In Vitro and in Vivo Models Analyzing Von Hippel-Lindau Disease-Specific Mutations

[CANCER RESEARCH 64, 8595–8603, December 1, 2004] In vitro and In vivo Models Analyzing von Hippel-Lindau Disease-Specific Mutations

W. Kimryn Rathmell,1,3 Michele M. Hickey,1,2 Natalie A. Bezman,1 Christie A. Chmielecki,3 Natalie C. Carraway,3 and M. Celeste Simon1,2 1Abramson Family Cancer Research Institute and the Department of Cell and Molecular Biology, and 2Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, Pennsylvania; and 3Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina

ABSTRACT transport and droplet formation (8, 9). Unregulated expression of the full complement of hypoxia response genes is surmised to contribute Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene much of the clinical and pathological phenotype of renal cell carci- cause tissue-specific tumors, with a striking genotype-phenotype correla- noma, which is characterized as a highly vascular, glycolytic, lipid- tion. Loss of VHL expression predisposes to hemangioblastoma and clear cell renal cell carcinoma, whereas specific point mutations predispose to rich tumor that can be associated with polycythemia (10, 11). Detailed pheochromocytoma, polycythemia, or combinations of hemangioblas- studies of the effects of VHL loss have identified the regulation of the toma, renal cell carcinoma, and/or pheochromocytoma. The VHL protein hypoxia response pathway via the proteasomal degradation of HIF1␣ (pVHL) has been implicated in many cellular activities including the and HIF2␣ as a major activity of the VHL protein (pVHL; refs. hypoxia response, cell cycle arrest, apoptosis, and extracellular matrix 12–15). The pVHL acts as the substrate receptor for an E3 ubiquitin Ϫ Ϫ remodeling. We have expressed missense pVHL mutations in Vhl / ligase complex and targets HIF1␣ and HIF2␣ for degradation under murine embryonic stem cells to test genotype-phenotype correlations in normal oxygen (O2) tension (16). The O2-dependent regulation of euploid cells. We first examined the ability of mutant pVHL to direct HIF␣ (referring to either HIF1␣ or HIF2␣) is imparted by posttrans- degradation of the hypoxia inducible factor (HIF) subunits HIF1␣ and lational hydroxylation of specific prolines located in the HIF␣ O - HIF2␣. All mutant pVHL proteins restored proper hypoxic regulation of 2 ␣ HIF1␣, although one VHL mutation (VHLR167Q) displayed impaired bind- dependent degradation domain by HIF prolyl hydroxylases (17–19). ␣ ␣ ing to Elongin C. This mutation also failed to restore HIF2␣ regulation. In When O2 levels drop, HIF1 and HIF2 accumulate (5). In the separate assays, these embryonic stem cells were used to generate terato- absence of pVHL, HIF1␣ and HIF2␣ are maximally stabilized in mas in immunocompromised mice, allowing independent assessment of the presence of atmospheric O2 levels and show no additional O2- the effects of specific VHL mutations on tumor growth. Surprisingly, dependent accumulation (13). Y112H teratomas expressing the VHL mutant protein displayed a growth We previously reported that VhlϪ/Ϫ murine embryonic stem cells ␣ Ϫ Ϫ disadvantage, despite restoring HIF regulation. Finally, we observed predictably disrupt the hypoxia response pathway (20). In Vhl / increased microvessel density in teratomas derived from VhlϪ/Ϫ as well as embryonic stem cells, HIF1␣ and HIF2␣ are highly expressed under VHLY112H, VHLR167Q, and VHLR200W embryonic stem cells. Together, these observations support the hypothesis that pVHL plays multiple roles in the normoxic conditions, and protein levels are not additionally stabilized cell, and that these activities can be separated via discrete VHL point in response to O2 deprivation. Furthermore, Vhl deletion gives rise to mutations. The ability to dissect specific VHL functions with missense highly glycolytic cells, as would be expected in cells with elevated Ϫ Ϫ mutations in a euploid model offers a novel opportunity to elucidate the levels of glycolytic enzymes. When Vhl / embryonic stem cells are activities of VHL as a tumor suppressor. grown in a teratoma model system the tumors display a highly vascular phenotype, although with a surprising reduction in tumor volume (20). INTRODUCTION The spectrum of tumors arising in individual VHL patients strongly Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene correlates with specific VHL mutations (21, 22), and the syndrome has give rise to a variety of tumors and other abnormalities in affected been divided into type 1 and type 2 disease based on predisposition for individuals including renal clear cell carcinoma, pheochromocytoma, pheochromocytoma (Fig. 1A). Type 1 disease is characterized by hemangioblastoma, and polycythemia (1). Some of these disease mutations, which delete, silence, or destabilize the VHL gene, and this manifestations derive from the unregulated expression of the hypoxia patient group has a low frequency of pheochromocytoma (23). Type inducible factor (HIF) transcription complex. HIF is a heterodimer 2 disease is characterized by a strong predisposition for pheochromo- composed of a highly regulated ␣ subunit (either HIF1␣ or HIF2␣/ cytoma, and it is additionally subdivided into 2A (pheochromocy- EPAS1) and a ubiquitously expressed ␤ subunit (HIF1␤/ARNT; refs. toma, hemangioblastoma, and low risk for renal cell carcinoma), 2B 2–4). This complex, in cooperation with the coactivators cAMP- (pheochromocytoma, hemangioblastoma, and high risk for renal cell responsive element binding protein and p300, activates transcription carcinoma), and 2C (pheochromocytoma only). Molecular analysis of via a hypoxia response element in the promoter or enhancer regions of these mutations shows that type 2A mutants and type 2C mutants many hypoxia-responsive genes. Genes transcriptionally activated by maintain interaction with the ubiquitin ligase complex, whereas 2B HIF include factors involved in angiogenesis, glucose transport, gly- mutants are deficient in this interaction (23). In addition, homozygos- colysis, and erythropoiesis as recently reviewed (5–7), and lipid ity for a VHL mutation in the extreme COOH-terminal domain has been associated with a highly penetrant congenital form of polycy- Received 4/22/04; revised 9/8/04; accepted 10/1/04. themia termed Chuvash Polycythemia (24, 25). No tumor predispo- Grant support: NIH Grant K08-CA098410 and a V Foundation Scholar Award sition has yet been identified with this mutation. (W. Rathmell), Howard Hughes Medical Institute Predoctoral Fellowships and the Ruth L. Kirschstein National Research Service Award (M. Hickey and N. Bezman), and NIH In addition to VHL disease, mutations in VHL have been identified Grant HL66130 and the Howard Hughes Medical Institute (M. Simon). in the majority of patients with sporadic clear cell renal cell carcinoma The costs of publication of this article were defrayed in part by the payment of page (26–28), which constitutes the majority of carcinomas of the kidney. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. This form of renal cell carcinoma is characterized by a highly vascular Requests for reprints: M. Celeste Simon, University of Pennsylvania, Abramson cystic or solid mass comprised of nests of tumor cells containing Family Cancer Research Institute, BRB II/III, Room 450, Philadelphia, PA 19104. Phone: (215) 746-5526; Fax: (215) 746-5511; E-mail: [email protected]. abundant clear cytoplasm consisting of glycogen and neutral lipid. ©2004 American Association for Cancer Research. Although loss of VHL is not a transforming event in such cells, VHL 8595

