2). The real optimal annealing temperature is very It is a matter of fact that thermostable DNA polymerases with often determined by using a thermal cycler with temperature 5′→3′ amplification activity are one of the key enzymes in gradient. Additional, the heating and cooling rates of the thermal many molecular applications. Therefore, industrial business cycler, the thermal conductivity of the thermoblock material, the volume is much and there is financial pressure to find better volume of the mixture (Chang and Lee 2005) and the thickness polymerases than the established ones. Mainly A-type and B- of the used plastic material have an important influence on the type polymerases are in use (Table 1). The increasing microbi- evaluation of an optimal PCR process (Table 3). The perfor- ology genome projects in combination with new molecular mance of the thermal cyclers as well as the transfer of protocols technologies facilitate launching new thermostable DNA poly- from one system to another are also important points which merases. However, marketing names like super, turbo, ultra, could be considered (Schoder et al. 2003, 2005). However, this dream, gold and many more confuse the users and are not review describes the common widely used thermostable DNA helpful. Published values of fidelity are mostly analysed at polymerases (Table 1) and their important features for PCR optimal conditions with λ-DNA. These error rates cannot trans- applications. mit for any application. A PCR process must often be validated A-type polymerases from bacteria Thermus K. Terpe (*) SensoQuest GmbH, Hannah-Vogt-Str. 1, 37085 Göttingen, Germany e-mail: [email protected] The genus Thermus belongs to the bacteria and to the class of URL: www.sensoquest.de Deinococci. Thermus species grow optimal at 65–70 °C, and 10244 Table 1 Overview of the most common thermophilic DNA polymerases and their characteristics (n.p. = not published) Name of DNA Species origin Optimal Extension rate Error rate = mutation 5′→3′/3′→5′ Extra Half-life time References polymerase extension [kbp/min] frequency per bp exonuclease nucleotide measured temperature per duplication activity overhang between − − (°C) [mf×bp 1×d 1] 95 and 100 °C − − Deep Vent™ Pyrococcus species GB-D 72 – 75 1.4 1.2 × 10 5– 2.7 × 10 6 No/yes 95 % blunt 95 °C/23 h Cline et al. (1996) − − − − [exo :2.0×10 4] [exo : no/no] [exo :70% 100 °C/8 h Huang and Keohavong (1996) blunt] − KOD1 Thermococcus 72 – 75 6.0 – 7.8 2.6 × 10 6 No/yes Blunt 95 °C/12 h Takagi et al. (1997) kodacaraensis 100 °C/3 h − − Pab (Isis™) Pyrococcus abyssi 70 – 80 n.p. 6.7 × 10 6– 6.6 × 10 7 No/yes Blunt 100 °C/5 h Dietrich et al. (2002) − − Pfu Pyrococcus furiosus 72 – 80 0.5 – 1.5 2.2 × 10 6– 0.7 × 10 6 No/yes Blunt 95 °C/95 % Cline et al. (1996) − − − [exo :6.0×10 5– [exo : no/no] after 1 h incubation Kim et al. (2007) − 2.0 × 10 5] Pwo Pyrococcus woesei 72 n.p. n.p. No/yes Blunt 100 °C/2 h Dabrowski and Kur (1998) − − Taq Thermus aquaticus 68 – 80 1.0 – 4.8 1.8 × 10 4–8.0 × 10 6 Yes/no 95 % 3′A97°C/10min Eckert and Kunkel (1990) 95 °C/40 min Flaman et al. (1994) Lee et al. (2010) Tbr Thermus brokianus 72 n.p. n.p. Yes/no 3′A 96°C/150min n.p. (DyNAzyme™) Tca Thermus caldophilus 70 – 80 1.0 – 2.3 n.p. Yes/no 3′A95°C/70minParketal.(1993) Tfi Thermus filiformis 70 –72 1.0 n.p. Yes/no 3′A 94°C/40min Choietal.