The HCMV Encoded Mrna-Export Factor Pul69 – Functional Conservation Within the Betaherpesvirinae and Identification of Mrna-Targets During Infection

Home , Betaherpesvirinae, Vent DNA polymerase

The HCMV encoded mRNA-export factor pUL69 – functional conservation within the Betaherpesvirinae and identification of mRNA-targets during infection

Der HCMV kodierte mRNA-Exportfaktor pUL69 – funktionelle Konservierung innerhalb der Betaherpesvirinae und Identifikation von gebundenen mRNAs während der Infektion

Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat.

vorgelegt von

Barbara Zielke

aus Nürnberg Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 3. Mai 2012

Vorsitzender der Promotionskommission: Prof. Dr. R. Fink

Erstberichterstatter: Prof. Dr. T. Stamminger

Zweitberichterstatter: Prof. Dr. A. Burkovski

The most reliable way to forecast the future is to try to understand the present.

John Naisbitt

Table of contents

A Summary ...... 1

A Zusammenfassung...... 2

B Introduction ...... 3

C Objectives ...... 14

D Materials and Methods...... 15

1. Biological Materials...... 15 1.1. Bacteria ...... 15 1.2. Eukaroytic cell cultures...... 15 1.3. Virus strains...... 15 1.4. Antibodies...... 16 1.4.1. Monoclonal antibodies...... 16 1.4.2. Polyclonal antibodies...... 16 1.4.3. Secondary antibodies...... 16 2. Nucleic acids...... 17 2.1. Oligonucleotides...... 17 2.2. Vectors and plasmids ...... 20 2.2.1. Vectors and vector systems ...... 20 2.2.2. Ready-to-use DNA constructs...... 20 2.2.3. Newly generated plasmids and BACmids ...... 22 2.3. Additional nucleic acids ...... 24 3. Enzymes, chemicals and media...... 24 3.1. Enzymes...... 24 3.2. Media...... 24 3.2.1. Bacterial media...... 24 3.2.2. Mammalian cell culture media...... 24 3.3. Chemicals...... 25 3.4. Standard buffers...... 25 4. Methods...... 26 4.1. Standard molecular biology techniques...... 26 4.2. In vitro mutagenesis ...... 26 4.3. Eukaryotic cell culture techniques ...... 26 4.3.1. Maintenance of eukaryotic cell cultures...... 26 4.3.2. Transfection of mammalian cells...... 27 4.3.3. Infection of human foreskin fibroblasts (HFFs)...... 27

Table of contents

4.4. Indirect immunofluorescence analysis...... 27 4.5. Heterokaryon analysis ...... 28 4.6. Nuclear mRNA-export assay ...... 28 4.7. Coimmunoprecipitation...... 29 4.8. RNA techniques...... 29 4.8.1. Total cellular RNA preparation from infected cell culture cells ...... 29 4.8.2. Cytoplasmic RNA preparation from infected cell culture cells...... 29 4.8.3. RNA-immunoprecipitation...... 30 4.8.4. Reverse transcription polymerase chain reaction (RT-PCR)...... 31 4.8.5. Quantitative SYBR-Green PCR (qPCR)...... 31 4.9. Generation and characterization of recombinant viruses ...... 32 4.9.1. Generation of recombinant HCMVs using the BACmid technology ...... 32 4.9.2. Homologous recombination using linear DNA fragments...... 32 4.9.3. Preparation, restriction enzyme digestion and PCR analysis of BACmid DNA...... 33 4.9.4. Reconstitution of recombinant viruses ...... 33 4.9.5. Virus titration based on IE1-gene expression...... 34 4.9.6. Absolute quantification of virus genome copy numbers using Taqman probes ...... 34 4.9.7. Characterization of recombinant viruses by multistep growth curve analysis...... 34 4.10. Generation and characterization of a cDNA-library after RNA-immunoprecipitation of pUL69 from HCMV-infected HFFs ...... 35

E Results ...... 36

1. Functional characterization of the betaherpesviral pUL69-protein family...... 36 1.1. Expression analyses of HCMV pUL69 and homologous proteins of the Betaherpesvirinae ...... 36 1.2. Nuclear localization of pUL69 and homologous betaherpesviral proteins...... 37 1.3. Homo- and heterodimerization of betaherpesviral pUL69-homologs ...... 38 1.4. Analysis of the nuclear mRNA-export activity of pUL69 and betaherpesviral homologs...... 42 1.4.1. Analysis of nuclear mRNA-export by transient transfection experiments...... 42 1.4.2. Stimulation of nuclear export of unspliced RNAs is restricted to the cytomegaloviral proteins pUL69, pC69 and pRh69...... 43 1.5. Nucleocytoplasmic shuttling of HCMV pUL69 and its betaherpesviral homologs ...45 1.6. Interaction with UAP56/URH49 is a prerequisite for stimulation of mRNA-export by pUL69, pC69 and pRh69 ...... 47 1.7. Interaction of pUL69 with UAP56/URH49 but not RNA-binding is essential for efficient replication of human cytomegalovirus...... 51

Table of contents

1.8. Characterization and functional analyses of chimeric fusion proteins between HCMV pUL69 and MCMV pM69 ...... 53 1.8.1. Verification of protein expression and analysis of subcellular localization of chimeric proteins pCh1 to pCh4 ...... 55 1.8.2. pM69 acquires mRNA-export activity by fusion of the UAP56-interaction motif of HCMV pUL69 to its N-terminus ...... 57 1.8.3. Transfer of the UAP56-interaction motif of pUL69 to pM69 enables the chimeric protein to substitute for pUL69 during HCMV-infection...... 59

2. Identification of viral and cellular mRNAs that are targeted by the HCMV encoded mRNA-export factor pUL69...... 63 2.1. Direct RNA-binding of pUL69 is no prerequisite for its mRNA-export activity, while UAP56-interaction is absolutely essential ...... 63 2.2. Association of pUL69 with CAT-mRNA in vivo ...... 66 2.3. RNA-binding of pUL69 influences the protein expression kinetics of certain HCMV gene products ...... 70 2.4. pUL69 interacts with UL44, UL83-pp65 and UL82-pp71 mRNAs in vivo ...... 72 2.5. Construction and evaluation of a cDNA-library to identify viral and cellular mRNAs that are associated with pUL69 in HCMV-infected HFF cells ...... 76 2.6. UL65 mRNA levels are significantly decreased in HFFs infected with AD169-pUL69ΔR1ΔRS...... 81

F Discussion ...... 84

G Abbreviations ...... 98

H References ...... 99

I Appendix ...... 110

Summary

A Summary

Human cytomegalovirus (HCMV), the betaherpesviral prototype, encodes for the pleiotropic transactivator pUL69, which has a counterpart in every member of the Herpesviridae family thus far sequenced. Even though pUL69 was identified to act as an mRNA-export factor facilitating the nuclear export of herpesviral intronless mRNAs via its nucleocytoplasmic shuttling activity and interaction with the cellular DExD/H-box RNA-helicases UAP56 or URH49, little is known about the conservation of these functions in the homologous proteins of other betaherpesviruses. This study functionally characterized the betaherpesviral pUL69- homologs pC69 of chimpanzee cytomegalovirus (CCMV), pRh69 of rhesus cytomegalovirus (RhCMV), pM69 of murine cytomegalovirus (MCMV), pU42 of human herpesvirus type 6 (HHV6) and pU42 of elephant endotheliotropic herpesvirus (ElHV1). Besides nuclear localization, homodimerization and nucleocytoplasmic shuttling activity were identified to be a conserved feature of all homologs. However, only pC69 and pRh69 were able to act as viral mRNA-export factors likewise to pUL69, and this function was dependent on their ability to interact with UAP56/URH49 in analogy to pUL69. Moreover, UAP56-interaction is of importance for HCMV-replication, since HCMV recombinants comprising pUL69-mutations or -substitutions within this domain exerted a strong replication defect in vivo. Moreover, in order to confirm the RNA-binding capacity of pUL69 in vivo, RNA- immunoprecipitation (RIP) experiments were performed demonstrating that pUL69 interacts with RNA in vivo via a complex N-terminal RNA-binding domain. Comparison of viral protein expression kinetics between wild type HCMV- and UL69-mutant infected HFFs illustrated differences in the expression of several viral early and late gene products, particularly. Furthermore, since until today no natural mRNA-target of the pUL69-mediated mRNA-export has been determined, this study identified viral and cellular mRNAs that are associated with pUL69 during HCMV-infection. Subsequently, RNA-immunoprecipitation (RIP) experiments of HCMV-infected HFF cells confirmed that pUL69 is associated with several viral mRNAs during the course of infection, including the mRNAs of UL44, UL83-pp65, and UL82-pp71. In addition, results obtained by transient transfection analyses demonstrated an independency of virus-encoded cofactors. Finally, by the generation of a cDNA-library of pUL69 coprecipitated mRNAs, nucleotide sequence analyses identified several novel cellular and viral transcripts that are associated with pUL69 during HCMV-infection.

1 Zusammenfassung

A Zusammenfassung

Das humane Cytomegalovirus – der Prototyp der Betaherpesviren - kodiert für das pleiotrope Transaktivatorprotein pUL69, von dem verwandte Proteine in allen bisher sequenzierten Mitgliedern der Herpesviren gefunden wurden. Für pUL69 wurde bereits gezeigt, dass es als viraler mRNA-Exportfaktor fungiert, welches den nukleären Export intronloser, herpesviraler mRNAs fördert, indem es zwischen Zellkern und Zytoplasma wandert und mit den zellulären RNA-Helikasen UAP56 oder URH49 interagiert. Bis heute ist allerdings nur sehr wenig über die Konserviertheit dieser Funktionen und Eigenschaften in verwandten Proteinen anderer Betaherpesviren bekannt. Daher wurden in dieser Arbeit die betaherpesviralen pUL69- Homologen pC69 des Schimpansen-Cytomegalovirus (CCMV), pRh69 des Rhesusaffen- Cytomegalovirus (RhCMV), pM69 des murinen Cytomegalovirus (MCMV), pU42 des humanen Herpesvirus Typ 6 (HHV6) sowie pU42 des Elefanten-Herpesvirus (ElHV1) funktionell charakterisiert. Hierbei konnte gezeigt werden, dass, neben einer Lokalisation im Zellkern, die Fähigkeit mit sich selbst zu interagieren und konstant zwischen Zellkern und Zytoplasma zu wandern konservierte Eigenschaften aller Homologen sind. In Anlehnung an pUL69 konnte jedoch nur für pC69 und für pRh69 eine Funktion als virale mRNA- Exportfaktoren nachgewiesen werden. Diese Eigenschaft war ebenfalls abhängig von ihrer Fähigkeit, mit UAP56/URH49 zu interagieren. Ferner wurde die Bedeutung der UAP56- Binding von pUL69 für die Replikation von HCMV hervorgehoben, da rekombinante Cytomegaloviren, die entsprechende Mutationen oder Substitutionen von pUL69 umfassten, einen stark ausgeprägten Replikationsdefekt aufzeigten. Um darüberhinaus die Fähigkeit von pUL69 an RNA zu binden genauer zu untersuchen, wurden RNA-Immunpräzipitationen durchgeführt. Diese zeigten, dass die Bindung von pUL69 an RNA in vivo durch eine komplexe, N-terminale RNA-Bindungsdomäne erfolgt. Der Vergleich von Protein-Expressionsmustern in Fibroblasten, die mit Wildtyp-Virus oder mit einer UL69-Mutante infiziert waren, wiesen im Besonderen Unterschiede in der Expression von verschiedenen frühen und späten HCMV-Genen auf. Da bis heute keine natürlichen mRNAs bekannt sind, die durch pUL69 aus dem Zellkern exportiert werden, sollten in dieser Arbeit zudem virale und/oder zelluläre RNAs identifiziert werden, die mit pUL69 im Laufe einer HCMV-Infektion assoziieren. Die anschließenden RNA-Immunpräzipitationen konnten darüber hinaus eine Assoziation von pUL69 mit verschiedenen viralen mRNAs, darunter UL44, UL83-pp65- und UL82-pp71, während einer HCMV-Infektion bestätigen, die zudem unabhängig von viralen Kofaktoren war. Abschließend konnten durch die Herstellung einer cDNA-Datenbank aus pUL69 assoziierten mRNAs weitere zelluläre und virale Transkripte identifiziert werden, die während einer HCMV-Infektion an pUL69 gebunden sind.

2 Introduction

B Introduction

Human Cytomegalovirus – general features On the basis of biological properties, genome structure and comparison of primary amino acid sequences, the familiy Herpesviridae has been subdivided into three subfamilies, the Alpha-, Beta- and Gammaherpesvirinae (Roizman et al., 1981; 1992). Human cytomegalovirus (HCMV), also referred to as human herpesvirus type 5 (HHV5), constitutes the prototype of the Betaherpesvirinae, and is characterized by a strict species specificity with humans being the only natural host (Mocarski et al., 2007). Besides HCMV, seven other human pathogenic herpesviruses have been identified so far: (i) the alphaherpesviruses herpes simplex virus type 1 and 2 (HSV1 and HSV2) as well as varicella zoster virus (VZV), (ii) the betaherpesviruses human herpesvirus type 6 and 7 (HHV6 and HHV7) and (iii) the gammaherpesviruses human herpesvirus type 8 (HHV8) and Epstein-Barr virus (EBV). In contrast to the alpha-subgroup, the Beta- and Gammaherpesvirinae are characterized by strict species specificity and a prolonged life cycle in both infected organisms and cell culture (Matthews et al., 1982; Roizman and Knipe, 2001).

HCMV is a globally spread, opportunistic pathogen with 50 to 100% of the human population being HCMV seropositive, depending on the socio-economic standards of a country (Krech, 1973; Onorato et al., 1985). Horizontal transmission represents the major pathway for primary infections and occurs by multiple means such as direct person-to-person contact, aerosol droplets, nursing, blood as well as solid organ and bone marrow transplantation (Stagno et al., 1986; Pass, 1985). Moreover, vertical transmission from mother to child during pregnancy or during birth is also possible (Lang and Kummer, 1975; Reynolds et al., 1973; Stagno et al., 1981). Primary infection of healthy individuals generally proceeds either inapparently or is accompanied by mild cold-like symptoms (Jordan et al., 1973; Cohen and Corey, 1985). However, acute or reactivated HCMV-infection can cause a range of severe or even life-threatening pathological manifestations such as haematological, hepatic and gastrointestinal abnormalities and interstitial pneumonia in patients with suppressed immune system like transplant recipients or AIDS patients (Vancikova and Dvorak, 2001; Drew, 1992a; 1992b). Besides the consequences of infection described for immunocompromised or immunosuppressed individuals, HCMV is still a major cause for virus-associated birth defects and congenital infections can result in mental retardation, seizures as well as progressive loss of hearing and vision (Dollard et al., 2007; Revello and Gerna, 2002). Moreover, HCMV has recently been discussed to be associated with age-related immunosenescence (Koch et al., 2006; 2007) and proliferative diseases like arteriosclerosis and coronary restenosis (Mueller et al., 2003; Bason et al., 2003; Melnick et al., 1996; Speir et al., 1995).

3 Introduction

Due to the global prevalence of HCMV, prophylaxis of exposition is not practicable. However, effective anti-HCMV drugs are available, with ganciclovir and forscarnet being the most conversant ones. Furthermore, due to numerous side effects of the current antivirals like nephrotoxicity, hematologic toxicities and the occurrence of drug resistant virus-mutants (Gilbert and Boivin, 2005; Danziger-Isakov and Mark, 2008), research for improved antiviral therapeutics is urgently required (Leen et al., 2008). Until today, no vaccine is available.

Likewise to all herpesviruses, HCMV establishes a lifelong latency after primary infection of individuals and, under normal conditions, is controlled efficiently by the immune system. However, latency can be interrupted by periods of reactivation (Drew and Lalezari, 1999). After the first direct contact with infectious virus, it has been suggested that epithelial cells of the upper alimentary, respiratory or genito-urinary tracts are sites of primary replication. Once HCMV-infection has been established, leukocyte- and endothelial cell-associated viremia appears to play an important role in the dissemination of the virus between various tissues of the host. Thus, productive lytic HCMV-replication can occur in diverse cell types including fibroblasts, epithelial cells, macrophages, smooth muscle and endothelial cells as well as in differentiated neuronal cells in vivo (Sinzger et al., 1995; Plachter et al., 1996; Sinzger and Jahn, 1996; Tsutsui et al., 2005; Cheeran et al., 2005). In contrast to this, HCMV-replication in vitro is limited to fibroblasts and to semi-permissive cell lines as for example U373 and U138. In response to productive lytic infection, cells characteristically undergo cell enlargement (cytomegaly), develop intranuclear inclusions and further characteristic features of a cytopathic effect (CPE). While the cell types of productive HCMV- replication are well known, the latent reservoir is not certainly clarified yet. However, cells of the haematopoietic system such as myeloid precursor cells and CD34+ haematopoietic stem cells are within the current focus of discussion (Sindre et al., 1996; Mendelson et al., 1996; Khaiboullina et al., 2004), thereby indicating that virus persistence is not restricted to certain organs (Sinclair, 2008). Latency is defined as virus-induced stage, in which the viral genome exists as an extrachromosomal episome in the absence of gene expression (Bolovan-Fritts et al., 1999). Until today, it still remains unclear which mechanisms are required for establishment and maintenance of latency and how reactivation of the lytic replication cycle occurs.

HCMV is one of the most complex pathogenic viruses; with a total diameter of approximately 150-200nm it displays the typical morphology of all herpesviruses. The linear, double- stranded DNA genome (229-240kbp) encoding for about 200 gene products (Chee et al., 1990) lies in the centre of the virion and is associated with a protein core, which itself is surrounded by an icosahedral capsid (Mocarski et al., 2007; Wright et al., 1964). This nucleocapsid is then embedded into a pleomorphic protein- and RNA-containing layer, the so-called tegument, representing a unique feature of herpesviruses. The HCMV tegument

4 Introduction comprises at least 20 proteins of viral and cellular origin as for example the viral regulatory factors pUL69, UL82-pp71, UL83-pp65 and the HCMV encoded protein kinase pUL97 (Baldick and Shenk, 1996; Winkler et al., 1994; Roby and Gibson, 1986; Mettenleiter, 2002; van Zeijl et al., 1997). In addition, a subset of viral and cellular mRNAs has been shown to be incorporated into the viral particle by a yet unknown mechanism (Bresnahan and Shenk, 2000a; Greijer et al., 2000; Sciortino et al., 2001). The outermost component of the HCMV virion is the host cell-derived lipid bilayer that originates from intracellular membranes and is modified by incorporation of viral glycoproteins which are required for the adsorption of the virus to its host cell but are also responsible for the induction of a neutralizing antibody response (Mocarski et al., 2007; Gibson, 1996; 2001).

Via distinct glycoproteins within its lipid bilayer HCMV attaches to heparansulfate on the surface of a host cell (Compton et al., 1992; 1993; Taylor and Cooper, 1990), whereupon the membranes of virus and host fuse to release capsid and tegument into the cytoplasm. The viral capsids are then rapidly transported to the cell nucleus and, after uncoating, the viral DNA is released through the nuclear pores into the nucleoplasm (Ogawa-Goto et al., 2003). As a common feature of herpesviruses in general, gene expression during lytic HCMV- replication follows a strictly temporarily coordinated cascade consisting of three sequential phases termed immediate-early (IE), early (E) and late (L) phase (Demarchi, 1981; Wathen and Stinski, 1982; McDonough and Spector, 1983). Expression of IE-genes is a prerequisite for progression into the early phase of the replication cycle and the subsequent synthesis of viral DNA which, in turn, is required for entry into the late phase, resulting in virion assembly and finally the release of infectious progeny virus from the cell (Mocarski et al., 2007). Starting at 2 to 6 hours after virus entry, IE-genes are transcribed, giving rise to viral regulatory proteins as for example IE1 and IE2, which are required to initiate the E-gene expression (Mocarski and Coucelle, 2001). In addition, some viral tegument proteins (e.g. UL82-pp71, pUL26 and pUL69) enhance the expression of these IE-regulatory proteins by activating the major-IE-enhancer/promoter (MIEP) (Liu and Stinski, 1992; Schierling et al., 2004; Stamminger et al., 2002; Winkler et al., 1994; 1995; Winkler and Stamminger, 1996). As a prerequisite for efficient HCMV-replication IE2 and pUL69 both induce a G1 phase cell cycle arrest (Lu and Shenk, 1996; 1999; Murphy et al., 2000; Wiebusch and Hagemeier, 1999). Transcription of E-genes starts 6 to 24 hours post infection (hpi). Proteins synthesized during this phase induce an intracellular environment most potent for viral DNA synthesis by expression of enzymes for nucleotide-biosynthesis as well as DNA-replication and transactivators of L-genes (Fortunato et al., 2000; Mocarski and Courcelle, 2001; Prichard et al., 1996). At the time DNA replication starts (~24hpi), the L-viral gene expression is initiated, which is characterized by the expression of structural proteins and enzymes involved in virion assembly, maturation and release of infectious progeny virus from the cell (Chee et al., 1990;

5 Introduction

Spaete et al., 1994; Mocarski et al., 2007). As a common feature of herpesviruses, viral DNA replication starts at defined elements (ori-lyt) and follows the principle of a rolling circle, thus synthesizing multiple copies of the viral genome in a concatemeric arrangement (Anders et al., 1992). DNA replication, formation of capsids and packaging of viral DNA occur in the nucleus (Gibson, 1996). Subsequently, nucleocapsids leave the nucleus via disruption of the nuclear lamina by the so-called nuclear egress complex (NEC) (Marschall et al., 2005; Milbradt et al., 2009). Finally, by budding into the trans-golgi network, viruses obtain their envelope (Gibson, 1996; Tooze et al., 1993), maturate and are then transported to the cell surface where they finally leave the cell by an exocytotic-like pathway (Mettenleiter, 2002). The entire replication cycle of HCMV requires approximately 48 to 72 hours and release of mature virus progeny can first be observed around 96 hours post infection, accentuating the complexity of HCMV as a human pathogen.

Classification of Herpesviridae As already mentioned above, the family Herpesviridae has been subdivided into three subfamilies, the Alpha-, Beta- and Gammaherpesvirinae (Fig. 1) (Roizman et al., 1992). Separation of these subfamilies is estimated to have proceeded approximately 180 to 200 million years ago (Davison, 2002), with development of genera within each subfamily occurring by more recent events (McGeoch et al., 2000). The subfamily Betaherpesvirinae contains four genera: Cytomegalovirus, Muromegalovirus, Roseolovirus, and Proboscivirus (Fig. 1). The most intensively studied betaherpesviruses belong to the genus Cytomegalovirus and include human cytomegalovirus (HCMV; Human herpesvirus 5), rhesus cytomegalovirus (RhCMV; Macacine herpesvirus 3), and chimpanzee cytomegalovirus (CCMV; Panine herpesvirus 2).

Fig. 1: Schematic phylogeny of the Herpesviridae family. Maximum likelihood phylogenetic tree of the Betaherpesvirinae. The classification into virus family, subfamily, genus as well as species are indicated at the top of the figure. Representative homologs of the viruses included in subsequent functional study are indicated by asterisks (Zielke et al., 2011).

6 Introduction

The genus Muromegalovirus comprises murine cytomegalovirus (MCMV; Murid herpesvirus 1) and rat cytomegalovirus (RCMV; Murid herpesvirus 2). Human herpesvirus 6 (HHV6; Human herpesvirus 6) and human herpesvirus 7 (HHV7; Human herpesvirus 7) belong to the genus Roseolovirus and, like HCMV, infect humans. Elephant endotheliotropic herpesvirus (ElHV1; Elephantid herpesvirus 1) is the founder member of the genus Proboscivirus (Davison et al., 2009). There are additional viruses within the Betaherpesvirinae subfamily that have not yet been classified into genera (Fig. 1).

The ICP27-protein family Many conserved proteins have been identified among members of the Herpesviridae family, and they are assumed to fulfil similar functions during the course of infection. Among these is a family of homologous proteins - the ICP27-protein family - whose members function as posttranscriptional activators that facilitate the nuclear export of intronless mRNAs (Sandri- Goldin, 2001; 2008; Toth and Stamminger, 2008). Members of the ICP27-protein family are present in every mammalian or avian herpesvirus sequenced to date, thus emphazising their functional importance. Proteins belonging to this family are depicted in figure 2 and include, among others, the alphaherpesviral proteins ICP27 of herpes simplex virus type 1 (HVS1; species, Human herpesvirus 1) and ORF4 of varicella zoster virus (VZV; Human herpesvirus 2) (Inchauspe and Ostrove, 1989; Sacks et al., 1985; Sandri-Goldin and Mendoza, 1992), the betaherpesviral protein pUL69 of HCMV (Winkler et al., 1994; Winkler and Stamminger, 1996), and the gammaherpesviral protein EB2 of Epstein-Barr virus (EBV; Human herpesvirus 4) (Buisson et al., 1989; Gruffat et al.,2002).

Fig. 2: Taxonomy of herpesviruses encoding members of the ICP27-protein family. Schematic alignment of alpha-, beta-, and gammaherpesviral proteins of the ICP27- protein family. The most highly conserved region (ICP27-homology region) is highlighted as a black bar. Proteins belonging to the Betaherpesvirinae are characterized by a C-terminal extension that is absent in alpha- and gammaherpesviral counterparts (Zielke et al., 2011).

Indeed, the overall amino acid sequence identity among members is low (∼20%). The region containing the C-terminal 200 amino acid (aa) residues of HSV1 ICP27 is the best conserved (~35%) and corresponds to a central domain within pUL69 and other betaherpesviral homologs. This domain is called the ICP27-homology region (Fig. 2) (Winkler et al., 2000). Thus, pUL69 and its betaherpesviral homologs are characterized by a unique C-terminal

7 Introduction extension that is absent in the alpha- and gammaherpesviral proteins (Fig. 2) (Cook et al., 1994; Winkler et al., 2000). Interestingly, although the overall function of characterized ICP27-protein family members as posttranscriptional regulators and viral mRNA-export factors appears to be well conserved, specific motifs (e.g. the RNA-binding motif and nuclear localization and export signals) have diverged considerably (Sandri-Goldin, 2008; Sergeant et al., 2008; Toth and Stamminger, 2008). pUL69 of HCMV The prototype ICP27-homolog of the Betaherpesvirinae is pUL69 of human cytomegalovirus (Fig. 3). The open reading frame (ORF) UL69 encodes a nuclear protein that consists of 744aa and is expressed during the early-late phase of viral replication (Winkler et al., 1994). As a result of differential phosphorylation, three isoforms of pUL69 can be detected (~105kDa, 110kDa, 116kDa) of which the 110kDa hypophosphorylated isoform is a constituent of the viral tegument (Winkler and Stamminger, 1996). Thus, pUL69 is delivered to host cells upon infection and might therefore also affect the IE phase of gene expression. Consistent with this, transactivation of the MIEP could be observed in the presence of pUL69 in transient transfection assays and this activity was enhanced synergistically by addition of the tegument protein UL82-pp71 (Winkler et al., 1995). Another feature of the tegument provided pUL69 is its ability to cause a G1-arrest in transfected as well as in infected cells (Hayashi et al., 2000; Lu and Shenk, 1999; Winkler and Stamminger, 1996), which is likewise mediated by its HSV1 homolog ICP27 (Song et al., 2001). However, the underlying mechanism remains to be elucidated.

Fig. 3: Schematic diagram of functional domains within HCMV pUL69. Grey boxes within the protein mark distinct protein domains with known functions. The location of each domain is indicated by numbers corresponding to the flanking amino acids. R1=arginine-rich motif 1; R2=arginine-rich motif 2; RS= arginine/serine-rich region; NLS=nuclear localization signal; NES=nuclear export signal; UAP56=motif for interaction with the cellular DExD/H-box RNA-helicase UAP56; RNA=RNA-binding domain; ICP27-homology= homology region showing the highest degree of sequence conservation, which is present in all members of this herpesviral protein family (compare Fig. 2).

Furthermore, pUL69 has been demonstrated to bind to the cellular transcription elongation factor hSPT6, which is implicated in transcription elongation and chromatin remodelling (Bortvin and Winston, 1996; Winkler et al., 2000). In combination with hSPT4/5, hSPT6 forms a protein complex which can bind to RNA-polymerase II and thereby activates or represses transcription elongation in vitro (Endoh et al., 2004; Hartzog et al., 1998). Importantly, the interaction of pUL69 with this cellular protein might provide a specific mechanism by which

8 Introduction pUL69 can activate gene expression, since pUL69-mutants lacking the hSPT6-interaction domain loose their transactivation potential (Winkler et al., 2000).

Analogous to HSV1 ICP27 and human herpesvirus 8 (HHV8; Human herpesvirus 8) ORF57, one well-conserved characteristic of pUL69 is its ability to self-associate and form high- molecular-mass complexes (Lischka et al., 2007; Malik and Clements, 2004; Zhi et al., 1999). Self-interaction is mediated via the conserved ICP27-homology region present in all members of the family and represents the only common function so far assigned to this domain (Fig. 3).

Moreover, pUL69, in analogy to its counterparts in HSV1 (ICP27) and EBV (EB2), acts as a posttranscriptional transactivator of gene expression (Soliman et al., 1997; Sandri-Goldin, 1998; Buisson et al., 1989; Rice and Knipe, 1988; Winkler et al., 1994) since it facilitates the nuclear export of mRNAs via its capability to shuttle between the nucleus and the cytoplasm and to recruit components of the cellular mRNA-export machinery (Chen et al., 2002; 2005; Cullen, 2003; Lischka et al., 2006; Williams et al., 2005). In order to continuously shuttle between the nucleus and the cytoplasm of an infected or transfected cell, pUL69 possesses an N-terminal, bipartite nuclear localization signal (NLS, aa21-45) and a non-conventional, leptomycin B (LMB)-insensitive nuclear export signal (NES, aa597-624) at its C-terminus, thereby promoting its export in a CRM-1 independent manner (Fig. 3) (Lischka et al., 2001). Moreover, three arginine-rich motifs comprising amino acids 17-46 (R1 and R2) and 123-136 (RS) have also been mapped to the N-terminus of the protein, which are required for direct RNA-binding of pUL69 and overlap in part with its NLS (Fig. 3) (Toth et al., 2006). Furthermore, previous publications demonstrated that pUL69 interacts with the cellular DExD/H-box RNA-helicase UAP56 or its close homolog URH49. The UAP56-interaction motif is also localized at the N-terminus of pUL69 (aa18-30), thereby again partially overlapping with the bipartite NLS and its RNA-binding domain (Fig. 3) (Lischka et al., 2006; Toth et al., 2006). Thus, pUL69 of HCMV targets a cellular mRNA-export factor to facilitate the export of unspliced mRNAs (Chen et al., 2002; Hiriart et al., 2003b; Lischka et al., 2006). Importantly, in the case of HCMV pUL69, loss of its mRNA-export activity occurs either when the protein-protein interaction with UAP56 is inhibited or when its nucleocytoplasmic shuttling activity is blocked (Lischka et al., 2001; 2006). Interestingly, RNA-binding itself seems to be dispensable for the pUL69 mediated mRNA-export, which is in contrast to EB2 or ICP27, where RNA-binding is a prerequisite for their mRNA-export activity (Hiriart et al., 2003a; Lischka et al., 2006; Sandri-Goldin, 1998; Toth et al., 2006).

Infection studies using pUL69 knock-out viruses revealed a considerable replication defect, thereby suggesting that, although not absolutely essential, pUL69 is required for an efficient viral replication (Hayashi et al., 2000). This is in contrast to ICP27 and EB2, which have been demonstrated to be essential for replication of HSV1 or EBV, respectively (Gruffat et al.,

9 Introduction

2002; Sacks et al., 1985). Additionally, complementation studies showed that pUL69 fails to substitute for ICP27 in the context of an HSV1-infection, however, seems to be able to replace EB2 in EBV-infections, at least in part (Gruffat et al., 2002; Winkler et al., 1994).

Cellular mRNA-export in higher eukaryotes One of the characteristic features of higher eukaryotes is the spatial and temporal separation of several cellular processes by the nuclear membrane. Whereas gene transcription and splicing for instance occur in the nucleus, translation of mRNAs to proteins takes place in the cytoplasm. By cellular, well-controlled mRNA-export pathways, these separated processes are tightly interconnected to a linear, sequential arrangement. Several components involved in cellular mRNA-export have been identified during the last years, which, simplified, can be classified into three groups: (i) RNA-adaptor proteins, (ii) receptor proteins that recognize and bind to adapter proteins and (iii) export proteins of the nuclear pore complex (Izaurralde, 2002; Cullen, 2003b). Direct RNA-binding is mediated by the RNA-adaptor proteins: amongst several others, members of the REF protein family are best characterized. REF proteins shuttle between the nucleus and the cytoplasm, directly bind to mRNAs and, in addition, can interact with TAP/p15. This protein functions as a cellular export protein thereby facilitating the translocation of cellular mRNAs from the nucleus into the cytoplasm through the nuclear pores (Strasser and Hurt, 2000; Stutz et al., 2000; Zenklusen et al., 2001; Rodrigues et al., 2001; Erkmann and Kutay, 2004; Segref et al., 1997). The heterodimeric protein TAP/p15 appears to be the major mRNA-export receptor in eukaryotes (Herold et al., 2001; Katahira et al., 1999; Segref et al., 1997) and although TAP/p15 is able to directly interact with RNA in vitro, it is reasonable that additional factors, as for example REF proteins or SR-proteins, are needed to bridge the interaction between TAP and mRNA in vivo (Braun et al., 2001; Gruter et al., 1998; Liker et al., 2000; Huang et al., 2003; Huang and Steitz, 2001).

Another protein that seems to fulfil criteria of an RNA-adaptor protein is the DExD/H-box RNA helicase UAP56. Besides its role for RNA-export, this protein appears to be involved in several further steps of RNA metabolism (Linder and Stutz, 2001; Rocak and Linder, 2004). In analogy to REF, UAP56, also known as U2AF65-associated protein, is able to directly interact with RNA and to shuttle between the nucleus and the cytoplasm (Fleckner et al., 1997; Thomas et al., 2011). Moreover, UAP56 has been demonstrated to recruit REF onto mRNAs, thereby promoting their export via TAP/p15, however, UAP56 must be released from this complex before RNA-export can occur, since binding of UAP56 and TAP/p15 to REF are mutually exclusive (Gatfield et al., 2001; Herold et al., 2003; Luo et al., 2001; Strasser and Hurt, 2001). Interestingly, URH49 (UAP56 related helicase 49kDa) has recently been discovered in mammalian cells, a protein which shares ~90% amino acid sequence identity with UAP56 and appears to exert similar or redundant functions (Pryor et al., 2004). As UAP56 has been identified initially as a U2AF65-associated protein, it was denoted to be a

10 Introduction component involved in the splicing process (Fleckner et al., 1997). In order to control, help and monitor correct exon-exon connection during splicing, the so-called exon-junction complex (EJC), is deposited upstream of the splice site by a large number of nuclear factors. Proteins within the EJC have been shown to fulfil diverse functions in mRNA processing either during splicing, translation or nonsense mediated mRNA decay (NMD). Yet, they also confer interaction partners for cellular mRNA-export factors, thereby directly coupling splicing to mRNA-export (Lykke-Andersen et al., 2001; Le Hir et al., 2000; 2001). This is further underlined by the fact, that both REF as well as UAP56 have been demonstrated to interact with both components of the splicing machinery and the EJC, indicating that they are responsible for the export of spliced mRNAs (Reed and Hurt, 2002; Reed, 2003). However, it is noteworthy, that both REF and UAP56 have also been implicated in the export of intron- containing, unspliced mRNAs, indicating that these mRNA-export factors can alternatively be loaded onto nascent mRNAs (Gatfield et al., 2001; Jensen et al., 2001; Kiesler et al., 2002; Lei and Silver, 2002; Rodrigues et al., 2001; Strasser and Hurt, 2000). Indeed, UAP56 and REF are recruited cotranscriptionally to nascent mRNA (Lei et al., 2001; Zenklusen et al., 2002). Studies in yeast revealed an interaction of UAP56 with the transcription elongation factor Hpr1, a constituent of the transcription elongation complex (THO) (Abruzzi et al., 2004; Zenklusen et al., 2002; Rondon et al., 2003). Moreover, by interaction of UAP56, REF, and presumably also TAP/p15, with components of THO, a multi-protein complex - the so-called TREX-complex (transcription export complex) - is built up, which couples transcription- elongation with mRNA-export and is conserved form yeast to human (Strasser et al., 2002).