Fig. 1. Embryonic stem cell expression of representative VHL missense mutations. A. VHL disease subtypes, characteristic patterns of disease, and mutations used in this analysis to represent each subtype of VHL disease. B, schematic of VHL gene. The hemagglutinin tag is located at the NH2 terminus as indicated. Important residues are identified, as are the known interaction domains. C, human pVHL immunoblot. Protein extracts from embryonic stem cells expressing the indicated version of pVHL, pVHL null, and endogenous mouse pVHL were compared with in vitro translated human pVHL protein. Note the lack of signal in the endogenous pVHL extract from Vhlϩ/Ϫ extracts. D, murine pVHL immunoblot. Protein extracts from pVHL wild-type, heterozygous, and null embryonic stem cells. (HA, hemagglutinin)

mutations have been identified in renal cysts and dysplastic lesions, ally, the mutation associated with VHL type 2B disease (VHLR167Q) strongly suggesting they represent an early event in renal tumorigen- uniquely conferred impaired interaction with Elongin C as well as a ␣ ␣ esis (29). Furthermore, renal cell carcinoma cells regain O2-regulated disruption of HIF2 hypoxia responsive regulation, whereas HIF1 gene expression (15, 30) and lose their transformed phenotype on protein regulation remained intact. Additionally, a mutant associated reintroduction of wild-type pVHL activities (31, 32). with VHL type 2A disease (VHLY112H) showed a suppressive growth Whereas VHL clearly regulates the hypoxia response pathway, the effect similar to that observed with Vhl loss in teratomas. Consistent cohort of mutations giving rise to type 2C disease has not been found with previous observations, we detected no impact on the hypoxia to affect HIF regulation (33). In fact, VHL disease-associated pheo- response pathway by a mutant associated with VHL type 2C disease chromocytoma has been speculated to develop as a result of a gain of (VHLL188V), in which patients are only susceptible to pheochromocy- function of pVHL, as this tumor type is almost exclusively observed toma (33). All of the mutants in this study showed defective deposi- in the setting of missense mutations (34). Furthermore, several activ- tion of fibronectin, extending previous observations that extracellular ities have been ascribed to pVHL in addition to the regulation of the matrix remodeling is perturbed by most pathologically significant hypoxia response pathway and were recently reviewed (35), including VHL mutations. Finally, the mutation associated with the newest potential function in cell cycle regulation (36–38), cell growth (39, subtype of VHL disease, Chuvash Polycythemia (VHLR200W), con- 40), cytoskeletal structure (41, 42), and extracellular matrix deposition ferred regulation of the hypoxia response pathway. These results show (43). In this report we take advantage of genotype-phenotype corre- the use of a novel model system able to distinguish the effects of Ϫ/Ϫ lation, and we have complemented Vhl embryonic stem cells with pathogenic mutations associated with different manifestations of VHL a selected group of mutations representing the various subtypes of disease. These findings provide additional support for the hypothesis VHL disease, including Chuvash Polycythemia, to dissect potentially that pVHL has multiple cellular activities, and that activities in addi- distinct activities of pVHL that are intrinsic to tissue-specific tumor tion to the regulation of HIF1␣ are integral to VHL-mediated tumor types seen in the hereditary disease. Although this system is not an cell growth and tumor vascularization. absolute recreation of a tumor environment, this model system offers several tangible advantages for the study of pVHL function. First, embryonic stem cells permit examination of pVHL activity in euploid MATERIALS AND METHODS cells free of the competing mutations intrinsic to tumor cell lines. Second, embryonic stem cells permit the examination of three-dimen- Cell Lines. All of the embryonic stem cells were cultured in DMEM-H sional growth in a teratoma model system. Finally, embryonic stem (Invitrogen, Carlsbad, CA) supplemented with 15% FBS, 1% nonessential amino cells have uses beyond the scope of this report, including multiple acids, 2% L-glutamine, 1% penicillin-streptomycin, leukemia inhibitory factor avenues of in vitro differentiation and the opportunity to generate (ESGRO, Life Technologies, Inc., Rockville, MD), and 2-mercaptoethanol (In- Ϫ/Ϫ chimeric animals to model VHL disease. Previous mouse models of vitrogen). Embryonic stem cells were derived from a Vhl clone described VHL disease have been hampered by lethality or severe vascular previously (20) by transfection of linearized vector containing an hemagglutinin- tagged human VHL cDNA construct (a generous gift of Dr. William G. Kaelin, phenotypes (44–47). Harvard Medical School, Boston, MA) driven by an EF1␣ promoter containing Using missense mutations designed to represent distinct disease either wild-type VHL sequence or the following point mutations: Tyr112His, patterns and exploit the effects of limited disruption of pVHL activity, Arg167Gln, Leu188Val, or Arg200Trp. Generation of missense mutations was we propose to discriminate the activities of various VHL missense done with a PCR-based method described previously (48) with the primer pairs mutations in a variety of biological and functional assays. In the (Y112Hf, CACGAGGTCACCTTTGGCTCTTCAGAG; Y112Hr: GCTGTG- context of this unique model, we observed, surprisingly, that all of the GATGCGGCGGCCCGTG; R167Qf, AGAGCCTAGTCAAGC-CTGAGAA- mutant forms of pVHL restored HIF1␣ hypoxic regulation. Addition- TTA; R167Qr, GGACAACCTGGAGGCATCGCTCTTT; L188Vf, GTGGAA- 8596