(1999) Zheng et al. (2008) Tfl Thermus flavus 70 –74 2.0 – 4.0 n.p. Yes/no 3′A97°C/10minKaledin et al. (1981) 95 °C/40 min − − Tfu Thermococcus fumiculans 72 0.32 5.3 × 10 5–0.9 × 10 5 No/yes Blunt 95 °C/3.3 h Cambon-Bonavita et al. (2000) 100 °C/2 h − − Tgo Thermococcus 72 1.5 5.6 × 10 6– 3.5 × 10 6 No/yes Blunt 95 °C/2 h Bonch-Osmolovskaya et al. Appl Microbiol Biotechnol (2013) 97:10243 gorgonarius (1996) − − Tli (Vent™) Thermococcus litoralis 72 – 80 1.0 4.5 × 10 5– 2.8 × 10 6 No/yes Blunt 95 % 95 °C/6.7 h Cline et al. (1996) − − − − [exo :1.9×10 4] [exo : no/no] [exo : 100 °C/1.8 h Mattila et al. (1991) blunt 70 %] − − Tma (UlTma™) Thermotoga maritima 65 – 75 n.p. 7.4 × 10 5– 3.2 × 10 5 No/yes Blunt 95 % 97.5 °C/50 min Diaz and Sabino (1998) Flaman et al. (1994) − TNA1_pol Thermococcus sp. NA1 75 3.6 2.2 × 10 4 No/yes n.p. 95 °C/12.5 h Kim et al. (2007) 100 °C/3.5 h Tne Thermotoga neopolitana 72 – 75 n.p. n.p. No/yes n.p. 90 °C/1 h Chatterjee et al. (2002) − Tpe Thermococcus 75 2.0 3.4 × 10 6 No/yes 90 % blunt 95 °C/4 h Lee et al. (2010) peptonophilus Tth Thermus thermophilus 70 – 74 1.5 – 2.0 n.p. Yes/no 3′A 95 °C/20 min Carballeira et al. (1990) − Tzi (Pfx50™) Thermococcus zilligii 68 0.5 – 1.0 2.0 × 10 6 Yes/no Blunt n.p. Griffiths et al. (2007) – 10254 Appl Microbiol Biotechnol (2013) 97:10243–10254 10245 Table 2 Formulas for calculation of the melting temperature (Tm)of recommended. The empirical results calculated with the T7 primer allow oligonucleotides (summarized in von Ahsen et al. 2001). Empirical the deductive reasoning that optimal annealing conditions should be formulas based on GC content, length and the concentration of monova- optimized using gradient function of thermal cyclers. However, next to + lent cations [Na ]. PCR is typically performed in 0.05 M monovalent the manual way for empirical calculation of the Tm, many programs are in cation concentration [Na+]. The number of nucleotides in the oligonucle- use which consider additional sequence-specific stacking effects and otide is n . Mismatches and additives like detergents are not thermodynamic data Formulas for calculating the melting temperature (Tm) of oligonucleotides using the example of T7 primer with the sequence Tm (°C) TAATACGACTCACTATAGGG and 0.05 M monovalent cation concentration 4×(G + C)+2×(A + T) 56.0 69.3+0.41×(%GC)−650/n 53.2 69.3+0.41×(%GC)−535/n 59.0 + 77.1+0.41 (%GC)+11.7 (log10[Na ])−528/n 51.9 + + −1 77.8+0.41 (%GC)+11.7 (log10[Na ]×(1.0+0.7×[Na ]) −528/n 53.1 + 80.4+0.345 (%GC)+log10[Na ]×[17.0−0.135(%GC)]−550/n 51.6 + 81.5+0.41 (%GC)+16.6 (log10[Na ])−500/n 51.3 + + −1 81.5+0.41 (%GC)+16.6 log10([Na ]×(1.0+0.7×[Na ]) )−500/n 51.1 they survive temperatures between 50 and 80 °C. Their heat enzymes have a molecular mass of approximately 94– stable A-type DNA polymerase which belongs to the same 95 kDa (Choi et al. 1999;Lawyeretal.1993;Parketal. family that includes the prokaryotic Pol I polymerases 1993), and an intrinsic 5′→3′ exonuclease activity, but lack a (Braithwaite and Ito 1993) has been analysed since many 3′→5′ proofreading nuclease activity. The fidelity of all en- years (Chien et al. 1976), and ever since this time more and zymes depends on the pH and on concentrations of substrates more polymerases from Thermus were characterized. The Mg2+ and dNTP which formed complexes with primers and templates.