Nuclear mRNA-export of herpesviruses Most DNA-viruses, as for example herpesviruses, replicate within the nucleus of their host cell, thereby exploiting several cellular processes and pathways. Interestingly, while most of the human transcripts undergo splicing, the majority of the herpesviral transcriptome is intronless. Yet, since mRNA-export in eukaryotes is directly coupled to splicing, herpesviruses are dependent on the nuclear export and subsequent translation of unspliced transcripts. Moreover, by the establishment of a stringent surveillance system, eukaryotic cells ensure a proper biogenesis of their mRNAs. This control system resembles an intrinsic defence of eukaryotic cells against pathogens, which detects, retains and destroys partially or completely unspliced transcripts (Hilleren et al., 2001; Houseley et al., 2006). In order to overcome this hurdle, herpesviruses, amongst others, have evolved strategies to promote the nuclear export of otherwise inefficiently exported viral mRNAs via exploitation of distinct nuclear export pathways. As already mentioned above, all herpesviruses encode for a group of homologous regulatory proteins – the ICP27-protein family – which specifically facilitate the nuclear export of viral intronless mRNAs (Sandri-Goldin, 2004). The prototype of these virus-encoded mRNA-export factors is the HSV1 encoded multifunctional protein ICP27

11 Introduction

(Sandri-Goldin, 2001). It has been demonstrated that ICP27 directly binds to RNA, shuttles between the nucleus and the cytplasm in a CRM1-independent manner (Fig. 4A). Moreover, it interacts with the cellular mRNA-export factor REF and hence the mRNA-export receptor TAP/p15, thereby facilitating the nuclear export of viral intronless HSV1 transcripts to the cytoplasm (Fig. 4A) (Chen et al., 2002; 2005; Koffa et al., 2001; Phelan and Clements, 1997; Sandri- Goldin, 1998; 2004; Soliman et al., 1997). Moreover, in analogy to ICP27, it has been described that the gammaherpesviral homologs EB2 of Epstein-Barr virus (EBV), ORF57 of Kaposi`s sarcoma associated herpesvirus (KSHV, HHV8) and ORF57 of Herpes virus saimiri (HVS) also exert nucleocytoplasmic shuttling activity and export their intronless transcripts by interaction with REF and TAP (Bello et al., 1999; Farjot et al., 2000; Hiriart et al., 2003b; Malik et al., 2004; Semmes et al., 1998; Williams et al., 2005). As already mentioned above, pUL69 of HCMV represents the best characterized betaherpesviral ICP27-homolog. Yet, in contrast to ICP27 or EB2, pUL69 intervenes with the cellular mRNA-export pathway upstream of REF by interaction with UAP56 (Fig. 4B) (Lischka et al., 2006). Moreover, whereas nucleocytoplasmic shuttling activity was also found to be absolutely essential for the pUL69-mediated accumulation of unspliced RNAs, direct RNA-binding was dispensable for the stimulatory effect on mRNA-export, thereby indicating functional differences to ICP27 and EB2 (Toth et al., 2006; Hiriart et al., 2003a; Sandri-Goldin, 1998).

A B Fig. 4: Nuclear mRNA-export of herpesviruses. (A) ICP27 represents the HSV1 encoded mRNA-export factor, which binds to intronless viral mRNAs and interacts with the cellular RNA-export factor REF, thereby facilitating the nuclear export of transcripts via the cellular export receptor TAP/p15. (B) The ICP27- homolog of HCMV, pUL69, recruits the cellular DExD/H-box RNA-helicase UAP56 to intronless viral mRNAs. UAP56 then interacts with REF thereby promoting the nuclear export of HCMV transcripts presumably via TAP/p15 through the nuclear pore compex (NPC).

Importantly, until today there is no evidence for any sequence-specificity in RNA-binding and export of ICP27, EB2, or pUL69 in vitro (Hiriart et al., 2003a; Mears and Rice, 1996; Toth et al., 2006). However, there exist several indications implying a selectivity of RNA-targeting by these mRNA-export factors in vivo: for instance, it has been demonstrated that ICP27 selectively binds to HSV1 intronless rather than intron-containing RNAs and that EB2 selectively exports a set of EBV-replication genes and late-mRNAs (Sandri-Goldin, 1998; Batisse et al., 2005; Semmes et al., 1998). In addition, recent studies identified distinct

12 Introduction response-elements within the mRNAs of HSV1 or HVS, which are specifically recognized by the corresponding mRNA-export factors ICP27 or ORF57, respectively (Colgan et al., 2009; Sedlackova et al., 2010). In contrast, not a single target of the pUL69 mediated mRNA-export has been identified so far, even though it seems very likely that pUL69 also exerts sequence- specificity in RNA-binding, since it was demonstrated that it efficiently binds to CAT-reporter- but not to GAPDH-mRNA (Toth et al., 2006). Whether primary nucleotide sequences, secondary RNA-structures and/or distinct protein-protein interactions confer and define the RNA-binding specificity of the herpesvirus encoded mRNA-export factors is under intense investigation.

13 Objectives

C Objectives

Human cytomegalovirus (HCMV) has still to be considered as an important, ubiquitous pathogen causing severe and even fatal pathologies in immunocompromised patients and newborns. In order to define novel targets for anti-cytomegaloviral treatment, current research focuses on the interaction of HCMV with its host cell, thus giving insight into regulatory processes during infection. All family members of the Herpesviridae encode pleiotropic transactivator proteins with homology to ICP27 of HSV1, that function as viral mRNA-export factors facilitating the nuclear export of herpesviral, intronless mRNAs. For pUL69 of HCMV, the prototype of ICP27-homologs within the Betaherpesvirinae, nucleocytoplasmic shuttling activity as well as interaction with the cellular DExD/H-box RNA helicases UAP56 or URH49 have been demonstrated to be prerequisites for its mRNA-export activity. In contrast, direct RNA-binding appears to be dispensable. Interestingly, however, protein domains within pUL69 required for these functions share only minor sequence conservation with its alpha- and gammaherpesviral counterparts. Therefore, one aim of this study was the functional characterization of pUL69-homologs encoded by various related betaherpesviruses in order to identify conserved and unique features within this protein family. Using a broad variety of experimental setups, the pUL69-homologs of chimpanzee cytomegalovirus (CCMV, pC69), rhesus cytomegalovirus (RhCMV, pRh69), murine herpesvirus (MCMV, pM69), human herpesvirus type 6 (HHV6, pU42) and elephant endotheliotropic herpesvirus (ElHV1, pU42) should therefore be characterized in detail and ultimately help to understand the functional mechanisms by which these viral proteins are able to access and manipulate the cellular machinery particularly for nuclear mRNA-export. Moreover, even though pUL69 was demonstrated to act as the HCMV-encoded mRNA- export factor, natural mRNA-targets have not been identified so far. Therefore, RNA- immunoprecipitation experiments should be performed to confirm the RNA-binding capacity of pUL69 and to identify viral and cellular mRNAs that are associated with pUL69 during HCMV-infection. Additionally, a cDNA-library of pUL69 coprecipitated mRNAs should be established and evaluated to identify further natural pUL69 target-mRNAs. Finally, the in vivo role of pUL69 associated mRNAs during HCMV-replication should be elucidated by semi- quantitative RT-PCRs. The characterization of these mRNAs will shed more light onto the role of pUL69 for the regulation of viral and cellular gene expression.

14 Materials and Methods

D Materials and Methods

1. Biological Materials 1.1. Bacteria

Escherichia coli DH10B: F- endA1 hsdR17 (r -, m +) supE44 thi-1 λ- recA1 gyrA96 relA1 k k deoRΔ Δ(lacZYA-argF)-U169 φ80lacZΔM15 (Grant et al., 1990).

b Escherichia coli GS1783: DH10B [λcl857 (cro-bioA) <> araC-PBADflpe] (Lee et al., 2001).

One Shot® TOP10 Electrocomp™ E. coli: F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139Δ (ara-leu) 7697 galU galK rpsL(StrR) endA1 nupG λ- (Invitrogen, Karlsruhe, Germany).

1.2. Eukaroytic cell cultures HEK293T: human embryonic kidney epithelial cell line, transformed by adenovirus type 5 (Ad5) that contains the simian virus 40 (SV40) large tumor antigen (T Ag) (Pear et al., 1993). HeLa: Human papilloma virus positive- (HPV+) human cervical carcinoma cell line (Nelson- Rees and Flandermeyer, 1976). HFF: HCMV-permissive primary human foreskin fibroblasts, isolated from foreskin tissue of newborns. NIH3T3: mouse embryonic fibroblast cell line (Todaro and Green, 1963).

1.3. Virus strains HCMV AD169: laboratory HCMV-strain isolated by Rowe and colleagues (Rowe et al., 1956). HCMV AD169-UL69mutUAP56: AD169-derived recombinant HCMV encoding the amino acid replacement mutant pUL69 R22,23,25,26A (Zielke et al., 2011). HCMV AD169-UL69ΔR1ΔRS: AD169-derived recombinant HCMV expressing an internal deletion mutant of pUL69, lacking aa17-30 and aa123-139 of the protein (Zielke et al., 2011). HCMV AD169-UL69ΔR2ΔRS: HCMV AD169-mutant expressing an internal deletion mutant of pUL69, ΔR2ΔRS, lacking arginine/serine-rich motifs spanning aa36-50 and aa123-139 (Zielke et al., 2011). HCMV AD169ΔUL69: HCMV AD169-mutant derived from HCMV AD169 by deletion of the UL69 gene. Genomic sequences from nucleotides 128922 to 131156 were removed from the AD169 genome. HCMV AD169-FLAG-UL69: AD169-derived recombinant HCMV coding for a FLAG-tagged version of pUL69. HCMV AD169-FLAG-M69: AD169-derived recombinant HCMV in which the UL69 gene was replaced by the homologous region of MCMV (M69) in fusion with an N-terminal FLAG- epitope. HCMV AD169-FLAG-Ch1: AD169-derived recombinant HCMV expressing a chimeric protein consisting of aa12-50 of HCMV pUL69 fused to the N-terminus of MCMV pM69. In addition the chimeric protein contains an N-terminal FLAG-epitope for detection.

15 Materials and Methods

1.4. Antibodies 1.4.1. Monoclonal antibodies M2: mouse monoclonal antibody directed against the synthetic FLAG-epitope (DYKDDDDK) (Sigma-Aldrich, Deisenhofen, Germany). MAb-β-actin: mouse monoclonal antibody directed against the cellular protein β-actin (Sigma-Aldrich, Deisenhofen, Germany). MAb-β-galactosidase: mouse monoclonal antibody directed against β-galactosidase of E. coli (Roche, Mannheim, Germany). MAb-Myc (9E10): mouse monoclonal antibody (hybridoma supernatant) directed against the Myc-epitope (MEQKLISEDL) (provided by Dr. S. Lang, Erlangen, Germany). MAb-UL44: mouse monoclonal antibody to the viral DNA-polymerase processivity factor UL44 of HCMV (provided by Prof. Bodo Plachter, Mainz, Germany). MAb 28-4: mouse monoclonal antibody to the viral major capsid protein MCP (pUL86) (Waldo et al., 1989). MAb 41-18: mouse monoclonal antibody for detection of the viral tegument protein pp28 (pUL99) (Sanchez et al., 2000). MAb 63-27: mouse monoclonal antibody for detection of IE1 (pUL123) (Winkler et al., 1994; Andreoni et al., 1989). MAb 65-33: mouse monoclonal antibody for detection of pp65 (pUL83), kindly provided by PhD W. Britt (Birmingham, USA). MAb 69-66: mouse monoclonal antibody for detection of the viral tegument protein pUL69 (Winkler et al., 1994).

1.4.2. Polyclonal antibodies Anti-FLAG: rabbit polyclonal antibody directed against the FLAG-epitope (DYKDDDDK) (Sigma-Aldrich, Deisenhofen, Germany). Anti-pHM178: rabbit polyclonal antibody directed against aa135-579 of the HCMV protein IE2p86 (Hofmann et al., 2000). Anti-UL26: rabbit polyclonal antibody for detection of pUL26 (Stamminger et al., 2002). Anti-UL69: rabbit polyclonal antisera for detection of the viral transactivator protein pUL69 (Winkler et al., 1994). Anti-UL84: rabbit polyclonal antibody for detection of pUL84 (Gebert et al., 1997). Anti-UL97: rabbit polyclonal antisera directed against the viral protein kinase pUL97 (Marschall et al., 2003). SA2932: rabbit polyclonal antibody for detection of the viral tegument protein pp71 (pUL82).

1.4.3. Secondary antibodies All secondary antibodies were purchased from Dianova (Hamburg, Germany). - HRP-(horseradish peroxidase) coupled goat-anti-mouse IgG (H+L) - HRP-coupled goat anti-rabbit IgG (H+L) - Cy3-conjugated goat anti-mouse IgG (H+L) - FITC-conjugated goat-anti-rabbit IgG (H+L)

16 Materials and Methods

2. Nucleic acids 2.1. Oligonucleotides All oligonucleotides were obtained from biomers.net GmbH (Ulm, Germany). The primer sequences (annotated 5` to 3`) used for PCR-cloning, PCR-mutagenesis, nucleotide sequencing analysis, RT-PCR, BACmid mutagenesis or quantitative real-time PCR are listed below. Restriction enzyme cleavage sites are highlighted in bold. a) Sequencing primers: HA-seq ATGTACCCATACGATGTTCCAGATTACGCT M13for GTAAAACGACGGCCAG M13rev CAGGAAACAGCTATGAC Sp6 CATTTAGGTGACACTATAG T7 TAATACGACTCACTATAGGG b) Primers for PCR-cloning: 5`CCMVC69nestedO GCCGCGCTTTCCGCGTGCCC 3`CCMVC69nestedO GAACATCCGAATCGGGGTGG 5`CCMVC69nestedI ATATATTAGCAGGCCGCGTG 3`CCMVC69nestedI GGGAGAGAGACAGGCAAGTC 5`CCMV69EcoRV GCTAGATATCCATGGAGCTGCACGGGCGTG 3`CCMV69XhoI CAGTCTCGAGTCAGTACTCGTCCATGTCGTCGCTG 5ÈlHV1U42nested CAGCTAGATGATCTGTCCCC 3ÈlHV1U42nested CATAGTATAATGATCCGAGG 5ÈlHV1U42nestedI GGGAACAGCAACGCCAGCAG 3ÈlHV1U42nestedI CGCTACACATTATAAATTGC 5ÈlHV1U42BamHI GCATGGATCCATGGAATCTGGAAGGCGG 3ÈlHV1U42EcoRI GCATGAATTCCTACAGCGTCATATCGCTC 5`HHV6U42BamHI CAGTGGATCCTATCCTCGTGGAGTAAAACGCTC 3`HHV6U42XhoI CAGTCTCGAGTTATTCTGAGTCAGAAGAACATG 5`MCMV69EcoRV ATCGGATATCCATGCTGCGGACCGGTGTCAAGAGACG 3`MCMV69XbaI ATCGTCTAGACTAGTCAGTCAGAGTCCATCTCGCTGTAGG 5`M69aa1EcoRV ATCGGATATCATGCTGCGGACCGGTGTCAAGAGACG 5`RhCMV69BamHI CAGTGGATCCTCATTCGAACGCGAAGAACGTGC 3`RhCMV69XhoI CAGTCTCGAGCTACAAATATCCCTCTTCATCGTC 5`Rh69aa199EcoRI CAGTGAATTCGCGCTCATCAATCAGGAGCTTGATAGC 5`TULPseedBamHI GCATGGATCCACGACCAACTCATACACCTC 3`TULPseedEcoRV GCATGATATCAGGTTTGAGGGGGAATG 5ÙL69aa1BamHI GATCGGATCCATGGAGCTGCACTCACGCGGC

17 Materials and Methods

5ÙL69aa12BamHI CGATGGATCCCCGTCGTTATCTTCCCTGAG 3ÙL69aa50EcoRV CGATGATATCCGGCGAGGTTGGACTTCGCTCG 3ÙL69aa140EcoRV CGATGATATCGGCCACGCGTCGCTTGAAAGAGGAGGACG 3ÙL69aa207EcoRI CAGTGAATTCCAGCATCTGTTGTTGTTGCGG c) Primers for site-directed mutagenesis: 5`C69mutUAP CCTCAGCGAGCGAGAAGCCGCCGCGGCCGCGGCACGGCG CTTCTG 3`C69mutUAP CAGAAGCGCCGTGCCGCGGCCGCGGCGGCTTCTCGCTCGC TGAGG 5`Rh69mutUAP GCGACCGAGAACGCCGTGCTCGGCGGGCACGGCGCTTCTG 3`Rh69mutUAP GCAGAAGCGCCGTGCCCGCCGAGCACGGCGTTCTCGGTCG d) Primers for generation of a linear recombination cassette and verification of recombinant BACmids: 5`ΔUL69kana GTAACGGGATAAGGGACAGCAATCATCACGCACAACACCCT TCACTCTCTTTGGATGACGACGATAAGTAGGG 3`ΔUL69kana CTATATATACATCAGCGTGCCCGAACGTGACCTTCCTAGCGA CGGCGGCCAAAGAGAGTGAAGGGTGTTGTGCGTGATGATTG CTGTCCCTTATCCCGTTACAACCAATTAA 5ÙL69rev-kana TTTTTGCTAGCAGTCAAGATCTGGTACGAGCCACGGATCGAC ACGGGGACACCGTCGTCTAGGATGACGACGATAAGTAGGG 3ÙL69rev-kana TTTTTGCTAGCAACCAATTAACCAATTCTGATTAG 3ÙL69rev TAACGGGATAAGGGACAGCAATCATCACGCACAACACCCTTC ACTCTCTTTTTAGTCATCCATATCATCG 5`FLAG CTATATATACATCAGCGTGCCCGAACGTGACCTTCCTAGCGA CGGCGGCCATGGACTACAAAGACGATGAC 5`M69/Ch7-kana TTTTCCGCGGCGACAGCGCGCCGTCTCGAAAATCTCAACAG TCTCAACAGCAGCCCGAGAGGATGACGACGATAAGTAGGG 3`M69/Ch7-kana TTTTCCGCGGAACCAATTAACCAATTCTGATTAG 3`M69/Ch7 TAACGGGATAAGGGACAGCAATCATCACGCACAACACCCTTC ACTCTCTTTTCAGTCAGAGTCCATCTCG NtermofUL69 CAACGCCAAAAACGTCCAC CtermofUL69 CACCAAGCTCAGGCACGC

18 Materials and Methods e) Primers for RT-PCR and quantitative SYBR-Green and Taqman PCR: CAT5 CGTTGATATATCCCAATGGC CAT3 GCATGATGAACCTGAATCGC 698GAP5 GTACGTCGTGGAGTCCACTG 698GAP3 TCCACCACCCTGTTGCTGTA 5`luc CGATTTATCTAATTTACACGAAATTGC 3`luc ATGGCGGCCGCCACGGCGATCTTTCCGCC 5ÙL44BamHI CGATGGATCCAATGGATCGCAAGACGCGCCTC 3ÙL44SalI GCATGTCGACCATGTTTTTCACGCCGTGGAAACTGACGCGG 5`pp65UL83BamHI CGATGGATCCAATGGAGTCGCGCGGTCG 3`pp65UL83XhoI GCATCTCGAGGGCCAGTCCCGAGACCGTGAG 5`pp71UL82 CATAGGATCCAGTTCGCCTTTCGCGCCG 3`pp71UL82 CATACTCGAGTTCTATGGAGACGCCCGGG 5`MCP_UL86 GCACGTCAGTTATCATC 3`MCP_UL86 TGAGCGACGAGAACGGC 5`pp28UL99BamHI GCATGGATCCATGGGTGCCGAACTCTGC 3`pp28UL99EcoRI GCATGAATTCTTAAAAGGGCAAGGAGGCGGC 5ÌE1RNA CGATATGGAGTCCTCTGCCAAGAGAAAGATGG 3ÌE1RNA CGATTCTTCCGTCTGGGTATATTTTTTCAGC 5ÙL65 GCATTCATGTTACTACGTGTGTGTTTTTTGC 3ÙL65 GCATGACGAACCACATCATCTTTTTTTTATGTTGC 5`CDC42_BamHI GCATGGATCCATGCAGACAATTAAGTGTG 3`CDC42_XhoI GCATCTCGAGTCATAGCAGCACACACC 5`TULP1/3 GCATAAGCTKAGRTCCAACCTCMTGGGGA 3`TULP1/3 GCATGTGGACWATCTGGAAGTTCTT 5`TULPseed GCATGGATCCACGACCAACTCATACACCTC 3`TULPseed GCATGATATCAGGTTTGAGGGGGAATG CMV5` AAGCGGCCTCTGATAACCAAG CMV3` GAGCAGACTCTCAGAGGATCGG CMV MIE FAM/TAMRA CATGCAGATCTCCTCAATGCGGCG f) Primers for generation of a cDNA-library after RNA-immunoprecipitation 5`Biotin-AttB1-HA TCGTCGGGGCCAACTTTGTACAAAAAAGTTGGATGTACCCAT ACGATGTTCCAGATTACGCT

3`d(T)n-AttB2-Biotin GGCGGCCGCCCAACTTTGTACAAGAAAGTTGGGTTTTTTTTT TTTTTTTTTTT

19 Materials and Methods

2.2. Vectors and plasmids 2.2.1. Vectors and vector systems pCB6: mammalian expression vector driven by an HCMV promoter that also carries a neomycin selection cassette (Brewer, 1994). pCATCH, pSuperCATCH: mammalian expression vector for FLAG-fusion proteins that contains an ampicilin resistence gene for selection in bacteria (Georgiev et al., 1996). pcDNA3: mammalian expression vector driven by the HCMV major-IE-enhancer/promoter that carries a neomycin and an ampicillin selection cassette and contains the SV40 polyadenylation signal (Invitrogen, Karlsruhe, Germany). pDS-Red-N1: vector encoding the red fluorescent protein (Clontech, Palo Alto, USA). pEPkan-S: eukaryotic expression vector encoding the kanamycin resistence gene aphAI as well as two I-SceI restriction sites in opposite orientation and one sequence encoding the FLAG epitope in the backbone of pcDNA3 (Invitrogen, Karlsruhe, Germany). pDONR™221: prokaryotic vector for directional cloning of PCR products with the Invitrogen Gateway Technology (Invitrogen, Karlsruhe, Germany). The pDONR™221 vector has a pUC origin and universal M13 sequencing sites.

2.2.2. Ready-to-use DNA constructs FLAG-UAP56: eukaryotic expression vector coding for UAP56 with an N-terminal FLAG- epitope (Momose et al., 2001). Cre recombinase: eukaryotic expression vector for Cre recombinase, kindly provided by Dr. G. Hahn (Munich, Germany). pCB6-pp71: eukaryotic expression vector encoding the HCMV tegument protein pp71 (Lorz et al., 2006). pCFN-β-Gal: eukaryotic expression plasmid encoding β-galactosidase fused to the nuclear export signal (NLS) of SV40 T Ag (Roth and Dobbelstein, 1997). pCFN-rev-β-Gal: plasmid encoding β-galactosidase in fusion with the NLS of SV40 T Ag and HIV1 Rev protein (Roth and Dobbelstein, 1997). pcRev: eukaryotic expression plasmid encoding HIV1 Rev protein obtained from J. Hauber (Hamburg, Germany). pcRex: eukaryotic expression plasmid encoding HTLV Rex protein obtained from J. Hauber (Hamburg, Germany). pDM128/CMV/RRE: chloramphenicol acetyltransferase (CAT) reporter plasmid, which contains an intronic CAT-reporter gene along with the HIV1 Rev-responsive element (RRE) (Cullen, 2004). pDM128/CMV/RRE: CAT-reporter plasmid which contains an intronic CAT-gene along with the HTLV1 Rex-responsive element (RxRE) (Cullen, 2004). pF299: reporter plasmid coding for CAT under control of the HSV1 thymidine kinase promoter (Luckow and Schuetz, 1987). pF305: eukaryotic expression vector encoding the reporter protein luciferase driven by the thymidine kinase promoter of HSV1 (Winkler et al., 1994). pEF-pp65: eukaryotic expression plasmid encoding full-length pp65 (UL83) of HCMV (von Einem, Ulm, Germany). pHM160: eukaryotic plasmid encoding full-length pUL69 of HCMV in the pCB6 vector (Winkler et al., 1994). pHM323: pCB6-based eukaryotic expression vector coding for the HCMV polymerase processivity factor pUL44 (Winkler, 1995, unpublished).

20 Materials and Methods pHM494: pcDNA3-based eukaryotic expression plasmid coding for the HCMV immediate early gene product IE1p72 (Mueller, 1996, unpublished). pHM971, 972: pcDNA3-based eukaryotic expression vector for the construction of N-terminal in frame fusions to a FLAG-epitope or a FLAG-tag plus the SV40 T Ag nuclear localization signal (NLS), respectively (Hofmann et al., 2000; 2002). pHM1356: eukaryotic expression plasmid coding for the HCMV tegument protein pp28 (UL99) (Winkler, 1999, unpublished). pHM1580: pcDNA3-based eukaryotic expression vector for the construction of N-terminal in frame fusions to a Myc-epitope (Hofmann et al., 2002). pHM1752: pHM1580-based plasmid coding for N-terminally Myc-tagged pM69 of MCMV (Trommer, MD thesis, 2001). pHM2098: pHM971-based eukaryotic expression vector coding for FLAG-pUL69 (Lischka et al., 2006). pHM2202: pHM971-based plasmid coding for FLAG-tagged URH49 (Lischka et al., 2006). pHM2213: eukaryotic expression vector encoding the HCMV tegument protein pp71 (UL82) with a C-terminal His-tag (Tavalai, 2004, unpublished). pHM2235: pHM1580-based plasmid coding for N-terminally Myc-tagged pUL69 (Lischka et al., 2007). pHM2316: pHM971-based plasmid encoding the amino acid replacement mutant pUL69 R22,23,25,26A unable to interact with UAP56 (Lischka et al., 2006). pHM2317: pHM971-based plasmid encoding the amino acid replacement mutant pUL69 R39,40,42,43A unable to localize to the cell nucleus with an N-terminal FLAG-epitope (Lischka et al., 2007). pHM2322: pHM971-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa17-30 (ΔR1) (Toth et al., 2006). pHM2323: pHM971-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa36-50 (ΔR2) (Toth et al., 2006). pHM2324: pHM971-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa123-139 (ΔRS) (Toth et al., 2006). pHM2325: pHM971-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa17-30 and aa123-139 (ΔR1ΔRS) (Toth et al., 2006). pHM2326: pHM971-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa36-50 and aa123-139 (ΔR2ΔRS) (Toth et al., 2006). pHM2328: pHM972-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa36-50 (ΔR2) fused to the SV40 T Ag NLS (Toth et al., 2006). pHM2330: pHM972-based eukaryotic plasmid encoding N-terminally FLAG-tagged pUL69 with internal deletion of aa36-50 and aa123-139 (ΔR2ΔRS) fused to the SV40 T Ag NLS (Toth et al., 2006). pHB5: Bacterial artificial chromosome (BACmid) comprising the HCMV genome of the laboratory strain AD169 (Borst et al., 1999). pHB15: BACmid containing the genomic sequence of the HCMV laboratory strain AD169 (Hobom et al., 2000). pHM2890: pHB5-based BACmid encoding the amino acid replacement mutant pUL69 R22,23,25,26A (Zielke et al., 2011). pHM2891: pHB5-based HCMV BACmid encoding an internal deletion mutant of pUL69 lacking aa17-30 and aa123-139 of the protein (Zielke et al., 2011).

21 Materials and Methods pHM2892: pHB5-based HCMV BACmid encoding an internal deletion mutant of pUL69, ΔR2ΔRS, lacking arginine/serine-rich motifs spanning from aa36-50 and aa123-139 (Zielke et al., 2011). pHM2889: pHB5-based BACmid comprising the HCMV genome of laboratory strain AD169. This recombinant BACmid was generated via homologous recombination by exchanging mutated versions of the UL69 gene (pHM2890, pHM2891, pHM2892) into wild type UL69 sequence and therefore represents a markerless UL69-revertant (Zielke et al., 2011). pMF335-6: Cosmid containing parts of the genome of HHV6 strain U1102 including the open reading frame (ORF) for U42. (Neipel et al., 1991). pMF311-12: Cosmid containing parts of the genome of HHV6 strain U1102 ORF for U42. (Neipel et al., 1991).

2.2.3. Newly generated plasmids and BACmids pHM2837: pHM971-based eukaryotic expression vector coding for FLAG-pRh69 of RhCMV (Zielke et al., 2011). pHM2838: pHM1580-based plasmid coding for N-terminally Myc-tagged pRh69 of RhCMV (Zielke et al., 2011). pHM2839: pHM971-based eukaryotic expression vector coding for FLAG-pM69 of MCMV (Zielke et al., 2011). pHM2840: pHM971-based eukaryotic expression vector coding for FLAG-pU42 of HHV6 (Zielke et al., 2011). pHM2841: pHM1580-based plasmid coding for N-terminally Myc-tagged pU42 of HHV6 (Zielke et al., 2011). pHM2875: pHM971-based eukaryotic expression vector coding for FLAG-pU42 of ElHV1 (Zielke et al., 2011). pHM2876: pHM1580-based plasmid coding for N-terminally Myc-tagged pU42 of ElHV1 (Zielke et al., 2011). pHM2960: pHM971-based eukaryotic expression vector coding for FLAG-pC69 of CCMV (Zielke et al., 2011). pHM2961: pHM1580-based plasmid coding for N-terminally Myc-tagged pC69 of CCMV (Zielke et al., 2011). pHM3090: pHM1580-based plasmid encoding the amino acid replacement mutant pUL69 R22,23,25,26A unable to interact with UAP56 (Zielke et al., 2011). pHM3055: pHM971-based plasmid encoding the amino acid replacement mutant pC69 R22,23,25,26A unable to interact with UAP56 with an N-terminal FLAG-epitope (Zielke et al., 2011). pHM3069: pHM1580-based plasmid encoding the amino acid replacement mutant pC69 R22,23,25,26A unable to interact with UAP56 with an N-terminal Myc-epitope (Zielke et al., 2011). pHM3054: pHM971-based plasmid encoding the amino acid replacement mutant pRh69 Q83R with an N-terminal FLAG-epitope (Zielke et al., 2011). pHM3068: pHM1580-based plasmid encoding the amino acid replacement mutant pRh69 Q83R with an N-terminal Myc-epitope (Zielke et al., 2011). pHM3052: pHM971-based plasmid encoding a chimeric protein consisting of aa1-207 of HCMV pUL69 and aa199-777 of RhCMV pRh69 in fusion with an N-terminal FLAG-epitope. pHM3157: pHM971-based plasmid encoding a chimeric protein consisting of aa12-50 of HCMV pUL69 and aa1-843 of MCMV pM69 in fusion with an N-terminal FLAG-epitope.

22 Materials and Methods pHM3158: pHM1580-based plasmid encoding a chimeric protein consisting of aa12-50 of HCMV pUL69 and aa1-843 of MCMV pM69 in fusion with an N-terminal Myc-epitope. pHM3159: pHM971-based plasmid encoding a chimeric protein consisting of aa12-50 of HCMV pUL69mutUAP56 (pHM2316; R22,23,25,26A) and aa1-843 of MCMV pM69 in fusion with an N-terminal FLAG-epitope. pHM3160: pHM1580-based plasmid encoding a chimeric protein consisting of aa12-50 of HCMV pUL69mutUAP56 (pHM2316; R22,23,25,26A) and aa1-843 of MCMV pM69 in fusion with an N-terminal Myc-epitope. pHM3266: pHM971-based plasmid encoding a chimeric protein consisting of aa1-140 of HCMV pUL69 and full-length pM69 of MCMV in fusion with an N-terminal FLAG-epitope. pHM3267: pHM1580-based plasmid encoding a chimeric protein consisting of aa1-140 of HCMV pUL69 and full-length pM69 of MCMV in fusion with an N-terminal Myc-epitope. pHM3268: pHM971-based plasmid encoding a chimeric protein consisting of aa1-140 of HCMV pUL69mutUAP56 (pHM2316, R22,23,25,26A) and full-length pM69 of MCMV in fusion with an N-terminal FLAG-epitope. pHM3269: pHM1580-based plasmid encoding a chimeric protein consisting of aa1-140 of HCMV pUL69mutUAP56 (pHM2316, R22,23,25,26A) and full-length pM69 of MCMV in fusion with an N-terminal Myc-epitope. pHM3546: pHM2098-based expression plasmid comprising the wild type HCMV UL69 gene with an internal insertion of the kanamycin resistance gene aphAI. The plasmid also comprises a restriction site for the homing endonuclease I-SceI. pHM3547: pHM2839-based expression plasmid comprising the wild type MCMV M69 gene with an internal insertion of the kanamycin resistance gene aphAI. The plasmid also comprises a restriction site for the homing endonuclease I-SceI. pHM3548: pHM3157-based expression plasmid comprising the coding sequence for a chimeric protein consisting of pUL69aa12-50 and full-length pM69. The plasmid contains an internal insertion of the kanamycin resistance gene aphAI, as well as a restriction site for the homing endonuclease I-SceI. pHM3560: pHB15-based HCMV BACmid in which the genomic sequence of the UL69 gene, spanning nucleotides 128922 to 131156, was removed from the AD169 genome. pHM3564: pHB15-based HCMV BACmid encoding pUL69 with an N-terminal FLAG-epitope. pHM3565: pHB15-based HCMV BACmid in which the UL69 gene was replaced by its homologous region of MCMV (M69) in fusion with an N-terminal FLAG-epitope. pHM3566: pHB15-based HCMV BACmid expressing a chimeric protein consisting of aa12- 50 of HCMV pUL69 and aa1-843 of MCMV pM69 in fusion with an N-terminal FLAG-tag instead of wild type pUL69. pHM3608: pHM971-based plasmid harboring the nucleotide sequence corresponding to putative pUL69 target-mRNA(s) of Tubby-like-proteins (TULP). The sequence was derived after sequence alignment of highly similar RNAs that were coprecipitated by pUL69 from AD169-infected HFFs during cDNA-library generation.

23 Materials and Methods

2.3. Additional nucleic acids Gene RulerTM: DNA-ladder for determination of size and approximate yield of double- stranded DNA in agarose gels obtained from Fermentas (St. Leon-Rot, Germany). Genomic CCMV DNA: genomic CCMV DNA was a generous gift of G. Hayward (Baltimore, USA). Genomic ElHV1 DNA: genomic ElHV1 DNA was kindly provided by B. Ehlers (Robert Koch Institute, Berlin, Germany). Genomic RhCMV DNA: genomic RhCMV DNA was a kind gift of M. Mach (Institute for Clinical and Molecular Virology, Erlangen, Germany).

3. Enzymes, chemicals and media 3.1. Enzymes The applied restriction enzymes were purchased from Fermentas (St. Leon-Rot, Germany), Invitrogen (Karlsruhe, Germany), New England Biolabs (Frankfurt, Germany) or Roche (Mannheim, Germany) and used with the provided buffers according to the manufacturer’s instructions. Vent DNA-polymerase was obtained from New England Biolabs (Frankfurt, Germany), shrimp alkaline phosphatase from Fermentas (St. Leon-Rot, Germany), T4 DNA Ligase from Invitrogen (Karlsruhe, Germany), T4 RNA Ligase from Epicentre Biotechnologies (Madison, USA), DNase I from Roche (Mannheim, Germany), RNase A from Sigma-Aldrich (Deisenhofen, Germany), RNaseH from Roche (Mannheim, Germany), Tobacco acid pyrophosphatase from Epicentre Biotechnologies (Madison, USA) were utilised with buffers recommended and according to the manufacturer’s protocols.

3.2. Media 3.2.1. Bacterial media LB medium (Luria-Bertani medium): 10g of Bactotryptone, 5g of Bacto yeast, 8g of NaCl and 1g of glucose were dissolved in 1 liter of water and adjusted to a pH of 7.2 using NaOH followed by autoclaving. Depending on the requirements, ampicillin (100μg/ml), kanamycin (30μg/ml) or chloramphenicol (15μg/ml) was added. LB agar (Luria-Bertani agar): 15g of agar were dissolved in 1 liter of LB medium followed by autoclaving. After cooling down to about 55°C, ampicillin (50mg/ml), kanamycin (15mg/ml), chloramphenicol (15mg/ml) or (+)-L-Arabinose (1%) was added according to the requirements.

SOC medium: 20g of Bactotryptone, 5g of Bacto yeast, 2.5mM NaCl, 10mM MgCl2, 10mM MgSO and 20mM glucose were dissolved in 1 liter of H O followed by filter- 4 2 sterilization.

3.2.2. Mammalian cell culture media DMEM (Dulbecco´s modified Eagle medium): medium was purchased from Gibco/BRL

(Eggenstein, Germany) as a ready-to-use mixture, dissolved in sterile H2O and adjusted to a pH of 7.0. MEM (Eagle´s minimal essential medium): medium was obtained from Gibco/BRL

(Eggenstein, Germany) as a ready-to-use substance, dissolved in sterile H2O and adjusted to a pH of 7.0. FBS (fetal bovine serum): FBS was purchased from Sigma-Aldrich (Deisenhofen, Germany).

Trypsin/EDTA: 0.25% trypsin, 140mM NaCl, 5mM KCl, 0.56mM Na2HPO4, 5mM D(+) glucose, 25mM Tris/HCl, 0.01% EDTA, pH 7.0.

24 Materials and Methods

3.3. Chemicals Chemicals for laboratory use were purchased from Roth (Karlsruhe, Germany), Sigma- Aldrich (Deisenhofen, Germany), Merck (Darmstadt, Germany), Biomol (Hamburg, Germany), Boehringer (Mannheim, Germany), Fluka (Buchs, Switzerland), and Serva (Heidelberg, Germany).