GACCACCCAAATGTGCAGA; L188Vr, ATCTTCGTAGAGCGACCTGA-C- RESULTS GATG; R200Wf, TGGCTGACACAGCGCATTGCAC; and R200Wr, CTC- Ϫ/Ϫ CAG-GTCTTTCTGCACATTTGGG). Clones were grown in hygromycin selec- The pVHL Expression in Vhl Embryonic Stem Cells. Ϫ/Ϫ tion media and screened by Southern blotting for integration. The construct is Vhl embryonic stem cells generated as described previously (20) depicted in Fig. 1B, which also shows the location of each point mutation. were transfected with plasmid encoding a hemagglutinin-tagged hu- Immunoblot Analysis and Immunoprecipitation. Immunoblots for man wild-type or mutant VHL cDNA representing each subtype of HIF1␣ and HIF2␣ were done as described previously (20). Whole cell extracts VHL disease (Fig. 1, A and B). Integration was confirmed by Southern were prepared by lysis in 1% NP40 lysis buffer and quantified by BCA protein blotting (data not shown). Immunoblots were done to show that the assay (Pierce, Rockford, IL) for the HIF1␣ analysis. Nuclear extracts were selected clones expressed levels of human pVHL protein (Fig. 1C) prepared by a 400 mmol/L NaCl extraction and quantitated by Bradford comparable with that of endogenous expression of the murine protein protein assay (Bio-Rad, Hercules, CA) for the HIF2␣ analysis. Twenty-five in wild-type or heterozygous embryonic stem cells (Fig. 1D). Fig. 1D micrograms of protein were loaded for the VHL immunoblots, 50 ␮g of protein shows expression of endogenous pVHL in wild-type and heterozy- was loaded for the HIF␣ immunoblots. Coimmunoprecipitation was done with gous clones as detected by a murine pVHL-specific antibody. Forty- the ProFound Mammalian hemagglutinin tag IP/CoIP kit according to the eight transgenic clones were isolated for each mutation, and clones manufacturer’s specifications (Pierce). Separation was done on 8 to 10% SDS with matched minimal levels of expression were selected to approx- polyacrylamide gel and transferred to ECL nitrocellulose (Amersham, Pisca- imate the expression of endogenous murine pVHL and to avoid taway, NJ). Equal loading and even transfer was confirmed by reversible effects of overexpression (Fig. 1, C and D). staining with Ponceau S. Primary antibodies were used at a dilution of 1:1,000 Regulation of HIF1␣ Expression Is Restored by pVHL Mutant for murine pVHL (Santa Cruz Biotechnology, Santa Cruz, CA), 1:2,000 for ␣ ␣ Proteins. Four representative clones of each VHL disease subtype HIF1 (Cayman Chemical, Ann Arbor, MI), 1:2,000 for HIF2 (Novus ␣ Biologicals, Littleton, CO), 1:1,000 for human pVHL (BD PharMingen, San were analyzed for expression of HIF1 protein after growth for 4 Diego, CA), and 1:500 for Elongin C (Santa Cruz Biotechnology). Secondary hours at normoxia (21% O2) or hypoxia (1.5% O2). Extracts from ϩ/Ϫ ␣ antibodies were horseradish peroxidase conjugated, detected by ECL (Amer- Vhl cells had low normoxic HIF1 expression, which increased Ϫ/Ϫ sham), and exposed to autoradiograph film (Eastman Kodak, Rochester, NY). after hypoxia treatment. In contrast, Vhl cells showed high nor- Scanning densitometry was done with Scion software (Scion, Frederick, MD). moxic levels of HIF1␣ without additional induction after hypoxia Ϫ/Ϫ Electrophoretic Mobility Shift Assay. Gel shift analysis was done for (Fig. 2A). Reconstitution of the Vhl cells with wild-type human HIF1␣ on nuclear extracts with a radiolabeled probe incorporating the hypoxia VHL cDNA (VHLwt) restored normoxic suppression and hypoxic response element of the erythropoietin promoter as described previously (20). induction of HIF1␣ expression. Of note, each of the mutants also Experiments were also done with vascular endothelial growth factor (VEGF) restored normoxic regulation of HIF1␣. This observation was con- hypoxia response element sequence with identical results. HIF1␣ antibody firmed in multiple independently derived clones encompassing a wide (Novus Biologicals) was added to control lanes to show HIF1␣ participation in range of expression with minor clonal variation (data not shown). This the shifted complex. The bands were detected with phosphoimager analysis somewhat surprising result is in contrast to previous evaluations of the (Molecular Dynamics, Sunnyvale, CA). VHLY112H and VHLR167Q mutations, which exhibited dysregulation of ELISA. Secretion of soluble VEGF was detected by ELISA (R&D Sys- HIF1␣ in human renal cell carcinoma cell cultures (23). Furthermore, tems, Minneapolis, MN), according to the manufacturer’s instructions. Con- VHLR200W has been correlated with a subtle increase in normoxic ditioned media was analyzed after 16-hour incubation of linearly growing cells HIF1␣ expression but preserved hypoxic induction in human cells at either 1.5% O or ambient O tension. Duplicate analysis was done on 2 2 (24). However, our results are consistent with previous observations triplicate cultures for all of the sample conditions. Colorimetric change was that type 2C mutations (including VHLL188V) had no effect on hypoxic measured at 495 nmol/L with a Becton-Dickinson ELISA plate reader. regulation of HIF1␣ (33). Northern Blot Analysis. Northern analysis of total RNA was done on ␣ samples prepared after 16 hours of either hypoxia (1.5% O ) or normoxia To confirm the observation that HIF1 regulation was restored in 2 ␣ treatment. RNA was prepared in TRIzol according to the manufacturer’s the VHL mutant clones and assay levels of active HIF1 , nuclear recommendations (Life Technologies, Inc.). Samples were separated by 1% extracts from two independently derived clones of each mutant were denaturing agarose gel electrophoresis and passively transferred to Hybond tested for binding activity to an hypoxia response element derived n ϩ nitrocellulose membrane (Amersham) in 10ϫ SSC. Blots were probed from the erythropoietin promoter sequence. The wild-type comple- with RNA specific oligos for VEGF, phosphofructokinase, aldolase A, and mented clones, and each of the mutants restored regulation of HIF1␣ ␣-actin labeled with 32P by High Prime (Boehringer Mannheim, Mannheim, DNA binding activity (Fig. 3C). These results were confirmed with a Germany). After UV fixation with 1200 Joules (Stratalinker; Stratagene, second radiolabeled probe containing the hypoxia response element La Jolla, CA), the membrane was probed sequentially with radiolabeled probes derived from the VEGF promoter sequence (data not shown). Anti- after stripping in boiling 0.5% SDS. Signals were detected by phosphoimager body directed against HIF1␣ was added to control lanes to show analysis (Molecular Dynamics). participation of HIF1␣ in hypoxia response element binding by “su- Teratoma Analysis. For the generation of teratomas, 5 ϫ 106 cells in 100 pershifting” the complex. Each of the oligonucleotides used for ␮L sterile PBS were injected s.c. between the shoulder blades of NIH III EMSA are specific for HIF1␣ binding,4 and addition of an antibody immunodeficient mice (Jackson Laboratories, Bar Harbor, ME, and Charles to HIF2␣ did not result in a mobility shift of the DNA binding River Laboratories, Wilmington, MA). The tumors were permitted to grow for complex (data not shown). These results suggest that hypoxia re- 21 days and were monitored for tumor growth. The tumors were then har- sponse element binding assays exclusively detect HIF1 complex for- vested, weighed, formalin fixed, and embedded in paraffin. Paraffin sections mation (and not HIF2 complexes). Although embryonic stem cells were stained by standard immunohistochemistry techniques with the following express adequate levels of HIF2␣ protein, it is nonfunctional as a primary antibodies: Ki67 (Novocastra Laboratories, Ltd., Newcastle upon DNA binding protein (8). Tyne, UK), cleaved caspase 3 (Cell Signaling, Beverly, MA), Fibronectin (Cell ␣ Signaling), VEGF (Neomarkers, Fremont, CA), CD34 (Cal Biochemicals, HIF2 Expression Is Dysregulated in Type 2B Mutant Clones. wt L188V Darmstadt, Germany), CD31 (Neomarkers), and VWF (Dako, Carpinteria, Embryonic stem cells complemented with VHL or the VHL and R200W ␣ CA). Secondary detection was done with biotinylated mouse, rabbit, or goat VHL mutants suppressed HIF2 protein expression under nor- specific antibodies, ABC enhancement kit (Vector, Burlingame, CA), and moxic conditions and produced increased levels of HIF2␣ on hypoxic DAB detection reagent (Vector). Dilute hematoxylin, or cresol green in the case of CD31 stain, was used for counterstain (Vector). 4 B. Keith and M. C. Simon, unpublished observations. 8597