Load more

Recommended publications
  • Methanothermus Fervidus Type Strain (V24S)
    UC Davis UC Davis Previously Published Works Title Complete genome sequence of Methanothermus fervidus type strain (V24S). Permalink https://escholarship.org/uc/item/9367m39j Journal Standards in genomic sciences, 3(3) ISSN 1944-3277 Authors Anderson, Iain Djao, Olivier Duplex Ngatchou Misra, Monica et al. Publication Date 2010-11-20 DOI 10.4056/sigs.1283367 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Standards in Genomic Sciences (2010) 3:315-324 DOI:10.4056/sigs.1283367 Complete genome sequence of Methanothermus fervidus type strain (V24ST) Iain Anderson1, Olivier Duplex Ngatchou Djao2, Monica Misra1,3, Olga Chertkov1,3, Matt Nolan1, Susan Lucas1, Alla Lapidus1, Tijana Glavina Del Rio1, Hope Tice1, Jan-Fang Cheng1, Roxanne Tapia1,3, Cliff Han1,3, Lynne Goodwin1,3, Sam Pitluck1, Konstantinos Liolios1, Natalia Ivanova1, Konstantinos Mavromatis1, Natalia Mikhailova1, Amrita Pati1, Evelyne Brambilla4, Amy Chen5, Krishna Palaniappan5, Miriam Land1,6, Loren Hauser1,6, Yun-Juan Chang1,6, Cynthia D. Jeffries1,6, Johannes Sikorski4, Stefan Spring4, Manfred Rohde2, Konrad Eichinger7, Harald Huber7, Reinhard Wirth7, Markus Göker4, John C. Detter1, Tanja Woyke1, James Bristow1, Jonathan A. Eisen1,8, Victor Markowitz5, Philip Hugenholtz1, Hans-Peter Klenk4, and Nikos C. Kyrpides1* 1 DOE Joint Genome Institute, Walnut Creek, California, USA 2 HZI – Helmholtz Centre for Infection Research, Braunschweig, Germany 3 Los Alamos National Laboratory, Bioscience Division, Los Alamos, New Mexico, USA 4 DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany 5 Biological Data Management and Technology Center, Lawrence Berkeley National Laboratory, Berkeley, California, USA 6 Oak Ridge National Laboratory, Oak Ridge, Tennessee, USA 7 University of Regensburg, Archaeenzentrum, Regensburg, Germany 8 University of California Davis Genome Center, Davis, California, USA *Corresponding author: Nikos C.
    [Show full text]
  • RT-PCR Protocol Utilizing RT-PCR
    Protocol TD-P Revision 1.0 Creation Date: 2/18/2019 Revision Date: 4/24/2019 Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Utilizing RT-PCR Kit Introduction Our RT-PCR Kit combines two powerful mixtures: i) 5x Master Mix and ii) Hot start Taq 2x master mix with a standard buffer for 2-step RT-PCR. The two mixtures require minimal handling during the reaction setup and offer consistent and robust RT-PCR reactions. First strand cDNA synthesis is achieved by using the 5x Master Mix, which contains Reverse Transcriptase, recombinant RNase inhibitor, dNTPs, an optimized buffer, MgCl2 and protein stabilizers. Reverse Transcriptase is a recombinant MMLV reverse transcriptase with reduced RNase H activity and increased thermostability. This kit also provides two optimized primers and nuclease-free water. An anchored Oligo-dT primer [d(T)23VN] forces the primer to anneal to the beginning of the polyA tail and the random hexamer primer mix provides random and consistent priming sites covering the entire RNA templates including both mRNAs and non- polyadenylated RNAs. In addition, this kit is highly efficient at producing full-length cDNA from long RNA templates at temperatures between 42-55°C. The amplification step features a high quality Hot Start Taq DNA Polymerase, which offers higher fidelity and better amplification in a master mix format. RT-PCR product can be generated up to 6 kb. Our RT-PCR Kit can be used for cDNA synthesis followed by gene expression data validation. The advantages of our RT-PCR Kit include robust and active cDNA synthesis at temperatures up to 55°C and high efficiency at producing full-length cDNA from as little as 50 pg of total RNA.