3.4. Standard buffers

2x BES (BES-buffered saline): 50mM BES, 280mM NaCl, 1.5mM Na2HPO4, pH 6.95. Buffer for coimmunoprecipitation (CoIP): 10ml 1M Tris/HCl, pH 8.0, 6ml 5M NaCl, 2ml 0.5M EDTA, 1ml Nonident P40 (NP-40), adjusted to 200ml with sterile water. Protease- inhibitors were added as follows: 2ml 100mM PMSF and 400µl each of 1mg/ml Aprotinin, Leupeptin and Pepstatin. Buffer for RNA-immunoprecipitation (RIP): 10ml 1M Tris/HCl, pH 8.0, 12ml 5M NaCl, 2ml 0.5M EDTA, 1ml Nonident P40 (NP-40), adjusted to 200ml with sterile water. Protease- inhibitors were added as follows: 2ml 100mM PMSF and 400µl each of 1mg/ml Aprotinin, Leupeptin and Pepstatin. In addition, 20µl of RNase-inhibitor RNasin (Fermentas, St. Leon- Rot, Germany) were included. 6x DNA loading buffer: 30% glycerol, 0.25% bromphenol blue, 0.25% xylencyanol. ECL solution A: 50mg luminol (Sigma-Aldrich, Deisenhofen, Germany) dissolved in 200ml 0.1M Tris/HCl (pH 8.6). ECL solution B: 11mg p-hydroxycoumarin acid (Sigma-Aldrich, Deisenhofen, Germany) dissolved in 10ml DMSO. 4% paraformaldehyde solution: 4% paraformaldehyde dissolved in PBSo. PBSo (Phosphate-buffered saline without CaCl and MgCl ): 138mM NaCl, 2.7mM KCl, 2 2

6.5mM Na2HPO4, 1.5mM KH2PO4. 4x SDS protein loading buffer: 125mM Tris/HCl (pH 6.8), 2mM EDTA, 20% glycerol, 4% SDS, 10% β-mercaptoethanol, 0.01% bromphenol blue. 10x SDS-PAGE buffer: 286g of glycine, 60.6g of Tris and 20g of SDS were dissolved in water adjusting the volume to 2 liters. Stripping buffer: 2% SDS, 100mM β–mercaptoethanol, 62.5mM Tris/HCl (pH 6.7).

1x TAE buffer: 24.2g Tris, 1.7g EDTA, 5.7ml glacial acetic acid (H2O ad 5 liter). 1x TE buffer: 10mM Tris/HCl (pH 6.8), 1 mM EDTA. 0.2% Triton X-100: 0.2% Triton X-100 dissolved in PBSo. Western blotting buffer: 15.1g of Tris, 75g of glycine and 1 liter of ethanol were dissolved in

H2O adjusting the volume to 5 liters.

25 Materials and Methods

4. Methods 4.1. Standard molecular biology techniques - Small-scale DNA-preparation via alkaline lysis procedure (Zagursky et al., 1985). - Large-scale preparation of plasmid DNA using Maxiprep-Kits obtained from either Qiagen (Hilden, Germany) or Invitrogen (Karlsruhe, Germany) according to the manufacturer’s instructions. - Photometric determination of DNA concentrations (Sambrook and Russell, 2001). - Automated nucleotide sequencing of DNA using the fluorescence-based ABI-Prism 2000 sequencing detector (ABI, Weiterstadt, Germany) or the 3130XL genetic analyser (Applied Biosystems, Weiterstadt, Germany). - PCR (polymerase chain reaction) for amplification of DNA fragments was performed according to Sambrook et al. (1989). Depending on the conditions DMSO, formamide, MgSO or betaine were added to improve the efficiency of the reaction. 4 - Restriction enzyme digestion of DNA, dephosphorylation via shrimp alkaline phosphatase (SAP), ligation with T4 DNA ligase, agarose gel electrophoresis (Sambrook et al., 1989). - Elution and purification of DNA fragments from agarose gels, PCR reactions or restriction enzyme digestion by using commercial kits from either Invitrogen (Karlsruhe, Germany) or Qiagen (Hilden, Germany). - Introduction of plasmid DNA into bacteria by electroporation (Sambrook et al., 1989). - SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Laemmli, 1970). - Enhanced chemiluminescence (ECL) immunodetection of proteins (GE-Healthcare, Freiburg, Germany). - RNA extraction using phenol-chloroform and precipitation of DNA or RNA by ethanol or isopropanol (Sambrook et al., 1989).

4.2. In vitro mutagenesis Site-directed mutagenesis was applied for the construction of single amino acid changes in the UAP56-interaction motifs of FLAG-and Myc-pC69 (pHM2960; pHM2961) and FLAG- and Myc-Rh69 (pHM2837; pHM2838). The mutation(s) were introduced by means of complementary oligonucleotide primers using the QuickChange site-directed mutagenesis kit (Stratagene, Heidelberg, Germany) as instructed by the manufacturer.

4.3. Eukaryotic cell culture techniques 4.3.1. Maintenance of eukaryotic cell cultures Eukaryotic cell cultures were maintained in plastic flasks (Greiner bio-one GmbH, Germany) at 37°C, 5% CO and 80% humidity in corresponding culture media: 2 HEK293T: DMEM medium, 10% (v/v) FBS, 350μg/ml L-glutamine, and 10μg/ml gentamicin. HeLa: MEM medium, 5% (v/v) FBS, 350μg/ml L-glutamine, and 10μg/ml gentamicin. HFF: MEM medium, 5% (v/v) FBS, 350μg/ml L-glutamine, and 10µg/ml gentamicin. NIH3T3: DMEM medium, 8% (v/v) FBS, 350μg/ml L-glutamine, and 10µg/ml gentamicin. After reaching confluent monolayers, adherent growing cells were detached from the surface by Trypsin/EDTA treatment and reseeded into new flasks containing fresh medium.

26 Materials and Methods

4.3.2. Transfection of mammalian cells HEK293T cells were transfected via the standard calcium phosphate precipitation method (Ausubel et al., 1989). The day before transfection, either 5.5 x 105 or 5.0 x 106 cells were seeded into one well of a six-well dish or into a 10cm dish, respectively, supplied with appropriate amounts of DMEM medium and incubated over night at 37°C. For Western blot analysis, RNA- or coimmunoprecipitations a total of 1-10µg of DNA content were used for each transfection sample. Approximately 16 hours post transfection, the cells were washed once with PBSo, provided with fresh medium and incubated for another 24 hours. Finally, the cells were harvested for further processing in respective experiments. For immunofluorescence analysis, 2.8 x 105 HeLa cells were splitted onto coverslips into one well of a six-well dish 24 hours before transfection. Transfection of DNA plasmids (1µg total) was performed by utilizing LipofectaminTM 2000 (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s instructions. HFF cells were transfected with commercially available transfection reagent X-treme GENE HP DNA Transfection Reagent (Roche, Mannheim, Germany). Transfection procedure and total DNA content to transfect 3.0-3.5 x 105 HFF cells was performed according to the instructions of the manufacturer.

4.3.3. Infection of human foreskin fibroblasts (HFFs) For infection of HFFs with wild type (wt) AD169 or recombinant HCMVs, 3.0 x 106 cells were seeded into 10cm dishes 2-3 days before infection. The medium was then removed and substituted by 1ml of infectious cell culture supernatant containing the appropriate number of plaque forming or IE1-units. Approximately 2 hours later, the infectious supernatant was replaced by fresh MEM-medium and incubated at 37°C for variable periods of time (12, 24, 48, 72, 96 hours post infection). For preparation of virus stocks, HFF cells were infected with a high multiplicity of infection (MOI) and incubated at 37°C for about 7-10 days until the cultures displayed a pronounced cytopathic effect (CPE). Supernatants were collected, cleared by centrifugation for 10min at 2000rpm (revolutions per minute) and stored in aliquots at -80°C.

4.4. Indirect immunofluorescence analysis HeLa cells grown on coverslips in six-well dishes (2.8 x 105cells/well) were washed twice with PBSo at 48 hours post transfection. By incubation with 4% paraformaldehyde for 10min at room temperature (RT) cells were fixed and then washed again two times with PBSo. Permeabilization of the cells was achieved by incubation with 0.2% Triton X-100 in PBSo on ice for 20min. Cells were washed again three times with PBSo over a time period of 5min followed by incubation with 200μl of the appropriate primary antibody diluted in PBSo-1% FBS or as undiluted hybridoma-supernatant for 30-45min at 37°C. Excessive antibodies were

27 Materials and Methods removed by washing three times with PBSo, followed by incubation with a corresponding fluorescent dye-conjugated secondary antibody, which was likewise diluted in 200μl of PBSo- 1% FBS and incubated with the cells for further 30-45min at 37°C. The cells were mounted using the DAPI (4, 6-Diamino-2phenylindol)-containing Vectashield mounting medium (Alexis, Grünberg, Germany) and then analysed using the Leica TCS SP5 confocal microscope (Leica, Wetzlar, Germany). Adobe Photoshop package (version 8.0.1) was used for processing of images.

4.5. Heterokaryon analysis To examine nucleocytoplasmic shuttling activity of pUL69 and betaherpesviral pUL69- homologs heterokaryon assays were carried out as initially described by Pinol-Roma and colleagues (Pinol-Roma and Dreyfuss, 1992). For this, 2.8 x 105 HeLa cells were seeded in six-well dishes and transfected with appropriate DNA plasmids via standard calcium phosphate precipitation 24 hours later. The next day, transfected HeLa cells were detached from dish surfaces by Trypsin/EDTA treatment and transferred to 15ml reaction tubes. After adding 8ml of fresh MEM-media to the cells, samples were centrifuged at 1500rpm, 4°C for 5min. Supernatants were discarded and HeLa cell pellets were resuspended in 6.6 x 105 NIH3T3 cells, thereby mixing both cell types. Co-cultures of transfected HeLa and NIH3T3 cells were seeded on coverslips in six-well dishes and incubated overnight at 37°C. The following day, de novo protein synthesis was blocked by addition of 50μg/ml cycloheximide (Sigma-Aldrich, Deisenhofen, Germany) for 30min. Subsequently, cells were washed in PBSo, and heterokaryons were formed by incubating the cells in pre-warmed 50% PEG (polyethylene glycol 8000, 1g/ml, Sigma-Aldrich, Deisenhofen, Germany) for exactly 2min to form interspecies heterokaryotic cells. Following cell fusion, coverslips were washed extensively in PBSo and returned to fresh medium containing 50μg/ml cycloheximide in order to allow the proteins to shuttle between the nuclei of heterokaryons. Exactly 4 hours later, cells were fixed with 4% paraformaldehyde and indirect immunofluorescence analysis was performed as described above to determine the subcellular localization of the transiently expressed protein of interest. At least 20 heterokaryons were analysed for each sample, and nuclear shuttling was only scored positive when a minimum of 80% of the heterokaryotic cells showed a positive staining of the investigated protein.

4.6. Nuclear mRNA-export assay To monitor nuclear export of unspliced mRNA in human cell culture, a method has been developed by Hope and colleagues (Hope et al., 1990). This assay is based on the pDM128/CMV reporter plasmid whose description can be found in chapter E 1.4.1. HEK293T or NIH3T3 cells were plated in six-well dishes at 5.0 x 105 cells per well the day before transfection. DNA-transfection was performed by the standard calcium phosphate precipitation method using 150ng of the reporter plasmid pDM128/CMV/RRE or

28 Materials and Methods pDM128/CMV/RxRE and 2µg of each co-transfected effector plasmid (Rev or Rex, FLAG- pUL69, FLAG-tagged betaherpesviral pUL69-homologs, FLAG-tagged chimeric proteins or FLAG-tagged pUL69-mutants). The cells were lysed 48h after transfection and CAT-protein expression was analysed by a CAT enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s protocol (Roche, Mannheim, Germany). Each transfection was performed in triplicate and repeated at least three times. Equal aliquots of each transfection were saved for monitoring protein expression by Western blotting

4.7. Coimmunoprecipitation In order to identify protein-protein interactions in vivo, coimmunoprecipitation (CoIP) analyses were performed as originally described by Bannister and colleagues (Bannister and Kouzarides, 1996). For this, transfected HEK293T cells (1.0 x 106) were lysed for 20min at 4°C in 800μl of CoIP buffer (50mM Tris/HCl, pH 8.0, 150mM NaCl, 5mM EDTA, 0.5 % NP- 40, 1mM PMSF, 2μg each of Aprotinin, Leupeptin and Pepstatin per ml). After centrifugation, aliquots of each sample were taken as input controls and the remaining supernatant was incubated with an appropriate antibody coupled to protein-A-sepharose beads for 1.5h at 4°C. The sepharose beads were collected by centrifugation and washed five times in CoIP buffer. Finally, the immunoprecipitated proteins were recovered by boiling in 4xSDS sample buffer and protein complexes were analysed by SDS-PAGE and Western blotting.

4.8. RNA techniques 4.8.1. Total cellular RNA preparation from infected cell culture cells Total cellular RNA was isolated from human foreskin fibroblasts infected with wild type AD169 or the UL69-mutant virus AD169-UL69ΔR1ΔRS using the SV40 total RNA isolation kit (Promega, Madison, USA) according to the manufacturer’s instructions. Finally, the RNA pellets were resuspended in 50μl of RNase-free H2O and used for subsequent reverse transcription reactions to generate cDNAs, which were then quantified via quantitative SYBR- Green PCR (qPCR).

4.8.2. Cytoplasmic RNA preparation from infected cell culture cells To separate cytoplasmic from total RNAs 3.0 x 106 HFF cells, infected with wild type AD169 or the UL69-mutant AD169-UL69ΔR1ΔRS, were lysed in 100μl of NP40-lysis buffer (100 mM HEPES, pH 7.8, 100 mM KCl, 80% Glycerol, 1.0% Nonidet P-40, 40units of RNasin (Roche), 1 mM DTT) on ice for 2min. After centrifugation (4000rpm, 5min, 4°C), the cytoplasmic RNA fraction was collected, resuspended in 1ml TRIZOL (Invitrogen, Karlsruhe, Germany) and RNAs were isolated exactly as described by the manufacturer’s instructions, before each pellet was resuspended in 50µl RNase-free H2O. To exclude any DNA contaminations in RNA samples used for RT-PCR and quantitative PCR analyses, 10units of RNase-free DNase I (Roche, Mannheim, Germany) were added to each fraction and incubated at 37°C

29 Materials and Methods for 1 hour, before RNAs were isolated again by phenol extraction and ethanol precipitation.

Finally, the RNA pellet was resuspended in 50μl of RNase-free H2O.

4.8.3. RNA-immunoprecipitation The RNA-immunoprecipitation was performed essentially as described by Niranjanakumari and colleagues (Niranjanakumari et al., 2002) with several modifications to ensure optimal experimental settings for the detection of pUL69-RNA interactions. In the case of RNA- immunoprecipitation experiments from transiently transfected HEK293T cells, 5.0 x 106 cells were seeded in 10cm dishes and transfected with a combination of two plasmids 24 hours later. Using the standard calcium phosphate precipitation method, either FLAG-pUL69, FLAG-pUL69ΔR1ΔRS or other pUL69-mutants were co-transfected with the CAT-reporter plasmid pDM128/CMV/RRE or various eukaryotic expression plasmids encoding different cytomegaloviral proteins. 48 hours after transfection all samples were harvested and immunoprecipitation was performed using MAb-FLAG or MAb-UL69 for precipitation of pUL69 or pUL69-mutants. For RNA-immunoprecipiation analyses of HCMV-infected fibroblasts, 3.0 x 106 HFFs were infected with wild type AD169 or the UL69-mutant AD169- UL69ΔR1ΔRS at an MOI of 0.1 or 1.0. 72 hours post infection, the cells were harvested and immunoprecipitation was performed using MAb-UL69 for precipitation of pUL69. At indicated time points, all samples were harvested in 1ml PBSo and subsequently lysed in 1ml of RIP buffer (50mM Tris/HCl, pH 8.0, 300mM NaCl, 5mM EDTA, 0.5% NP-40, 20units/ml RNasin RNAse inhibitor (Promega) 1mM PMSF, 2μg each of Aprotinin, Leupeptin and Pepstatin per ml) for 20min at 4°C. After centrifugation at 14000rpm for 10min at 4°C, 150µl aliquots of each sample were taken as input controls for Western blot analysis and RNA-extraction, while the remaining supernatant was incubated with an appropriate antibody (MAb-FLAG or MAb-UL69) coupled to protein-A-Dynabeads (Invitrogen, Karlsruhe, Germany) for 1.5h at 4°C. Thereafter, the beads were collected using a DynaMag-2magnet (Invitrogen, Karlsruhe, Germany) and washed 5 times with 500μl of RIP buffer. Finally, the beads containing the immunoprecipitated samples were collected and resuspended in 100μl of RNase-free water. RNA bound by pUL69 or pUL69-mutant proteins were extracted using TRIZOL (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s instruction. Briefly, 100μl of each sample were mixed with 300μl TRIZOL and 80μl chloroform. The contents were mixed thoroughly and incubated at room temperature for 10min followed by centrifugation at 14000rpm for 10min at 4°C. The upper aqueous phase was then subjected to isopropanol precipitation in the presence of 1μl of 20μg/μl glycogen (Roche, Mannheim, Germany) as a carrier. RNA-precipitates were collected by centrifugation at 14000rpm for 10min, washed with 70% ethanol, air-dried and resuspended in 50μl of RNase-free water. In addition, to exclude any DNA contamination within RNA-precipitates, each sample was treated with

30 Materials and Methods

20units of recombinant RNase-free DNase I (Roche, Mannheim,Germany) for 1hour at 37°C. Finally, the precipitated RNAs from input and immunoprecpitates were analysed by RT-PCR.

4.8.4. Reverse transcription polymerase chain reaction (RT-PCR) For the evaluation of the RNA-immunoprecipitation experiments 5µl of each RNA sample purified from the input lysates and immunoprecipitates were used as a template for RT-PCR using the Transcriptor One-Step RT-PCR system (Roche, Mannheim, Germany) according to the instructions of the manufacturer. To ensure that the amplification reaction was within the linear range either the input RNA sample was diluted or the number of the PCR cycles within the RT-PCR was decreased. For amplification of the distinct viral and cellular mRNAs, target specific primers were chosen and are listed in table 2.1.

4.8.5. Quantitative SYBR-Green PCR (qPCR) Quantification of RNA samples isolated from HFFs infected with wild type AD169 or the mutant AD169-pUL69ΔR1ΔRS was performed using the semi-quantitative SYBR-Green real- time PCR System at 72 hours post infection. For this, equal amounts of RNA from each sample were reverse transcribed to cDNA using the Maxima SYBR-Green/Rox qPCR Master Mix (2x) (Fermentas, St. Leon-Rot, Germany). Quantitative PCR reactions were then carried out in triplicates by intercalation of the cyanine dye SYBR-Green into double-stranded cDNA using target specific primers listed in table 2. 1. The 25µl samples contained 12.5µl Maxima SYBR-Green/Rox qPCR Master Mix (2x), 0.5µl of each primer (50pM) and 9.5µl nuclease- free H2O. 2µl of the RT-PCR generated cDNAs were used as template DNA. Real-Time PCR amplification was carried out in an Applied Biosystems 7500 Real-Time PCR System. The initial denaturation step (95°C, 10min) was subsequently followed by 45 cycles of denaturation (95°C, 15sec), primer annealing (55°C, 33sec) and strand elongation. Afterwards, a dissociation curve of the amplicons was carried out to ascertain the specificity of the reactions. For this purpose, samples were denatured again (95°C, 15sec) and rehybridised (60°C, 1min). Temperature was then gradually increased for 1 degree (1min each) until the maximum temperature of 98°C was reached. Due to the determination of the DNA melting point the homogeneity of amplicons could be suggested. Additionally, PCR reactions were analysed by agarose gel electrophoresis. Data analysis was performed using the Applied Biosystems Sequence Detection Software (Version 1.2.3).

31 Materials and Methods

4.9. Generation and characterization of recombinant viruses 4.9.1. Generation of recombinant HCMVs using the BACmid technology For the construction of recombinant HCMVs the BACmid technology was employed. This method is based on a bacterial artificial chromosome (BAC) carrying the entire HCMV genome of the laboratory strain AD169 (Hobom et al., 2000). In addition, the BACmid contains a bacterial origin of replication as well as a selection marker (chloramphenicol resistance gene) thereby allowing the propagation in E.coli. In bacteria any kind of mutation (deletion, insertion, or point mutation) can be introduced into the HCMV genome-containing BACmid DNA via homologous recombination. Thereafter, positive recombinant BACmids carrying a modified HCMV genome can be transfected into HCMV-permissive cells (HFFs) for the reconstitution of infectious viral particles.

4.9.2. Homologous recombination using linear DNA fragments To engineer recombinant HCMVs harboring a deletion or a substitution within the UL69 gene, linear recombination cassettes were utilised to replace the respective wild type sequence by a selection marker gene via recombination-mediated genetic engineering. A two-step recombination strategy (Tischer et al., 2006), using the kanamycin gene (aphaI) as a selection marker, was employed for the construction of UL69-recombinants. The linear recombination fragments were generated by PCR using pEPkan-S (kindly provided by K. Osterrieder, Berlin) or pEPkan-S-based plasmids as template DNA. These plasmids harbor a restriction site for the homing endonuclease I-SceI upstream of the aphaI gene, which is needed for the second recombination event. Primers used for PCR contained a 60bp homologous region to the up- and downstream genomic sequence and were overlapping in sequence over a 40bp region. PCRs were performed with Phusion High Fidelity DNA polymerase (Finnzymes, Vantaa, Finland), DpnI was added to digest template DNA, and the amplicon was purified from an agarose gel with the Quiagen Gel Extraction Kit (Quiagen, Hilden, Germany). In order to accomplish the homologous recombination, approximately 100ng of PCR fragment were transformed into chemically competent E.coli strain GS1783 (gift of Gregory A. Smith, Northwestern University, Chicago, USA), which also encode the restriction homing endonuclease I-SceI under an arabinose-inducible promoter. The bacteria already harbored the HCMV BACmid pHB15 and Red recombination was performed as described earlier (Zhang et al., 1998). Positive transformants were identified using agar plates containing kanamycin. Subsequently, to eliminate the kanamycin resistance cassette by site-specific recombination, I-SceI expression was induced by addition of 1% arabinose in the selected bacteria. This resulted in a DNA double-strand break, which was repaired due to a second recombination event. Positive colonies were selected on chloramphenicol and 1% arabinose LB-plates at 32°C for 1-2 days. Finally, obtained

32 Materials and Methods recombinant BACmids were verified by PCR, restriction enzyme digestion, and direct sequencing of the recombinational junctions.

4.9.3. Preparation, restriction enzyme digestion and PCR analysis of BACmid DNA BACmid DNA mini-preparations were conducted by standard alkaline lysis procedure from 5ml cultures grown overnight according to the protocol of Zagursky and colleagues (Zagursky et al., 1985). The isolated DNA was then analysed via restriction enzyme cleavage. For this, 15μl of mini-prep BACmid DNA was digested with 1.5μl of the restriction endonucleases AscI or AflII, 2μl of the according 10x buffers and sterile water (ad 20μl). After 3h of digestion, the samples were loaded onto 0.8% agarose gels and separated via pulse field gel electrophoresis. For a characterization of insertion or deletion of the kanamycin selection marker recombinant BACmids were also analysed by PCR reactions resulting in the amplification of DNA fragments with variable length, thereby discriminating between BACmids harboring the aphaI cassette or those without this selection marker gene, respectively. Moreover, the nucleotide sequence of the wild type and the mutated UL69 gene region was determined by automated sequence analysis on a 3130XL genetic analyser (Applied Biosystems, Weiterstadt, Germany) in order to confirm the correct insertion of intended deletion-, substitution- or revertant- (wild type) sequences as well as to exclude the presence of undesired mutations within the BACmid DNA.

4.9.4. Reconstitution of recombinant viruses In order to obtain recombinant infectious viruses, HFF cells (preferably below passage 15) were transfected with the recombinant BACmid DNA. For this, 3.0 x 105 HFF cells were seeded into six-well dishes in 2ml of medium one day before transfection. The following day, 1μg of appropriate BACmid DNA was combined with 0.5µg of an expression vector encoding the CRE recombinase and with 0.5μg of the eukaryotic expression plasmid pCB6-pp71 coding for pp71, since the HCMV tegument protein is known to enhance the infectivity of viral DNA (Baldick et al., 1997). The respective DNAs (2μg of DNA in total per sample) were mixed with 4μl of X-treme GENE HP DNA Transfection Reagent (Roche, Mannheim, Germany) in 100μl of serum-free medium and incubated at room temperature for 10-15min, before they were distributed evenly over the cells followed by incubation for 6 hours at 37°C. Thereafter, the medium was replaced by 2ml of fresh MEM supplemented with 5% FBS, 350μg/ml glutamine and 10μg/ml gentamicin. Approximately 7 days after transfection, the cells were transferred into small Nunc flasks and further incubated 7 to 14 days at 37°C until plaques appeared. After development of a nearly complete cytopathic effect (CPE), the supernatant was used for infection of fresh HFF cultures and preparation of virus stocks.

33 Materials and Methods

4.9.5. Virus titration based on IE1-gene expression For titrating virus stocks based on IE1-gene expression, 8.0 x 105 HFF cells were seeded into each well of a 24-well dish one day prior to infection. 24 hours later, virus supernatant was diluted from 1:5 to 1:56 and 300µl of each virus dilution was applied to the cells and incubated for 2 hours before fresh medium was added. 36 hours post infection the cells were fixed with methanol and immunofluorescence analysis was performed using the monoclonal IE1-antibody 63-27, specific for detection of the IE1p72-protein of HCMV. HFF cells positive for IE1 were counted at an appropriate virus dilution, multiplied by the dilution factor and by 3.33 to estimate the titer of the virus supernatant in pfu/ml regarding IE1-protein expression.

4.9.6. Absolute quantification of virus genome copy numbers using Taqman probes Determination of the HCMV genome copy numbers in cell culture supernatants during growth curve analyses was carried out via quantitative Real-Time PCR using fluorescence-labeled Taqman probes and the ABI Prism 7700 sequence detector (Applied Biosystems, Foster City, USA) as well as the corresponding software SDS (sequence detection system) version 1.9 (Heid et al., 1996). Template DNA was prepared by K-lysis of virus supernatants, before the viral load was determined by amplification of a region within the exon 4 of the IE1 gene locus (ORF UL123) using the primers CMV5’ and CMV3’ together with the fluorescence- labelled probe CMV MIE FAM/TAMRA, also homologous to a sequence within the exon 4. 7 1 For the determination of reference CT values, serial dilutions (10 -10 DNA molecules of IE1) of the respective standards were examined by PCR reactions in parallel. The 25µl total reaction volume contained 5µl of either sample or standard DNA, 10µl of 2x Taqman PCR Mastermix (Applied Biosystem, Foster City, USA), 1.5µl of each primer (5µM stock solultion), 0.4µl of the probe (10µM stock solution) and 1.6µl water. Reactions were conducted in triplicates. The initial denaturation step of 5min at 95°C was followed by 40 amplification cycles with denaturation (95°C, 15sec), oligonucleotide hybridisation (60°C, 30sec) and strand elongation (68°C, 33sec). The viral genome copy numbers were subsequently calculated using the sample-specific CT value when set into relation to the standard serial dilutions.

4.9.7. Characterization of recombinant viruses by multistep growth curve analysis To further determine the replication capacities of the reconstituted recombinant viruses multistep growth curve analyses were performed. For this, 3.0 x 105 HFF cells were seeded into six-well dishes and infected the following day in parallel with wild type HCMV AD169 as well as one of the recombinant viruses with equal IE1 units (MOI 0.001 or 0.1). Triplicate samples of the infected cell supernatants were harvested at 2, 4, 6, 8, 10 and 12 days post inoculation and subjected to lysis by Proteinase K treatment. Thereafter, to quantify the genome copy numbers, all samples were subjected to titration via IE1-staining or quantitative PCR analysis of the amount of viral IE1-gene by Taqman-qPCR.

34 Materials and Methods

4.10. Generation and characterization of a cDNA-library after RNA-immunoprecipitation of pUL69 from HCMV-infected HFFs To generate a cDNA-library from pUL69-coprecipitated RNAs, RNA-immunoprecipitation experiments were performed essentially as described in 4.7.3. Briefly, 6.0 x 106 HFF cells were infected with wild type AD169 at an MOI of 1.0. Approximately 72 hours post infection the cells were harvested, lysed and immunoprecipitation of pUL69 was performed using MAb-UL69. Thereafter, pUL69 coprecipitated RNAs were isolated and extracted using TRIZOL as described above. To remove polyphosphates at the 5`end of all RNAs, samples were treated with 10units of tobacco acid pyrophosphatase (Epicentre Biotechnologies, Madison, USA) for 30min at 37°C. Afterwards, Biotin-labeled RNA-Acceptor oligonucleotides (Biotin-AttB1-HA; 1.0µg per reaction) were ligated to the 5` end of pUL69-coprecipitated RNAs using 10units of T4 RNA-ligase from Epicentre Biotechnologies (Madison, USA) for 30min at 37°C. cDNA-synthesis was carried out rapidly thereafter using the Superscript Reverse Transcriptase (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s instructions. Briefly, 5µl of oligo-ligated RNAs were incubated with 500ng biotinylated-AttB2- Oligo(dT)-primers, 500µl of 20mM dNTPs in a total volume of 20µl for 5min at 65°C, followed by a short cooling on ice. Subsequently, each reaction was supplemented with 4µl of 5x RT- buffer, 1µl of 0.1M DTT, 1µl of RNasin (40units; Promega, Mannheim, Germany) and 1µl Superscript RT enzyme (200units) and was then incubated at 50°C for 60min. The reaction was stopped by a final heat inactivation at 70°C for 15min. In order to remove RNAs of the generated cDNA/RNA-hybrids, all samples were further treated with 1µl RNaseH (40units, Roche, Mannheim, Germany) and incubated at 37°C for 20min. For recovery and purification of all cDNAs, samples were subjected to phenol-chloroform extraction as described above, resuspended in 10µl of RNase-free H2O and finally successful cDNA-synthesis was verified by agarose gel electrophoresis. According to the manufacturer’s instructions, approximately 100ng of cDNA were then cloned into the Gateway vector pDONR221 (Invitrogen, Karlsruhe, Germany) resulting in various constructs harboring diverse nucleotide sequences, resembling pUL69 target RNAs during infection. 20 hours later, ligation products were transformed into the One Shot® TOP10 Electrocomp™ E.coli (Invitrogen, Karlsruhe, Germany) and plated on kanamycin containing LB-agar plates. Finally, individual E.coli colonies were picked, plasmid-DNA was isolated via standard alkaline lysis procedure and nucleotide sequences of pUL69 coprecipitated RNAs were identified by standard sequencing using the 3130XL genetic analyser (Applied Biosystems, Weiterstadt, Germany).

35 Results

E Results

1. Functional characterization of the betaherpesviral pUL69-protein family

1.1. Expression analyses of HCMV pUL69 and homologous proteins of the Betaherpesvirinae Starting point for subsequent expression studies and functional analyses of ICP27-protein family members from the Betaherpesvirinae was the engineering of N-terminally epitope- tagged eukaryotic expression plasmids encoding a representative selection of betaherpesviral pUL69-homologs. While FLAG-UL69 and Myc-UL69 were already available in the laboratory, FLAG- and Myc-tagged full-length constructs of CCMV C69, RhCMV Rh69, MCMV M69, and U42 of HHV6 and ElHV1 were successfully synthesized for the first time. In order to verify the functionality and to determine the expression patterns of each constructs, they were transfected into HEK293T cells and protein expression was analysed 2 days later by Western blotting using anti-FLAG or anti-Myc antibodies (Fig. 5A and B). Since FLAG- and Myc-epitopes are short polypeptides, the molecular mass of each protein was not significantly altered upon fusion. FLAG-pUL69 and Myc-pUL69, which served as transfection and expression controls, could be detected with its characteristic isoforms of 105 to 116kDa (Fig. 5A and B, lane 2) (Winkler and Stamminger, 1996). Intriguingly, open reading frame C69, which encodes 920 amino acids (aa), was translated into a protein of approximately 125kDa, while Rh69, which encodes 777aa, was translated into a protein of 130kDa (Fig. 5A and B, lanes 3 and 4). U42 of HHV6, which encodes 515aa, was detected in its FLAG- and Myc-tagged versions at about 60kDa (Fig. 5A and B, lane 6). Most surprisingly, pM69, containing an intermediate length of 843aa, was determined to have the highest molecular mass of any betaherpesviral pUL69-homolog, with an apparent size of approximately 135 to 140kDa (Fig. 5A and B, lane 5). Finally, ORF U42 of ElHV1, which consists of 660aa, was translated into a protein of about 80kDa (Fig. 5A and B, lane 7). Thus, the protein expression of all pUL69-homologs could be confirmed by these Western blot experiments using primary antibodies against the respective tag. Moreover, for the detection of HCMV pUL69, two specific antibodies were already available: the murine monoclonal MAb-UL69 antibody as well as the rabbit polyclonal UL69-antiserum PAb-UL69 (Winkler et al., 1994; 2000). Since the betaherpesviral pUL69-homologs share an amino acid conservation to HCMV pUL69, at least to a certain extent, detection of these proteins by the pUL69 specific antibodies was feasible. To test this, Western blots for FLAG- and Myc-tagged proteins described above were stripped, thereby removing previous bound antibodies and membranes were subsequently incubated with MAb-UL69 or PAb-UL69 (Fig. 5A and B, middle panels).

36 Results

A B

Fig. 5: Expression analysis of pUL69 and its betaherpesviral homologs. (A and B) HEK293T cells were transfected with plasmids encoding N-terminally FLAG-tagged (A) or Myc-tagged (B) versions of pUL69 (lane 2), pC69 (lane 3), pRh69 (lane 4), pM69 (lane 5), and pU42 of HHV6 (lane 6) and ElHV1 (lane 7), as indicated. Transfection of an empty vector served as a specificity control (mock, lane 1). Cells were lysed under denaturing conditions at about 36 hours post transfection. Lysates were separated by SDS-PAGE and protein expression was analysed by Western blotting using anti-FLAG- or anti-Myc antibodies. In addition, to test the reactivity of pUL69-specific antibodies against the betaherpesviral homologs, the monoclonal mouse anti-UL69 antibody (MαUL69) as well as the polyclonal rabbit UL69-antisera (RαUl69)were also applied in Western blot analyses. Cellular β-actin levels served as controls for equal protein loading. Molecular size markers are indicated (kDa).

Contrary to expectations, non of the homologs could be detected by Western blot analyses using pUL69-specific antibodies, except of pUL69 itself, which served as internal control (Fig. 5A and B, lane 2). Even pC69 and pRh69, representing the closest pUL69 relatives were not detectable. Finally, Western blots were stained against the cellular cytoskeleton component β-actin, to assure loading of equal amounts of cell lysates (Fig. 5A and B, lower panels).

1.2. Nuclear localization of pUL69 and homologous betaherpesviral proteins As HCMV pUL69 was already demonstrated to accumulate within the nuclei of infected and transfected cells (Winkler et al., 1994), indirect immunofluorescence analyses of the betaherpesviral pUL69-homologs pC69, pRh69, pM69, HHV6 pU42 and ElHV1 pU42 were carried out in order to determine their subcellular distributions. For this, HeLa cells were transiently transfected with expression plasmids encoding FLAG- and Myc-tagged versions of all homologs. Approximately 36 hours post transfection, the cells were fixed, permeabilised and immunofluorescence staining was performed using appropriate antibodies. As illustrated in figure 6, all investigated FLAG- and Myc-tagged pUL69- homologs exhibited intranuclear accumulation (Fig. 6A and B, c to m), as it was also observed for pUL69, which served as an internal control (Fig. 6A and B, a and b). A similar diffuse distribution of pUL69, pC69, pRh69, pM69 and pU42 of HHV6 and ElHV1 throughout

37 Results the nucleus, with an exception of the nucleoli, was also detected in HFF cells (data not shown), thereby further underlining the specificity of the results presented here. Interestingly, in some cells pRh69 and pM69 (Fig. 6A and B, f and k) were concentrated in distinct foci within the nucleus, an observation that is consistent with previous findings of pUL69 aggregates in infected cells (Winkler et al., 1994). Nuclear localization was conclusively identified to be conserved within the ICP27-protein family of the Betaherpesvirinae and most likely throughout the Herpesviridae. A B

Fig. 6: Nuclear localization of pUL69 and homologous betaherpesviral proteins. (A and B) HeLa cells were transfected with plasmids for FLAG-tagged (A) or Myc-tagged (B) versions of pUL69 (a and b), pC69 (c and d), pRh69 (e and f), HHV6 pU42 (g and h), pM69 (i and k) or ElHV1 pU42 (l and m), as indicated on the left side. 36 hours post transfection, cells were fixed and analysed for intracellular distribution of the respective proteins by indirect immunofluorescence using anti-FLAG- (A) or anti-Myc-antibodies (B). As a secondary antibody, anti- mouse-FITC (A) or anti-mouse-Cy3 (B) was used and cell nuclei were counterstained with DAPI.