Fig. 2. Effects of VHL mutation on HIF1␣ and HIF2␣ expression and interactions with Elongin C. A, HIF1␣ immunoblot. The top of two bands illus- trated shows HIF1␣ protein; the bottom is a nonspecific band of slightly smaller size. Paired lanes represent extracts prepared from embryonic stem cells expressing the indicated form of pVHL. B, HIF2␣ immunoblot. Each panel represents two independently derived embryonic stem cell clones expressing the form of pVHL indicated at the right. *, a nonspecific protein detected as a loading control. C, HIF1␣ electrophoretic mobility shift analysis. Embryonic stem cell clones expressing the form of pVHL at the tops of the panels are grouped in triplicates. First lane, normoxia treatment; second lane, hypoxia treatment; third lane, hypoxia treatment and HIF1␣ antibody supershift. *, a nonspecific DNA binding protein showing controlled loading. D, Elongin C coimmunoprecipitation. He- magglutinin immunoprecipitates from each indicated cell line immunoblotted for VHL and Elon- gin C. Relative capture of Elongin C compared with pVHL. (H, hypoxia treatment; WT, wild-type)

stimulation. Clones expressing the mutant protein representing type Unique among the panel of mutants studied in this assay, dysregu- 2A VHL disease (VHLY112H) showed a variable pattern of HIF2␣ lation of HIF2␣ expression was consistently observed in extracts from regulation. VHLY112H clones exhibited at least partial restoration of four independently derived clones expressing the VHL disease type hypoxic regulation. This mutation was unique among the panel in 2B mutant (VHLR167Q), two of which are shown in Fig. 2B. These showing HIF2␣ regulation that seemed to be dose-dependent over a clones showed elevated expression of HIF2␣ under normoxia, with no wide range of pVHL expression. Independently derived clones ex- additional induction in protein levels at 1.5% O2. This effect was pressing VHLY112H (Fig. 2B) showed elevated HIF2␣ levels under observed across many expression levels of pVHL. In contrast to the normoxia, which were additionally induced in response to hypoxia. regulation of HIF1␣ observed in these mutant clones, the impaired

Fig. 3. HIF target gene expression in cultured embryonic stem cells. A, VEGF ELISA. Ⅺ, normoxia conditions; f, hypoxia conditions. Bars, ϮSEM. B, Northern blot analysis of VEGF, phosphofructokinase, Aldolase A, and tubulin as a loading control. VHL genotype of each embryonic stem cell clone indicated at top. (WT, wild-type; H, hypoxia treatment; PFK, phosphofructokinase)

8598

Fig. 4. Teratoma growth effects of VHL missense mutations. A, teratoma mass. The tumor genotype is indicated at the bottom of each bar. Mass of the excised tumor is shown relative to the Vhlϩ/Ϫ standard. Number of tumors included in this analysis is shown above each bar. Histology of teratomas. B. H&E stained teratomas were visualized at 10ϫ magnification, and the number of enlarged vascular lesions was counted on 10 to 15 random fields. C, H&E staining of teratomas. Vhlϩ/Ϫ, VhlϪ/Ϫ, VHLY112H, VHLR167Q, VHLL188V, and VHLR200W are indicated on each panel. All images are at 20ϫ magnification. Arrows indicate the location of hemangiomas. Bars, ϮSEM. (WT, wild-type)