    [Show full text]
  • Expression of Telomerase Activity, Human Telomerase RNA, and Telomerase Reverse Transcriptase in Gastric Adenocarcinomas Jinyoung Yoo, M.D., Ph.D., Sonya Y
    Expression of Telomerase Activity, Human Telomerase RNA, and Telomerase Reverse Transcriptase in Gastric Adenocarcinomas Jinyoung Yoo, M.D., Ph.D., Sonya Y. Park, Seok Jin Kang, M.D., Ph.D., Byung Kee Kim, M.D., Ph.D., Sang In Shim, M.D., Ph.D., Chang Suk Kang, M.D., Ph.D. Department of Pathology, St. Vincent’s Hospital, Catholic University, Suwon, South Korea esis of gastric cancer and may reflect, along with Telomerase is an RNA-dependent DNA polymerase enhanced hTR, the malignant potential of the tu- that synthesizes TTAGGG telomeric DNA onto chro- mor. It is noteworthy that methacarn-fixed tissue mosome ends to compensate for sequence loss dur- cannot as yet substitute for the frozen section in the ing DNA replication. It has been detected in 85–90% TRAP assay. of all primary human cancers, implicating that the telomerase seems to be reactivated in tumors and KEY WORDS: hTR, Stomach cancer, Telomerase, that such activity may play a role in the tumorigenic TERT. process. The purpose of this study was to evaluate Mod Pathol 2003;16(7):700–707 telomerase activity, human telomerase RNA (hTR), and telomerase reverse transcriptase (TERT) in Recent studies of stomach cancer have been di- stomach cancer and to determine their potential rected toward gaining a better understanding of relationships to clinicopathologic parameters. Fro- tumor biology. Molecular analysis has suggested zen and corresponding methacarn-fixed paraffin- that alterations in the structures and functions of embedded tissue samples were obtained from 51 oncogenes and tumor suppressor genes, genetic patients with gastric adenocarcinoma and analyzed instability, as well as the acquisition of cell immor- for telomerase activity by using a TRAPeze ELISA tality may be of relevance in the pathogenesis of kit.
    [Show full text]
  • Llll|Llll Technical Tips
    Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press llll|llll Technical Tips The reverse transcriptase-polymerase reverse transcriptase, the multiple Single-step chain reaction (RT-PCR) provides an ef- rounds of amplification catalyzed by Elimination of fective method for detecting very small DNA polymerase are equally effective amounts of a specific mRNA in a small at amplifying either the cDNA or con- Contaminating sample of total RNA.O,2) Unfortunate- taminating genomic DNA. Even mi- DNA Prior to ly, for purposes of detecting RNA by nuscule amounts of contaminating this procedure, after the initial step of DNA (<1%) can produce a false- Reverse converting RNA into cDNA using positive amplification signal in an RT- Transcriptase PCR Donald D. Dilworth and John R. McCarrey Department of Genetics, Southwest Foundation for Biomedical Research, San Antonio, Texas 78228 FIGURE 1 Effects of pretreatment with nuclease on production of amplification signals by RT-PCR. Five hundred nanograms of total RNA from mouse liver supplemented with 0, 1, 5, or 10% genomic DNA was subjected to RT-PCR using primers determined from the mouse 13- actin cDNA sequence, (14) and reverse transcriptase and AmpliTaq DNA polymerase (Perkin- Elmer Cetus). Primers used were: (upstream) 5'-GCGGACTGTTACTGAGCTGCGT-3' and (downstream) 5 ' -GAAGCAATGCTGTCACCTTCCC-3 ', which delineated a 453-bp amplifica- tion product from either a cDNA or genomic DNA template, since this sequence apparently does not span an intron in genomic DNA. In each case a comparison of amplification with (+) or without (-) the addition of reverse transcriptase is shown. (A) RT-PCR with no prior nuclease treatment.