1.3. Homo- and heterodimerization of betaherpesviral pUL69-homologs Since homodimerization was reported as a well-conserved characteristic of all studied members of the ICP27-protein family (Lischka et al., 2007; Malik et al.,. 2004; Zhi et al., 1999), it was conceivable that self-interaction is also a feature of the betaherpesviral counterparts. To analyse this, HEK293T cells were cotransfected with a combination of two

38 Results expression plasmids for the FLAG- and the Myc-tagged version of C69, Rh69, M69, and U42 of HHV6 or ElHV1, either in combination or together with a construct encoding the red fluorescent protein (RFP), as indicated in figure 7A. Two days later, cells were harvested and protein expression was verified by Western blotting using anti-FLAG- or anti-Myc-antibodies (Fig. 7A, upper and middle panels). Next, FLAG-tagged proteins were immunoprecipitated by an anti-FLAG-antibody before nonbound protein complexes were removed by extensive washing steps. After electrophoretic separation of the protein complexes, coprecipitated Myc- tagged versions of pC69, pRh69, pM69, and pU42 of HHV6 or ElHV1 could be detected by Western blotting (Fig. 7A, lower panel, lanes 2, 5, 8, 11,14).

A B

Fig. 7: Homo- and heterodimerization of betaherpesviral pUL69-homologs. (A and B) Coimmunoprecipitation analyses. (A) For homodimerization analyses, HEK293T cells were cotransfected with a combination of plasmids for RFP and FLAG- or Myc-tagged pC69 (lanes 1 and 3), pRh69 (4 and 6), HHV6 pU42 (7 and 9), pM69 (10 and 12), and ElHV1 pU42 (13 and15) or a combination of plasmids for FLAG- and Myc-tagged pUL69-homologs (lanes 2, 5, 8, 11, and 14). (B) For heterodimerization analyses of pC69 (lanes 1 and 2), pRh69 (3 and 4), HHV6 pU42 (5 and 6), pM69 (7 and 8), and ElHV1 pU42 (9 and 10), HEK293T cells were cotransfected with the respective FLAG-tagged pUL69-homolog and Myc-pUL69 (lanes 1, 3, 5, 7, and 9) or vice versa (lanes 2, 4, 6, 8 and 10). Two days post transfection, cells were harvested, lysed and immunoprecipitation was performed using anti-FLAG antibodies. After electrophoresis, coprecipitated proteins were visualized by Western blotting using anti-Myc antibodies (A and B, lower panels). Immunoglobulin heavy chain (Ighc) served as an internal control for the presence of the precipitating antibody.

The results were considered specific since no coprecipitation was observed when the FLAG- tagged protein was replaced by RFP (Fig. 7A, lanes 3, 6, 9, 12, and 15). These results clearly show that homodimerization is a conserved feature of pUL69-homologs within the subfamily Betaherpesvirinae.

39 Results

Since betaherpesviral proteins exhibit considerable amino acid conservation of the ICP27- homology region in the centre of the proteins, it was also reasonable that an analysis of the capacity of the betaherpesviral homologs to heterodimerize with pUL69 might identify critical protein domains required for this interaction. To investigate this, HEK293T cells were cotransfected with vectors encoding FLAG-tagged pC69, pRh69, pM69, or pU42 of HHV6 or ElHV1 together with Myc-UL69, or vice versa, as indicated in figure 7B. Two days later, cells were harvested and protein expression was monitored by Western blotting (Fig. 7B, upper and middle panels). After immunoprecipitation of FLAG-tagged proteins, coprecipitated proteins were identified by Western blotting using an anti-Myc antibody. As illustrated in the lower panel of figure 7B, a protein-protein interaction with HCMV pUL69 could be detected for pC69, pRh69, HHV6 pU42, and pM69 (Fig. 7B, lanes 1 to 8). Interestingly, these co- immunoprecitation analyses revealed that ElHV1 pU42 was unable to heterodimerize with pUL69 (Fig. 7B, lanes 9 and 10). Moreover, nonspecific interactions of FLAG- or Myc-tagged pUL69-homologs could be excluded, since no bands were visible on the coimmunoprecipitation blot when RFP was cotransfected with any of the FLAG- or Myc- tagged proteins (Fig. 7A and B, data not shown). To further validate these results an alternative experimental approach also using a different cell type was performed. The integral element of these analyses was an expression plasmid encoding for FLAG-UL69mutNLS, which carries four alanine substitutions within its bipartite nuclear localization signal (NLS) and therefore displays a predominant cytoplasmic distribution. Importantly, it has been demonstrated before that the cytoplasmic pUL69mutNLS protein is recruited to the nucleus via homodimerization with cotransfected wild type pUL69 (Lischka et al., 2007). Given this finding, pUL69mutNLS could also be used to analyse the heterodimerization capacity of the betaherpesviral homologs by investigating its subcellular localization upon coexpression with any of the homologs. For this purpose, HeLa cells were transfected with FLAG-UL69mutNLS alone (Fig. 8, a to d) or in combination with Myc-tagged UL69 (Fig. 8, e to h), C69 (Fig. 8, i to m), Rh69 (Fig. 8, n to q), M69 (Fig. 8, r to u), HHV6 U42 (Fig. 8, v to y), or ElHV1 U42 (Fig. 8, z to C). Two days later, cells were fixed and the subcellular localization of the proteins was examined by indirect immunofluorescence microscopy. As shown before, all Myc-tagged proteins containing a functional NLS localized to the cell nuclei, whereas FLAG-UL69mutNLS displayed a cytoplasmic distribution (Fig. 8, b). Interestingly, coexpression of pUL69, pC69, pRh69, pM69, or HHV6 pU42 with pUL69mutNLS resulted in a nuclear localization of both proteins (Fig. 8, h, m, q, u, and y). In contrast, pU42 of ElHV1 was not able to rescue pUL69mutNLS from the cytoplasm into the nuclei of transfected cells (Fig. 8, C). The outcome of these immunofluorescence analyses confirmed the results obtained by coimmunoprecipitation experiments. Concluding, heterodimerization with pUL69 of HCMV is a conserved feature of betaherpesviral pUL69-homologs belonging to the more closely related genera

40 Results

Cytomegalovirus, Muromegalovirus, and Roseolovirus but not of the more distantly related genus Proboscivirus.

Fig. 8: Nuclear recruitment of a pUL69-NLS mutant by heterodimerization with pUL69-homologs. HeLa cells were either transfected solely with a plasmid for FLAG-tagged pUL69 harboring point mutations within its nuclear localization signal (Flag-UL69mutNLS; a to d) or in combination with Myc-tagged pUL69 (e to h) or one of the pUL69-homologs (i to C). Two days later, indirect immunofluorescence analyses were performed using primary antibodies Rabbit-anti-FLAG and MAb-Myc and anti-rabbit-FITC or anti-mouse-Cy3 as a secondary antibody. For visualization of cell nuclei, cells were costained with DAPI.

41 Results

1.4. Analysis of the nuclear mRNA-export activity of pUL69 and betaherpesviral homologs Several publications demonstrate that pUL69 shares distinct functions with its alpha - and gammaherpesviral counterparts as for example with ICP27 of HSV1 and EB2 of EBV. In analogy to these herpesviral homologous proteins, pUL69 has been shown to shuttle between the nucleus and the cytoplasm (Lischka et al., 2001) and this nucleocytoplasmic shuttling activity was determined to be essential for the pUL69 mediated mRNA-export (Lischka et al., 2001). Moreover, another fundamental parameter for pUL69 in order to function as a viral mRNA-export factor is its ability to interact with the cellular DExD/H-box- RNA helicase UAP56, which enables pUL69 to facilitate the nuclear export of unspliced transcripts (Lischka et al., 2006). Since one of the characteristic features of pUL69 and homologous herpesviral proteins is their capacity to increase the cytoplasmic accumulation of intronless or unspliced mRNAs, it was now investigated whether betaherpesviral pUL69- homologs also possess the ability to facilitate nuclear mRNA-export of unspliced mRNAs.

1.4.1. Analysis of nuclear mRNA-export by transient transfection experiments For the analysis of nuclear mRNA-export of unspliced transcripts in human cell cultures a method has been developed by Hope and collegues (Hope et al., 1990). This assay is based on the observation that mRNAs containing introns are generally retained in the nucleus until splicing is completed and unspliced transcripts are rapidely degraded. Since Herpesviruses in general encode intron-containing transcripts, the nuclear export of unspliced mRNAs from the nucleus to the cytoplasm represents an essential step during HCMV-replication. The experimental setup used in the following assays is based on the insertion of a chloramphenicol acetyltransferase (CAT) reporter gene into an intron of the reporter plasmid pDM128. Consequently, CAT-protein expression becomes dependent on the nuclear export of unspliced CAT-containing transcripts. Importantly, by recruitment of specific (viral) nuclear mRNA-export factors to the unspliced CAT-containing mRNAs, nuclear export of these unspliced transcripts can be enhanced. In order to analyse the nucleocytoplasmic mRNA- export pathway of the HIV1 Rev protein, the pDM128 reporter construct was generated to study nucleocytoplasmic RNA-export mediated by HIV1. To examine mRNA-export of further virus families, several derivatives of the pDM128 reporter plasmid have been developed until now. In this, and all following studies, two pDM128/CMV plasmids, in which the SV40 promoter was replaced by the major immediate-early enhancer/promoter of CMV, were used to monitor mRNA-export of betaherpesviral pUL69-homologs (Fig. 9). All of these reporter constructs have in common that they contain the CAT gene in the tat-rev intron of the HIV1 env-gene. Since this particular intron underlies inefficient splicing due to suboptimal HIV1 splice sites, both unspliced and spliced RNAs are generated in the nucleus of transfected cells.

42 Results

Fig. 9: Schematic representation of the pDM128/CMV reporter plasmids. The CAT-reporter gene can be found in an intron. Consequently, CAT-protein expression is only possible from the unspliced transcript. The two reporter plasmids differ only in the cis-acting sequence found in the intron: CMV-P=CMV major IE promoter/enhancer; SD and SA=splice donor and acceptor sites, respectively; RRE=HIV1 Rev responsive element; RxRE=HTLV1 Rex responsive element; SV40PA=SV40 late poly(A) signal.

As already mentioned above, CAT-protein synthesis requires the nuclear export of the unspliced CAT-mRNA. Therefore, if cells are transfected with pDM128/CMV alone, CAT- protein expression remains weak since human cells lack endogenous factors to export unspliced CAT-mRNAs. However, upon co-transfection of human cell lines with the pDM128/CMV based reporter plasmids and expression vectors for viral mRNA-export factors, CAT-protein expression can be significantly increased. To investigate the mRNA- export activity of HCMV pUL69, pUL69 in-frame-deletion or amino-acid exchange mutants or betaherpesviral pUL69-homologs, two types of pDM128/CMV reporter plasmids were used (Fig. 9). One of them contained the HIV1 Rev responsive element (RRE) in the intron between the CAT gene and the 3` splice site which allows that Rev RNA-export factor binds to the unspliced mRNA via its RNA target sequence thus promoting the nuclear export of the unspliced RNAs. This reporter plasmid is called pDM128/CMV/RRE. The other reporter plasmid, termed pDM128/CMV/RxRE, expresses transcripts containing the RxRE cis-acting RNA element instead of the RRE, which are specifically exported to the cytoplasm by the HTLV1 RNA-exporter Rex (Fig. 9).

1.4.2. Stimulation of nuclear export of unspliced RNAs is restricted to the cytomegaloviral proteins pUL69, pC69 and pRh69 As mentioned above, one major characteristic of the members of the herpesviral ICP27- protein family characterized so far is their ability to function as viral mRNA-export factors. In order to investigate whether representative betaherpesviral pUL69-homologs can likewise facilitate the nuclear export of unspliced mRNAs, the functional reporter assay described above was performed to monitor RNA-export in vivo (Hope et al., 1990). This assay has previously been used to demonstrate the nuclear export of unspliced RNA by either pUL69 or the homologous protein of Epstein-Barr virus, EB2 (Farjot et al., 2000; Hiriart et al., 2003b; Lischka et al., 2006). Here, HEK293T cells were cotransfected with the pDM128/CMV/RRE reporter (Fig. 10A) and vectors encoding the well-characterized mRNA-export factors HIV1

43 Results

Rev (Thomas et al., 1998) and HCMV pUL69 (Lischka et al., 2006) or one of the FLAG- tagged betaherpesviral pUL69-homologs, pC69, pRh69, pM69 or pU42 of HHV6 or ElHV1, as indicated in figure 10B. Two days later, cells were harvested and the amount of CAT- protein was quantified using a CAT-enzyme-linked immunosorbent assay (ELISA) (Fig. 10B). In accordance with previous results, co-transfection of the empty pcDNA3 vector had only minor effects on the level of CAT-protein expression, while expression was significantly increased upon coexpression of HIV1 Rev or HCMV pUL69 (Fig. 10B, compare lane 1 with lane 2 and 3). Coexpression of pDM128/CMV/RRE with pC69 or pRh69 resulted in an increased CAT-protein level similar to that observed when pUL69 was present (Fig. 10B, compare lane 4 and 5 with lane 3), implying that these two betaherpesviral proteins can, in analogy to their HCMV counterpart, function as viral mRNA-export factors. However, neither pM69, HHV6 pU42 nor ElHV1 pU42 was able to promote the accumulation of unspliced CAT-mRNAs in the cytoplasm, as can be deduced from CAT-protein levels that were comparable to those of the negative control (Fig. 10B, compare lane 6 to 8 with lane 1).

A B

Fig. 10: Nuclear mRNA-export by betaherpesviral pUL69-homologs. (A and B) CAT-mRNA-export assay of pUL69 and homologous proteins. The diagram shows the relative amounts of CAT-protein measured 36h post transfection of HEK293T (B) or NIH3T3 (C) cells with a mixture of the reporter pDM128/CMV/RRE and plasmids expressing either FLAG-pUL69 (panel A, lane 3; panel B, lane 2) or FLAG-tagged betaherpesviral pUL69- homologs as indicated at the bottoms of the diagrams (panel A, lanes 4 to 8; panel B, lanes 3 to 7). HIV1 Rev served as a positive control (panel A, lane 2) and pcDNA3 as a negative control (panels A and B, lanes 1). The relative amounts of CAT-protein are given as percentages relative to that of HIV1 Rev (panel A) or HCMV pUL69 (panel B) and standard deviations of at least three experiments are shown as bars.

However, these CAT-mRNA-export assays were performed in human HEK293T cells and might therefore not be suitable for all pUL69-homologs of the Betaherpesvirinae subfamily with different host species, for example pM69 of MCMV or ElHV1 pU42, due to the lack of species-specific host cofactors. In order to exclude this possibility, analogous CAT-reporter assays were performed in murine NIH3T3 cells (Fig. 10C). Interestingly, coexpression of pDM128/CMV/RRE and HCMV pUL69, as a positive control, or CCMV pC69 and RhCMV pRh69 again led to a significant increase in the CAT-protein level in NIH3T3 cells and

44 Results therefore underlined their ability to function as viral mRNA-export factors, even in cells from a different host species. In contrast, coexpression of MCMV pM69, HHV6 pU42 or ElHV1 pU42 with the reporter plasmid did not increase the CAT-protein level in murine host cells, thus confirming the results obtained in HEK293T cells. This finding argues against a dependency on species-specific host cofactors. In summary, these results show that the cytomegaloviral proteins pUL69, pC69 and pRh69 exert mRNA-export activity irrespective of the cell system utilised. In contrast, the betaherpesviral counterparts pM69 and HHV6 or ElHV1 pU42 were not able to promote the nuclear export of unspliced mRNA in this particular reporter assay.

1.5. Nucleocytoplasmic shuttling of HCMV pUL69 and its betaherpesviral homologs It has become apparent that some pUL69-homologs within the subfamilies Alphaherpesvirinae and Gammaherpesvirinae, including HSV1 ICP27, EBV EB2, HHV8 ORF57 and herpesvirus saimiri (HVS) ORF57, shuttle independently of virus-encoded cofactors between the nucleus and the cytoplasm (Bello et al., 1999; Goodwin et al., 1999; Mears et al., 1996; 1998; Sandri-Goldin, 1998; Semmes et al., 1998; Soliman et al., 1997). Such nucleocytoplasmic shuttling activity was also confirmed for HCMV pUL69 and represents a prerequisite for its mRNA-export activity (Lischka et al., 2001; 2006). To analyse if representative betaherpesviral pUL69-homologs exert nucleocytoplasmic shuttling activity, which might account for the different behavior in the mRNA-export assay presented before, interspecies heterokaryon assays were performed as originally described by Pinol- Roma and colleagues (Pinol-Roma and Dreyfuss, 1992). HeLa cells were cotransfected with vectors encoding FLAG-pUL69 or its betaherpesviral counterpart FLAG-pC69, FLAG-pRh69, HHV6-pU42, MCMVpM69 or ElHV1-pU42 and the reporter pCFNrevβGal, which served as a shuttling positive control. Two days later, HeLa cells were fused to nontransfected murine NIH3T3 cells, resulting in heterokaryons comprising the cell nuclei of both species. Four hours after fusion, cells were fixed and the subcellular localization of transfected proteins was analysed by indirect immunofluorescence analyses using polyclonal rabbit-anti-FLAG- and monoclonal anti-β-Gal antibodies (Fig. 11). In order to distinguish between murine and human nuclei, cells were counterstained with DAPI, thereby identifying the murine nuclei by their characteristic punctate pattern (Fig. 11, white arrows). For a control, HeLa cells were transfected with either CFNrevβGal or CFNβGal. CFNrevβGal encodes β-galactosidase fused to the NLS of simian virus 40 large T antigen (SV40 T Ag) as well as to the nuclear export signal (NES) of HIV1 Rev (Fig. 11).

45 Results

Fig. 11: Nucleocytoplasmic shuttling of pUL69 and betaherpesviral homologs. HeLa cells were cotransfected with CFNβGal (a to d), CFNrevβGal (e to h) or a combination of CFNrevβGal and the indicated pUL69-homolog (i to C). CFNrevβGal served as a shuttling positive control and CFNβGal displayed the shuttling negative control. Interspecies heterokaryons were formed by fusion of transfected HeLa cells with murine NIH3T3 cells. Four hours later, cells were fixed and the localization of transfected proteins was assessed by indirect immunofluorescence using an antibody specific for β-galactosidase and rabbit anti-FLAG for detection of pUL69- homologs. Cell nuclei were counterstained with DAPI.

Consequently, this construct served as a shuttling positive control and β-galactosidase was detected in both types of nuclei within a heterokaryon (Fig. 11, e and f), as it was for HCMV pUL69 (data not shown). The second plasmid, CFNβGal, expresses β-galactosidase fused to the NLS of SV40 T Ag, however, it lacks an NES (Fig. 11), thus serving as a nonshuttling control. Hence it localized exclusively to human nuclei but not to murine nuclei within a heterokaryon (Fig. 11, a and b). In analogy, CFNrevβGal, serving as an internal positive

46 Results control for each approach, could always be detected in murine and human cell nuclei (Fig. 11, k, o, s, w, and A). Accordingly, these heterokaryon analyses revealed that the cytomegaloviral proteins pC69 and pRh69 were detected in both types of cell nuclei in interspecies heterokaryons and therefore displayed nucleocytoplasmic shuttling activity analogous to that of HCMV pUL69 (Fig. 11, i to m for pC69 and n to q for pRh69). To our surprise, the more distantly related pM69, as well as HHV6 and ElHV1 pU42, which were negative in the mRNA-export assays, were also able to accumulate within murine cell nuclei and were therefore evaluated as nucleocytoplasmic shuttling proteins (Fig. 11, r to u for pM69, v to y for HHV6 pU42, and z to C for ElHV1 pU42). In summary, heterokaryon analyses identified pC69, pRh69, pM69 and pU42 of HHV6 and ElHV1 as nucleocytoplasmic shuttling proteins that share this functional activity with their HCMV counterpart. This result not only identified nucleocytoplasmic shuttling as a well-conserved feature throughout the Herpesviridae ICP27-protein family but further suggests that this activity may not be sufficient for mRNA-export.

1.6. Interaction with UAP56/URH49 is a prerequisite for stimulation of mRNA-export by pUL69, pC69 and pRh69 Our group reported previously that interaction of pUL69 with the cellular DExD/H-box RNA helicase UAP56 or URH49 is a prerequisite for its mRNA-export activity (Lischka et al., 2006). Since UAP56 is well conserved throughout the vertebrates it was tempting to speculate that a UAP56/URH49-interaction might correlate with the mRNA-export activity of the cytomegaloviral pUL69-homologs. Initial bioinformatic approaches revealed that the UAP56/URH49-interaction motif of pUL69 (Lischka et al., 2006) is 100% or 91% conserved within the cytomegaloviral proteins pC69 and pRh69, respectively (Fig. 12A), but is absent in pM69, HHV6 pU42 and ElHV1 pU42. This supports the assumption that a UAP56-interaction accounts for the mRNA-export activities of cytomegaloviral proteins pUL69, pC69 and pRh69. To test this hypothesis, amino acid exchange mutants of pC69 and pRh69 were constructed with alterations of the properties of each protein to a loss-of-function or a-gain-of function with regard to UAP56/URH49-interaction. In the case of pUL69 and pC69, the UAP56-interaction motif was altered by site-directed mutagenesis of four codons for essential arginines, thereby aiming to disrupt the protein-protein interaction (Fig. 12A). The UAP56/URH49-interaction motif within pRh69 varies from the defined interaction motif by a single amino acid, which was altered by site-directed mutagenesis to mimic the UAP56/URH49-interaction motif as contained within pUL69 (Fig. 12A). Since the UAP56/URH49-interaction motif of pUL69 overlaps in part with its NLS and since the NLSes of pC69 and pRh69 have not yet been mapped in detail, the subcellular localization of each mutant was determined first. For this experiment, HeLa cells were transfected with expression constructs encoding FLAG-tagged or Myc-tagged mutants of pUL69, pC69 or pRh69. Two days later, indirect immunofluorescence analyses revealed an intranuclear

47 Results localization of each FLAG-tagged (Fig. 12B, g to m) or Myc-tagged (Fig. 12B, a to f) pUL69-, pC69- and pRh69-mutant.

A B

Fig. 12: Mutation of the UAP56/URH49-interaction motif of pUL69, pC69 and pRh69 has no influence on their nuclear localization. (A) Amino acid alignment of the UAP56/URH49-interaction motif of HCMV pUL69 and the corresponding sequences of CCMV pC69 and RhCMV pRh69. To generate gain-of-function or loss-of- function mutants, site-directed mutagenesis was performed as indicated and the resulting constructs were subsequently analysed. (B) Nuclear localization of amino acid exchange constructs indicated in panel A. HeLa cells were transfected with FLAG- or Myc-tagged mutants of pUL69, pC69 or pRh69, as indicated. Two days later, cells were fixed and the subcellular localization of proteins was determined by indirect immunofluorescence analyses using anti-FLAG (g to m) or anti-Myc (a to f) antibodies as described before. DAPI was used for counterstaining of the cell nuclei.

Next, the UAP56/URH49-binding capacity of mutant and wild type proteins was investigated by coimmunoprecipitation. HEK293T cells were cotransfected with FLAG-URH49 and Myc- tagged genuine and mutated versions of pUL69, pC69 or pRh69 (Fig. 13A). Two days later, cells were lysed and immunoprecipitation was performed using anti-FLAG antibodies. As determined by staining of the CoIP Western blot with an anti-Myc antibody, URH49 was able to coprecipitate wild type pUL69 and pC69 (Fig. 13A, lower panel, lane 1 and 3) but not the respective loss-of-function mutants (Fig. 13A, lower panel, lane 2 and 4). Interestingly, URH49 coprecipitated not only the gain-of-function mutant pRh69mutUAP but also the wild type pRh69 carrying one amino acid substitution within the UAP56/URH49-interaction motif of pUL69 (Fig. 13A, lower panel, lane 5 and 6). Thus, our results identified a UAP56/URH49 consensus motif (RERRAXRARRF) within the cytomegaloviral proteins pUL69, pC69 and pRh69 that was essential for URH49-interaction. Next, we analysed by CAT-mRNA-export assays whether the UAP56/URH49-interaction was required for stimulation of nuclear- mRNA-export by the cytomegaloviral proteins. In accordance with our previous results, co- transfection of the CAT-reporter pDM128/CMV/RRE with HCMV pUL69, CCMV pC69 or RhCMV pRh69 resulted in an increased level of CAT-protein similar to that observed after coexpression of the positive control HIV1 Rev (Fig. 13B, lanes 2, 3, 5 and 7). However, neither pUL69mutUAP56 nor pC69mutUAP56, both of which harbor point mutations abrogating the UAP56-interaction, was able to promote the accumulation of unspliced CAT- mRNA in the cytoplasm (Fig. 13B, lane 4 and 6). In the case of pRh69mutUAP56, the predicted gain-of-function mutation of the UAP56-interaction motif slightly increased its ability

48 Results to export unspliced CAT-mRNA compared to that of wild type pRh69 (Fig. 13B, lane 7 and 8). In summary, this set of experiments indicates that interaction with the cellular DExD/H- box RNA helicases UAP56 and/or URH49 is a prerequisite for the mRNA-export activity of the cytomegaloviral proteins pUL69, pC69 and pRh69.

A B

Fig. 13: UAP56/URH49-interaction is crucial for cytomegaloviral mRNA-export. (A) URH49-binding capacity of constructs indicated in figure 12. Coimmunoprecipitation analyses of cell lysates from HEK293T cells that were cotransfected with FLAG-URH49 (lanes 1 to 6) and Myc-tagged wild type pUL69, pC69 or pRh69 (lanes 1, 3 and 5) or point-mutated versions of these proteins (lanes 2, 4 and 6). Two days post transfection, cells were lysed and immunoprecipitation was performed using anti-FLAG antibodies. After electrophoresis, coprecipitated proteins were visualized by Western blotting with an anti-Myc antibody (lower panel). Immunoglobulin heavy chain (Ighc) served as an internal control for the presence of the precipitating antibody. (B) CAT mRNA-export assay of wild type pUL69, pC69 and pRh69 and the respective mutants carrying mutations in the UAP56/URH49-interaction motif. The diagram shows the relative amounts of CAT-protein measured 36h after transfection of HEK293T cells with a mixture of the reporter pDM128/CMV/RRE and plasmids expressing either wild type pUL69 (lane 3), pC69 (lane 5) or pRh69 (lane 7) or mutants pUL69mutUAP (lane 4), pC69mutUAP (lane 6) and pRh69mutUAP (lane 8). HIV1 Rev served as a positive control (lane 2) and pcDNA3 as a negative control (lane 1). The relative amounts of CAT-protein are given as percentages relative to that of HIV1 Rev. Standard deviations of at least three experiments are shown as bars.

Previous experiments showed explicitly that UAP56/URH49-interaction indeed is the mRNA- export activity determining component of the cytomegaloviral proteins pUL69, pC69 and pRh69. Moreover, as bioinformatic approaches revealed that the UAP56/URH49-interaction motif of pUL69 (Lischka et al., 2006) is 100% or 91% conserved within the cytomegaloviral proteins pC69 and pRh69, it seemed likely that each individual UAP56-interaction motif could be exchanged by another without altering the proteins activity as an mRNA-export factor. In order to investigate this hypothesis a chimeric fusion protein termed pUL69/pRh69 was generated via standard molecular biology cloning (Fig. 14). pUL69/pRh69 comprises the aa1-207 of HCMV pUL69, including its wild type UAP56-interaction motif (aa18-30), N- terminally fused to aa199-777 of RhCMV pRh69, lacking its own UAP56-interaction domain (aa75-87) (Fig. 14).

49 Results

Fig. 14: Schematic illustration of a pUL69/pRh69 chimeric fusion protein. Depicted are the wild type proteins of HCMV pUL69 and RhCMV pRh69. pUL69/pRh69 represents a chimeric fusion protein of pUL69 with pRh69 comprising aa1-207 of pUL69 at the N-terminus and aa199-777 of pRh69 at the C-terminus. (UAP56=UAP56- interaction motif of pUL69 or pRh69).

In order to assure specific detection of the chimeric protein, a FLAG-epitope was fused in frame to the N-terminus, thereby allowing recognition of the chimer independently from its origin. To analyse the mRNA-export activity of the pUL69/pRh69 chimeric protein, CAT- mRNA-export assays were conducted exactly as described before. In accordance with previous results, both pUL69 as well as pRh69 were able to efficiently promote the accumulation of unspliced CAT-transcripts in the cytoplasm (Fig. 15, lane 3 and 4), which can be deduced from CAT-protein levels comparable to those of the positive control HIV1 Rev (Fig. 15, lane 2).

Fig. 15: Nuclear mRNA-export activity of a pUL69/pRh69 fusion protein. CAT- mRNA-export assay of pUL69, pRh69 and the pUL69/pRh69 chimeric protein. The diagram shows the relative amounts of CAT- protein measured 36h post transfection of HEK293T cells with a mixture of the reporter pDM128/CMV/RRE and plasmids expressing either FLAG-UL69 (lane 3), FLAG-Rh69 (lane 4), FLAG-Rh69mutUAP56 (lane 5) or FLAG-tagged UL69/Rh69 chimer, as indicated at the bottom of the diagram. HIV1 Rev served as a positive control (lane 2) and pcDNA3 as a negative control (lane 1). The relative amount of CAT-protein are given as percentages relative to that of HIV1 Rev and standard deviations of at least three experiments are shown as bars. In parallel, Western blot analyses were performed using anti-FLAG- and anti-β-actin- antibodies to assure equal protein expression and loading.

Moreover, the gain-of-function mutant of pRh69 – pR69mutUAP56 – again showed a slight increase in its mRNA-export activity compared to wild type pRh69 (Fig. 15, lane 5). Noteworthy, coexpression of the pDM128/CMV/RRE with the chimeric protein pUL69/pRh69

50 Results resulted in an mRNA-export capacity comparable to pRh69 wild type protein (Fig. 15, compare lane 6 with 4), implying that transfer of the UAP56-interaction motif of pUL69 to pRh69 can substitute for its own, native interaction motif. To exclude variations in the protein expression levels of all proteins investigated, Western blot analyses were carried out in parallel and assured equal protein loading (Fig. 15, lower panels). Taken together, all results obtained so far clearly highlight the functional significance of the UAP56-interaction for the mRNA-export activity of the cytomegaloviral proteins pUL69, pC69 and pRh69.

1.7. Interaction of pUL69 with UAP56/URH49 but not RNA-binding is essential for efficient replication of human cytomegalovirus Due to the observation that the UAP56-binding site of pUL69 is functionally conserved in pC69 and pRh69, it was tempting to hypothesize that this protein interaction might play a critical role during HCMV-replication. In order to investigate this possibility, several recombinant viruses harboring mutations within the N-terminal coding sequence of pUL69 had already been generated (Giede-Jeppe, 2011; Zielke et al., 2011). Since previous studies revealed that the UAP56-binding site overlaps with a tripartite arginine-rich RNA-binding motif of pUL69 (Lischka et al., 2006), three different UL69 mutations were introduced into the HCMV genome via BACmid-recombination.

Fig. 16: Schematic diagram illustrating the structure of recombinant viruses that were generated by homologous recombination in Escherichia coli. In a first step, the selection marker galK was inserted into UL69 of BAC pHB5. Subsequently, the selection marker was replaced by either a wild type or a mutated UL69 sequence. The upper half of the figure shows the genomic region of HCMV strain AD169 containing UL69 (numbers refer to nucleotide positions of AD169). The lower half of the figure illustrates functional domains of UL69 and indicates the localization of mutations/deletions that were introduced into recombinant BACmids (numbers refer to nucleotide positions of the UL69 open reading frame). UAP56=UAP56-binding motif of UL69; RNA=RNA-binding domain of UL69 comprising the arginine-rich motifs R1, R2 and RS; ICP27-homology=ICP27- homology region of UL69; NES=nuclear export signal. The UAP56- and/or RNA-binding capacities of pUL69 variants are indicated on the right site of the figure.

51 Results

UL69mutUAP corresponds to the previously mentioned mutant of UL69 that carries alanine substitutions within the UAP56-binding domain, thus abrogating the interaction with UAP56. UL69ΔR1ΔRS and UL69ΔR2ΔRS are internal deletion mutants of arginine-rich regions, both of which have been shown to lack RNA-binding activity (Toth et al., 2006). In addition, however, UL69ΔR1ΔRS is also negative for UAP56-binding, since the arginine-rich region R1 overlaps with the UAP56-binding site (Fig. 16). The structural integrity of mutant and revertant viruses was confirmed by restriction enzyme digest and Southern blot analyses as well as by PCR amplification of UL69 genomic sequences (data not shown; Giede-Jeppe, 2011) followed by nucleotide sequence determination of the entire UL69 ORF. After reconstitution of infectious viruses, multistep growth curve analyses of wild type, mutant, and revertant AD169 viruses were performed in parallel. For these analyses, HFFs were infected in triplicate (multiplicity of infection, MOI=0.1) with viral inocula normalized for equal immediate-early (IE) units. After harvesting the supernatants at 2, 4, 6 and 8 days post infection (dpi), they were subjected to IE1p72 immunofluorescence titration. As depicted in figure 17, growth curve analyses illustrated a clear decrease in the release of progeny virions of the AD169-UL69mutUAP and AD169-UL69ΔR1ΔRS viruses, both of which lack a functional UAP56-binding motif. The growth properties of the revertant virus AD169-UL69rev were not altered compared to those of the wild type AD169 virus (Fig. 17A), while the AD169-UL69ΔR2ΔRS virus, expressing an RNA-binding-deficient pUL69, exhibited a slight but significant delay in the release of progeny virions.

A B

Fig. 17: Growth kinetics of recombinant AD169-derived viruses carrying UL69 mutations that either affect UAP56- and/or RNA-binding capacity of pUL69. (A) Growth kinetics of recombinant AD169-derived viruses Multistep growth curve analyses of AD169-UL69, AD169-UL69rev, AD169-UL69mutUAP, AD169-UL69ΔR1ΔRS, and AD169-UL69ΔR2ΔRS. HFFs were infected with equal IE units (MOI=0.1) of each virus. The viral supernatants were harvested at the indicated time points (days post infection, dpi), followed by the determination of IE units. Each infection was performed in triplicate and the standard deviations are depicted by error bars. (B) Quantification of viral genomes in the supernatants of infected HFF cells by real-time PCR. Aliquots of the supernatants obtained for the multistep growth curves shown in panel A were treated with proteinase K, incubated at 56°C for 1h, and subsequently denatured at 95°C. 5µl of each lysate were subjected to real-time PCR to quantify the genomic equivalents in the supernatants of the recombinant viruses. Evaluations were performed in triplicate for each of the three infections per virus. Standard deviations are indicated.

52 Results

Since pUL69 has been shown to be a constituent of viral particles (Winkler and Stamminger, 1996), the mutations introduced into pUL69 might affect the infectivity of HCMV virions. To exclude this possibility, DNA was extracted from the viral supernatants obtained from the growth curve experiment of figure 17A and viral genomic equivalents were determined by real-time PCR. As shown in figure 17B, the amounts of viral DNA in the supernatants clearly paralleled the release of progeny virus as observed by growth curve analyses (compare Fig. 17A and B). Taken together, these results suggest that the interaction of pUL69 with UAP56/URH49 is required for the efficient replication of human cytomegalovirus.

1.8. Characterization and functional analyses of chimeric fusion proteins between HCMV pUL69 and MCMV pM69 Initial CAT-mRNA-export assays demonstrated that besides pUL69 only the closer related cytomegaloviral homologs pC69 and pRh69 were able to act as viral mRNA-export factors, whereas the less related pUL69-homologs of MCMV, HHV6 and ElHV1 could not promote the accumulation of unspliced CAT-transcripts in the cytoplasm (compare Fig. 10). Moreover, previous experiments clearly highlighted that both nucleocytoplasmic shuttling as well as direct UAP56-interaction are both prerequisites for pUL69, pC69 and pRh69 in order to function as virus-encoded mRNA-export factors. Importantly, interspecies heterokaryon analyses of those betaherpesviral pUL69-homologs investigated revealed that nucleocytoplasmic shuttling activity is a conserved functional feature of the betaherpesviral ICP27-protein familliy (Fig. 11), which therefore cannot account for the differences observed in the CAT-mRNA-export assay.

Fig. 18: pM69 fails to recruit UAP56 in vivo. Coimmunoprecipitation analysis of cell lysates from HEK293T cells that were cotransfected with FLAG-UAP56 (lanes 2 to 5) and Myc- tagged pUL69 (lanes 1 and 2), pC69 (lane 3), pRh69 (lane 4) or pM69 (lane 5). 36h post transfection, cells were lysed and immunoprecipitation was performed using anti- FLAG antibodies. Coprecipitated proteins were visualized by Western blotting with an anti-Myc antibody (lower panel). Immunoglobulin heavy chain (Ighc) served as an internal control for the presence of the precipitating antibody.