␣ R200W O2-dependent regulation of HIF2 is the expected result for this VHL showed an intermediate level of normoxic VEGF expres- mutation based on previous investigations of the hypoxia response sion but preserved hypoxic induction (Fig. 3A). pathway in cells with mutations affecting the ␤ domain of pVHL (23). VEGF protein expression determined by ELISA was confirmed by From these observations, we conclude that the forced expression of Northern analysis. Each of the mutants rescued VEGF transcriptional human VHLR167Q results in the exclusive disruption of HIF2␣ regu- regulation similar to VHLwt. Additional targets of the HIF transacti- lation. A nonspecific band shown in Fig. 2B corresponding to the vator complex were also tested. Regulation of phosphofructokinase R167Q lanes displayed for the VHL mutant showed equal loading. This and aldolase A both showed dysregulated expression in VhlϪ/Ϫ cells, control is representative of loading controls for each of the other but low normoxic expression and hypoxic induction were restored on mutants (data not shown). expression of VHLwt and VHL mutants (Fig. 3B). These observations To determine whether the human pVHL mutants produce this effect paralleled our findings of preserved regulation of HIF1␣ with each on HIF regulation as a result of species-specific effects on the forma- mutant and show an intact hypoxia response in this in vitro system. tion of the proteasomal complex, we subjected the cells to coimmu- Activation of each of these HIF target genes was not impacted by noprecipitation with the hemagglutinin tag on the mutant pVHL as an elevated normoxic expression of HIF2␣ seen in mutants VHLY112H immunologic target. Immunoprecipitated proteins were electrophore- and VHLR167Q. This in vitro finding is consistent with recent evidence sed and probed for presence of pVHL and Elongin C. Fig. 2D displays that HIF2␣ is not functionally active in embryonic stem cells in the pVHL present only in immunoprecipitates from complemented culture (8). clones and shows that VHLR167Q is the sole mutant with reduced VHL Mutants Restore Tumor Growth in a Teratoma Assay. interaction with Elongin C. The relative amounts of Elongin C to VHL The teratoma model provides a differentiated in vivo system in which complex are displayed after scanning densitometry measurements. HIF2␣ has been observed to have activity.5 Previously, we showed VHL Mutants Restore HIF1␣ Signaling Pathways. The hypoxia response pathway is regulated via rapid stabilization of the ␣ subunits that loss of Vhl in embryonic stem cells results in decreased tumor size of the HIF complex under conditions of low O . These transcription in a teratoma assay. This surprising effect on growth from loss of a 2 wt factors in turn activate the expression of a number of genes important tumor suppressor was reversed on VHL expression (20). Here we observed the effect of complementing VhlϪ/Ϫ embryonic stem cells in the cellular response to O2 deprivation. Notably, VEGF expression is induced by the activity of these transcription factors. Secreted with mutated versions of VHL on teratoma growth. Data are shown for VEGF, measured by ELISA, correlated with HIF1␣ protein levels. tumor mass after 3 weeks of growth (Fig. 4A). The teratomas gener- Y112H Vhlϩ/Ϫ clones showed low-level secretion of VEGF under normoxic ated from embryonic stem cells expressing VHL showed a gen- conditions, with a significant increase after 16-hour hypoxia treatment eral trend toward the development of smaller tumors as was observed Ϫ/Ϫ Ϫ/Ϫ (1.5% O2). Vhl clones expressed high levels of VEGF at 21% O2 for Vhl cells. Increased numbers of tumors were generated with and did not show additional induction on hypoxic stimulation. In this mutation to enhance the significance of this trend and to make contrast to the VhlϪ/Ϫ parental clone, each mutant form of pVHL restored VEGF regulation. Clones expressing mutants VHLL188V and 5 K. Covello, M. C. Simon, and B. D. Keith, submitted for publication. 8599

Fig. 5. Ki67 staining for cellular proliferation. A, teratoma sections from Vhlϩ/Ϫ, VhlϪ/Ϫ, VHLY112H, VHLR167Q, VHLL188V, and VHLR200W. B, area of 20ϫ field with positive Ki67 nuclear stain. VHL genotype of each teratoma is indicated below the bar. Bars, ϮSEM.

available more tumor tissue for subsequent analysis. Additionally, the and von Willebrand Factor were positive for the cells lining the histology of the teratomas displayed a striking correlation between blood-filled cavities, although high-power examination suggested a pVHL mutation and the formation of large blood-filled cavities lined morphologically abnormal endothelial layer (Fig. 6, A–F; data not by epithelial cells characteristic of hemangiomas (Fig. 4, C–H). The shown). These immunostains detected both large and small vessels appearance of these lesions was quantified by counting their number throughout the masses. Quantification of the microvessel density in 10 random low-power fields from three independent teratomas for revealed increased microvessel density for VhlϪ/Ϫ tumors and the each mutation (Fig. 4B). Teratomas derived from VhlϪ/Ϫ, VHLY112H, mutants VHLY112H, VHLR167Q, and VHLR200W (Fig. 6G). This pattern VhlR167Q, and VHLR200W embryonic stem cells showed a high inci- of increased microvessel density is consistent with the numbers of dence of these lesions. It should be noted, however, that VhlϪ/Ϫ and hemangiomas observed in the teratomas and correlates well with VHL VHLY112H teratomas seemed to have a higher proportion of very large mutations associated with development of renal cell carcinoma or hemangiomas, and this was not accounted for in the quantitation. polycythemia. Interestingly, this pattern of vascularity does not cor- To address the disparate growth trends for VhlϪ/Ϫ and VHLY112H relate with dysregulated HIF␣ expression, suggesting a potential teratomas, we analyzed teratomas for proliferative activity by immu- alternate mechanism for angiogenesis in this model. nostain for Ki67 expression. A small but reproducible proliferative VEGF Protein Expression in Teratomas. VEGF immunohisto- advantage was noted for genotypes associated with larger tumors (Fig. chemical staining of the teratomas revealed dense VEGF staining of 5, A–G). Evaluation of activated caspase 3 expression revealed no VhlϪ/Ϫ sections but low level staining for Vhlϩ/Ϫ, VHLY112H, striking difference among any teratomas, ruling out a significant VHLR167Q,orVHLL188V teratomas (Fig. 7). This result interestingly apoptotic phenotype in the smaller tumors (data not shown). We have correlates directly with the in vitro embryonic stem cell findings previously reported on both activated caspase 3 and terminal de- regarding HIF1␣ dysregulation. Parallels to HIF2␣ could not be oxynucleotidyl transferase-mediated nick end labeling assay for the drawn in this differentiated system. Furthermore, the VEGF expres- Vhlϩ/Ϫ and VhlϪ/Ϫ tumors and showed no significant difference sion pattern observed by immunostaining does not correlate with between the two types of teratomas (20). These results corroborate our observed differences in tumor growth characteristics, microvessel previous observations in VhlϪ/Ϫ teratomas that loss of a putative density, or the hemangiomas noted in a subset of the teratomas, tumor suppressor gene causes a proliferative defect. Additionally, a suggesting that alternate activities of pVHL are important for the mutant that does not cause the same HIF dysregulation, VHLY112H, observed phenotypes. From this data we can conclude that VEGF is also caused diminished proliferation. Finally, hemangiomas were ob- highly expressed in VhlϪ/Ϫ teratomas, which may account for the served in all of the mutants except the type 2C mutant VHLL188V. vascular nature of these teratomas. However, the vascularity of the VHL Mutant Teratomas Display Marked Vascularity Not Cor- other mutant clones cannot be directly correlated to tissue expression related with VEGF Expression. One remarkable histologic obser- of VEGF-165, although expression of other isoforms of VEGF or vation was that the VhlϪ/Ϫ, VHLY112H, and VHLR167Q teratomas other angiogenic factors may play a role in the vascular phenotype. seemed to be more hemorrhagic, with large blood-filled cavities, as Fibronectin Deposition Is Decreased in All VHL Mutants. Pre- compared with the other teratomas (Fig. 4, B–D). Immunostains for vious analysis of pVHL activity in renal cell carcinoma cell lines with CD31/platelet/endothelial cell adhesion molecule (PECAM), CD34, loss or mutation of VHL has consistently showed a defect in extracellular 8600