    [Show full text]
  • Pfu DNA Polymerase Deoxynucleoside-Triphosphate: DNA Deoxynucleotidyl-Transferase (DNA-Directed); EC 2.7.7.7
    Version 060918 G:\products\productflyer\pcr\polymerasen\proof\descr_m3004_pfu_en.docx ENAXXON fon: +49(0)731 – 3608 123 X G fax: +49(0)731 – 3608 962 b i o s c i e n c e E-Mail: [email protected] Pfu DNA Polymerase Deoxynucleoside-triphosphate: DNA deoxynucleotidyl-transferase (DNA-directed); EC 2.7.7.7 Product Cat# Package size Pfu DNA Polymerase (proof-reading polymerase) M3004.0250 250 units Pfu DNA Polymerase (proof-reading polymerase) M3004.0500 2 x 250 units Pfu DNA Polymerase (proof-reading polymerase) M3004.1250 5 x 250 units Description The Genaxxon bioscience Pfu DNA Polymerase is a thermostable enzyme possessing 5‘-3‘ DNA polymerase and 3‘-5‘ proof reading exonuclease activities. It is isolated from the hyperthermophilic marine archae Pyroccocus furiosus (Pfu). The enzyme provides extremely high fidelity. Whereas the enzyme is not able to amplify long fragments as efficiently as the Genaxxon Taq polymerase because of its very high exonuclease activity. To overcome this restriction we recommend to use the Genaxxon ReproFast DNA Polymerase, which will provide a more robust synthesis of longer amplification products (Barnes et al. (1994) Proc. Natl. Acad. Sci., USA 91, 2216-2220). Use of the Genaxxon Pfu DNA Polymerase in amplification results in blunt-ended products, which is not recommended for cloning into T/A vectors. Concentration: 2.5 units/µL Unit definition: One unit is defined as the amount of enzyme that incorporates 10nmoles of dNTPs into acid-insoluble form in 30 min at 72°C under the assay conditions (25mM TAPS (tris-(hydroxymethyl)methyl-amino-propane-sulphonic acid, sodium salt) pH9.3 (at 25°C), 50mM KCl, 2mM MgCl2, 1mM ß-mercaptoethanol) and activated calf thymus DNA as substrate.
    [Show full text]
  • A Proposal to Rename the Hyperthermophile Pyrococcus Woesei As Pyrococcus Furiosus Subsp
    Archaea 1, 277–283 © 2004 Heron Publishing—Victoria, Canada A proposal to rename the hyperthermophile Pyrococcus woesei as Pyrococcus furiosus subsp. woesei WIROJNE KANOKSILAPATHAM,1 JUAN M. GONZÁLEZ,1,2 DENNIS L. MAEDER,1 1,3 1,4 JOCELYNE DIRUGGIERO and FRANK T. ROBB 1 Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Baltimore, MD 21202, USA 2 Present address: IRNAS-CSIC, P.O. Box 1052, 41080 Sevilla, Spain 3 Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20274, USA 4 Corresponding author ([email protected]) Received April 8, 2004; accepted July 28, 2004; published online August 31, 2004 Summary Pyrococcus species are hyperthermophilic mem- relatively rapidly at temperatures above 90 °C and produce ° bers of the order Thermococcales, with optimal growth tem- H2S from elemental sulfur (S ) (Zillig et al. 1987). Two Pyro- peratures approaching 100 °C. All species grow heterotrophic- coccus species, P. furiosus (Fiala and Stetter 1986) and ° ally and produce H2 or, in the presence of elemental sulfur (S ), P. woesei (Zillig et al. 1987), were isolated from marine sedi- H2S. Pyrococcus woesei and P.furiosus were isolated from ma- ments at a Vulcano Island beach site in Italy. They have similar rine sediments at the same Vulcano Island beach site and share morphological and physiological characteristics: both species many morphological and physiological characteristics. We re- are cocci and move by means of a tuft of polar flagella. They port here that the rDNA operons of these strains have identical are heterotrophic and grow optimally at 95–100 °C, utilizing sequences, including their intergenic spacer regions and part of peptides as major carbon and nitrogen sources.