Unfortunately, initial bioinformatic approaches were unable to determine any UAP56- interaction motifs within the amino acid sequences of pM69 or pU42 of HHV6 or ElHV1 and

53 Results coimmunoprecipitation experiments investigating direct protein-protein interaction with UAP56 had not been conducted so far. In summary, these findings led to the tempting speculation that betaherpesviral pUL69- homologs, with the exception of the cytomegaloviral proteins pUL69, pC69 and pRh69, fail to promote nuclear mRNA-export simply because they are inable to interact with UAP56/URH49 an to thereby gain access to the cellular mRNA-export machinery. To test this hypothesis, the UAP56-binding capacity of pM69, serving as representative mRNA-export negative pUL69-homolog, was investigated in the first instance. For this, HEK293T cells were cotransfected with FLAG-UAP56 and Myc-tagged versions of pUL69, pC69, pRh69 or pM69 (Fig. 18). Two days later, cells were lysed and coimmunoprecipitation was performed using anti-FLAG antibodies. As determined by staining of the CoIP Western blot with an anti-Myc antibody, UAP56 was able to interact specifically with pUL69, pC69 as well as pRh69 (Fig. 18, lower panel, lanes 2 to 4) as expected. In contrast pM69, was not coprecipitated by UAP56 (Fig. 18, lower panel, lane 5), indicating that pM69 indeed cannot associate with this cellular mRNA-export factor. Having shown that UAP56-interaction presumably represents the ultimate cause for the missing mRNA-export activity of pM69, it was highly suggestive that transfer of N-terminal fragments of pUL69, comprising its UAP56- interaction motif, to MCMV pM69 can convert this protein into an active mRNA-export factor. In order to clarify this hypothesis, four chimeric proteins comprising full length pM69 fused to N-terminal fragments of pUL69 or pUL69mutUAP56 were constructed (Fig. 19). Since the UAP56-interation domain of pUL69 comprises only 12 amino acids (aa 18-30), it is likely to fold improperly when expressed as short peptide solely or in fusion proteins. Therefore, in order to ensure correct folding of this domain within each chimeric protein, a minimum of 38 amino acids of the pUL69 N-terminus, comprising the UAP56-binding domain, were included in each hybrid. Chimeric protein 1 (pCh1) comprises aa12-50 of pUL69 N-terminally fused to pM69 (Fig. 19). The second hybrid (pCh2) encodes the exact same fusion protein pCh1, except that it harbors four point mutations within the UAP56-interaction motif (R22,23,25,26A), thereby abrogating UAP56-recruitment by pUL69 (Fig. 19). Chimeric proteins pCh3 and pCh4 also comprise pM69 at their C-termini, but possess longer N- terminal fragments of pUL69 or pUL69mutUAP56 reaching from aa1-140, respectively (Fig. 19). In order to assure specific detection of all generated fusion proteins, FLAG- or Myc- epitopes were fused in frame at the N-terminus of all chimers to allow recognition of all proteins independently from their origin.

54 Results

Fig. 19: Schematic illustration of HCMV pUL69, MCMV pM69 and chimeric fusion proteins pCh1 to pCh4. HCMV pUL69mut contains four alanine substitutions within its UAP56-interaction motif thereby abrogating direct protein-protein interaction. pCh1 to pCh4 represent chimeric fusion proteins of pUL69 with pM69. pCh1: aa12-50 of pUL69 fused to full length pM69; pCh2: aa12-50 of pUL69mut fused to full length pM69; pCh3: aa1-140 of pUL69 fused to full length pM69; pCh4: aa1-140 of pUL69mut fused to full length pM69. Grey boxes within each protein mark distinct domains with known functions (UAP56=UAP56-interaction motif of pUL69; NLS=nuclear localization signal; NES=nuclear export signal). The localization of each domain is indicated by numbers corresponding to the flanking amino acids (aa).

1.8.1. Verification of protein expression and analysis of subcellular localization of chimeric proteins pCh1 to pCh4 Starting point for the functional characterization of the pUL69/pM69 chimeric fusion proteins was the verification of protein expression by Western blot analyses (Fig. 20A). For this, HEK293T cells were transfected with plasmids encoding FLAG-pUL69 (lane 2), FLAG-pM69 (lane 3) or the FLAG-tagged chimeric fusion proteins pCh1 to pCh4 as indicated in figure 20 (lanes 4 to 7). 36h post transfection, cell lysates were prepared, separated by SDS-PAGE and protein expression was analysed using an anti-FLAG-antibody (Fig. 20A, upper panel). HCMV pUL69 and MCMV pM69 served as transfection and expression controls and were detectable at their molecular weighs of 105-116kDa and 130kDa, respectively (Fig. 20A, upper panel, lanes 2 and 3) (Winkler et al., 1994; Zielke et al., 2011). Moreover, the chimeric proteins pCh1 and pCh2 were translated into proteins of approximately 135kDa in size (Fig. 20A, upper panel, lane 4 and 5). In addition, the pUL69/pM69 fusion proteins pCh3 and pCh4 were detected at a molecular mass of approximately 140kDa (Fig. 20A, upper panel, lane 6 and 7). Thus, protein expression of HCMV pUL69, MCMV pM69 as well as the chimeric pUL69/pM69 fusion protein pCh1 to pCh4 was verified successfully by Western blotting using an anti-FLAG-antibody directed against the respective epitope. Moreover, to test the reactivity of pUL69-specific antibodies against the betaherpesviral pUL69-homolog pM69 of MCMV and the chimeric fusion protein pCh1 to pCh4, the monoclonal UL69-antibody (MαUL69) as well as the rabbit polyclonal UL69-antiserum (RαUL69) were also adopted in Western blot analyses (Fig. 20A, middle panels). First of all, the reactivity of both antibodies

55 Results against pUL69 of HCMV was confirmed (Fig. 20A, middle panels, lane 2). Moreover, RαUL69 was also able to detect all chimeric fusion proteins pCh1 to pCh4, whereas MαUL69 was restricted in its immunogenicity to pCh3 and pCh4 (Fig. 20A, middle panels, lanes 4 to 7). In contrast, none of the two pUL69-specific antibodies was able to visualize pM69 of MCMV in these Western blot analyses (Fig. 20A, middle panels, lane 3). Finally, to assure loading of equal amounts of cell lysates, Western blots were stained with an anti-β-actin antibody (Fig 20A, lower panel).

A B

Fig. 20: Nuclear localization of pUL69, pM69 and chimeric fusion proteins pCh1 to pCh4. (A) Expression analysis of pUL69, pM69 and chimeric fusion proteins pCh1 to pCh4 by Western blotting of cell lysates from HEK293T cells, which were transfected with plasmids encoding N-terminally FLAG-tagged versions of pUL69 (lane 2), pM69 (lane 3) or pCh1 to pCh4 (lanes 4 to 7) as indicated. Transfection of an empty vector served as specificity control (mock, lane 1). Cells were lysed under denaturating conditions 48h post transfection. Lysates were separated by SDS-PAGE and protein expression was analysed by Western blotting using an anti-FLAG antibody (A, upper panel). To test the reactivity of pUL69 specific antibodies against hybrid proteins, the monoclonal MαUL69 antibody as well as the polyclonal RαUL69 antisera were also applied in Western blot analyses (A, middle panels). Cellular β-actin levels served as controls for equal protein loading (A, lower panel). Molecular size markers are indicated (kDa). (B) Nuclear localization of pUL69, pM69 and chimeric fusion proteins pCh1 to pCh4. HeLa cells were transfected with plasmids for FLAG-tagged versions of pUL69 (c and d), pM69 (e and f), pCh1 (g and h), pCh2 (i and k), pCh3 (l and m) or pCh4 (n and o) as indicated. Transfection of empty vector served as specifity control. Two days later, cells were fixed and the subcellular localization of proteins was determined by indirect immunofluorescence analyses using anti-FLAG antibodies (a to o) and anti-mouse-FITC as secondary antibody. DAPI was used for counterstaining of the cell nuclei.

Having verified the correct expression of all generated chimeric proteins, indirect immunofluorescence analyses were carried out to determine the subcellular localization of each hybrid. For this purpose, HeLa cells were transfected with expression plasmids for the FLAG-tagged versions of pUL69 (Fig. 20B, c and d), pM69 (Fig. 20B, e and f) or the chimeric proteins pCh1 to pCh4 (Fig. 20B, g to o). Two days post transfection cells were fixed and indirect immunofluorescence staining was performed using an anti-FLAG antibody. Besides pUL69 and pM69, for which a nuclear distribution had already been reported (Winkler and Stamminger, 1996; Lischka et al., 2006, Zielke et al., 2011), all chimeric protein also displayed a nuclear accumulation (Fig. 20B, g to o). Interestingly, in analogy to pM69, a

56 Results concentration of proteins within distinct inner nuclear foci was observed for all chimeric proteins. Concluding, fusion of N-terminal pUL69-fragments to full length pM69 does not affect the subcellular localization of pM69, since all of the generated chimeric proteins still showed a nuclear distribution.

1.8.2. pM69 acquires mRNA-export activity by fusion of the UAP56-interaction motif of HCMV pUL69 to its N-terminus As already mentioned in the introduction, one of the main functions of pUL69 is its ability to act as a viral mRNA-export factor facilitating the nuclear export of unspliced transcripts (Lischka et al., 2006). In contrast, the betaherpesviral pUL69-homolog of MCMV, pM69, cannot stimulate nuclear mRNA-export to the cytoplasm, eventhough pM69 possesses nucleocytoplasmic shuttling activity (Zielke et al., 2011). Whether the inability of pM69 to function a viral mRNA-export factor originates from its failure to interact with UAP56 had not been investigated so far, but provided a feasible hypothesis and was confirmed by coimmunoprecipitation experiments (Fig. 18). A B

Fig. 21: Transfer of the UAP56-interaction motif of pUL69 to pM69 converts the protein into a functional mRNA-export factor. (A) UAP56-binding capacity of pUL69, pM69 and chimeric protein as indicated in figure 19. Coimmunoprecipitation analyses of cell lysates from HEK293T cells that were cotransfected with FLAG-UAP56 (lanes 3 to 8) and Myc-tagged pUL69 (lane 1 and 3), pM69 (lane 2 and 4) or pCh1 to pCh4 (lanes 5 to 8) as indicated. Two days post transfection, cells were lysed and immunoprecipitation was performed using anti-FLAG antibodies. After electrophoresis, coprecipitated proteins were visualized by Western blotting with an anti-Myc antibody (lower panel). Immunoglobulin heavy chain (Ighc) served as an internal control for the presence of the precipitating antibody. (B) Nuclear mRNA-export activity of pUL69, pM69 and chimeric protein pCh1 to pCh4. The diagram shows the relative amounts of CAT-protein measured 36h after transfection of HEK293T cells with a mixture of the reporter pDM128/CMV/RRE and plasmids expressing either pUL69 (lane 3), pM69 (lane 4), or pCh1 to pCh4 (lanes 5 to 8). HIV1 Rev served as a positive control (lane 2) and pcDNA3 as a negative control (lane 1). The relative amounts of CAT-protein are given as percentages relative to that of HIV1 Rev. Standard deviations of at least three experiments are shown as bars. In parallel, to assure that all proteins were expressed properly in comparable amounts, Western blot analysis of lysates used for CAT mRNA-export assays were conducted using an anti-βactin as well as anti-FLAG antibodies (lower panels).

57 Results

To clarify if transfer of the UAP56-interaction motif of pUL69 can convert pM69 into an active mRNA-export factor, the chimeric fusion proteins pCh1 to pCh4 were tested for their UAP56- binding capacity by coimmunoprecipitation experiments. For this, HEK293T cells were transfected with FLAG-UAP56 (Fig. 21A, middle panel, lanes 3 to 8) in combination with Myc-tagged versions of pUL69 (Fig. 21A, lanes 1 and 3), pM69 (Fig. 21A, upper panel lanes 2 and 4) or with expression plasmids encoding the chimeric proteins pCh1 to pCh4 (Fig. 21A, lanes 5 to 8). Two days later, cells were lysed and immunoprecipitation was performed using FLAG-antibodies. As determined by staining of the CoIP Western blot with a Myc-antibody, UAP56 was able to specifically coprecipitate pUL69, which served as internal positive control (Fig. 21A, lower panel, lane 3), but not the betaherpesviral counterpart pM69 (Fig. 21A, lower panel, lane 4). Moreover, a direct protein-protein interaction of UAP56 with pCh1 and pCh3 was also verified (Fig. 21A, lower panel, lane 5 and 7). In contrast, the corresponding chimeric proteins pCh2 as well as pCh4 were not coprecipitated by UAP56 (Fig. 21A, lower panel, lane 6 and 8). Since pCh2 and pCh4 consist of the exact same amino acid sequences like pCh1 and pCh3, respectively, but harbor point mutations within the pUL69-fragments abrogating UAP56-interaction (R22,23,25,26A), it can be assumed that these amino acids account for the differences of the chimeric proteins in regard to their UAP56-binding capacity. Next, it was analysed by CAT-mRNA-export assays whether the UAP56-interaction was required for the stimulation of nuclear mRNA-export by pUL69, pM69 or the chimeric fusion proteins. To monitor mRNA-export in vivo, the CAT-reporter assay described before was applied. Here, HEK293T cells were cotransfected with the reporter plasmid pDM128/CMV/RRE and with vectors encoding HIV1 Rev (Fig. 21B, lane 2), FLAG-pUL69 (Fig. 21B, lane 3), FLAG-pM69 (Fig. 21B, lane 4) or the FLAG-tagged versions of pCh1 to pCh4 (Fig. 21B, lanes 5 to 8). 36 hours later, cells were harvested and the amount of CAT- protein was quantified using a CAT-ELISA (Fig. 21B). In accordance with previous results, co-transfection of empty vector or MCMV pM69 yielded only minor CAT-protein levels, while coexpression of the RNA-export factors HIV1 Rev or HCMV pUL69 resulted in a significant increase of measured CAT-protein (Fig. 21B, upper panel, lanes 1 to 4). In analogy to pUL69, pCh1 and pCh3 were also able to promote the accumulation of CAT-protein in the cytoplasm, since coexpression of these fusion proteins with pDM128/CMV/RRE yielded comparable CAT-protein levels (Fig. 21B, upper panel, lane 5 and 7). In contrast, pCh2 and pCh4, harboring the loss-of-function mutation within the UAP56-interaction motif of pUL69, were not able to function as mRNA-export factors, which can be deduced from CAT-protein levels comparable to the coexpression of empty vector (Fig. 21B, upper panel, lane 6 and 8). In parallel, to exclude variations in the expression levels of all proteins investigated, Western blot analyses were conducted and assured that all proteins were expressed properly in comparable amounts (Fig. 21B, lower panels).

58 Results

In summary, this set of experiments indicates that interaction with the cellular DExD/H-box RNA-helicase UAP56 is responsible for the differences in the mRNA-export activity of pUL69 and pM69. Moreover, fusion of N-terminal pUL69-fragments, comprising the native UAP56- interaction motif to pM69, enables chimeric proteins to efficiently bind to UAP56 and thereby to promote the accumulation of unspliced transcripts in the cytoplasm. This leads to the assumption that the UAP56-binding capacity of pUL69 can be transfered and renders an inactive heterologous ortholog to an active mRNA-export factor.

1.8.3. Transfer of the UAP56-interaction motif of pUL69 to pM69 enables the chimeric protein to substitute for pUL69 during HCMV-infection Previous experiments clearly demonstrated that fusion of the UAP56-interaction motif of the HCMV mRNA-export factor pUL69 to its MCMV counterpart pM69, enabled chimeric fusion proteins pCh1 and pCh3 to (i) interact with the cellular mRNA-export factor UAP56 and to (ii) promote the nuclear export of unspliced CAT-transcripts in the cytoplasm. However, all results generated so far were obtained from HEK293T cells, which were transiently transfected with respective eukaryotic expression plasmids and can thus not be projected to any viral context. Therefore, in order to analyse whether transfer of the UAP56-interaction motif of pUL69 to pM69 can indeed enable a chimeric fusion protein to substitute for pUL69 during HCMV-infection, recombinant cytomegaloviruses were generated via homologous recombination using the two step red-mediated recombination for markerless DNA manipulation (Tischer et al., 2006).

Fig. 22: Schematic illustration of recombinant HCMV BACmids. Schematic diagram illustrating the structure of recombinant HCMV BACmids generated via homologous recombination in E.coli. The upper panel shows the genomic region UL69 of the AD169-based HCMV BACmid pHB15 (numbers refer to nucleotide positions of strain AD169, BAC-PCR1 refers to PCR amplification that was performed to confirm the integrity of recombinant viruses). The lower panels illustrate the recombinant BACmids, which were generated by homologous recombination. HB15ΔUL69=deletion of ORF UL69; HB15-FLAG-UL69=ORF UL69 with an N-terminal FLAG- epitope; HB15-FLAG-M69=replacement of ORF UL69 by the orthologous ORF M69 of MCMV with an N-terminal FLAG-epitope; HB15-FLAG-Ch1= substitution of ORF UL69 by the chimeric fusion protein pCh1 (aa12-50 of HCMV pUL69 with full length pM69) with an N-terminal FLAG-epitope.

59 Results

By applying this strategy, the wild type AD169-based HCMV bacterial artificial chromosome (BACmid) pHB15 was first used to delete the genomic region UL69, resulting in the pHB15ΔUL69-BACmid (Fig. 22). Afterwards, the same genetic engineering was used to reinsert FLAG-UL69, FLAG-M69 or FLAG-Ch1 at the position of the UL69 ORF, thereby generating recombinant HCMV-BACmids pHB15-FLAG-UL69 (revertant), pHB15-FLAG-M69 or pHB15-FLAG-Ch1 (Fig. 22). The chimeric protein 1, pCh1, was chosen as a representative hybrid, since it was able to recruit UAP56 and to promote the accumulation of unspliced transcripts to the cytoplasm. In order to validate the genomic integrity of all BACmids, they were analysed using three independent methods: PCR analysis (BAC- PCR1), restriction endonuclease digest and direct nucleotide sequencing (Fig. 23A and B). Primers used for the BAC-PCR1 annealed at positions indicated in figure 22, thereby giving rise of a 2.5kbp fragment in the case of UL69 wild type or revertant, a 300bp fragment when the genomic region of UL69 was deleted or a 2.9kbp or 3.0 kbp fragment in the case that UL69 was replaced by FLAG-M69 or FLAG-Ch1, respectively (Fig. 23A).

A B

Fig. 23: Verification of the structural integrity of recombinant HCMV BACmids generated by homologous recombination. (A) PCR analyses using oligonucleotides specific for the UL69 flanking regions of UL68 and UL70. The localization of primers used for amplification is shown in figure 22 (BAC-PCR1). (B) AflII and AscI restriction enzyme digest, pulse field gel electrophoresis and subsequent ethidium bromide staining of 0.8% agarose gels of bacterial clones harboring recombinant BACmids as indicated. Wild type as well as recombinant BACmids comprise different AflII and AscI restriction sites thereby resulting in a distinct restriction pattern for each BACmid.

Secondly, to ascertain that recombination did not alter the BACmid genome apart from the desired deletion or substitution, the structural integrity of the obtained BACmids was investigated by restriction enzyme cleavage with AflII or AscI and subsequent pulse field gel electrophoresis (Fig. 23B). The restriction endonuclease digest of genomes was predicted by VectorNTI in order to select endonucleases that yield complex but still discriminable fragment patterns of pHB15 wild type versus modified BACmids (Fig. 23B). Analogous to the predicted patterns, the different fragments were detectable and confirmed the genomic integrity. Finally, the correctness of all genetically modified BACmids was additionally confirmed by nucleotide sequence analyses of recombined regions.

60 Results

After reconstitution of infectious viruses, multistep growth curve analyses of wild type, mutant, and revertant AD169-viruses were performed (Fig. 24A). For this, HFFs were infected in triplicate with viral inocula normalized for equal immediate-early (IE) units (multiplicity of infection, MOI=0.001). After harvesting of the supernatants at 2, 4, 6, 8, 10 and 12 days post infection (dpi), they were subjected to quantitative Taqman PCR (qPCR) determining the amount of viral IE1-gene, corresponding to HCMV genome equivalents present at each time point. As depicted in figure 24A, the growth properties of the revertant virus AD169-FLAG-UL69 were not altered compared to those of the wild type virus (Fig. 24A). However, substitution of UL69 by its MCMV-homolog M69 illustrated a significant decrease in the release of progeny virions, which was comparable to the deletion of the UL69 ORF from the HCMV genome, thereby indicating that pM69 cannot complement for pUL69 during HCMV-infection (Fig. 24A). In contrast, AD169-FLAG-Ch1 replicated like wild type virus (Fig. 24A) and thus clearly is able to substitute for pUL69 during infection.

A B

Fig. 24: Transfer of the UAP56-interaction motif of pUL69 to pM69 enables the chimeric protein to substitute for pUL69 during HCMV-infection. (A) Growth kinetics of recombinant AD169-derived viruses. In order to determine the replication capacities of the recombinant viruses AD169-wild type, AD169-ΔUL69 (deletion of UL69), AD169-FLAG-UL69 (revertant), AD169-FLAG-M69 and AD169-FLAG-Ch1, multistep growth curve analyses were performed. HFFs were infected with equal IE1-units (MOI=000.1) of wild type, revertant, or mutant viruses. The viral supernatants were harvested at the indicated time points (dpi), followed by the determination of viral genomes by real-time PCR. Aliquots of the supernatants were treated with proteinase K, incubated at 56°C for 1h, and subsequently denatured at 95°C. 5µl of each lysate were subjected to real-time PCR. Each infection was performed in triplicate, and the standard deviations are depicted by error bars. (B) Expression analysis of pUL69, pM69 and chimeric fusion protein pCh1 by Western blot analysis of cell lysates from HFF cells, which were infected at an MOI of 0.1 with wild type (lane 2) or recombinant HCMVs AD169-ΔUL69 (lane 3), AD169- FLAG-UL69 (lane 4), AD169-FLAG-M69 (lane 5), or AD169-FLAG-Ch1 (lane 6), as indicated. Uninfected cells served as a specificity control (mock, lane 1). 96h post infection cells were lysed under denaturating conditions, followed by separation of proteins using SDS-PAGE and Western blotting with an anti-FLAG antibody (B, upper panel). The monoclonal mouse anti-pUL69 antibody, the polyclonal rabbit pUL69-antisera and an IE1-specific antibody were also applied in Western blot analyses (B, middle panels). Cellular β-actin levels served as controls for equal protein loading. Molecular size markers are indicated (kDa).

61 Results

In order to verify the successful deletion or substitution of the UL69 gene in the viral genome as well as to exclude any contaminations within the virus stocks, Western blot analyses were performed (Fig. 24B). For this, HFF cells were either infected with wild type or the mutant viruses at an MOI of 0.1 and 96 hours later were harvested and analysed for the expression of the respective proteins (Fig. 24B). Western blot analyses clearly demonstrated that the FLAG-tagged version of pUL69 (revertant), pM69 and pCh1 were expressed with the desired N-terminal FLAG-epitope at the correct sizes (Fig. 24B, upper panel, lanes 4 to 6). In addition, the application of both pUL69-specific antibodies confirmed the deletion of pUL69 in AD169-ΔUL69 infected cells (Fig. 24B, middle panels, lane 3) and demonstrated again that only pUL69, but not pM69 or pCh1, is recognized by these specific antibodies (Fig. 24B, middle panels, lanes 2, 4, 5 and 6). To control for successful HCMV-infection, Western blots were stained with an IE1-antibody assuring the proper and equal expression of the HCMV immediate-early protein IE1 (Fig. 24B, middle panel). Finally, loading of equal protein extracts was approved by staining of the cellular house-keeping gene β-actin (Fig. 24B, lower panel). In summary, these results indicate that the capacity to interact with the cellular mRNA-export factor UAP56 accounts for the differences in the mRNA-export activity of HCVM pUL69 and MCMV pM69. Moreover, fusion of N-terminal pUL69-fragments to pM69 enables chimeric proteins to efficiently recruit UAP56 and thus to promote the accumulation of unspliced transcripts in the cytoplasm. This leads to the assumption that the UAP56-binding domain of pUL69 is transferable and can render an inactive heterologous protein to an active mRNA- export factor, which is even able to substitute for pUL69 during HCMV-infection.

62 Results

2. Identification of viral and cellular mRNAs that are targeted by the HCMV encoded mRNA-export factor pUL69 As already mentioned in the introduction, several publications illustrate that pUL69 of HCMV functions as a virus encoded mRNA-export factor that promotes the nuclear export of unspliced transcripts via its nucleocytoplasmic shuttling activity and interaction with the cellular mRNA-export factor UAP56 (Lischka et al., 2001; 2006). Furthermore, studies investigating the specificity of RNA-binding indicated that pUL69 non-specifically bound to several RNAs in vitro (Toth et al., 2006). In contrast, RNA-immunoprecipitation experiments analyzing the association of pUL69 with a reporter-mRNA, clearly demonstrated a selective RNA-binding of pUL69 (Toth et al., 2006), thereby arguing for a sequence-specific interaction of pUL69 with putative target-mRNAs in vivo. However, until today neither viral nor cellular mRNAs have been identified, which are associated with pUL69 during HCMV-infection. Regarding the pUL69-homologous mRNA-export factors ICP27 and EB2, both were shown to be required for the nuclear export of a distinct set of viral intronless or unspliced mRNAs (Pearson et al., 2004), suggesting that pUL69 binds analogously to a certain subset of mRNAs and promotes their nuclear export. Therefore, the objective of this study was to identify those viral and cellular mRNAs that are associated with pUL69 during infection.

2.1. Direct RNA-binding of pUL69 is no prerequisite for its mRNA-export activity, while UAP56-interaction is absolutely essential Previous experiments illustrated that pUL69 promotes the nuclear export of unspliced mRNAs generated from a CAT-reporter plasmid (compare Fig. 10; Lischka et al., 2001), thereby acting as a viral mRNA-export factor. However, in contrast to its herpesviral homologs ICP27 or EB2, for which direct RNA-binding was shown to be required for their function as mRNA-export factors (Johnson et al., 2009; Hiriat et al., 2003a), it was demonstrated that RNA-binding of UL69 itself is no prerequisite for its mRNA-export activity (Toth et al., 2006). In order to validate these data and to identify a pUL69-mutant incapable to bind RNA and to promote the accumulation of unspliced transcripts, CAT-mRNA-export assays as well as RNA-immunoprecipitation experiments were conducted. As previously mentioned, the RNA-binding motif of pUL69 is composed of three arginine-rich sequences termed R1 (aa17-30), R2 (aa36-50) and RS (aa123-139), which in part overlap with the nuclear localization signal (NLS; aa21-45) and/or the UAP56/URH49-interaction domain of pUL69 (aa18-30) (Fig. 25). To discriminate between these functional domains, a series of internal deletion or point mutants of pUL69 had been generated previously (Fig. 25; Toth et al., 2006, Lischka et al., 2006). In these mutants the arginine-rich sequences were removed either separately (Fig. 25; ΔR1, ΔR2, ΔRS) or in combinations (Fig. 25; ΔR1ΔRS, ΔR2ΔRS). Since mutants lacking the arginine cluster R2 (ΔR2, ΔR2ΔRS) exhibited a partial cytoplasmic distribution due to the deletion of the NLS, the nuclear localization of both

63 Results mutants was reconstituted by fusion of the SV40 T Ag NLS to the pUL69 N-terminus (Fig. 25; Toth et al., 2006). Moreover, all mutants had already been characterized in detail with regard to their subcellular localization, RNA-binding capacity and UAP56-interaction by several methods including immunofluorescence experiments, North Western assays and co- immunoprecipiation analyses (Toth et al., 2006), as indicated on the right side of figure 25.

Fig. 25: Schematic diagram of FLAG-tagged pUL69 and in-frame pUL69 deletion or point mutants. RNA- binding represents the RNA-binding domain of pUL69 containing arginine-rich sequences R1, R2 and RS. The binding domain of the cellular mRNA-export factor UAP56 within pUL69 overlaps with the R1 region whereas the NLS of the protein overlaps with the R2 region. The localization of the ICP27-homology region and the NES of pUL69 are also indicated. NLS in N-ΔR2 and N-ΔR2ΔRS stands for SV40 T Ag NLS.

Results obtained hereby clearly demonstrated that pUL69-mutants carrying a deletion of the RS cluster in combination with either R1 or R2 (Fig. 25; ΔR1ΔRS, ΔR2ΔRS) entirely lost their RNA-binding activity in vitro (Fig. 25, right panel), while mutants lacking either the arginine- rich sequence R1 or exhibiting point-mutations within the UAP56-binding motif failed to interact with UAP56 in vivo (Fig. 25, right panel). In order to confirm that RNA-binding of pUL69 is no prerequisite for its mRNA-export activity, CAT-mRNA-export assays were conducted using HEK293T cells (Fig. 26), which were transfected with the CAT-reporter plasmid pDM128/CMV/RxRE (compare Fig. 9) and eukaryotic expression plasmids encoding either wild type pUL69 or internal deletion mutants illustrated in figure 25 (Toth et al., 2006). Importantly, in contrast to the previous publication of Toth and collegues, the CAT-reporter plasmid pDM128/CMV/RxRE instead of pDM128/CMV/RRE (compare Fig. 9) was used for determination of the mRNA-export activity of wild type and mutants, thereby accentuating differences to previous experiments. In accordance with these results (Fig. 10; Lischka et al., 2006), the amount of CAT-protein was significantly increased after coexpression of wild type pUL69 or the positive control HTLV1

64 Results

Rex, indicating that both efficiently facilitate the nuclear export of unspliced CAT-transcripts (Fig. 26, lanes 2 and 3). Moreover, mutation of the UAP56-interaction motif (mutUAP56) or deletion of the R1 arginine-rich cluster (ΔR1) either solely or in combination with the RS sequence (ΔR1ΔRS) within pUL69 completely abolished the RNA-export activity (Fig. 26, lane 4, 7 and 11), as it has been demonstrated before. In addition, no discrepancies to previous results were observed for pUL69-mutants harboring deletions within the R2 and/or the RS clusters (ΔR2, ΔRS ΔRSΔRS, NLS-ΔR2, NLS-ΔRSΔRS): none of these pUL69- mutants showed a significant defect in their RNA-export activity (Fig. 26, lanes 5, 6, 8 to 10), but rather promoted the accumulation of CAT-protein as efficiently as wild type pUL69.

Fig. 26: Nuclear mRNA-export by pUL69 and -mutants. CAT- mRNA-export assay of pUL69 and -mutants. The diagram shows the relative amount of CAT-protein measured 36h post transfection of HEK293T cells with a mixture of the reporter pDM128/CMV/RxRE and plasmids expressing either FLAG- pUL69 (lane 3) or the FLAG- tagged pUL69-mutants (lanes 4 to 11) as indicated on the bottom of the diagram. HTLV1 Rex served as a positive control (lane 2) and pcDNA3 as a negative control (lane 1). The relative amounts of CAT-protein are given as percentages relative to that of HTLV1 Rex and standard deviations of at least three experiments are shown as bars. . In parallel, Western blot analyses were performed using anti- FLAG- and anti-β-actin- antibodies to assure equal protein expression and loading. Importantly, differences in the RNA-export activity of RNA-binding deficient pUL69-mutants were not due to insufficient protein expression since all mutants were expressed at comparable levels (Fig. 26, lower panels). In summary, analogously to the previous results, CAT-mRNA-export assays reconfirmed that the RNA-binding deficient pUL69-mutants ΔR2ΔRS and NLS-ΔR2ΔRS were still able to promote the nuclear export of unspliced RNA, indicating that, in contrast to ICP27 and EB2 (Johnson et al., 2009, Hiriart et al., 2003a), direct RNA interaction is not a prerequisite for the RNA-export activity of pUL69. Importantly, these experiments further confirmed that binding of pUL69 to UAP56/URH49 is crucial for the pUL69 mediated export of a reporter-mRNA (Lischka et al., 2006).

65 Results

2.2. Association of pUL69 with CAT-mRNA in vivo To understand the physical association of proteins with RNAs in vivo and to identify RNAs that are associated with a protein of interest, a method was developed by Niranjanakumari and colleagues (2002) termed ribonucleoprotein immunoprecipitation (RIP). RIP functions similar to chromatin immunoprecipiations and allows the identification of RNAs associated with a given protein in vivo. Since one aim of this study was the identification of viral as well as cellular mRNAs that are associated with pUL69, the establishment of such RIP experiments for pUL69 as the protein of interest was essential at first. For this, HEK293T cells were transfected with the CAT- reporter plasmid pDM128/CMV/RRE, as a known pUL69 target, either solely (Fig. 27, lane 1) or in combination with FLAG-tagged pUL69 (Fig. 27, lanes 2 to 4). Cell lysates were prepared 36 h after transfection and Western blotting was performed to ensure that pUL69 protein was expressed at a comparable level in all samples (Fig. 27, WB, Input, upper panel). Additionally, RT-PCR was used to detect the amount of co-transfected CAT-mRNA in each of these cell lysates (Fig. 27, RT-PCR, Input, lanes 1 to 4). Thereafter, immunoprecipitation of pUL69 was performed using either an anti-FLAG antibody (Fig. 27, WB, IP, lane 5 and 6), or the pUL69-specific antibodies MαUL69 and RαUL69 (Fig. 27, WB, IP, lane 7 and 8) and Western blot analyses of the immunoprecipitates demonstrated equal amounts of pUL69 in all samples. Subsequently, pUL69-associated RNAs were extracted from those immunoprecipitates and the presence of CAT-mRNA in the samples was monitored by RT- PCR using primers specific for the intronic CAT sequence (Fig. 27, RT-PCR, IP, lanes 6 to 10). As expected, CAT-mRNA could not be amplified from an immunoprecipitate when no pUL69 was present (Fig. 27, RT-PCR, lower panel, lane 5).

Fig. 27: RNA-immunoprecipitation investigating the association of pUL69 with CAT-mRNA in vivo. Immunoprecipitation of pUL69 from HEK293T cells after transfection of the cells with the CAT-reporter plasmid pDM128/CMV/RRE and pcDNA3 (lane 1 and 5) or FLAG-pUL69 (lanes 2 to 4 and 6 to 8), followed by Western blotting using an anti-FLAG antibody (upper panel, lanes 1 to 4). Immunoprecipitation of pUL69 was performed using either an anti-FLAG antibody (MαFLAG, lanes 5 and 6), the monoclonal anti-pUL69 antibody (MαUL69, lane 7) or a rabbit polyclonal anti-pUL69 anti-serum (RαUL69, lane 8). mRNA was extracted prior and after immunoprecipitation and followed by RT-PCR using sequence-specific primers for the intronic CAT- reporter gene and GAPDH (RT-PCR, lanes 1 to 8). In parallel, PCRs were performed to exclude any DNA contamination in the RNA samples (PCR, lanes 1 to 8).

66 Results

However, upon precipitation of pUL69 with any of the three antibodies, coprecipitated CAT- mRNA could be detected readily (Fig. 27, RT-PCR, lower panel, lanes 5 to 8) demonstrating that CAT-mRNA specifically associates with pUL69 within the transfected cells. Moreover, to determine if pUL69 exhibits any specificity in RNA-binding or if it non-specifically binds to any RNA within the transfected cells, all immunoprecipitates were analysed for the presence of GAPDH-mRNA, as an example for an abundant cellular transcript. Although GAPDH-mRNA was detectable in all cell lysates (Fig. 27, RT-PCR, Input, lower panel lanes 1 to 4) by RT- PCR, it was not present in the pUL69 immunoprecipitates (Fig. 27, RT-PCR, IP, lower panel, lanes 5 to 8), demonstrating that the association of CAT-mRNA with pUL69 in vivo seems to be specific, thereby indicating that pUL69 exerts sequence-specific RNA-binding in vivo. Furthermore, in order to exclude any DNA contaminations in samples used for RT-PCR, PCR reactions were conducted in parallel and revealed no impurities in all RNA samples (Fig. 27, PCR, lanes 1 to 8).

Having verified that RIP analysis provides a suitable methodology to analyse the association of pUL69 with RNA in vivo, this experimental setup was used to investigate the RNA-binding capacity of pUL69 and in-frame deletion or point mutants. For this, HEK293T cells were cotransfected with plasmids encoding either wild type pUL69 without any tag or the FLAG- tagged versions of pUL69, -mutUAP56, -ΔR1, -ΔR1ΔRS or − ΔR2ΔRS in combination with the CAT-reporter plasmid pDM128/CMV/RRE (Fig. 28) and RNA-immunoprecipitations were performed exactly as described before. 36 hours post transfection, cell lysates were prepared and subjected to immunoprecipitation using either an anit-FLAG-antibody (Fig. 28. WB, lane 7) or the monoclonal pUL69-antibody MαUL69 (Fig. 28, WB, lanes 8 to 12). Western blot analyses before and after precipitation ensured proper protein expression in all cell lysates and confirmed specific and comparable immunoprecipitation of pUL69 and - mutants when MαUL69 was used (Fig. 28, WB, lanes 8 to 12), which was not the case when precipitation of untagged pUL69 was performed using the anti-FLAG-antibody (Fig. 28, WB, lane 7). In addition, RT-PCR specific for CAT- or GAPDH-mRNAs were conducted in parallel to monitor the mRNA levels in both, cell lysates and immunoprecipitates. As illustrated, GAPDH- as well as CAT-mRNAs were present in all cell lysates (Fig. 28, RT-PCR, Input, lanes 1 to 6). Moreover, in accordance to previous results, RT-PCR reaction demonstrated that after precipitation of wild type pUL69 coprecipitated CAT-, but not GAPDH-mRNA, was easily detectable (Fig. 28, RT-PCR, IP, lane 8), which was not the case when pUL69 was absent (Fig. 28, RT-PCR, IP, lane 7). In contrast, when the two previously approved RNA- binding deficient mutants ΔR2ΔRS and ΔR1ΔRS were immunoprecipitated, coprecipitated CAT-mRNA was barely or not detectable (Fig. 28, RT-PCR, lane 11 and 12), emphasizing the importance of the arginine-rich regions for in vivo RNA-binding of pUL69.