Fig. 6. Endothelial cell staining of teratomas. A, PECAM/CD31 staining on teratomas of the indicated VHL genotype. B, CD34 staining on teratomas of the indicated VHL genotype. All immunohistochemical analyses are shown at 20ϫ magnification. C, quanti- tative analysis of microvessel density measured in vessels per field. Bars, ϮSEM. (WT, wild-type)

matrix remodeling as a result of perturbation of direct or indirect inter- logically significant human VHL mutations in a primary culture actions with fibronectin (42, 43). We have previously reported a defect in system. This model system provides a unique opportunity to ob- Ϫ/Ϫ fibronectin deposition in teratomas derived from Vhl cells (20), which serve the effects of wild-type and mutant forms of pVHL protein is restored on introduction of wild-type human VHL cDNA. Analysis of on cellular and metabolic pathways in the absence of competing these teratomas confirmed this observation and extended the observed tumor-promoting genetic lesions. Additionally, these primary cells defect in fibronectin deposition to teratomas expressing VHLY112H, are amenable to three-dimensional growth as grafted teratomas, VHLR167Q, VHLlL188V, and VHLR200W (Fig. 8). This result suggests that and thus provide a platform for the study of in vivo growth control, perturbations in any pVHL domain can cause defective extracellular matrix deposition and may impact on each of the various phenotypes vascularization, and extracellular matrix deposition. observed in VHL disease. The regulation of the hypoxia response by manipulation of pVHL activity has undergone evaluation in both in vitro studies as well as in cultured human tumor cells. These results have showed DISCUSSION that in renal tumor cells (13) and murine embryonic stem cells To better understand the molecular mechanisms underlying (20), loss of VHL results in constitutive stabilization of the HIF1␣ VHL-mediated tumorigenesis, we have generated a panel of patho- and HIF2␣ transcription factors and activation of the HIF-mediated

Fig. 7. VEGF expression in teratomas. Panels show representative expression patterns of VEGF by immunohistochemical analysis in teratomas derived from the indicated embryonic stem cell clone. All images are at 20ϫ magnification. (WT, wild-type)

8601

which may impart the differential regulation of HIF1␣ and HIF2␣ we have observed in our model system. Although such an analysis is beyond the scope of this report, the mechanism that contributes to the independent regulation of HIF2␣ is certainly an interesting avenue of investigation. The isolated dysregulation of HIF2␣ observed in the VHLR167Q mutant lines provides a unique opportunity to study the effect of high normoxic expression of this protein on tumor growth. Although investigations of the hypoxia response pathway have largely focused on the regulation of HIF1␣, perturbations of HIF2␣ regulation have been observed independently of HIF1␣ dysregulation in renal cell carcinomas. As an example, the intensively studied renal carcinoma cell line, 786-0, which lacks pVHL expression, has been found to have a high normoxic expression of HIF2␣, whereas HIF1␣ is not expressed at any detectable level in those cells, even with hypoxic stimulation. In the 786-0 cell line, inhibition of HIF2␣ results in a restoration of wild-type growth in xenograft tumors (49), suggesting that HIF2␣ may actually be the more critical mediator of clear cell renal cell carcinoma. We have additionally observed that despite stabilized HIF2␣ protein in VHLR167Q embryonic stem cells, a panel of HIF targets were not transcriptionally activated unless stimulated by hypoxia. In embryonic stem cells, we have previously observed the failure of HIF2␣ to transcriptionally activate target genes, even when present in high levels (8). Other reports have observed a localization defect of HIF2␣ in mouse embryo fibroblasts (50). However, HIF2␣ was present in nuclear extracts in this study. The inactivity of HIF2␣ may be because of a protein modification or transcriptional inhibitor present in this particular cell type. Additionally, high-level expression of HIF2␣ Fig. 8. Fibronectin deposition around small vessels in embryonic stem cell-derived may, in fact, play an important role in the phenotype of the cells teratomas. Arrows indicate the location of small vessels, which most clearly show the abnormality. All images are at 40ϫ magnification. exclusive of the typical cohort of HIF-responsive genes. Alternate transcriptional targets or alternate activities altogether may account for the phenotype observed in teratomas derived from cells with hypoxia response pathway. VHL mutations linked to type 2C VHL HIF2␣ overexpression. Our analysis, however, corroborates previous disease have been previously shown to preserve the ability to evidence that VHLL188V, associated with type 2C disease, must map to negatively regulate HIF1␣ and HIF2␣ (33) comparable with the a region outside the HIF␣ regulatory domains. ectopic expression of wild-type VHL. However, previous work in In teratomas we observed that VHLY112H tumors behaved like the human renal carcinoma cells has showed that VHL disease type 2A VhlϪ/Ϫ tumors with regard to reduced tumor growth, whereas the and 2B mutant proteins fail to restore normoxic ubiquitylation of other mutant tumors restored teratoma growth similar to VHLwt. This HIF1␣ and fail to fully repress normoxic expression of both HIF1␣ experiment strongly supports the hypothesis that reduced tumor and HIF2␣ (23). However, in this primary cell culture system, all growth is a VHL-specific event. Furthermore, we observed that the of the pVHL mutants fully restored the wild-type pattern of HIF1␣ VHL mutant VHLY112H, which has a markedly different signature on expression. A VHL type 2B disease mutant, VHLR167Q, was the the regulation of the hypoxia response compared with VhlϪ/Ϫ cells, sole mutant in which an impaired interaction with Elongin C was has a similar growth defect. This may provide insight into the poten- observed, corroborating previous studies (23). Despite this appar- tially distinct roles of HIF1␣ and HIF2␣ accumulation in tumor ent deficit in Elongin C binding, however, this mutant displayed growth. oxygen-dependent regulation of HIF1␣ protein levels, binding An interesting effect of Vhl loss in various tissues in mouse models activity, and target gene activation. VHLR167Q expression, how- of VHL disease is the development of extensive vascular malforma- ever, resulted in dysregulated HIF2␣ levels, suggesting either that tions in multiple VHL disease target organs (45, 46). In our panel of pVHL to Elongin C interaction is only necessary for regulation of VHL mutants, we observed markedly increased vascularity in VHLϪ/Ϫ HIF2␣, or that even a small interaction with the ubiquitin ligase and VHLY112H teratomas and moderately increased vascularity in complex is sufficient to retain oxygen-dependent regulation of VHLR167Q and VHLR200W teratomas. These VHL mutants are associ- HIF1␣. Evaluation of an embryonic stem line bearing targeted ated with phenotypes of hemangioblastoma and erythropoietin over- arginine to glutamine mutation at the equivalent site in both murine expression, which are hallmarks of activation of the hypoxia response Vhl alleles confirms elevated levels of HIF2␣ in this setting.6 This pathway. model system represents the first example of a primary cell culture Finally, multiple lines of evidence have shown a role for pVHL in system in which the regulation of HIF1␣ and HIF2␣ are discon- the maintenance of the extracellular matrix. We have observed a nected and provides a model system in which the distinct roles of defect in fibronectin deposition in each of our mutant embryonic stem each of these factors can be additionally elucidated. cell teratomas, although exogenous expression of VHLwt does restore A limitation of this system is the potential for different interactions this phenotype (20). This unique and interesting effect of VHL per- between human pVHL and the murine milieu. Although human and turbation may be an integral contributor to the growth characteristics mouse pVHL share considerable homology, differences do exist of VHL disease-associated tumors, possibly by threatening the struc- tural integrity of the extracellular matrix and thus permitting the 6 W. K. Rathmell and M. C. Simon, unpublished data. formation of large vascular lesions characteristic of the teratomas. 8602