    [Show full text]
  • 2236.Full.Pdf
    2236 The Journal of Experimental Biology 215, 2236-2246 © 2012. Published by The Company of Biologists Ltd doi:10.1242/jeb.065516 RESEARCH ARTICLE Flexibility in thermoregulatory physiology of two dunnarts, Sminthopsis macroura and Sminthopsis ooldea (Marsupialia; Dasyuridae) Sean Tomlinson1,*, Philip C. Withers1 and Shane K. Maloney2 1School of Animal Biology, Faculty of Natural and Agricultural Sciences and 2School of Anatomy, Physiology and Human Biology, Faculty of Life and Physical Sciences, The University of Western Australia, Crawley 6009 WA, Australia *Author for correspondence ([email protected]) SUMMARY Stripe-faced dunnarts (Sminthopsis macroura) and Ooldea dunnarts (S. ooldea) were acclimated for 2weeks to ambient temperature (Ta) regimes of 12–22°C, 18–28°C and 25–35°C, and then measured for standard, basal (BMR) and maximum (MMR) metabolic rate using flow-through respirometry. Sminthopsis macroura maintained a stable body temperature under all experimental Ta and acclimation regimes. Although its BMR was not statistically different between the three acclimation regimes, the lower end of the thermoneutral zone (TNZ) shifted from 30°C under the 18–28°C and 12–22°C acclimation regimes to 35°C under the 25–35°C acclimation regime. MMR increased significantly at the cooler acclimation regimes. EWL increased at Ta35°C, compared with lower Ta, in all acclimation regimes, but an increase in evaporative water loss (EWL) at Ta10°C observed in cool acclimations did not occur at the 25–35°C regime. In contrast, S. ooldea had variable body temperature between experimental Ta in all acclimation regimes, but no acclimational shift in TNZ, which was between 30 and 35°C.
    [Show full text]
  • Expand Reverse Transcriptase from Escherichia Coli: AP401 (K) Deoxynucleoside-Triphosphate:DNA Deoxynucleotidyl-Transferase (RNA Directed) E.C.2.7.7.49
    For life science research only. Not for use in diagnostic procedures. Expand Reverse Transcriptase from Escherichia coli: AP401 (k) Deoxynucleoside-triphosphate:DNA deoxynucleotidyl-transferase (RNA directed) E.C.2.7.7.49 Cat. No. 11 785 826 001 1 000 U y Version 13 Cat. No. 11 785 834 001 5 000 U Content version: March 2020 Store at Ϫ15 to Ϫ25°C Product overview General handling instructions Pack content RNA preparation For high quality eucaryotic mRNA preparations it is Vial Content necessary to minimize the activity of RNases liberated Expand Reverse • 1000 U (Cat. No. 11 785 826 001) during cell lysis by using inhibitors of RNases or meth- ods that disrupt cells and inactivate RNases simultane- Transcriptase • 5000 U (Cat. No. 11 785 834 001) ously. A good overview of the methods is given in (4) as Expand Reverse cDNA synthesis buffer (first-strand) well as in (5). Suitable reagents for the isolation of total Transcriptase 250 mM Tris-HCl, 200 mM KCl, 2) RNA/or mRNA are the mRNA Isolation Kit and TriPure Buffer, 5 × conc. 25 mM MgCl2, 2.5% Tween 20 Isolation Reagent. (v/v), pH 8.3 (25°C). Consequently, it is also important to avoid the acciden- Dithiothreitol 100 mM tal introduction of trace amounts of RNases from other (DTT) solution potential sources in the laboratory, like glassware, plasticware, contaminating solutions and contamina- Storage and The undiluted enzyme is stable at –15 to –25°C through tion of the investigators hands. stability the expiration date printed on the label. The product is shipped on dry ice.