67 Results

Fig. 28: RNA-binding of pUL69 is no prerequisite for its mRNA-export activity in vivo. Immunoprecipitation of pUL69 and mutants from cotransfected HEK293T cells essentially as described in figure 27 using the anti- pUL69 antibody (MαUL69, lanes 8 to 12) or the anti-FLAG antibody (MαFLAG, lane 7). Protein levels in the input (lanes 1 to 6) and in the immunoprecipitates (lanes 7 to 12) were monitored by Western blotting using MαUL69. RT-PCR and control-PCR specific for intronic CAT- and GAPDH-mRNA using extracted RNA from input (lanes 1 to 6) and immunoprecipitate samples (lanes 7 to 12) were performed exactly as described in figure 27.

Furthermore, to investigate whether the interaction of pUL69 with the cellular mRNA-export factor UAP56 contributes to the association of pUL69 with CAT-mRNA in vivo, the ΔR1- mutant or the point-mutant pUL69mutUAP56 both incapable to interact with UAP56, were also analysed in these RNA-immunoprecipitation experiments (Fig. 28, lane 9 and 10). Interestingly, RT-PCR demonstrated a significantly reduced level of CAT-mRNAs coprecipitated by pUL69ΔR1 and pUL69mutUAP56 (Fig. 28, RT-PCR, IP, lane 9 and 10), indicating that the R1 or, rather, the UAP56-binding motif might be involved in direct or indirect RNA-contact of pUL69 as well, thereby confirming previous in vitro results (Toth et al., 2006). To finalize this experiment, in order to exclude any DNA contaminations in cell lysates and immunoprecipitation samples used for RT-PCR, control-PCR reactions were conducted in parallel and revealed no impurities in all RNA samples (Fig. 28, PCR, middle panels).

In summary, RIP analyses of wild type pUL69 and -mutants clearly demonstrated that the ΔR2ΔRS mutant, which had previously been shown to be inactive in in vitro RNA-binding (Toth et al., 2006), was still able to precipitate low amounts of CAT-mRNA, whereas the RNA- and UAP56-binding deficient mutant ΔR1ΔRS was negative, suggesting that the interaction with UAP56 contributes to the association of pUL69 with CAT-mRNA in vivo. Therefore, the pUL69-mutant ΔR1ΔRS, incapable to promote the nuclear export of unspliced CAT-transcripts as well as to associate with CAT-mRNA, was used as the negative control for all further experiments.

68 Results

Finally, to exclude that pUL69 non-specifically associates with any kind of cotransfected reporter-RNA in HEK293T cells as well as to expulse promoter-dependent loading of pUL69 to transcripts, another RIP experiment was conducted. In this case the cells were transfected with FLAG-tagged pUL69 in combination with the CAT-reporter plasmid pDM128/CMV/RRE (Fig. 29, lane 2), its derivative pDM128/CMV/RxRE (Fig. 29, lane 3), the TKpromCAT plasmid, in which the CAT-reporter gene is driven by the HSV1 thymidine kinase promoter (Fig. 29, lane 4), or with a luciferase encoding reporter plasmid termed TKpromLuc (Fig. 29, lane 5). Immunoprecipitation of pUL69 was performed using anti-FLAG-antibodies and Western blot analyses of all samples demonstrated that pUL69 was expressed and precipitated at equal amounts (Fig. 29, WB, lanes 1 to 5). Subsequently, RNA was extracted from lysates and precipitates as described before and RT-PCR was carried out using oligonucleotides specific for GAPDH-, CAT- or luciferase-mRNAs. As expected, all different mRNAs were detectable in the corresponding input-fractions by RT-PCR (Fig. 29, RT-PCR, lanes 1 to 5). Moreover, in analogy to previous results, CAT-mRNA derived from the pDM128/CMV/RRE was coprecipitated by pUL69 (Fig. 29, RT-PCR, lane 2), which was not the case for GAPDH-mRNA (Fig. 29, RT-PCR, lane 1) as already described in figure 27 and 28. In analogy, CAT-mRNAs derived from either pDM128/CMV/RxRE or TKpromCAT were also amplified by RT-PCR after precipitation of pUL69 (Fig. 29, RT-PCR, lane 3 and 4), indicating that CAT-mRNA specifically associates with pUL69 irrespective of the promoter (CMV or TK). In contrast, RT-PCR was not able to detect any luciferase mRNA in immunoprecipitates, even though it was present in corresponding cell lysates (Fig. 29, RT- PCR, lane 5), again underlining the selectivity of RNA-binding of pUL69 in vivo.

Fig. 29: pUL69 specifically associates with CAT- but not with luciferase-mRNA in vivo. Immunoprecipitation of pUL69 from HEK293T cells which were transfected with different CAT- reporter plasmids or with a luciferase reporter. Immunoprecipitation of pUL69 using the anti- FLAG antibody (MαFLAG) as well as RNA- isolation, RT-PCR and PCR reactions were performed essentially as described in figure 27. Protein levels in the input (WB, upper panel) and in the immunoprecipitates (WB, lower panel) were monitored by Western blotting using MαFLAG. RT-PCR and control-PCR specific for GAPDH-, CAT- and luc-mRNA of extracted RNA from input (IN) and immunoprecipitate samples (IP) were performed exactly as described in figure 27.

69 Results

In summary, it can be concluded from these experiments that pUL69 associates specifically with CAT-mRNA in living cells, thereby indicating a selectivity in the RNA-binding behaviour of the protein. Moreover, it is noteworthy that the pUL69-RNA complex can be totally disrupted by deletion of distinct arginine-rich regions (R1 and RS), which have been shown to mediate UAP56-interaction as well as direct RNA-binding of pUL69.

2.3. RNA-binding of pUL69 influences the protein expression kinetics of certain HCMV gene products In order to analyse the functional importance of RNA-binding as well as UAP56-interaction by pUL69, the replication capacities of recombinant HCMVs harboring mutations within the respective interaction domains of pUL69 had been analysed before (Fig. 16 and 17). These studies revealed a severe replication defect of a virus harboring internal deletions of motifs responsible for UAP56/URH49-interaction and RNA-binding of pUL69 (ΔR1ΔRS), while a virus expressing an RNA-binding deficient pUL69-mutant (ΔR2ΔRS) replicated comparable to wild type virus (Fig. 17; Zielke et al., 2011). To further characterize the recombinant viruses and to determine which stages of viral replication are affected when UAP56- interaction and/or RNA-binding of pUL69 was abrogated, viral protein expression kinetics between wild type AD169, AD169-pUL69ΔR1ΔRS and AD169-pUL69ΔR2ΔRS were analysed. For this, HFF cells were infected with each of the viruses separately at an MOI of 0.1. At various time points post infection, cells were harvested and viral protein expression was analysed by Western blotting using antibodies directed against selected immediate-early (Fig. 30A), early (Fig. 30B) and late (Fig. 30C) HCMV gene products using protein specific antibodies as indicated. The expression kinetics of the IE1-protein p72 or the IE2-proteins IE2-p86, IE2-p60 and IE2-p40 did not reveal any significant differences between wild type, pUL69ΔR1ΔRS and pUL69ΔR2ΔRS-mutant viruses (Fig. 30A). Regarding early HCMV gene products, the synthesis and the accumulation of the HCMV serine/threonine protein kinase pUL97, the DNA-polymerase processivity factor pUL44, the regulatory protein pUL84 and the tegument protein pUL26 were comparable for wild type and mutant viruses throughout the replication cycle (Fig. 30B). In contrast, the expression level of the tegument protein pp71 was significantly reduced in HFFs infected with the RNA-binding and UAP56-interaction deficient pUL69-mutant ΔR1ΔRS in comparison to cells infected with wild type AD169 or the pUL69-mutant incapable to bind to RNA (ΔR2ΔRS) (Fig. 30B). Interestingly, a strong enhancement of pUL69 protein expression itself was also observed in HFFs infected with both virus mutants especially at late time of infection (Fig. 30B). Finally, the expression kinetics of three late HCMV proteins was investigated by staining Western blots with antibodies directed against the major capsid protein MCP and the two tegument proteins pp65 and pp28 (Fig. 30C).

70 Results

Fig. 30: Comparative analyses of the viral protein expression kinetics between AD169-, AD169- UL69ΔR1ΔRS- and AD169-UL69ΔR2ΔRS-infected HFF cells. HFFs were infected with AD169, AD169- UL69ΔR1ΔRS or AD169-UL69ΔR2ΔRS, respectively, at an MOI of 0.1. Lysates were prepared at indicated time points and subjected to Western blot analyses. (A) Analyses of immediate-early viral protein expression kinetics using IE1-p72 as well as IE2-specific antibodies. (B) Analyses of early viral protein expression kinetics. A representative selection of HCMV early and early-late proteins were detected with specific antibodies for each gene product. (C) Analyses of late viral protein expression. MCP, UL83-pp65 and UL99-pp28 were detected using monoclonal antibodies directed against each protein. Moreover, the cellular protein β-actin was stained and served as a loading control (D).

These Western blots revealed a significant defect in the accumulation of MCP in cells infected with pUL69ΔR1ΔRS compared to wild type virus or the pUL69ΔR2ΔRS mutant virus. Surprisingly, protein expression of pp65 displayed a strong increase in protein levels in

71 Results pUL69ΔR1ΔRS-infected cells starting already 24hpi (Fig. 30C). To ensure that differences of protein levels between wild type and mutant viruses were not due to the use of variable amounts of cell extracts, Western blot analyses of the house-keeping gene beta-actin were conducted in parallel and did not reveal any differences among the lysates (Fig. 30D). Taken together, the results described above demonstrate that deletions within the arginine- rich motifs R1 and RS of pUL69, abrogating UAP56-interaction and RNA-binding, which results in a strong replication defect of the HCMV-recombinant virus, might be due to defects in protein expression kinetics of a subset of HCMV gene products including mainly early and late proteins.

2.4. pUL69 interacts with UL44, UL83-pp65 and UL82-pp71 mRNAs in vivo The comparison of protein expression kinetics between wild type and pUL69-mutant viruses by Western blot analyses (Fig. 30) revealed that HFFs infected with the pUL69-mutant virus incapable to bind RNA and to interact with UAP56 (ΔR1ΔRS) showed a defect in the accumulation of the tegument protein pp71, the major capsid protein MCP and an increased protein level of pp65 during the course of infection. Therefore, it seemed likely that the respective mRNAs encoding these proteins might be targeted by pUL69 during infection. To test this hypothesis, RNA-immunoprecipitation experiments from HFFs infected with wild type AD169 at an MOI of 0.1 were performed. 72 hours post infection, cell lysates were prepared and subjected to immunoprecipitation using either an anti-FLAG-antibody (Fig. 31A, WB, lane 3) or the monoclonal pUL69-antibody MαUL69 (Fig. 31A, WB, lane 4). Western blot analyses of pUL69 before and after precipitation ensured proper protein expression in both cell lysates and confirmed specific and comparable immunoprecipitation of pUL69 when the monoclonal antibody was used, which was not the case when precipitation was performed using the anti-FLAG-antibody (Fig. 31A, WB). RNA was extracted from the lysates and immunoprecipitates using TRIZOL and subjected to RT-PCR reactions using oligonucleotides specific for the cytomegaloviral mRNAs encoding UL44, UL83-pp65, UL82- pp71, UL99-pp28, UL86-MCP as well as IE1 or the cellular mRNA of GAPDH as the negative control (Fig. 31A, RT-PCR). RT-PCR reactions were successful since corresponding agarose-gels showed an amplification of all tested mRNAs in cell lysates prior to immunoprecipitation (Fig. 31A, RT-PCR, lanes 1 and 2). Interestingly, upon precipitation of pUL69 out of cell lysates, RT-PCR reactions only resulted in an amplification of mRNAs encoding UL44, UL83-pp65 and UL82-pp71, while UL99-pp28-, IE1-, UL86-MCP- and GAPDH-mRNAs were not amplified, implying that they were not coprecipitated by pUL69 (Fig. 31A, RT-PCR, lane 4). In addition, these results were considered specific as no coprecipitated mRNAs could be detected when unspecific anti-FLAG-antibody was used for immunoprecipitation (Fig. 31A, RT-PCR, lane 3).

72 Results

Next, to assure that this association was dependent on the RNA-binding capacity and/or UAP56-interaction of pUL69, we took advantage of the AD169-pUL69ΔR1ΔRS mutant virus incapable to interact with UAP56 and to bind to RNA in vitro (compare Fig. 25; Toth et al., 2006; Lischka et al., 2006; Zielke et al., 2011). Therefore, RNA-immunoprecipitation experiments from HFFs infected with either wild type AD169 or the recombinant, mRNA- export-negative mutant virus (AD169-pUL69ΔR1ΔRS) were performed essentially as described before. Again, UL44-, UL83-pp65- and UL82-pp71-mRNAs could be amplified by RT-PCR after immunoprecipitation of wild type pUL69, which was not the case when the mutant pUL69ΔR1ΔRS was precipitated (Fig. 31B, RT-PCR, compare lane 4 with 3). The specificity of this result was ascertained by the fact that comparable amounts of (mutant-) pUL69 were precipitated (Fig. 31B, WB, lane 3 and 4) and equal levels of mRNA were detected by RT-PCR in both input fractions (Fig. 31B, RT-PCR, lane 1 and 2). In addition, GAPDH-mRNA was neither associated with wild type nor mutant protein and therefore underlines the specificity of the coprecipitated mRNAs.

A B

Fig. 31: Identification of cytomegaloviral mRNAs targeted by pUL69 during HCMV-infection. (A) Immunoprecipitation of pUL69 from HFF cells 72h after infection with AD169 at an MOI of 1.0. Immunoprecipitation was performed using either an anti-FLAG antibody (MαFLAG, lane 3) or an anti-pUL69 antibody (MαUL69, lane 4). Protein expression was monitored prior to immunoprecipitation (Input, lane 1 and 2) as it was for precpitated pUL69 (lanes 3 and 4) using MαUL69. RNA was extracted from lysates and precipitates, followed by RT-PCR using sequence-specific primers for different mRNAs as indicated. (B) Immunoprecipitation of pUL69 or pUL69ΔR1ΔRS from HFF cells 72h afters infection with AD169 or UL69ΔR1ΔRS at an MOI of 1.0, respectively. Immunoprecipitation was performed using an anti-pUL69 antibody (MαUL69, lane 3 and 4). Control of protein expression by Western blotting, RNA-preparation and RT-PCR were performed as described above.

73 Results

So far, identification of pUL69-associated mRNAs by RIP experiments was always performed from cell lysates of HCMV-infected fibroblast 72h post infection, representing a rather late time point during the HCMV replicative cycle. However, information about a time-dependency of RNA-binding by pUL69 during infection is missing, but might provide a feasible mode of action for the regulation of viral gene expression. Therefore, in order to determine whether pUL69-association with specific mRNAs is restricted to distinct time points during infection, RIP experiments were conducted from HFF cells after infection with AD169 for 24, 48 and 72 hours (Fig. 32) exactly as described before. Western blot analyses of pUL69 in the input fractions demonstrated the presence of pUL69 as early as 24 hpi with an increasing amount during the course of infection (Fig. 32, WB, Input). Immunoprecipitation of pUL69 was performed using MαUL69 (Fig. 32, WB, IP), followed by extraction of coprecipitated RNAs out of each lysate as described previously. Hereby, RT-PCR reactions using oligonucleotides specific for the cytomegaloviral mRNAs of UL44, UL83-pp65, UL82-pp71, UL99-pp28, UL86-MCP as well as IE1 or the cellular mRNA of GAPDH illustrated increasing amounts of viral mRNAs during the HCMV-replication cycle in the input fractions (Fig. 32, Input, RT-PCR).

Fig. 32: pUL69 is associated with UL44-, UL83-pp65- and UL82-pp71-mRNAs during the course of HCMV- infection. Immunoprecipitation of pUL69 from HFF cells infected with AD169 at an MOI of 1.0. Cell lysates and immunoprecipitation was performed at 24, 48 and 72 hpi using MαUL69 (IP). Protein expression was monitored at each time point prior to immunoprecipitation (Input, lanes 1 to 4) as it was for precpitated pUL69 (IP, lanes 5 to 8) using MαUL69. RNA was extracted from lysates and precipitates, followed by RT-PCR using sequence-specific primers for different mRNAs as indicated.

74 Results

Moreover, in accordance to previous results, RNA-immunoprecipitation experiments again confirmed an association of pUL69 with UL44-, UL83-pp65- and UL82-pp71-mRNAs, but not with MCP-, UL99-pp28- or IE1-mRNAs in vivo (Fig. 32, IP, RT-PCR). However, specific binding of pUL69 to this subset of virus-encoded mRNAs was not altered during the cytomegaloviral replication cycle, thereby arguing against a time-dependency of RNA-binding by pUL69 (Fig. 32, IP, RT-PCR).

Finally, having shown that UL44-, UL83-pp65- and UL82-pp71-mRNAs are associated with pUL69 during HCMV-infection, it was necessary to investigate whether the interaction of these mRNAs with pUL69 was dependent on additional virus-encoded cofactors. To trace this assumption, RIP experiments were repeated in transiently transfected HEK293T cells, which were cotransfected with FLAG-tagged wild type pUL69 or the mRNA-export negative mutant pUL69ΔR1ΔRS in combination with the CAT-reporter plasmid pDM128/CMV/RRE as the posivitive control or with eukaryotic expression plasmids encoding the HCMV genes of UL44, UL83-pp65 and UL82-pp71, UL99-pp28 or IE1 (Fig. 33A and B). Immunoprecipitation of pUL69 and its derivative was performed using an anti-FLAG-antibody and protein expression was monitored prior and after immunoprecipitation by Western blotting (Fig. 33A and B, WB).

A B

Fig. 33: Association of pUL69 with UL44-, UL83-pp65- and UL82-pp71-mRNAs in transiently transfected HEK293T cells. (A and B) Immunoprecipitation of FLAG-pUL69 and FLAG-pUL69ΔR1ΔRS from cotransfected HEK293T cells essentially as described in figure 27 using an anti-FLAG antibody (MαFLAG) for precipitation. Protein levels in the input and in the immunoprecipitates were monitored by Western blotting using MαFLAG (WB, upper panels). RT-PCRs and control-PCRs specific for GAPDH-, CAT-mRNA and various viral mRNAs from extracted RNAs of input and immunoprecipitate samples were performed exactly as described in figure 27.

75 Results

RNA was extracted from lysates and precipitates as described above and RT-PCR was carried out using oligonucleotides specific for the respective mRNAs. Moreover, in order to exclude any DNA contaminations in samples used for RT-PCR, control-PCR reactions were conducted in parallel and revealed no impurities in all RNA samples (Fig. 33A and B, PCR, input- and IP-panels, lanes 1 to 10 and 1 to 4). Notably, all mRNAs were detectable in the corresponding input fractions by RT-PCR (Fig. 33A and B, RT-PCR, input). Moreover, in analogy to previous results, UL44-, UL83-pp65- and UL82pp71-mRNAs were coprecipitated specifically by wild type pUL69, as it was also the case for the CAT-mRNA which served as positive control (Fig. 33A and B, RT-PCR, IP). In contrast, pUL69 was not able to associate with GAPDH-mRNA (Fig. 33A and B, RT-PCR, IP) as already described in figure 27 and 28 and therefore these results were considered specific. In addition, neither UL99-pp28- nor IE1-mRNAs could be amplified by RT-PCR after precipitation of pUL69 (Fig. 33B, RT-PCR, IP), indicating that these two mRNAs are indeed not associated with pUL69 in vivo. Noteworthy, no mRNAs was coprecipitated by the RNA-export negative pUL69-mutant ΔR1ΔRS (Fig. 33A, RT-PCR, IP, lanes 6 to 10), and served as the negative control, which did not coprecipitate any of the mRNAs although, it was present in all lysates.

In conclusion, this set of experiments identified UL44-, UL83-pp65- and UL82-pp71-mRNAs to be associated with pUL69 during HCMV-infection in a time-independent manner. In addition, these results clearly demonstrate that this association is dependent on the RNA- binding capacity and/or UAP56-interaction of pUL69 while virus-specific cofactors are not required.

2.5. Construction and evaluation of a cDNA-library to identify viral and cellular mRNAs that are associated with pUL69 in HCMV-infected HFF cells Having identified a distinct subset of cytomegaloviral mRNAs to be associated with pUL69, it was desirable to identify further cytomegaloviral as well as cellular mRNAs that interact with pUL69 during the course of HCMV-infection. So far, RT-PCR analysis of pUL69- coprecipitated mRNAs was limited by the use of target specific oligonucleotides for amplification which only allowed the identification of supposable pUL69 target-mRNAs. In order to circumvent this problem, a novel experimental setup was established which allows the generation of a cDNA-library from mRNAs coprecipitated by pUL69 from HCMV-infected HFFs (Fig. 34A). Briefly, HFF cells were infected with the wild type HCMV strain AD169 at an MOI of 1.0 and 72 hpi, the cells were harvested, lysed and subjected to immunoprecipitation of pUL69 using MαUL69 (Fig. 34A). Protein expression of pUL69 was monitored prior to immunoprecipitation (Fig. 34B, lane 1) as it was for the amount of precipitated protein (Fig. 34B, lane 2). pUL69-associated mRNAs were extracted from the immunoprecipitates using TRIZOL, followed by a dephosphorylation at their 5`end using Tobacco Acid Pyrophosphatase (TAP) (Fig. 29A).

76 Results

A B

Fig. 34: cDNA-library construction of mRNAs coprecipitated by pUL69 from HCMV-infected HFF cells. (A) Flow chart illustrating the experimental procedure for generation of a cDNA-library from mRNAs coprecipitated by pUL69 after immunoprecipiation from HCMV-infected HFFs using MαUL69 for precipitation. Coprecipitated mRNAs were isolated and reversely transcribed. Thus obtained cDNAs were amplified via PCR to generate dsDNAs, which were subsequently cloned into a eukaryotic expression vector thereby generating a cDNA-library. Finally, pUL69-associated mRNAs were identified by standard nucleotide sequence analyses. (B) Western blot analyses of lysate from HCMV-infected HFFs. Protein expression was monitored prior to immunoprecipitation (input, lane 1) as it was for the amount of precipitated protein (IP, lane 2) using MαUL69. (C) Agarose gel illustrating the amount of cDNA generated by reverse transcription of pUL69-coprecipitated mRNAs during cDNA library construction.

Monophosphorylated mRNAs were then ligated to a biotinylated AttB1-HA-oligonucleotid of known sequence using the RNA-specific T4-ligase (Fig. 34A). By utilization of a second biotinylated AttB2-oligo(dT)-primer, these RNAs were then reversely transcribed resulting in an RNA/cDNA-hybrid (Fig. 34A). After RNA digestion within these hybrids using RNaseH, cDNAs were amplified via PCR with oligonucleotides specific for the ligated AttB-sites (Fig. 34A). In parallel, the amount of cDNAs generated by reverse transcription of pUL69- coprecipitated mRNAs was monitored by standard DNA agarose gel analyses and revealed a mean cDNA-length of approximately 250bp (Fig. 34C). Finally, generated dsDNAs were purified and applied to the Gateway Cloning procedure (Invitrogen, Germany) thereby generating a cDNA-library encoding pUL69-associated mRNAs (Fig. 34A). A subset of growth-selected clones was picked, followed by DNA isolation and nucleotide sequence analyses by standard methods. The obtained sequences were subjected to BLAST-search resulting in a set of three mRNAs that appear to be associated with pUL69 during HCMV-

77 Results infection. Table 1 depicts the identified mRNAs and their corresponding recurrence in different cDNA-library clones.

Table 1: Viral and cellular mRNAs associated with pUL69 during HCMV-infection. Listed are cellular and viral mRNAs, which were coprecipitated by pUL69, isolated and identified after cDNA-library generation upon RNA-immunoprecipitation of pUL69 from HCMV infected HFFs. Recurrence denotes the number of discrete cDNA-library clones that correspond to one individual pUL69 target-mRNA.

BLAST alignments of the corresponding mRNA sequences discovered two cellular and one viral mRNA that appear to be associated with pUL69. Cell-division-cycle-42-mRNA, representing one of the cellular pUL69 target-mRNA, encodes a multifunctional protein which regulates signalling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. In contrast, the second cellular mRNA-sequence associated with pUL69 during HCMV-infection corresponds to a widespread nucleotide sequence which can be found in several mRNAs encoding diverse cellular proteins as for example Tubby-like-protein-1, NADH-dehydrogenase-precursor, protein kinase A (PRKA) anchor protein 12 or alkylglycerone phosphate synthase precursor Due to the fact that Tubby-like-protein-1-mRNA (TULP) was listed on top of the results obtained for this BLAST-aligment, the putative pUL69 target-mRNA was termed TULPseed. The third hit, so far being the only cytomegaloviral mRNA identified to be pUL69-associated, encodes for the so far uncharacterized protein pUL65.

Having identified mRNAs targeted by pUL69 during infection, it was necessary to verify each individual hit by an independent experimental approach: RIP experiments were again performed from HFFs infected with either wild type AD169 or the mRNA-export negative mutant virus AD169-pUL69ΔR1ΔRS as described before (compare Fig. 31B). Western blot analyses of pUL69 and its -mutant, before and after precipitation, ensured proper protein expression in both cell lysates and confirmed specific immunoprecipitation of pUL69 and pUL69ΔR1ΔRS when MαUL69 was used (Fig. 35, WB, upper panel). RT-PCR reactions using oligonucleotides specific for TULPseed-, cell-division-cycle-42- (CDC42) and HCMV UL65-mRNAs, detected equal amounts of each mRNA in both input fractions (Fig. 35, RT- PCR, lane 1 and 2). However, CDC42-, TULPseed/ and UL65-mRNAs could only be amplified by RT-PCR after immunoprecipitation of wild type pUL69, which was not the case when the mutant pUL69ΔR1ΔRS was precipitated (Fig. 35, RT-PCR, compare lane 4 with 3). In addition, GAPDH-mRNA was neither associated with wild type nor mutant protein and therefore underlines the specificity of this experiment (Fig. 35, RT-PCR). However, this RIP

78 Results experiment cannot exclude that CDC42-, TULPseed- and UL65-mRNAs are bridged to pUL69 via the RNA-binding protein UAP56.

Fig. 35: pUL69 is associated with CDC42-, TULPseed- and UL69-mRNA during HCMV- infection. Immunoprecipitation of pUL69 or pUL69ΔR1ΔRS from HFF cells 72h after infection with AD169 or UL69ΔR1ΔRS at an MOI of 1.0, respectively. Immunoprecipitation was performed using an anti-pUL69 antibody (MαUL69, lane 3 and 4). Control of protein expression by Western blotting, RNA-preparation and RT-PCR were performed exactly as described before.

Finally, having shown that CDC42-, TULPseed- and UL65-mRNAs are specifically associated with pUL69 during HCMV-infection, it was of general interest to investigate if this interaction was also independent of virus-encoded cofactors as it has been demonstrated for the other pUL69-associated mRNAs of UL44, UL83-pp65 and UL82-pp71. In order to characterize the association of pUL69 with the newly identified pUL69-target-mRNAs, RIP experiments from transiently transfected cell cultures were performed. For this, HEK293T cells were transfected with FLAG-tagged wild type pUL69 or the mRNA-export negative mutant pUL69ΔR1ΔRS either solely (mock) or in combination with the CAT-reporter plasmid pDM128/CMV/RRE as positive control (Fig. 36). Immunoprecipitation of pUL69 and its mutant was performed using MαUL69 and protein expression was monitored prior and after immunoprecipitation by Western blotting (Fig. 36, WB, upper panel). RNA was extracted from lysates and precipitates as described before and RT-PCR was carried out using oligonucleotides specific for the respective mRNAs as indicated (Fig. 36, RT-PCR). Moreover, in order to exclude any DNA contaminations in samples used for RT-PCR, control- PCR reactions were conducted in parallel and revealed no impurities in all RNA samples (Fig. 36, PCR, input- and IP-panels).

79 Results

Fig. 36: Association of pUL69 with CDC42- and TULPseed-mRNAs in transiently transfected HEK293T cells. Immunoprecipitation of pUL69 and pUL69ΔR1ΔRS from cotransfected HEK293T cells essentially as described before using the anti-pUL69 antibody MαUL69 for precipitation. Protein levels in the input and in the immunoprecipitates were monitored by Western blotting using MαUL69 (WB, upper panels). RT-PCRs and control-PCRs specific for GAPDH-, intronic CAT-, CDC42- and TULPseed-mRNAs from extracted RNAs of input and immunoprecipitate samples were performed exactly as described before.

In accordance to previous results, the mRNAs of GAPDH, CAT, CDC42 and TULPseed were detectable in the corresponding input-fractions by RT-PCR (Fig. 36, RT-PCR, input-panel). Moreover, as expected CDC42- and TULPseed-mRNA sequences were specifically coprecipitated by wild type pUL69, as it was also the case for the CAT-mRNA, which served as positive control (Fig. 36, RT-PCR, IP). In contrast, pUL69 was not able to associate with GAPDH-mRNA (Fig. 36, RT-PCR, IP) as already described before, thereby underlining the experimental validity. Furthermore, in analogy to several previous results, neither mRNA was coprecipitated by the RNA-export negative pUL69-mutant ΔR1ΔRS (Fig 36, RT-PCR, IP- panel), which served as internal negative control. Concluding, generation of a cDNA-library from HCMV-infected HFFs resulted in the identification of three so far unknown mRNAs that are specifically associated with pUL69 during infection. Moreover, CDC42-, TULPseed- and UL65-mRNAs were validated to be pUL69 target-mRNAs by independent RIP experiments from transfected and infected cell cultures. The functional significance of these protein-mRNA complexes in the context of HCMV-replication, however, remains to be elucidated.

80 Results

2.6. UL65 mRNA levels are significantly decreased in HFFs infected with AD169- pUL69ΔR1ΔRS The previous comparison of protein expression kinetics between HFF cells, which were infected with wild type virus or with the RNA-binding deficient pUL69-mutant ΔR1ΔRS (Fig. 30) revealed only minor, but still visible differences in the expression pattern of certain viral gene products, even though the mutant displayed a severe replication defect (Fig. 17). However, it still needed to be clarified whether the mRNA expression levels in general, or of specific transcripts, were also varying between wild type and mutant infected cell cultures. Since, RIP experiments of pUL69 as well as the generation of a cDNA-library from pUL69- associated mRNAs during HCMV-infection, identified several viral and cellular mRNAs to be targets of pUL69, it was tempting to speculate that these transcripts might also be altered in their expression level between wild type and the pUL69ΔR1ΔRS-mutant. To analyse this hypothesis, fibroblasts were infected with AD169 or AD169-pUL69ΔR1ΔRS at an MOI of 1.0 for 72 hours, before the cells were harvested and subjected to total RNA-isolation. Subsequently, the mRNA expression levels of viral transcripts corresponding to UL44, UL83- pp65, UL82-pp71, MCP, IE1, UL65 as well as to the cellular mRNAs of the ribosomal protein L4 (RPL4), CDC42 and TULPseed were determined by quantitative SYBR-Green RT-PCRs for wild type as well as for mutant-infected cells. Thereafter, the threshold values (Ct-values) of the mRNA expression levels of both samples were normalized to GAPDH, respectively, before mRNAs of ΔR1ΔRS-infected cells were set into relation to mRNAs of wild type infected HFFs (Fig. 37). RPL4 as another house-keeping gene served as internal control and showed 100% identity in the mRNA expression level between wild type- and mutant-infected cells. Importantly, while the mRNA levels of RPL4, as a house-keeping gene, were not altered irrespective of the virus used for infection (Fig. 37, lane 1), it was striking that especially UL65-mRNA levels were significantly decreased in HFFs infected with the RNA- and UAP56-binding deficient pUL69-mutant ΔR1ΔRS (Fig. 37, lane 7). In addition, all further viral transcription levels investigated were also diminished in mutant-infected cells, yet, never as drastically as in the case of UL65 mRNA levels (Fig. 37, lanes 2 to 6). However, it is noteworthy that transcripts of the HCMV immediate-early protein IE1 were also lowered by approximately 20% in ΔR1ΔRS-infected HFFs (Fig. 37, lane 6), suggesting that fibroblasts were either infected with slightly different MOIs than calculated or that IE1-expression is altered in the cells infected with the pUL69-mutant incapable to bind and export RNA. Nevertheless, it is remarkable, that the cellular transcripts of the so far identified pUL69- targets – CDC42 and TULPseed - were also decreased in mutant-infected cells, underlining their relevance for HCMV-infection in vivo.

81 Results

Fig. 37: Viral mRNA levels are decreased in ΔR1ΔRS-infected HFFs. Total RNA was isolated form HFFs, which were infected with wild type AD169 or the mutant AD169-pUL69ΔR1ΔRS (MOI=1) and harvested 72hpi. RNA was assayed by qRT-PCR for RNA expression levels of UL44, UL83-pp65, UL82-pp71, UL86-MCP, IE1, UL65, CDC42 and TULPseed as indicated at the bottom of the figure. All mRNA levels were normalized to GAPDH expression levels and the cellular RPL4-mRNA levels served as internal control. Determinations were performed in triplicates.

Initial relative quantification clearly demonstrated that mRNA levels of putative pUL69 target transcripts, as for example UL65- and UL44-mRNAs, appeared to be significantly downregulated in fibroblasts infected with the RNA-binding deficient pUL69-mutant ΔR1ΔRS compared to wild type infected cells. However, it was still unclear whether the nuclear export of mRNAs transcribed from corresponding genes was actually affected by pUL69. To answer this question, fibroblasts were infected with AD169 or AD169-pUL69ΔR1ΔRS at an MOI of 1.0 and 72 hpi the cells were harvested, followed by a fractionation of cytoplasmic and nuclear mRNAs. Next, in analogy to previous quantifications of total mRNA samples, cytoplasmic transcripts of HFFs infected with wild type or mutant virus were analysed by SYBR-Green RT-PCR using target-specific oligonucleotides for amplification. As expected, the mRNA levels of GAPDH and RPL4, serving as internal controls for cellular house keeping genes, were comparable between both samples (Fig. 38, lane 1 and 2). In contrast, even though UL44 transcripts were significantly decreased in ΔR1ΔRS-infected HFF cells (Fig. 38, lane 2), their nuclear export seemed not to be affected by deletions within pUL69, that abrogated RNA- and UAP56-binding, as cytoplasmic mRNA levels were similar to those of wild type infected HFFs (Fig. 38, lane 3). Just the opposite was observed for transcripts corresponding to UL83-pp65, UL82-pp71 and MCP: while only slight reductions of total transcripts were detectable in total RNA-samples of wild type and mutant infected HFFs, the cytoplasmic mRNA levels of each of these transcripts was reduced remarkably in ΔR1ΔRS- infected cell cultures (Fig. 38, lanes 4 to 6), indicating that direct RNA-binding and/or UAP56- interaction of pUL69 were critical for the nuclear export of these transcripts.

82 Results

Fig. 38: Viral mRNA levels are significantly decreased in ΔR1ΔRS-infected HFFs. Cytoplasmic RNA was isolated from HFFs, which were infected with wild type AD169 or the mutant AD169-pUL69ΔR1ΔRS (MOI=1) and harvested 72hpi. RNA was assayed by qRT-PCR for cytoplasmic RNA expression levels of UL44, UL83-pp65, UL82-pp71, UL86-MCP, IE1, UL65, CDC42 and TULPseed as indicated at the bottom of the figure. The mRNA expression levels were normalized to GAPDH- and RPL4-mRNAs served as internal controls. Determinations were performed in triplicates.

Finally, the cytoplasmic mRNA fractions of UL65, CDC42 and TULPseed in both samples were also analysed by qRT-PCR. Notably, the cytoplasmic accumulation of all three transcripts was strongly decreased in cells infected with AD169-pUL69ΔR1ΔRS (Fig. 38, lanes 8 to 10), which is even more of importance since total mRNA levels of UL65, CDC42 and TULPseed were already significantly reduced in the corresponding total RNA-sample (Fig. 38, lanes 7 to 9), suggesting that these mRNAs are indeed targets of the pUL69 mediated mRNA-export in vivo. Moreover, this result indicates that a defect in the RNA- and UAP56-binding capacity of pUL69 leads to an overall reduction in the mRNA expression levels of respective transcripts. In conclusion, this set of experiments clearly demonstrated that the transcription levels of several pUL69 target-mRNAs were drastically decreased in HFF cells infected with the pUL69-mutant ΔR1ΔRS, indicating that both RNA-binding and/or UAP56-interaction were required for the proper gene expression of the respective transcripts. Moreover, the final experiment strongly suggests that this observation was due to a defect in the transport of the respective transcripts to the cytoplasm. However, the discrimination between individual and highly interconnected steps of RNA-biogenesis, as for example transcription initiation and elongation, nuclear RNA-export or translation initiation, which might be affected by pUL69 during HCMV-infection, will be a subject for future studies.