Taken together, these results suggest a complex pathway of regu- 22. Crossey PA, Richards FM, Foster K, et al. Identification of intragenic mutations in the lation of tumor angiogenesis and growth mediated by subtle alter- von Hippel-Lindau disease tumour suppressor gene and correlation with disease phenotype. Hum Mol Genet 1994;3:1303–8. ations in the pVHL protein. It is likely that pVHL roles outside of the 23. Clifford SC, Cockman ME, Smallwood AC, et al. Contrasting effects on HIF-1alpha regulation of the hypoxia response pathway are impacting cellular regulation by disease-causing pVHL mutations correlate with patterns of tumouri- growth, and that cell-specific factors directing the transcriptional genesis in von Hippel-Lindau disease. Hum Mol Genet 2001;10:1029–38. 24. Ang SO, Chen H, Hirota K, et al. Disruption of oxygen homeostasis underlies hypoxia response are an important determinant of downstream effects congenital Chuvash polycythemia. Nat Genet 2002;32:614–21. of VHL mutation. Although the specific mechanisms mediating tumor 25. Pastore YD, Jelinek J, Ang S, et al. Mutations in the VHL gene in sporadic apparently growth and development in this model system remain to be identified, congenital polycythemia. Blood 2003;101:1591–5. 26. Foster K, Prowse A, van den Berg A, et al. Somatic mutations of the von Hippel- this analysis provides additional evidence of the tissue-specific regu- Lindau disease tumour suppressor gene in non-familial clear cell renal carcinoma. lation of HIF2␣, and the potential importance of this member of the Hum Mol Genet 1994;3:2169–73. HIF transcription factor family in the development of clear cell renal 27. Kondo K, Yao M, Yoshida M, et al. Comprehensive mutational analysis of the VHL gene in sporadic renal cell carcinoma: relationship to clinicopathological parameters. cell carcinoma. Genes Chromosomes Cancer 2002;34:58–68. 28. Shuin T, Kondo K, Torigoe S, et al. Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human REFERENCES renal cell carcinomas. Cancer Res 1994;54:2852–5. 29. Mandriota SJ, Turner KJ, Davies DR, et al. HIF activation identifies early lesions in 1. Maher ER, Kaelin WG Jr. von Hippel-Lindau disease. Medicine (Baltim) 1997;76: VHL kidneys: evidence for site-specific tumor suppressor function in the nephron. 381–91. Cancer Cell 2002;1:459–68. 2. Wang GL, Jiang BH, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a 30. Jiang Y, Zhang W, Kondo K, et al. Gene expression profiling in a renal cell carcinoma basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl cell line: dissecting VHL and hypoxia-dependent pathways. Mol Cancer Res 2003; Acad Sci USA 1995;92:5510–4. 3. Wang GL, Semenza GL. Purification and characterization of hypoxia-inducible factor 1:453–62. 1. J Biol Chem 1995;270:1230–7. 31. Chen F, Kishida T, Duh FM, et al. Suppression of growth of renal carcinoma cells by 4. Semenza GL. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr the von Hippel-Lindau tumor suppressor gene. Cancer Res 1995;55:4804–7. Opin Genet Dev 1998;8:588–94. 32. Iliopoulos O, Kibel A, Gray S, Kaelin WG Jr. Tumour suppression by the human von 5. Wenger RH. Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hy- Hippel-Lindau gene product. Nat Med 1995;1:822–6. poxia-inducible transcription factors, and O2-regulated gene expression. FASEB J 33. Hoffman MA, Ohh M, Yang H, et al. von Hippel-Lindau protein mutants linked to 2002;16:1151–62. type 2C VHL disease preserve the ability to downregulate HIF. Hum Mol Genet 6. Semenza GL, Roth PH, Fang HM, Wang GL. Transcriptional regulation of genes 2001;10:1019–27. encoding glycolytic enzymes by hypoxia-inducible factor 1. J Biol Chem 1994;269: 34. Ohh M, Kaelin WG Jr. VHL and kidney cancer. Methods Mol Biol 2003;222:167–83. 23757–63. 35. Kaelin WG, Iliopoulos O, Lonergan KM, Ohh M. Functions of the von Hippel-Lindau 7. Ratcliffe PJ, O’Rourke JF, Maxwell PH, Pugh CW. Oxygen sensing, hypoxia- tumour suppressor protein. J Intern Med 1998;243:535–9. inducible factor-1 and the regulation of mammalian gene expression. J Exp Biol 36. Pause A, Lee S, Lonergan KM, Klausner RD. The von Hippel-Lindau tumor sup- 1998;201(Pt 8):1153–62. pressor gene is required for cell cycle exit upon serum withdrawal. Proc Natl Acad Sci 8. Hu CJ, Wang LY, Chodosh LA, Keith B, Simon MC. Differential roles of hypoxia- USA 1998;95:993–8. inducible factor 1alpha (HIF-1alpha) and HIF-2alpha in hypoxic gene regulation. Mol 37. Bindra RS, Vasselli JR, Stearman R, Linehan WM, Klausner RD. VHL-mediated Cell Biol 2003;23:9361–74. hypoxia regulation of cyclin D1 in renal carcinoma cells. Cancer Res 2002;62: 9. Saarikoski ST, Rivera SP, Hankinson O. Mitogen-inducible gene 6 (MIG-6), 3014–9. adipophilin and tuftelin are inducible by hypoxia. FEBS Lett 2002;530: 38. Baba M, Hirai S, Yamada-Okabe H, et al. Loss of von Hippel-Lindau protein causes 186–90. cell density dependent deregulation of CyclinD1 expression through hypoxia-induc- 10. Wykoff CC, Pugh CW, Harris