    [Show full text]
  • For Improvement of Nucleic Acid Synthesis and Ampli
    Europäisches Patentamt *EP001088891B1* (19) European Patent Office Office européen des brevets (11) EP 1 088 891 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.7: C12N 15/55, C12N 15/54, of the grant of the patent: C12N 9/22, C12N 9/12, 12.01.2005 Bulletin 2005/02 C12Q 1/68, C12P 19/34 (21) Application number: 99119268.3 (22) Date of filing: 28.09.1999 (54) Thermostable enzyme promoting the fidelity of thermostable DNA polymerases - for improvement of nucleic acid synthesis and amplification in vitro Thermostabiles Enzym welches die Genauigkeit thermostabiler DNA Polymerasen erhöht - zur Verbesserung der Nucleinsäuresynthese und in vitro Amplifikation Enzyme thermostable pour augmenter la fidélité de polymèrase d’ADN thermostable - pour l’amélioration de la synthèse des acides nucléiques et d’amplification in vitro (84) Designated Contracting States: • KLENK H-P ET AL: "The complete genome AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU sequence of the hyperthermophilic, MC NL PT SE sulphate-reducing archaeon Archaeoglobus fulgidus" NATURE,GB,MACMILLAN JOURNALS (43) Date of publication of application: LTD. LONDON, vol. 390, 27 November 1997 04.04.2001 Bulletin 2001/14 (1997-11-27), pages 364-370, XP002091622 ISSN: 0028-0836 (73) Proprietor: Roche Diagnostics GmbH • KALUZ S ET AL: "DIRECTIONAL CLONING OF 68298 Mannheim (DE) PCR PRODUCTS USING EXONUCLEASE III" NUCLEIC ACIDS RESEARCH,GB,OXFORD (72) Inventors: UNIVERSITY PRESS, SURREY, vol. 20, no. 16, 1 • Dr.Waltraud Ankenbauer January 1992 (1992-01-01), pages 4369-4370, 82377 Penzberg (DE) XP002072726 ISSN: 0305-1048 • Franck Laue • BOOTH P M ET AL: "ASSEMBLY AND CLONING 82396 Paehl-Fischen (DE) OF CODING SEQUENCES FOR NEUROTROPHIC • Dr.Harald Sobek FACTORS DIRECTLY FROM GENOMIC DNA 82377 Penzberg (DE) USING POLYMERASE CHAIN REACTION AND • Michael Greif URACIL DNA GLYCOSYLASE" 83661 Lenggries (DE) GENE,NL,ELSEVIER BIOMEDICAL PRESS.
    [Show full text]
  • Biotechnology Explorer™
    Biotechnology Explorer™ GAPDH PCR Module Instruction Manual Catalog #166-5010EDU explorer.bio-rad.com This kit is shipped at 4°C. Open immediately upon arrival and store reagents at –20°C within 2 weeks. Duplication of any part of this document permitted for classroom use only. Please visit explorer.bio-rad.com to access our selection of language translations for Biotechnology Explorer kit curricula. For technical support, call your local Bio-Rad office or, in the U.S., call 1-800-424-6723 Dear Educator: Amplification as the path to visualization of DNA Molecular biologists are faced with the classic needle in a haystack problem. Often we must find a few copies of a piece of DNA that code for a given gene in the haystack of DNA comprising the entire genome. Even if there are a thousand copies of the same piece of DNA it is often still difficult to locate them. However by selectively amplifying only that specific piece of DNA we can separate it from the rest of the DNA and visualize it. Once we can visualize the DNA, we can use the tools of molecular biology to open the whole vista of genetic engineering. We can work with the DNA to make discoveries in science, agriculture, and medicine. The method used to amplify the DNA is the polymerase chain reaction (PCR). PCR is capable of repeatedly doubling the amount of specific DNA. After many PCR cycles a million-fold or billion-fold times as much DNA is generated. Because of the increasing use of PCR in science it is important to provide students with an understanding of the basic principles and applications of PCR.