83 Discussion

F Discussion

The human cytomegaloviral protein encoded by ORF UL69 belongs to a family of regulatory factors that is conserved among all herpesviruses and includes the proteins ICP27 of herpes simplex virus type 1, EB2 of Epstein-Barr virus, and ORF57 of Kaposi’s sarcoma-associated herpesvirus. For all characterized members of this protein family, a function as posttranscriptional activators that facilitate the nuclear export of mRNA has been documented. This function is mediated via the capability of these proteins to shuttle between the nucleus and the cytoplasm and to interact with components of the cellular mRNA-export machinery (Sandri-Goldin, 2008; Sergeant et al., 2008; Toth and Stamminger, 2008). Interestingly, most of the protein domains important for mRNA-export stimulation (e.g., the interaction site for cellular mRNA-export factors and the nuclear export signal) have been mapped to regions of the herpesviral mRNA-export factors that show either no or a low level of sequence conservation. For this reason, it was feasable that characterization of the closely related proteins within the Betaherpesvirinae subfamily homologous to pUL69 might shed more light on the evolution of regulatory protein domains. Due to the lack of reactive antibodies against any betaherpesviral pUL69-homolog, the starting point of subsequent analyses was the construction of epitope-tagged eukaryotic expression constructs for pC69 of chimpanzee cytomegalovirus, pRh69 of rhesus cytomegalovirus, pM69 of murine cytomegalovirus, and pU42 of human herpesvirus type 6 or elephant endotheliotropic herpesvirus. Interestingly, Western blot analyses revealed that the apparent molecular masses of the respective proteins (pC69, ~125 kDa; pRh69, ~130 kDa; pM69, ~135 to 140 kDa; HHV6 pU42, ~60 kDa; and ElHV1 pU42, ~90 kDa) differed from the predicted molecular masses calculated by the ExPASy proteomics server (pC69, 100.7 kDa; pRh69, 87.5 kDa; pM69, 93.0 kDa; HHV6 pU42, 59.8 kDa; ElHV1 pU42, 71.4 kDa). This result was not without precedent, since the predicted and apparent molecular masses of pUL69 also differ considerably due to phosphorylation by cellular and viral kinases that contribute to aberrant migration in SDS-PAGE (Rechter et al., 2009; Thomas et al., 2009; Winkler and Stamminger, 1996). However, the presence of additional posttranslational modifications is likely, since a recent study predicted SUMOylation of pUL69, although the respective attachment sites for SUMO were not characterized in detail (Salsman et al., 2008). Furthermore, as recently demonstrated for HSV-1 ICP27 (Souki et al., 2009; Souki and Sandri-Goldin, 2009), pUL69 protein function might also be regulated via methylation. It is therefore feasible to speculate that at least some of the betaherpesviral homologs are also posttranslationally modified in the context of human cells, thus contributing to the discrepancies between predicted and observed molecular masses.

84 Discussion

Even though in silico analyses failed to identify a classical NLS within pUL69 or any of its homologs and the alignment of the nonconventional bipartite NLS of pUL69 (Lischka et al., 2006) with protein sequences of the homologs revealed 94.6% and 47.1% sequence identity with pC69 and pRh69, respectively, whereas HHV6 pU42 (20.6%) and pM69 (20.6%) and ElHV1 pU42 (29.4%) displayed only insignificant sequence homology, we determined a nuclear distribution for every protein. Remarkably, pRh69 and pM69 concentrated in distinct foci within the nucleus, which resembled nuclear pUL69 aggregates observed in transfected or infected cells treated with protein kinase inhibitors (Rechter et al., 2009; Thomas et al., 2009; Winkler et al., 1994). Previous studies investigated whether this speckled staining pattern of pUL69 could be explained by colocalization with nuclear splice domain components like SC35; however, this was not detected for pUL69 (Rechter et al., 2009; Winkler et al., 1994) nor for pRh69 and pM69 (data not shown). Thus, given the low level of NLS conservation within the betaherpesviral pUL69-protein family, in order to be translocated to the nucleus these proteins must either be capable of interacting with human importins or have at least one common cellular interaction partner.

Like HCMV pUL69, all of its betaherpesviral homologs share a region with a high degree of conservation throughout the three herpesviral subgroups, the so-called ICP27 homology region. The only common function assigned to the ICP27-homology region so far is self- interaction, which has been demonstrated for ICP27 of HSV1, ORF57 of KSHV and pUL69 of HCMV (Malik and Clements, 2004; Lischka et al., 2007; Zhi et al., 1999). By alignment of the pUL69 self-interaction domain (aa269 to 574) with protein sequences of betaherpesviral pUL69 homologs, pC69 of CCMV was determined to be the homolog displaying the highest score for sequence identity (77.1%). In contrast, pRh69, pM69, HHV6 pU42, and ElHV1 pU42 displayed significantly less amino acid sequence identity (~36%). Hence, the findings that homodimerization is a common feature of the betaherpesviral pUL69-homologs and, more strikingly, that pC69, pRh69, pM69, and HHV6 pU42 heterodimerize with pUL69 should ultimately help to narrow down the homodimerization and heterodimerization domains within each pUL69-homolog and to identify highly conserved amino acid residues that are required for these interactions. It is noteworthy, however, that the ICP27-homology region mediating self-interaction seems to be less amenable to divergence during herpesviral evolution, since multimerization is a common feature of ICP27-homologs of all three herpesviral subgroups analysed so far. Interestingly, a comparison of the self-interaction domains of several herpesviral ICP27-homologs using the PSIPRED method revealed that this region might form a globular, highly structured core domain (Jones, 1999; Lischka et al., 2007), thereby potentially forming a central scaffold which enables these proteins to interact with themselves and possibly also with other cellular and/or viral proteins.

85 Discussion

In addition, since all betaherpesviral homologs, except ElHV1 U42, were able to heterodimerize with pUL69 it is highly conceivable that multimers of different betaherpesviral ICP27-counterparts are functionally active, thereby indicating that they might substitute for each other during the course of infection. This is further of relevance, since complementation studies already demonstrated that even though pUL69 fails to replace ICP27 in the context of HSV1-infection, it can, at least in part, substitute for EB2 during EBV-infection, suggesting that the betaherpesviral ICP27-proteins are closer related to gammerherpesviral- than to alphaherpesviral counterparts (Gruffat et al., 2002; Winkler et al., 1994). Moreover, the self-interaction domain of pUL69 also corresponds to a region within pUL69 that mediates binding to the cellular transcription elongation factor hSPT6 (Winkler et al., 2000). Since homodimerization appears to be conserved within the betaherpesviral pUL69- homologs, it is also feasible that they are likewise able to interact with hSPT6. This protein- protein interaction might provide a mechanism by which these proteins activate gene expression, induce replication or have an impact on chromatin remodelling. However, further experiments are needed to prove any interaction and to investigate its functional impact.

One important feature of the ICP27 protein family is their capacity to function as viral mRNA- export factors, as described in the introduction. Therefore, to monitor mRNA export in vivo an established CAT-reporter assay, originally developed by Hope and colleagues, was performed (Hope et al., 1990) and showed that only the cytomegaloviral proteins pUL69, pC69, and pRh69, analogous to HIV1 Rev, were able to export unspliced CAT-mRNA to the cytoplasm, while pM69, HHV6 pU42, and ElHV1 pU42 were negative in this assay. It is noteworthy that these assays were performed in human HEK293T and HeLa cells (data not shown). Thus, one might assume that pC69 and pRh69, which diverged more recently from HCMV pUL69 during evolution, might still interact with human cellular cofactors necessary for this export activity. In contrast, MCMV pM69 and ElHV1 pU42, which diverged earlier from HCMV pUL69, might not be able to recognize and interact with human cofactors, even though they could possess mRNA-export activity within their natural hosts. Note that pM69 also failed to export this specific reporter RNA in the context of murine NIH3T3 cells, while pUL69, pC69, and pRh69 remained active, thereby suggesting that pM69, at least in the context of this RNA-export assay, does not function as a viral mRNA-export factor, in contrast to its cytomegaloviral counterparts. As HHV6 pU42 was also negative in the context of human cells, one might speculate that HHV6, as a lymphotropic human pathogen, requires cellular cofactors that are not expressed in tissue culture cells like HeLa or HEK293T. Further experiments using virus-specific host cell types need to be performed before a final conclusion can be reached.

In a previous study, nucleocytoplasmic shuttling was reported to be a prerequisite for the pUL69-mediated mRNA-export and this activity was also essential for the transactivation

86 Discussion function of the protein (Lischka et al., 2001; 2006). Therefore, it was of general interest to analyse whether the betaherpesviral homologs also exhibit a nucleocytoplasmic shuttling activity. Importantly, an in silico search for a classical leucine-rich NES did not detect a matching sequence in any of the betaherpesviral pUL69-homologs. This finding was not without precedent, as it had been reported previously that the C-terminus of pUL69 contains a non-classical bipartite CRM1-independent NES that is located between aa597-624 (Lischka et al., 2001). However, alignment of the pUL69 NES with sequences of the other betaherpesvirus family members failed to identify a motif with strong homology. The highest NES sequence identity of 39.3% was detected for pM69 of MCMV, whereas even the more closely related cytomegaloviral pUL69-homologs pC69 and pRh69 displayed a sequence homology of only approximately 30%. Interestingly, however, results obtained from heterokaryon analyses clearly showed that, in addition to the cytomegaloviral proteins pUL69, pC69, and pRh69, the more distantly related factors pM69, HHV6 pU42, and ElHV1 pU42 exhibited nucleocytoplasmic shuttling activity. Future studies will aim at a precise definition of the amino acid sequence motifs as well as the cellular factors that facilitate the nuclear export of each member of the betaherpesviral pUL69-protein family. Nevertheless, these findings suggest that all betaherpesviral pUL69-homologs possess nucleocytoplasmic shuttling activity, however, it cannot explain differences observed in the mRNA-export assay, thereby indicating that nucleocytoplasmic shuttling seems not to be sufficient for the observed mRNA-export activity of the cytomegaloviral proteins pUL69, pC69, and pRh69. Moreover, one might speculate that different homologs target different export receptors or that they use the same export receptor, which is targeted at different sites. Interestingly, a recent study demonstrated that, in addition to its effect on mRNA export, pUL69 facilitates the translation of mRNAs by excluding 4EBP1 from the cap-binding complex (Aoyagi et al., 2010). Thus, it is tempting to speculate that nucleocytoplasmic shuttling, which would be required for such a cytoplasmic function to modulate protein translation, is highly conserved within the betaherpesviruses. Further experiments will be required to address this hypothesis.

Since previous studies demonstrated that HCMV facilitates the cytoplasmic accumulation of unspliced mRNAs via recruitment of the cellular DExD/H-box RNA helicases UAP56 and/or URH49 (Lischka et al., 2006), it was tempting to investigate whether this was also true for pC69 and pRh69. Site-directed mutagenesis was performed, and subsequent coimmunoprecipitation analyses in concert with CAT-mRNA-reporter assays clearly demonstrated that the UAP56/URH49 interaction of pUL69, pC69, or pRh69 was absolutely essential for their mRNA-export activity. Since the evolutionary conservation of the UAP56/URH49-binding site suggests an important function of this protein interaction motif for viral replication, recombinant human cytomegaloviruses carrying mutations within pUL69 that have previously been shown to either abrogate the interaction with UAP56 and/or to interfere 87 Discussion with the RNA-binding capacity of pUL69 (Lischka et al., 2006; Toth et al., 2006) were constructed. Growth curve analyses clearly revealed a severe replication defect of two viruses harboring UAP56-binding site mutations, while a revertant virus and a virus expressing an RNA-binding deficient pUL69 mutant replicated comparably to wild type virus. This result strongly suggests that the interaction of pUL69 with UAP56/URH49 is essential for efficient viral replication. However, in contrast to data of this study, Kronemann and colleagues reported on the generation and characterization of a recombinant cytomegalovirus expressing the UAP56-binding-deficient alanine substitution mutant mUAP of pUL69 (Kronemann et al., 2010). Surprisingly, the growth curve analyses performed in this study revealed that the UAP56-binding-deficient virus replicated to levels even greater than those of the wild type virus (Kronemann et al., 2010). The reason for this obviously contradictory result is presently not clear and requires further investigation but may be related to the fact that Kronemann and colleagues introduced the UL69 mutations into an already altered AD169-derived virus that carries an additional expression cassette for green fluorescent protein and a puromycin resistance gene, thereby deleting the open reading frame UL21.5 (Cantrell and Breshnahan, 2005; Kronemann et al., 2010). Furthermore, it is highly unlikely that the introduction of an adventitious mutation accounts for the impaired replication associated with the lack of UAP56-binding activity as observed in this study, since the respective phenotype was observed with two different viruses (UL69mUAP and UL69ΔR1ΔRS) that were generated in independent recombination reactions. In addition, to confirm previous results and to highlight the role of the pUL69-UAP56- interaction for cytomegaloviral replication, this study was extended by investigating the UAP56-binding capacity of its MCMV-counterpart pM69. Interestingly, coimmunoprecipitation experiments clearly demonstrated that, in contrast to pUL69, pM69 can not interact with this cellular mRNA-export factor. This is of importance, since despite the fact that pM69 was able to continuously shuttle between the nucleus and the cytoplasm it failed to promote the accumulation of unspliced CAT-transcripts in transient mRNA-export assays. Noteworthy, transfer of the functional UAP56-interaction motif of pUL69 to pM69, converted this protein into an active mRNA-export factor, which was able to directly bind to UAP56. It is of importance, however, that the N-terminal localization of the fused UAP56-interaction motif to pM69 was crucial, since constructs harbouring C-terminal fusions failed to restore the mRNA-export activity of respective chimeric proteins (data not shown). This indicates that correct folding of the fusion proteins or at least of the UAP56-interaction domain is of major relevance for the complexation with UAP56. Most importantly, growth curve analyses of recombinant viruses expressing pM69 or a chimeric protein encoding pM69 C-terminally fused to pUL69 aa12-50, clearly demonstrated that fusion of the UAP56-interaction motif of pUL69 to pM69 can indeed convert the homolog into an active, functional mRNA-export factor, which, instead of pM69, is able to substitute for pUL69 during HCMV-infection.

88 Discussion

Concluding, the results presented in this study clearly demonstrated that pUL69, pC69 and pRh69 recruit UAP56 or its close homolog URH49, two cellular mRNA-export factors (Fleckner et al., 1997; Pryor et al., 2004), which act upstream of REF and couple transcription as well as splicing to cellular mRNA-export (Erkmann and Kutay, 2004). This is in contrast to ICP27 of HSV1, EB2 of EBV and ORF57 of HVS, which are directly interacting with the cellular export factor REF (Hiriart et al., 2003b; Koffa et al., 2001; Malik et al., 2004). Most importantly, this study provides numerous evidences that UAP56-interaction of pUL69, pC69 and pRh69 is essential for cytomegaloviral replication. Moreover, the UAP56- interaction motif of pUL69 is transferable and can convert pM69 into an active functional mRNA-export factor, which can substitute for pUL69 during HCMV-infection.

To summarize the first part of this PhD-thesis, despite the low level of amino acid sequence conservation within the betaherpesviral pUL69-protein family, this study characterized nuclear localization, homodimerization and nucleocytoplasmic shuttling activity as conserved features of the betaherpesviral proteins homologous to pUL69 of HCMV. Moreover, UAP56/URH49-binding capacity was identified as a unique feature of the cytomegaloviral proteins pUL69, pC69, and pRh69 that is essential for their mRNA export activity and for efficient replication of HCMV.

In analogy to several homologous proteins of the herpesvirus family, including HSV1 ICP27 and EBV EB2 (Farjot et al., 2000; Malik et al., 2004; Sandri-Goldin, 2001), the transactivator protein pUL69 of HCMV has been implicated in RNA-processing and -transport to maximize the production of progeny virions (Winkler et al., 1994; Winkler and Stamminger, 1996; Lischka et al., 2006; Toth et al., 2006). The common properties of these so-called “herpesvirus-encoded mRNA-export factors” involve a (i) nucleocytoplasmic shuttling activity, (ii) the promotion of nuclear export of unspliced transcripts as wells as (iii) the exploitation of cellular proteins involved in nuclear mRNA-export. Interestingly, for some of these herpesviral mRNA-export factors, direct RNA-binding was demonstrated to be essential for their stimulatory effects on mRNA-metabolism (Corbin-Lickfett et al., 2010; Johnson et al., 2009; Hiriat et al., 2003a). In contrast, studies investigating the RNA-binding specificity of the HCMV-counterpart pUL69 illustrated that pUL69 non-specifically bound to several RNAs in vitro, however, indicated a selective RNA-binding of this protein, thereby arguing for a sequence-specific RNA-interaction of pUL69 with putative targets in vivo (Toth et al., 2006). Moreover, RNA-binding-deficient HCMVs exerted a replication defect, pointing to the fact that RNA-binding of pUL69 is important for HCMV-replication in vivo (Zielke et al., 2011). In order to validate previous data and to identify mRNA-targets that are associated with pUL69 during HCMV-infection, CAT-mRNA export assays and RNA-immunoprecipitation experiments were performed. Previous publications already narrowed down the RNA-binding domain of pUL69 to its N-terminus, comprising three arginine-rich sequences termed R1 (aa17-30), R2 (aa36- 89 Discussion

50) and RS (aa123-139), which in part overlap with its nuclear localization signal (NLS; aa21- 45) and/or the UAP56/URH49-interaction domain (aa18-30) (Lischka et al., 2006; Toth et al., 2006). To discriminate between these functional domains, a series of internal deletion or point mutants of pUL69 had been generated previously (Toth et al., 2006; Lischka et al., 2006). Results presented in this study clearly demonstrate that pUL69 mutants carrying point-mutations within the UAP56-binding motif, deletion of the R1-cluster, or the R1-cluster in combination with the RS-sequence (ΔR1, ΔR1ΔRS) entirely loose their RNA-export activity in vivo. These data are of general interest, since they reconfirm previous results showing that direct RNA-binding of pUL69 is no prerequisite for its mRNA-export activity and thereby accentuate an important difference to its well-known counterparts ICP27 or EB2 (Chen et al., 2002; Johnson and Sandri-Goldin, 2009; Sandri-Goldin, 1998; Johnson et al., 2009; Hiriart et al., 2003a; Koffa et al., 2001). Furthermore, these experiments clearly demonstrate that, in analogy to result obtained from the characterization of betherpesviral pUL69-homologs, binding of pUL69 to UAP56/URH49 is crucial for the pUL69 mediated export of a reporter- mRNA as it had been shown before (Zielke et al., 2011; Lischka et al., 2006). However, it can not be excluded that direct RNA-binding of pUL69 is required at later steps of viral replication as for example for the packaging of viral and cellular mRNAs into viral particles (Breshnahan and Shenk, 2000a; Terhune et al., 2004).

To understand the physical association of pUL69 with RNAs and to identify transcripts, which are associated with the HCMV-encoded mRNA-export factor during infection, RNA-immunoprecipitation experiments were performed. In analogy to previous publications, a selective RNA-protein complex formation of pUL69 with CAT-, but not with GAPDH-mRNA was observed, thereby indicating that pUL69 exerts sequence-specific RNA-binding in vivo (Toth et al., 2006). Moreover, a contribution of the UAP56-interaction of pUL69 for its association with RNAs is highly suggestive, since pUL69-mutants harbouring deletions or point mutations within the corresponding motif showed only a weak association with the reporter-mRNA and were not able to promote the nuclear export of unspliced transcripts in the mRNA-export assay. However, an additional involvement of the pUL69 RNA-binding domain appears to be required for the selective RNA-association of pUL69, at least in part, since only the pUL69- mutant ΔR1ΔRs, incapable to interact with UAP56 and to bind to RNA, failed to act as mRNA-export factor and was unable to precipitate the reporter mRNA in RIP-experiments. Furthermore, these results suggest the existence of a mechanism that confers specificity to the recognition of RNA by pUL69. This is not without precedence, since selective RNA- binding of homologous proteins of the herpesvirus family has already been reported before. For ICP27, the HSV1-homolog of pUL69, it was demonstrated that the protein selectively binds to viral intronless RNAs, but not to RNAs that undergo splicing (Sandri-Goldin, 1998) and that ICP27 selectively regulates the cytoplasmic localization of a subset of viral transcripts (Pearson et al., 2004). Moreover, EB2 was demonstrated to selectively mediate

90 Discussion the nuclear export of EBV replication-gene- and late-mRNAs in vivo (Batisse et al., 2005; Semmes et al., 1998). Interestingly, by appliance of the systematic evolution of ligands by exponential enrichment (SELEX) approach, Whitehouse and collegues were able to identify a response element in herpesvirus saimiri RNAs, which is recognized by ORF57 (Colgan et al., 2009). In contrast to these findings, the mechanism conferring RNA-binding specificity to pUL69 needs still to be elucidated.

Since until today no natural target-mRNAs of the pUL69 mediated nulear export have been determined, this study aimed to identify viral and/or cellular RNAs that are associated with pUL69 during HCMV-infection. To get a first indication, HFF cells were infected with either wild type HCMV or the pUL69-mutants ΔR1ΔRS and ΔR2ΔRS and the kinetics of several viral proteins were compared by Western blot analyses. The results obtained hereby demonstrate that the absence of pUL69 has distinct effects on the expression of several viral early and late genes. Deletion of the arginine-rich motifs conferring UAP56- and/or RNA- binding within pUL69 reduced the expression of UL82-pp71, while other early gene products were not affected. This is of general interest, since the open-reading frame UL82 encodes for a viral transactivator protein, which is necessary for an efficient HCMV-replication (Baldick, Jr. et al., 1997; Bresnahan and Shenk, 2000b). Noteworthy, pUL69 protein levels itself were strongly increased in HFF cells infected with both pUL69-mutants. This leads to the tempting speculation that arginine-rich motifs responsible for RNA-binding as well as for UAP56- interaction of pUL69 exert a negative influence on the expression of the protein itself, especially at late time points of infection. The cause of this interesting finding remains to be elucidated. However, since pUL69 is expressed with early-late kinetics and protein levels were markedly upregulated at late times of infection, it is possible that protein expression is adjusted both transcriptionally and/or translationally. In addition to this subset of early gene products, UL99-pp28, UL86-MCP as well as UL83-pp65, as representatives of true late gene products, were also altered in their expression profiles in HFFs infected with either pUL69- mutant in comparison to wild type infected cells. While UL99-pp28 and UL86-MCP proteins were significantly decreased during the course of infection, the expression of UL83-pp65 appeared to be elevated in mutant infected cells. This is not a novel finding, since the involvement of ICP27-homologs in the regulation of late gene expression has already been reported before. HSV1 ICP27 as well as EB2 of EBV are thought to specifically target most late genes during their replication cycles (Batisse et al., 2005; Sandri-Goldin, 1998; 2001). Moreover, transcript levels of UL83-pp65, UL82-pp71 and UL99-pp28 have been shown to be substantially decreased in ΔUL69-infected cells, thereby already pointing at a putative role of pUL69 in the regulation of their expression (Hayashi et al., 2000). In contrast, this study illustrates the upregulation of UL83-pp65 in pUL69-mutant infected cells, which is contradictory to a previous study demonstrating a reduction of the transcription of this gene

91 Discussion product in the absence of pUL69 (Hayashi et al., 2000). This finding, however, might hint at the involvement of pUL69 in translation-regulation, as it has recently been suggested by Aoyagi and colleagues (Aoyagi et al., 2010). In addition, infection of cells with a pp65-mutant resulted in increased pUL69 protein levels, thereby indicating that the expression regulation of pp65 and pUL69 are interconnected (Becke et al., 2010). In conclusion, UL82-pp71, UL99-pp28, UL83-pp65 and UL86-MCP, which were altered in their protein expression levels in HFF cells infected with RNA-binding and/or -export negative pUL69-mutants, were identified to represent putative target mRNAs of the pUL69-mediated mRNA export and/or translation. Moreover, it needs to be clarified whether the nuclear export of these genes is also affected by pUL69.

To test a putative targeting of cytomegaloviral mRNAs by pUL69, RNA-immunoprecipitation experiments from HFFs infected with wild type- or pUL69-ΔR1ΔRS viruses were conducted and analysed the specific association of pUL69 with a selection of cytomegaloviral mRNAs in vivo. For the very first time, this study provides evidence that pUL69 specifically interacts with UL44-, UL83-pp65- and UL82-pp71-mRNAs in a time-independent manner during the course of infection. As ICP27 and EB2 had already been implicated in the nuclear export of mainly late gene transcripts, it is very likely, that pUL69, as the prototype of betaherpesviral ICP27-homologs, exerts similar RNA-binding specificity (Batisse et al., 2005; Sandri-Goldin, 2001). Even though initial comparison of UL44 protein levels between wild type- and pUL69- mutant infected HFF cells did not suspect this mRNA as a potential pUL69-target, it is plausible that the HCMV-encoded DNA-polymerase-processivity-factor is targeted by pUL69. UL44, in analogy to pUL69, is expressed with early-kinetics, and was found to be essential for HCMV-replication (Ripalti et al., 1995). A pUL69-mediated nuclear export of UL44- transcripts might ensure that a sufficient amount of UL44 protein is available, which in turn is required for viral DNA-replication. However, it is noteworthy that UL44-mRNA levels were demonstrated to remain constant in HFF cells infected with a UL69-deletion virus (Hayashi et al., 2000), thereby suggesting that additional regulatory mechanisms are needed to overcome the lack of pUL69-mediated nuclear export of this essential HCMV-gene. UL83- pp65 as well as UL82-pp71 display major tegument phosphoproteins, which are not essential but important for efficient HCMV-replication (Schmolke et al., 1995; Baldick C. J. Jr. et al., 1997; Breshnahan and Shenk, 2000b). Both pUL69 as well as pp71 have been implicated to alter cell cycle progression: while pp71 was demonstrated to accelerate cells through G1 and to induce quiescent cells to re-enter the cell cycle and enter S-phase (Kaljeta and Shenk, 2002), pUL69 was shown to induce a G1-cell cycle arrest (Lu and Shenk, 1999; Hayashi et al., 2000). A combination of both activities might be beneficial for HCMV-replication, since the stimulation of quiescent cells and their subsequent arrest might provide a mechanism to maximize the production of progeny virions (Kaljeta and Shenk, 2002). Regarding UL83-

92 Discussion pp65, the protein was demonstrated to directly interact with pUL69 and to be required for the incorporation of pUL69 into viral particles (Chevillotte et al., 2009). Thus, pUL69-mediated nuclear export of UL83-pp65- and UL82-pp71-transcripts is very likely to support the proteins closely linked functions regarding cell cycle progression as well as tegument formation, thereby ensuring that adequate protein levels are available. In addition, keeping in mind that UL83-pp65 and UL82-pp71 derive from only one abundant transcript, it is very likely that the nuclear export of both mRNAs is connected. As already mentioned above, pUL69 is a tegument protein, which is delivered to the host cell immediately after infection (Winkler et al., 1995). However, since pUL69 is expressed with early-late kinetics, tegument-delivered protein levels might be too low to efficiently promote the nuclear export of immediate-early transcripts as for example of IE1/2, which therefore might indeed not display pUL69-targets. Therefore, it is highly suggestive that not the tegument-delivered pUL69 but more likely newly-synthesized protein is responsible for the nuclear export of identified target-mRNAs. Moreover, it needs to be taken into consideration that during the purification process of ribonucleoprotein (RNPs) complexes comprising pUL69 and putative target-mRNAs, it is possible that full-length transcripts associated with pUL69 are disrupted and only the RNA-sequence directly bound to pUL69 is protected. Oligonucleotides used for mRNA-specific RT-PCR amplifications of RNPs, were only spanning a short sequence within each transcript that may lie far distant of the pUL69- binding site within the respective mRNA. It can therefore not be excluded that certain mRNAs as for example UL86-MCP-, UL99-pp28- or IE1-, represent false-negative results and, in contrast to findings presented in this study, might also be associated with pUL69 during infection. Furthermore, since pUL69 was also demonstrated to interact with itself to form high-molecular-mass-complexes (Lischka et al., 2007), as well as to associate with the HCMV-encoded protein kinase pUL97 (Thomas et al., 2009; Becke et al., 2010) it was suggestive that pUL69 associates with the respective mRNAs in vivo and promotes their nuclear export. However, while putative formation of pUL69 with UL97-transcripts has not been analysed so far, this study failed to detect the association of pUL69 with its own mRNA (data not shown). Due to the limitations of the RNA-immunprecipitation experiments listed above, an association of pUL69 with it`s own as well as with the pUL97-transcript cannot be excluded and needs further experimental approaches. RNA-immunoprecipitations analyses are limited insofar that they only provide evidence for the formation of RNA-protein complexes (RNPs), however, cannot give insight into a putative nuclear export of the respective mRNAs by pUL69. Therefore, it still needs to be elucidated whether the association of UL44-, UL82-pp71- and UL83-pp65-mRNAs with pUL69 is also linked to their nuclear export and the accumulation of respective transcripts in the cytoplasm. In addition, transient transfection experiments clearly indicated that the pUL69-mRNA- complexes observed are independent of any additional virus-encoded cofactor, thereby

93 Discussion again underlining the specificity and selection of RNA-binding by pUL69 in vivo. Yet, it is noteworthy that pUL69 may also have the ability to promote viral and/or cellular mRNA- export by interaction with distinct components of the cellular mRNA-export pathway as for example UAP56 and URH49 or other so far unknown proteins. This is further supported by the fact that the pUL69-mutant ΔR1ΔRS, incapable to interact with UAP56 and to directly bind to RNA, was unable to precipitate any mRNAs in RIP-analyses. However, it excludes that the identified targets were bridged to pUL69 via the transcription-complex component hSpt6, since the pUL69-mutant ΔR1ΔRS, like pUL69 wild type, is still able to recruit hSpt6.

Having determined a distinct subset of cytomegaloviral mRNAs to be pUL69-associated, it was desirable to identify further viral as well as cellular mRNAs that interact with pUL69 during the course of HCMV-infection. So far, RIP-analysis of pUL69-coprecipitated mRNAs was limited by the use of target specific oligonucleotides for amplification, which only facilitated the identification of supposable pUL69 target-mRNAs. In order to circumvent this problem, a novel experimental setup was established which allowed the generation of a cDNA-library comprising mRNAs co-precipitated by pUL69 from HCMV-infected HFFs. Noteworthy, this technique resulted in numerous clones comprising putative pUL69 target- mRNAs but only a subset has been sequenced, however, lots of further targets can be identified in the future. So far, this method identified two cellular and one viral mRNA associated with pUL69 during HCMV-infection. Cell-division-control-protein-42-mRNA (CDC42) encodes for a GTPase of the Rho-subfamily involved in diverse cellular functions including cell morphology, migration, endocytosis and cell cycle regulation (Heasman and Ridley, 2008; Sinha and Yang, 2008; Melendez et al., 2011). Besides an involvement in tumorgenesis, invasion and cancer progression (Rathinam et al., 2011; Stengel and Zheng, 2011) a dysregulation of Rho-GTPase signaling have been demonstrated to be causative for the development and progression of neurodegenerative diseases such as mental retardation. Moreover, they display central key factors in the molecular pathways determining neuronal survival and death (Antoine-Bertrand et al., 2011; Linseman and Loucks, 2008). Noteworthy, inhibition of CDC42 was shown to be of importance for the survival of auditory hair cells, which cause sensorineural hearing loss when damaged (Bodmer et al., 2002). This is of general interest, since HCMV still is the major cause for virus-associated birth defects and congenital infections of immunologically immature newborns can cause mental retardation, seizures, progressive loss of hearing and vision (Dollard et al., 2007; Revello and Gerna, 2002; Revello et al., 2002). The finding that CDC42-mRNA is associated with pUL69 might be linked to the neurological pathogenesis observed during HCMV-infection: enhanced nuclear export of CDC42-transcripts is potentially able to increase cytoplasmic CDC42- protein levels and might result in an enhanced activity of its signalling pathways, which in turn can cause mental retardation as well as hearing loss.

94 Discussion

The second cellular mRNA-sequence identified to be associated with pUL69 during HCMV- infection corresponds to a widespread nucleotide-sequence, which is contained in several mRNAs encoding diverse cellular proteins as for example Tubby-like-protein-1, NADH- dehydrogenase-precursor, protein kinase A (PRKA) anchor protein 12 or alkylglycerone phosphate synthase precursor. Due to the fact that Tubby-like-protein-1-mRNA (TULP) was listed on top of the results obtained from BLAST-algorithms, the putative pUL69 target- mRNA was termed TULPseed. However, the results presented in this study cannot narrow down or define the actual mRNA-target/s corresponding to this primary nucleotide sequence. In contrast, this finding provokes the existence of a wide-spread response-element within pUL69 target-mRNAs. Noteworthy, Whitehouse and collegues already identified such a potential response-element in Herpesvirus saimiri RNAs, which is recognized by ORF57, the HVS-counterpart of pUL69 (Colgan et al., 2009). Open reading frame UL65, the only cytomegaloviral mRNA identified so far to be pUL69- associated during cDNA-library generation, is predicted to encode a 67kDa phosphoprotein that is so far uncharacterized regarding its function and activities (Scott et al., 2002). The role and impact of a potential nuclear export of UL65-mRNA by pUL69 therefore needs to be elucidated in future experiments. Until today the mechanism conferring selective association of pUL69 with its mRNA-targets in vivo has not been revealed. All three herpesviral subfamilies encode for viral mRNA-export factors with homology to HSV1 ICP27, which interact with several cellular proteins to exploit the cellular mRNA-export machinery for their own purposes. These interactions as well as the involvement of further viral cofactors may also provide a mode of action to confer specificity in RNA-recognition and -association. In addition, primary nucleotide sequences and/or secondary structures of mRNAs might play a role for their recognition by mRNA- export factors. Interestingly, for the HIV1 encoded mRNA-export factor Rev, which likewise to pUL69 contains arginine-rich motifs for RNA-binding, studies demonstrated that it associates with its mRNA-targets via complex secondary structures including internal loops (Malim et al., 1990; Cao et al., 2009). Furthermore, studies of the Herpesvirus saimiri mediated mRNA- export by the pUL69-homolog ORF57, identified a recurring motif present in its putative target-mRNAs, which is suggested to be essential for the association of HVS intronless mRNAs with ORF57 (Colgan et al., 2009). To clarify whether the pUL69 target-mRNAs identified in this study comprise either a primary sequence response-element or form distinct secondary structures that can be recognized by pUL69 is under current investigation. In addition, primary sequence alignments and secondary structure predictions using bioinformatics might accelerate the quest for a mechanism conferring RNA-binding specificity of pUL69.

Since RNA-immunoprecipitation experiments and the generation of a cDNA-library from pUL69-associated mRNAs during HCMV-infection identified several viral and cellular mRNAs 95 Discussion to be pUL69-targets, it was tempting to speculate that the respective transcripts might also be altered in their expression levels between wild type and pUL69ΔR1ΔRS-mutant infected HFFs. To clarify whether the mRNA expression levels in general, or of specific transcripts, are varying between wild type and mutant infected cell cultures, quantitative PCRs were performed. Importantly, while the mRNA levels of RPL4, as an unrelated house-keeping gene were comparable, it was striking that especially UL65-mRNA levels were significantly decreased (90%) in HFFs infected with the RNA- and UAP56-binding deficient pUL69-mutant ΔR1ΔRS in comparison to wild type infected cells. This is of major importance, since UL65- mRNA was identified to be associated with pUL69 during HCMV-infection. Both the generation and maintenance of proper UL65-transcription levels might be regulated via direct transcription activation and/or nuclear export of the respective mRNA by pUL69. Since pUL69 has been implicated as a pleiotopic transactivator of gene expression (Winkler et al., 1994) it is feasible that it strongly activates the transcription of the UL65-gene to maintain an adequate mRNA-level, even though the physiological relevance is so far unknown. Most importantly, however, fractionation of cytoplasmic and nuclear mRNAs clearly demonstrated that cytoplasmic UL65-mRNA levels were drastically diminished in pUL69-ΔR1ΔRS-infected cells in comparison to wild type infected HFFs, thereby accentuating the defect of a pUL69- mediated nuclear mRNA-export of this transcript. Moreover, it was noticeable that the mRNA-levels of the further identified pUL69-targets - UL44, UL82-pp71, UL83-pp65, CDC42 and TULPseed - were also decreased in mutant-infected cells. Interestingly, a previous study investigating regulation of a broad spectrum of cellular and viral transcripts revealed a two fold increase in CDC42-mRNA levels upon HCMV-infection (Hertel and Mocarski, 2004). These data perfectly fit to this study, demonstrating that CDC42-transcript levels were decreased by approximately 50% in pUL69-mutant infected HFFs, which therefore might hint at an involvement of pUL69 in the specific upregulation of this cellular transcript during infection. Furthermore, cytoplasmic mRNA levels of UL83-pp65, UL82-pp71 were markedly reduced in ΔR1ΔRS-infected cell cultures indicating that direct RNA-binding and/or UAP56- interaction of pUL69 were critical for the nuclear export of these transcripts. Yet, it is noteworthy that transcripts encoding the HCMV immediate-early protein IE1 were also lowered by approximately 20% in ΔR1ΔRS-infected HFFs, suggesting that fibroblasts were either infected with slightly different MOIs than calculated or that IE1-expression is altered in the cells infected with the pUL69-mutant incapable to bind and export RNA.