AL, Maxwell PH, Ratcliffe PJ. The HIF pathway: ible factor. Oncogene 2003;22:2728–38. implications for patterns of gene expression in cancer. Novartis Found Symp 2001; 39. Lieubeau-Teillet B, Rak J, Jothy S, et al. von Hippel-Lindau gene-mediated growth 240:212–25; discussion 225–31. suppression and induction of differentiation in renal cell carcinoma cells grown as 11. Wiesener MS, Munchenhagen PM, Berger I, et al. Constitutive activation of hypoxia- multicellular tumor spheroids. Cancer Res 1998;58:4957–62. inducible genes related to overexpression of hypoxia-inducible factor-1alpha in clear 40. Baba M, Hirai S, Kawakami S, et al. Tumor suppressor protein VHL is induced at cell renal carcinomas. Cancer Res 2001;61:5215–22. high cell density and mediates contact inhibition of cell growth. Oncogene 2001;20: 12. Ohh M, Park CW, Ivan M, et al. Ubiquitination of hypoxia-inducible factor requires 2727–36. direct binding to the beta-domain of the von Hippel-Lindau protein. Nat Cell Biol 41. Hergovich A, Lisztwan J, Barry R, Ballschmieter P, Krek W. Regulation of micro- 2000;2:423–7. tubule stability by the von Hippel-Lindau tumour suppressor protein pVHL. Nat Cell 13. Maxwell PH, Wiesener MS, Chang GW, et al. The tumour suppressor protein VHL Biol 2003;5:64–70. targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature (Lond) 42. Kamada M, Suzuki K, Kato Y, Okuda H, Shuin T. von Hippel-Lindau protein 1999;399:271–5. promotes the assembly of actin and vinculin and inhibits cell motility. Cancer Res 14. Cockman ME, Masson N, Mole DR, et al. Hypoxia inducible factor-alpha binding and 2001;61:4184–9. ubiquitylation by the von Hippel-Lindau tumor suppressor protein. J Biol Chem 43. Ohh M, Yauch RL, Lonergan KM, et al. The von Hippel-Lindau tumor suppressor 2000;275:25733–41. protein is required for proper assembly of an extracellular fibronectin matrix. Mol 15. Iliopoulos O, Levy AP, Jiang C, Kaelin WG Jr, Goldberg MA. Negative regulation of Cell 1998;1:959–68. hypoxia-inducible genes by the von Hippel-Lindau protein. Proc Natl Acad Sci USA 44. Gnarra JR, Ward JM, Porter FD, et al. Defective placental vasculogenesis causes embry- 1996;93:10595–9. onic lethality in VHL-deficient mice. Proc Natl Acad Sci USA 1997;94:9102–7. 16. Pugh CW, Ratcliffe PJ. The von Hippel-Lindau tumor suppressor, hypoxia-inducible factor-1 (HIF-1) degradation, and cancer pathogenesis. Semin Cancer Biol 2003;13: 45. Haase VH, Glickman JN, Socolovsky M, Jaenisch R. Vascular tumors in livers with 83–9. targeted inactivation of the von Hippel-Lindau tumor suppressor. Proc Natl Acad Sci 17. Ivan M, Haberberger T, Gervasi DC, et al. Biochemical purification and pharmaco- USA 2001;98:1583–8. logical inhibition of a mammalian prolyl hydroxylase acting on hypoxia-inducible 46. Ma W, Tessarollo L, Hong SB, et al. Hepatic vascular tumors, angiectasis in multiple factor. Proc Natl Acad Sci USA 2002;99:13459–64. organs, and impaired spermatogenesis in mice with conditional inactivation of the 18. Huang J, Zhao Q, Mooney SM, Lee FS. Sequence determinants in hypoxia-inducible VHL gene. Cancer Res 2003;63:5320–8. factor-1alpha for hydroxylation by the prolyl hydroxylases PHD1, PHD2, and PHD3. 47. Kleymenova E, Everitt JI, Pluta L, et al. Susceptibility to vascular neoplasms but no J Biol Chem 2002;277:39792–800. increased susceptibility to renal carcinogenesis in Vhl knockout mice. Carcinogenesis 19. Jaakkola P, Mole DR, Tian YM, et al. Targeting of HIF-alpha to the von Hippel- (Lond) 2004;25:309–15. Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science (Wash 48. Byrappa S, Gavin DK, Gupta KC. A highly efficient procedure for site-specific DC) 2001;292:468–72. mutagenesis of full-length plasmids using Vent DNA polymerase. Genome Res 20. Mack FA, Rathmell WK, Arsham AM, et al. Loss of pVHL is sufficient to cause HIF 1995;5:404–7. dysregulation in primary cells but does not promote tumor growth. Cancer Cell 49. Kondo K, Kim WY, Lechpammer M, Kaelin WG Jr. Inhibition of HIF2alpha is 2003;3:75–88. sufficient to suppress pVHL-defective tumor growth. PLoS Biol 2003;1:E83. 21. Zbar B, Kishida T, Chen F, et al. Germline mutations in the Von Hippel-Lindau 50. Park SK, Dadak AM, Haase VH, et al. Hypoxia-induced gene expression occurs disease (VHL) gene in families from North America, Europe, and Japan. Hum Mutat solely through the action of hypoxia-inducible factor 1alpha (HIF-1alpha): role of 1996;8:348–57. cytoplasmic trapping of HIF-2alpha. Mol Cell Biol 2003;23:4959–71.

8603

W. Kimryn Rathmell, Michele M. Hickey, Natalie A. Bezman, et al.

Cancer Res 2004;64:8595-8603.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/64/23/8595

Cited articles This article cites 49 articles, 23 of which you can access for free at: http://cancerres.aacrjournals.org/content/64/23/8595.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/64/23/8595.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/64/23/8595. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.