    [Show full text]
  • In Vitro and in Vivo Models Analyzing Von Hippel-Lindau Disease-Specific Mutations
    [CANCER RESEARCH 64, 8595–8603, December 1, 2004] In vitro and In vivo Models Analyzing von Hippel-Lindau Disease-Specific Mutations W. Kimryn Rathmell,1,3 Michele M. Hickey,1,2 Natalie A. Bezman,1 Christie A. Chmielecki,3 Natalie C. Carraway,3 and M. Celeste Simon1,2 1Abramson Family Cancer Research Institute and the Department of Cell and Molecular Biology, and 2Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, Pennsylvania; and 3Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina ABSTRACT transport and droplet formation (8, 9). Unregulated expression of the full complement of hypoxia response genes is surmised to contribute Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene much of the clinical and pathological phenotype of renal cell carci- cause tissue-specific tumors, with a striking genotype-phenotype correla- noma, which is characterized as a highly vascular, glycolytic, lipid- tion. Loss of VHL expression predisposes to hemangioblastoma and clear cell renal cell carcinoma, whereas specific point mutations predispose to rich tumor that can be associated with polycythemia (10, 11). Detailed pheochromocytoma, polycythemia, or combinations of hemangioblas- studies of the effects of VHL loss have identified the regulation of the toma, renal cell carcinoma, and/or pheochromocytoma. The VHL protein hypoxia response pathway via the proteasomal degradation of HIF1␣ (pVHL) has been implicated in many cellular activities including the and HIF2␣ as a major activity of the VHL protein (pVHL; refs. hypoxia response, cell cycle arrest, apoptosis, and extracellular matrix 12–15). The pVHL acts as the substrate receptor for an E3 ubiquitin Ϫ Ϫ remodeling.
    [Show full text]
  • (10) Patent No.: US 8715987 B2
    US008715987B2 (12) United States Patent (10) Patent No.: US 8,715,987 B2 Johnson et al. (45) Date of Patent: May 6, 2014 (54) SOLUBILIZED PHOSPHOLIPIDS FOR WO WOO 132887 A1 5, 2001 STABILIZING NUCLECACID WO WO2O080 13885 A2 1, 2008 POLYMERASES WO WO2O08077O17 A2 6, 2008 OTHER PUBLICATIONS (75) Inventors: Donald Johnson, Brookline, MA (US); Thomas C. Evans, Jr., Topsfield, MA Manual Translation CN 101570792A, Nov. 2009.* Barnes, WM. “The fidelity of Taq polymerase catalyzing PCR is (US) improved by an N-terminal deletion”. Gene, 112(1):29-35, 1992. Cann, et al., “A heterodimeric DNA polymerase: evidence that mem (73) Assignee: New England Biolabs, Inc., Ipswich, bers of Euryarchaeota possess a distinct DNA polymerase.”. Proc. MA (US) Natl. Acad. Sci. USA,95: 14250-5, 1998. Capitani.etal, “Effect of phosphatidylcholine vesicles on the activity (*) Notice: Subject to any disclaimer, the term of this of DNA polymerase-O.", Mol and Cell Biochem 27:137-138, 1979. patent is extended or adjusted under 35 Chien, et al., “Deoxyribonucleic acid polymerase from the extreme U.S.C. 154(b) by 0 days. thermophile Thermus aquaticus”,Journal of Bacteriology, 127:1550, 1976. Diaz, et al., "Accuracy of replication in the polymerase chain reaction. (21) Appl. No.: 13/450,549 Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase.”. Brazilian Journal of Medical (22) Filed: Apr. 19, 2012 and Biological Research, 31:1239, 1998. Eckert , et al. “The Fidelity of DNA Polymerases used in the (65) Prior Publication Data polymerase chain reactions'. Oxford University Press, New York, US 2012/O282669 A1 Nov.
    [Show full text]