Concluding, the second part of this PhD-thesis aimed to identify natural - viral and cellular - mRNAs that are associated with pUL69 during HCMV-infection. For the very first time, this study provides evidence that pUL69 specifically targets UL44-, UL82-pp71-, UL83-pp65- UL65-, CDC42- and TULPseed-transcripts independently of virus-encoded cofactors or the HCMV-replicative cycle. In addition, results obtained in this PhD-thesis clearly demonstrate

96 Discussion that the mRNA-levels of several pUL69 target-mRNAs are drastically decreased in HFF cells infected with the pUL69-mutant ΔR1ΔRS, indicating that both RNA-binding and/or UAP56- interaction were required for the proper gene transcription and/or nuclear export of the respective transcripts. However, the discrimination between individual and highly interconnected steps of RNA-biogenesis, as for example transcription initiation and elongation, nuclear RNA-export or translation initiation, which might be affected by pUL69 during HCMV-infection, will be subject for future studies.

Finally, it needs to be taken into consideration that pUL69 is a tegument protein, which is incorporated into HCMV-virions and that a subset of viral and cellular mRNAs has previously been demonstrated to be also part of infectious particles (Winkler and Stamminger, 1996; Breshnahan and Shenk, 2000a). The mechanism by which the packaging of mRNAs into HCMV virions occurs is still unknown. However, it is tempting to speculate that specific and coordinated binding of pUL69 to a selection of transcripts might provide a feasible mode of action.

97 Abbreviations

G Abbreviations

α anti Ighc immuno globulin heavy aa amino acid chain AIDS aquired immunodeficiency kana kanamycin syndrome kbp kilo base pair Ala/A alanine kDa kilo Dalton Arg/R arginine KSHV Kaposi-sarcoma- BACmid bacterial artificial chromosome associated herpesvirus β-gal β-galactosidase L late C- carboxy-terminus LMB leptomycin B CAT chloramphenicol acetyl- luc luciferase transferase M- Myc CCMV chimpanzee cytomegalovirus MAb monoclonal antibody CDC cell devision cycle MCMV murine cytomegalovirus cDNA complementary DNA MCP major capsid protein Ch chimer/chimeric MIEP major immediate-early CoIP co-immunoprecipitation enhancer/promoter CPE cytopathic effect min minute(s) Cy3 cyanine 3 MOI multiplicity of infection Δ delta/deletion mRNA messenger RNA dpi day(s) post infection mut mutant DAPI 4`,6-diamidino-2-phenylindole N- amino-terminus DNA deoxyribonucleic acid NES nuclear export signal DNase deoxyribonuclease NLS nuclear localization signal dNTP deoxyribonucleotidetriphosphate OD optical density dsDNA double-strand DNA ORF open reading frame E early PAGE polyacrylamid gel EBV Epstein-Barr virus electrophoresis ECL enhanced chemiluminescence PAb polyclonal antibody E. coli Escherichia coli PCR polymerase chain reaction EDTA ethylenediaminetetraacetic acid pfu plaque forming units EJC exon-junction complex rev reverse/revertant ElHV1 elephant endotheliotropic RFP red fluorescent protein herpesvirus 1 RhCMV rhesus cytomegalovirus F- FLAG RIP RNA-immunoprecipitation FBS fetal bovine serum RNA ribonucleic acid Fig figure RNase ribonuclease FITC fluorescein-iso-thiocyanat RNP ribonucleprotein complex galK galactokinase K rpm revolutions per minute GAPDH glycerinaldehyd-3-phosphat RPL ribosomal protein L dehydrogenase RT room temperature/reverse Gln/Q glutamine transcription hpi hour(s) post infection Ser/S serine HCMV human cytomegalovirus SDS sodium dodecyl sulfate HEK human embryonic kidney cells sec second(s) HFF human foreskin fibroblasts SV40 simian virus 40 HHV human herpesvirus TAE tris acetate-EDTA buffer HIV1 human immunodeficiency TE tris-EDTA buffer virus type1 TK thymidine kinase HRP horseradish peroxidase TREX transcription-elongation HSV1/2 herpes simplex virus type 1/2 export complex HTLV1 human T lymphotropic virus 1 TULP tubby-like-protein HVS herpes virus saimiri UL unique-long ICP27 infected cell protein 27 VZV varizella zoster virus IE immediate-early wt wild type

98 References

H References

Abruzzi, K.C., Lacadie, S., and Rosbash, M. (2004). Biochemical analysis of TREX complex recruitment to intronless and intron-containing yeast genes. EMBO J. 23, 2620-2631. Anders, D.G., Kacica, M. A., Pari, G., and Punturieri, S. M. (1992). Boundaries and structure of human cytomegalovirus oriLyt, a complex origin for lytic-phase DNA-replication. J. Virol. 66, 3373- 3384. Andreoni, M., Faircloth, M., Vugler, L., and Britt, W. J. (1989). A rapid microneutralization assay for the measurement of neutralizing antibody reactive with human cytomegalovirus. J. Virol. Methods 23, 157-167. Aoyagi, M., Gaspar, M., and Shenk, T. E. (2010). Human cytomegalovirus UL69 protein facilitates translation by associating with the mRNA cap-binding complex and excluding 4EBP1. Proc. Natl. Acad. Sci. USA 107, 2640-2645. Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1989). Current protocols in molecular biology. (New York: John Wiley & Sons, Inc.). Baldick, C. J., and T. Shenk. (1996). Proteins associated with purified human cytomegalovirus particles. J. Virol. 70, 6097-6105. Baldick, C. J., Jr., Marchini, A., Patterson, C. E., and Shenk, T. (1997). Human cytomegalovirus tegument protein pp71 (ppUL82) enhances the infectivity of viral DNA and accelerates the infectious cycle. J. Virol. 71, 4400-4408. Bannister, A. J. and Kouzarides, T. (1996). The CBP co-activator is a histone acetyltransferase. Nature 384, 641-643. Bason, C., Corrocher, R., Lunardi, C., Puccetti, P., Olivieri, O., Girelli, D., Navone, R., Beri, R., Millo, E., Margonato, A., Martinelli, N. and Puccetti, A. (2003). Interaction of antibodies against cytomegalovirus with heat-shock protein 60 in pathogenesis of atherosclerosis. Lancet 362, 1971- 1977. Batisse, J., Manet, E., Middeldorp, J., Sergeant, A., and Gruffat, H. (2005). Epstein-Barr virus mRNA-export factor EB2 is essential for intranuclear capsid assembly and production of gp350. J. Virol. 79, 14102-14111. Bello, L. J., Davison, A. J., Glenn, M. A., Whitehouse, A., Rethmeier, N., Schulz, T. F., and Barklie, C. J. (1999). The human herpesvirus-8 ORF 57 gene and its properties. J. Gen. Virol. 80, 3207-3215. Bolovan-Fritts, C. A., Mocarski, E. S., and Wiedeman, J. A. (1999). Peripheral blood CD14(+) cells from healthy subjects carry a circular conformation of latent cytomegalovirus genome. Blood 93, 394- 398. Borst, E. M., Hahn, G., Koszinowski, U. H., and Messerle, M. (1999). Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J. Virol. 73, 8320-8329. Bortvin, A. and Winston, F. (1996). Evidence that Spt6p controls chromatin structure by a direct interaction with histones. Science 272, 1473-1476. Braun, I. C., Herold, A., Rode, M., Conti, E., and Izaurralde, E. (2001). Overexpression of TAP/p15 heterodimers bypasses nuclear retention and stimulates nuclear mRNA-export. J. Biol. Chem. 276, 20536-20543. Bresnahan, W. A. and Shenk, T. E. (2000a). A subset of viral transcripts packaged within human cytomegalovirus particles. Science 288, 2373-2376. Bresnahan, W. A. and Shenk, T. E. (2000b). UL82 virion protein activates expression of immediate early viral genes in human cytomegalovirus-infected cells. Proc Natl Acad Sci USA. 97, 14506-14511. Brewer, C. B. (1994). Cytomegalovirus plasmid vectors for permanent lines of polarized epithelial cells. Methods Cell Biol. 43, 233-245.

99 References

Buisson, M., Manet, E., Trescol-Biemont, M. C., Gruffat, H., Durand, B., and Sergeant, A. (1989). The Epstein-Barr virus (EBV) early protein EB2 is a posttranscriptional activator expressed under the control of EBV transcription factors EB1 and R. J. Virol. 63, 5276-5284. Cantrell, S. R. and Breshnahan, W. A. (2005). Interaction between the human cytomegalovirus UL82 gene product (pp71) and hDaxx regulates immediate-early gene expression and viral replication. J. Viol. 79, 7792-7802. Chee, M. S., Bankier, A. T., Beck, S., Bohni, R., Brown, C. M., Cerny, R., Horsnell, T., Hutchison, C. A. III, Kouzarides, T., Martignetti, J. A., et al. (1990). Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top. Microbiol. Immunol. 154, 125-169. Cheeran, M. C., Hu, S., Ni, H. T., Sheng, W., Palmquist, J. M., Peterson, P. K., and Lokensgard, J. R. (2005). Neural precursor cell susceptibility to human cytomegalovirus diverges along glial or neuronal differentiation pathways. J. Neurosci. Res. 82, 839-850. Chen, I. H., Sciabica, K. S., and Sandri-Goldin, R. M. (2002). ICP27 interacts with the RNA-export factor Aly/REF to direct herpes simplex virus type 1 intronless mRNAs to the TAP export pathway. J. Virol. 76, 12877-12889. Chen, I. H., Li, L., Silva, L., and Sandri-Goldin, R. M. (2005). ICP27 recruits Aly/REF but not TAP/NXF1 to herpes simplex virus type 1 transcription sites although TAP/NXF1 is required for ICP27 export. J. Virol. 79, 3949-3961. Cohen, J. I. and Corey, G. R. (1985). Cytomegalovirus infection in the normal host. Medicine 64, 100- 114. Colgan, K. J, Boyne, J. R., and Whitehouse, A. (2009). Identification of a response element in a herpesvirus saimiri mRNA recognized by the ORF57 protein. J. Gen. Virol. 90, 596-601. Compton, T., Nepomuceno, R. R., and Nowlin, D. M. (1992). Human cytomegalovirus penetrates host cells by pH-independent fusion at the cell surface. Virology 191, 387-395. Compton, T., Nowlin, D. M., and Cooper, N. R. (1993). Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virology 193, 834-841. Cook, I. D., Shanahan, F., and Farrell, P. J. (1994). Epstein-Barr virus SM protein. Virology 205, 217-227. Cullen, B. R. (2003a). Nuclear RNA-export. J. Cell Sci. 116, 587-597. Cullen, B. R. (2003b). Nuclear mRNA-export: insights from virology. Trends Biochem Sci. 28, 419- 424. Cullen, B. R. (2004). Assaying nuclear messenger RNA-export in human cells. Methods Mol. Biol. 257, 85-92. Danziger-Isakov, L. and Mark, B. G. (2008). Hematologic complications of anti-CMV therapy in solid organ transplant recipients. Clin. Transplant. 23, 295-304. Davison, A. J. (2002). Evolution of the herpesviruses. Vet. Microbiol. 86, 69-88. Davison, A. J., Eberle, R., Ehlers, B., Hayward, G. S., McGeoch, D. J., Minson, A. C., Pellett, P. E., Roizman, B., Studdert, M. J., and Thiry, E. (2009). The order Herpesvirales. Arch. Virol. 154, 171-177. Demarchi, J. M. (1981). Human cytomegalovirus DNA: restriction enzyme cleavage maps and map locations for immediate-early, early, and late RNAs. Virology 114, 23-38. Dollard, S. C., Grosse, S. D., and Ross, D. S. (2007). New estimates of the prevalence of neurological and sensory sequelae and mortality associated with congenital cytomegalovirus infection. Rev. Med. Virol. 17, 355-363. Drew, W. L. (1992a). Nonpulmonary manifestations of cytomegalovirus infection in immunocompromised patients. Clin. Microbiol. Rev. 5, 204-210. Drew, W. L. (1992b) Cytomegalovirus infection in patients with AIDS. Clin. Infect. Dis. 14, 608-615. Drew, W. L. and Lalezari, J. P. (1999). Cytomegalovirus: disease syndromes and treatment. Curr. Clin.Top. Infect. Dis. 19, 16-29.

100 References

Endoh, M., Zhu, W., Hasegawa, J., Watanabe, H., Kim, D. K., Aida, M., Inukai, N., Narita, T., Yamada, T., Furuya, A., Sato, H., Yamaguchi, Y., Mandal, S. S., Reinberg, D., Wada, T., and Handa, H. (2004). Human Spt6 stimulates transcription elongation by RNA polymerase II in vitro. Mol. Cell Biol. 24, 3324-3336. Erkmann, J. A. and Kutay, U. (2004). Nuclear export of mRNA: from the site of transcription to the cytoplasm. Exp. Cell Res. 296, 12-20. Farjot, G., Buisson, M., Duc, D. M., Gazzolo, L., Sergeant, A., and Mikaelian, I. (2000). Epstein- barr virus EB2 protein exports unspliced RNA via a crm-1- independent pathway. J. Virol. 74, 6068- 6076. Fleckner, J., Zhang, M., Valcarcel, J., and Green, M. R. (1997). U2AF65 recruits a novel human DEAD box protein required for the U2 snRNP-branchpoint interaction. Genes Dev. 11, 1864-1872. Flint, S. J., L. W. Enquist, V. R. Racaniello, and Skalka, A. M. (2004). Principles of Virology. Second, 298-339. Fortunato, E. A., McElroy, A. K., Sanchez, I., and Spector, D. H. (2000). Exploitation of cellular signaling and regulatory pathways by human cytomegalovirus. Trends Microbiol 8, 111-119. Gatfield, D., Le Hir, H., Schmitt, C., Braun, I. C., Kocher, T., Wilm, M., and Izaurralde, E. (2001). The DExH/D box protein HEL/UAP56 is essential for mRNA nuclear export in Drosophila. Curr. Biol. 11, 1716-1721. Gebert, S., Schmolke, S., Sorg, G., Floss, S., Plachter, B., and Stamminger, T. (1997). The UL84 protein of human cytomegalovirus acts as a transdominant inhibitor of immediate-early-mediated transactivation that is able to prevent viral replication. J. Virol. 71, 7048-7060. Georgiev, O., Bourquin, J. P., Gstaiger, M., Knoepfel, L., Schaffner, W., and Hovens, C. (1996). Two versatile eukaryotic vectors permitting epitope tagging, radiolabelling and nuclear localisation of expressed proteins. Gene 168, 165-167. Gibson, W. (1996). Structure and assembly of the virion. Intervirology 39, 389-400. Gibson, W. (2001). Action at the assemblin dimer interface. Nat. Struct. Biol. 8, 739-741. Giede-Jeppe, A. (2011). Generierung und Charakterisierung rekombinanter Cytomegaloviren mit Mutationen der UAP56-Bindungsstelle sowie RNA-Bindungsdomäne des viralen mRNA-Exportfaktors pUL69. MD thesis at the University Erlangen-Nuremberg. Gilbert, C. and Boivin, G. (2005). Human cytomegalovirus resistance to antiviral drugs. Antimicrob. Agents Chemother. 49, 873-883. Goodwin, D. J., Hall, K. T., Stevenson, A. J., Markham, A. F., and Whitehouse, A. (1999). The open reading frame 57 gene product of herpesvirus saimiri shuttles between the nucleus and cytoplasm and is involved in viral RNA nuclear export. J. Virol. 73, 10519-10524. Grant, S. G., J. Jessee, F. R. Bloom, and Hanahan, D. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc. Natl. Acad. Sci. USA. 87, 4645-4649. Greijer, A. E., Dekkers, C. A., and Middeldorp, J. M. (2000). Human cytomegalovirus virions differentially incorporate viral and host cell RNA during the assembly process. J. Virol. 74, 9078-9082. Gruffat, H., Batisse, J., Pich, D., Neuhierl, B., Manet, E., Hammerschmidt, W., and Sergeant, A. (2002). Epstein-Barr virus mRNA-export factor EB2 is essential for production of infectious virus. J. Virol. 76, 9635-9644. Gruter, P., Tabernero, C., von Kobbe, C., Schmitt, C., Saavedra, C., Bachi, A., Wilm, M., Felber, B. K., and Izaurralde, E. (1998). TAP, the human homolog of Mex67p, mediates CTE-dependent RNA-export from the nucleus. Mol. Cell 1, 649-659. Hartzog, G. A., Wada, T., Handa, H., and Winston, F. (1998). Evidence that Spt4, Spt5, and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae. Genes Dev. 12, 357-369. Hayashi, M. L., Blankenship, C., and Shenk, T. (2000). Human cytomegalovirus UL69 protein is required for efficient accumulation of infected cells in the G1 phase of the cell cycle. Proc. Natl. Acad. Sci. USA. 97, 2692-2696.

101 References

Herold, A., Klymenko, T., and Izaurralde, E. (2001). NXF1/p15 heterodimers are essential for mRNA nuclear export in Drosophila. RNA 7, 1768-1780. Herold, A., Teixeira, L., and Izaurralde, E. (2003). Genome-wide analysis of nuclear mRNA-export pathways in Drosophila. EMBO J. 22, 2472-2483. Hilleren, P., McCarthy, T., Rosbash, M., Parker, R., and Jensen, T. H. (2001). Quality control of mRNA 3'-end processing is linked to the nuclear exosome. Nature 413, 538-542. Hiriart, E., Bardouillet, L., Manet, E., Gruffat, H., Penin, F., Montserret, R., Farjot, G., and Sergeant, A. (2003a). A region of the Epstein-Barr virus (EBV) mRNA-export factor EB2 containing an argininerich motif mediates direct binding to RNA. J. Biol. Chem. 278, 37790-37798. Hiriart, E., Farjot, G., Gruffat, H., Nguyen, M. V., Sergeant, A., and Manet, E. (2003b). A novel nuclear export signal and a REF interaction domain both promote mRNA-export by the Epstein-Barr virus EB2 protein. J. Biol. Chem. 278, 335-342. Hobom, U., Brune, W., Messerle, M., Hahn, G., and Koszinowski, U. H.. (2000). Fast screening procedures for random transposon libraries of cloned herpesvirus genomes: mutational analysis of human cytomegalovirus envelope glycoprotein genes. J. Virol. 74, 7720-7729. Hofmann, H., Floss, S., and Stamminger, T. (2000). Covalent modification of the transactivator protein IE2-p86 of human cytomegalovirus by conjugation to the ubiquitin-homologous proteins SUMO-1 and hSMT3b. J. Virol. 74, 2510-2524. Hofmann, H., Sindre, H., and Stamminger, T. (2002). Functional interaction between the pp71 protein of human cytomegalovirus and the PML-interacting protein human Daxx. J. Virol. 76, 5769- 5783. Hope, T. J., Huang, X. J., McDonald, D., and Parslow, T. G. (1990). Steroid-receptor fusion of the human immunodeficiency virus type 1 Rev transactivator: mapping cryptic functions of the arginine- rich motif. Proc. Natl. Acad. Sci. USA. 87, 7787-7791. Houseley, J., LaCava, J., and Tollervey, D. (2006). RNA-quality control by the exosome. Nat. Rev. Mol. Cell Biol. 7, 529-539. Huang, Y. and Steitz, J. A. (2001). Splicing factors SRp20 and 9G8 promote the nucleocytoplasmic export of mRNA. Mol. Cell 7, 899-905. Huang, Y., Gattoni, R., Stevenin, J., and Steitz, J. A. (2003). SR splicing factors serve as adapter proteins for TAP-dependent mRNA-export. Mol. Cell 11, 837-843. Inchauspe, G. and Ostrove, J. M. (1989). Differential regulation by varicella-zoster virus (VZV) and herpes simplex virus type-1 trans-activating genes. Virology 173, 710-714. Izaurralde, E. (2002). A novel family of nuclear transport receptors mediates the export of messenger RNA to the cytoplasm. Eur. J. Cell Biol. 81, 577-584. Jensen, T. H., Boulay, J., Rosbash, M., and Libri, D. (2001). The DECD box putative ATPase Sub2p is an early mRNA-export factor. Curr. Biol. 11, 1711-1715. Johnson, L. A. and Sandri-Goldin, R. M. (2009). Efficient nuclear export of herpes simplex virus 1 transcripts requires both RNA-binding by ICP27 and ICP27 interaction with TAP/NXF1. J. Virol. 83,1184-1192. Jones, D. T. (1999). Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292, 195-202. Jordan, M. C., Rousseau, W., Stewart, J. A., Noble, G. R., and Chin, T. D. (1973). Spontaneous cytomegalovirus mononucleosis. Clinical and laboratory observations in nine cases. Ann. Intern.Med. 79, 153-160. Katahira, J., Strasser, K., Podtelejnikov, A., Mann, M., Jung, J. U., and Hurt, E. (1999). The Mex67p-mediated nuclear mRNA-export pathway is conserved from yeast to human. EMBO J. 18, 2593-2609. Khaiboullina, S. F., Maciejewski, J. P., Crapnell, K., Spallone, P. A., Dean, S. A., Pari, G. S., Zanjani, E. D., and Jeor, S. S. (2004). Human cytomegalovirus persists in myeloid progenitors and is passed to the myeloid progeny in a latent form. Br. J. Haematol. 126, 410-417.

102 References

Kiesler, E., Miralles, F., and Visa, N. (2002). HEL/UAP56 binds cotranscriptionally to the Balbiani ring pre-mRNA in an intron-independent manner and accompanies the BR mRNP to the nuclear pore. Curr. Biol. 12, 859-862. Koch, S., Solana, R., Dela, R. O. and Pawelec, G. (2006). Human cytomegalovirus infection and T cell immunosenescence: a mini review. Mech. Ageing Dev. 127, 538-543. Koch, S., Larbi, A., Ozcelik, D., Solana, R., Gouttefangeas, C., Attig, S., Wikby, A., Strindhall, J., Franceschi, C., and Pawelec, G. (2007). Cytomegalovirus infection: a driving force in human T cell immunosenescence. Ann. N. Y. Acad. Sci. 1114, 23-35. Koffa, M. D., Clements, J. B., Izaurralde, E., Wadd, S., Wilson, S. A., Mattaj, I. W., and Kuersten, S. (2001). Herpes simplex virus ICP27-protein provides viral mRNAs with access to the cellular mRNA-export pathway. EMBO J. 20, 5769-5778. Kronemann, D., Hagemeier, S. R., Cygnar, D., Phillips, S., and Breshnahan, W. A. (2010). Binding of the human cytomegalovirus (HCMV) tegument protein UL69 to UAP56/URH49 is not required for efficient replication of HCMV. J. Virol. 84, 9649-9654. Krech, U. (1973). Complement-fixing antibodies against cytomegalovirus in different parts of the world. Bull. World Health Organ. 49, 103-106. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lang, D.J. and Kummer, J. F. (1975). Cytomegalovirus in semen: observations in selected populations. J. Infect. Dis. 132, 472-473. Le Hir, H., Izaurralde, E., Maquat, L. E., and Moore, M. J. (2000). The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19, 6860-6869. Le Hir, H., Gatfield, D., Izaurralde, E., and Moore, M. J. (2001). The exon-exon junction complex provides a binding platform for factors involved in mRNA-export and nonsense-mediated mRNA decay. EMBO J. 20, 4987-4997. Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A., and Copeland, N. G. (2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombino-genic targeting and subcloning of BAC DNA. Genomics 73, 56-65. Leen, A. M. and Heslop, H. E. (2008). Cytotoxic T lymphocytes as immune-therapy in haematological practice. Br. J. Haematol. 143, 169-179. Lei, E. P., Krebber, H., and Silver, P. A. (2001). Messenger RNAs are recruited for nuclear export during transcription. Genes Dev. 15, 1771-1782. Lei, E. P. and Silver, P. A. (2002). Intron status and 3'-end formation control cotranscriptional export of mRNA. Genes Dev. 16, 2761-2766. Liker, E., Fernandez, E., Izaurralde, E., and Conti, E. (2000). The structure of the mRNA-export factor TAP reveals a cis arrangement of a non-canonical RNP domain and an LRR domain. EMBO J. 19, 5587-5598. Linder, P. and Stutz, F. (2001). mRNA-export: travelling with DEAD box proteins. Curr. Biol. 11, R961-R963. Lischka, P., Rosorius, O., Trommer, E., and Stamminger, T. (2001). A novel transferable nuclear export signal mediates CRM1-independent nucleocytoplasmic shuttling of the human cytomegalovirus transactivator protein pUL69. EMBO J. 20, 7271-7283. Lischka, P., Toth, Z., Thomas, M., Mueller, R., and Stamminger, T. (2006). The UL69 transactivator protein of human cytomegalovirus interacts with DEXD/H-Box RNA helicase UAP56 to promote cytoplasmic accumulation of unspliced RNA. Mol. Cell Biol. 26, 1631-1643.

Lischka, P., Thomas, M., Toth, Z., Mueller, R., and Stamminger, T. (2007). Multimerization of human cytomegalovirus regulatory protein UL69 via a domain that is conserved within its herpesvirus homologues. J. Gen. Virol. 88, 405-410. Liu, B. and Stinski, M. F. (1992). Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements. J. Virol. 66, 4434-4444.

103 References

Lorz, K., Hofmann, H., Berndt, A., Tavalai, N., Mueller, R., Schlotzer- Schrehardt, U. and Stamminger, T. (2006). Deletion of open reading frame UL26 from the human cytomegalovirus genome results in reduced viral growth, which involves impaired stability of viral particles. J. Virol. 80, 5423-5434. Lu, M. and Shenk, T. E. (1996). Human cytomegalovirus infection inhibits cell cycle progression at multiple points, including the transition from G1 to S. J. Virol. 70, 8850-8857. Lu, M. and Shenk, T.E. (1999). Human cytomegalovirus UL69 protein induces cells to accumulate in G1 phase of the cell cycle. J. Virol. 73, 676-683. Luckow, B. and Schuetz, G. (1987). CAT constructions with multiple unique restriction sites for the functional analyses of eukaryotic promoters and regulatory elements. Nucl. Acids Res. 15, 5490. Luo, M. L., Zhou, Z., Magni, K., Christoforides, C., Rappsilber, J., Mann, M., and Reed, R. (2001). Pre-mRNA splicing and mRNA-export linked by direct interactions between UAP56 and Aly. Nature 413, 644-647. Lykke-Andersen, J., Shu, M. D., and Steitz, J. A. (2001). Communication of the position of exon- exon junctions to the mRNA surveillance machinery by the protein RNPS1. Science 293, 1836-1839. Malik, P., Blackbourn, D. J., and Clements, J. B. (2004). The evolutionarily conserved Kaposi's sarcoma-associated herpesvirus ORF57 protein interacts with REF protein and acts as an RNA-export factor. J. Biol. Chem. 279, 33001-33011. Malik, P. and Clements, J. B. (2004). Protein kinase CK2 phosphorylation regulates the interaction of Kaposi's sarcoma-associated herpesvirus regulatory protein ORF57 with its multifunctional partner hnRNP K. Nucleic Acids Res. 32, 5553-5569. Marschall, M., Freitag, M., Suchy, P., Romaker, D., Kupfer, R., Hanke, M., and Stamminger, T. (2003). The protein kinase pUL97 of human cytomegalovirus interacts with and phosphorylates the DNA polymerase processivity factor pUL44. Virology 311, 60-71. Marschall, M., Marzi, A., aus dem Siepen, T., Jochmann, R., Kalmer, M., Auerochs, S., Lischka, P., Leis, M., and Stamminger, T. (2005). Cellular p32 recruits cytomegalovirus kinase pUL97 to redistribute the nuclear lamina. J. Biol. Chem. 280, 33357-33367. Matthews, R. (1982). Classification and nomenclature of viruses. Fourth report of the International Committee on Taxonomy of Viruses. Intervirology 17, 1-199. McDonough, S. H. and Spector, D. H. (1983). Transcription in human fibroblasts permissively infected by human cytomegalovirus strain AD169. Virology 125, 31-46. McGeoch, D. J., Dolan, A., and Ralph, A. C. (2000). Toward a comprehensive phylogeny for mammalian and avian herpesviruses. J. Virol. 74, 10401-10406. Mears, W. E. and Rice, S. A. (1996). The RGG box motif of the herpes simplex virus ICP27-protein mediates an RNA-binding activity and determines in vivo methylation. J. Virol. 70, 7445-7453. Mears, W. E. and Rice, S. A. (1998). The herpes simplex virus immediate-early protein ICP27 shuttles between the nucleus and the cytoplasm. Virology 242, 128-137. Mendelson, M., Monard, S., Sissons, P., and Sinclair, J. (1996). Detection of endogenous human cytomegalovirus in CD34+ bone marrow progenitors. J. Gen. Virol. 77 (Pt 12), 3099-3102. Melnick, J. L., Adam, E. and DeBakey, M. E. (1996). Cytomegalovirus and atherosclerosis. Arch. Immunol. Ther. Exp. 44, 297-302. Mettenleiter, T. C. (2002). Herpesvirus assembly and egress. J. Virol. 76, 1537-1547. Milbradt, J., Auerochs, S., Sticht, H., and Marschall, M. (2009). Cytomegaloviral proteins that associate with the nuclear lamina: components of a postulated nuclear egress complex. J. Gen. Virol. 90, 579-590. Mocarski, E. S. and Courcelle, C. T. (2001). Cytomegaloviruses and their replication. In Fields Virology, D.M.Knipe and P.M.Howley, eds. (Philadelphia: Lippincott Williams and Wilkins), 2629-2673. Mocarski, E. S., Shenk T., and Pass, R.F. (2007). Cytomegaloviruses. In Fields Virology, D.M.Knipe and P.M.Howley, eds. (Philadelphia: Lippincott Williams and Wilkins), 2701-2772.

104 References

Momose, F., Basler, C. F., O'Neill, R. E., Iwamatsu, A., Palese, P., and Nagata, K. (2001). Cellular splicing factor RAF-2p48/NPI-5/BAT1/UAP56 interacts with the influenza virus nucleoprotein and enhances viral RNA synthesis. J. Virol. 75, 1899-1908. Mueller, C., Hodgson, J. M., Bestehorn, H. P., Brutsche, M., Perruchoud, A. P., Marsch, S., Roskamm, H., and Buettner, H. J. (2003). Previous cytomegalovirus infection and restenosis after aggressive angioplasty with provisional stenting. J. Interv. Cardiol. 16, 307-313. Murphy, E. A., Streblow, D. N., Nelson, J. A., and Stinski, M. F. (2000). The human cytomegalovirus IE86 protein can block cell cycle progression after inducing transition into the S phase of permissive cells. J. Virol. 74, 7108-7118. Neipel, F., Ellinger, K., and Fleckenstein, B. (1991). The unique region of the human herpesvirus 6 genome is essentially collinear with the UL segment of human cytomegalovirus. J. Gen. Virol. 72, 2293-2297. Nelson-Rees, W. A. and Flandermeyer, R. R. (1976). HeLa cultures defined. Science 191, 96-98. Niranjanakumari, S., Lasda, E., Brazas, R., and Garcia-Blanco, M.A. (2002). Reversible cross- linking combined with immunoprecipitation to study RNA- protein interactions in vivo. Methods 26, 182-190. Ogawa-Goto, K., Tanaka, K., Gibson, W., Moriishi, E., Miura, Y., Kurata, T., Irie, S., and Sata, T. (2003). Microtubule network facilitates nuclear targeting of human cytomegalovirus capsid. J. Virol. 77, 8541-8547. Onorato, I. M., Morens, D. T., and Wahl, G. M. (1985). Epidemiology of cytomegaloviral infections: recommendations for prevention and control. Review Infect. Dis. 7, 479-497. Pass, R. F. (2001). Cytomegalovirus. In Fields Virology, D.M.Knipe and P.M.Howley, eds. (Philadelphia: Lippincott Williams and Wilkins), 2675-2706. Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D.. (1993). Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl. Acad. Sci. USA. 90, 8392-8396. Phelan, A. and Clements, J. B. (1997). Herpes simplex virus type 1 immediate early protein IE63 shuttles between nuclear compartments and the cytoplasm. J. Gen. Virol. 78, 3327-3331. Pinol-Roma, S. and Dreyfuss, G. (1992). Shuttling of pre-mRNA-binding proteins between nucleus and cytoplasm. Nature 355, 730-732. Plachter, B., Sinzger, C., and Jahn, G. (1996). Cell types involved in replication and distribution of human cytomegalovirus. Adv. Virus Res. 46, 195-261. Prichard, M. N., Duke, G. M., and Mocarski, E. S. (1996). Human cytomegalovirus uracil DNA glycosylase is required for the normal temporal regulation of both DNA synthesis and viral replication. J. Virol. 70, 3018-3025. Pryor, A., Tung, L., Yang, Z., Kapadia, F., Chang, T. H., and Johnson, L. F. (2004). Growth- regulated expression and G0-specific turnover of the mRNA that encodes URH49, a mammalian DExH/D box protein that is highly related to the mRNA-export protein UAP56. Nucleic Acids Res. 32, 1857-1865. Rechter, S., Scott, G. M., Eickhoff, J., Zielke, K., Auerochs, S., Mueller, R., Stamminger, T., Rawlinson, W. D., and Marschall, M. (2009). Cyclin-dependent kinases phosphorylate the cytomegalovirus RNA-export protein pUL69 and modulate its nuclear localization and activity. J. Biol. Chem. 284, 8605-8613. Reed, R. and Hurt, E. (2002). A conserved mRNA-export machinery coupled to pre-mRNA splicing. Cell 108, 523-531. Reed, R. (2003). Coupling transcription, splicing and mRNA-export. Curr. Opin. Cell Biol. 15, 326-331. Revello, M. G. and Gerna, G. (2002). Diagnosis and management of human cytomegalovirus infection in the mother, fetus, and newborn infant. Clin. Microbiol Rev. 15, 680-715. Reynolds, D. W., Stagno, S., Hosty, T. S., Tiller, M., and Alford, C. A., Jr. (1973). Maternal cytomegalovirus excretion and perinatal infection. N. Engl. J. Med. 289, 1-5. Rice, S. A. and Knipe, D. M. (1988). Gene-specific transactivation by herpes simplex virus type 1 alpha protein ICP27. J. Virol. 62, 3814-3823.

105 References

Roby, C. and Gibson, W. (1986). Characterization of phosphoproteins and protein kinase activity of virions, noninfectious enveloped particles, and dense bodies of human cytomegalovirus. J. Virol. 59, 714-727. Rocak, S. and Linder, P. (2004). DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232-241. Rodrigues, J. P., Rode, M., Gatfield, D., Blencowe, B., Carmo-Fonseca, M., and Izaurralde, E. (2001). REF proteins mediate the export of spliced and unspliced mRNAs from the nucleus. Proc. Natl. Acad. Sci. USA 98, 1030-1035. Roizman, B., Carmichael, L. E., Deinhardt, F., de-The, G., Nahmias, A. J., Plowright, W., Rapp, F., Sheldrick, P., Takahashi,, M., and Wolf, K. (1981). Herpesviridae. Definition, provisional nomenclature, and taxonomy. The Herpesvirus Study Group, the International Committee on Taxonomy of Viruses. Intervirology 16, 201-217. Roizman, B., Desrosiers, R. C., Fleckenstein, B., Lopez, C., Minson, A. C., and Studdert, M. J. (1992). The family Herpesviridae: an update. The Herpesvirus Study Group of the International Committee on Taxonomy of Viruses. Arch. Virol. 123, 425-449. Roizman, B. and Knipe, D. M. (2001). Herpesviruses and Their Replication. In D. M. Knipe and P. M. Howley (eds.), (Lippincott Williams and Wilkins), Philadelphia 2399-2460. Rondon, A. G., Jimeno, S., Garcia-Rubio, M., and Aguilera, A. (2003). Molecular evidence that the eukaryotic THO/TREX complex is required for efficient transcription elongation. J. Biol. Chem. 278, 39037-39043. Roth, J. and Dobbelstein, M. (1997). Export of hepatitis B virus RNA on a Rev-like pathway: inhibition by the regenerating liver inhibitory factor IkappaB alpha. J. Virol. 71, 8933-8939. Rowe, W. P., Hartley, J. W., Waterman, S., Turner, H. C., and Huebner, R. J. (1956). Cytopathogenic agent resembling human salivary gland virus recovered from tissue cultures of human adenoids. Proc. Soc. Exp. Biol. Med. 92, 418-424. Sacks, W. R., Greene, C. C., Aschman, D. P., and Schaffer, P. A. (1985). Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J. Virol. 55, 796-805. Salsman, J., Zimmerman, N., Chen, T., Domagala, M., and Frappier, L. (2008). Genome-wide screen of three herpesviruses for protein subcellular localization and alteration of PML nuclear bodies. PLoS. Pathog. 4, epub:1000100. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning - a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Sambrook, J. and Russell, D. W. (2001). Molecular cloning - a laboratory manual 3rd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Sanchez, V., Sztul, E., and Britt, W. J. (2000). Human cytomegalovirus pp28 (UL99) localizes to a cytoplasmic compartment which overlaps the endoplasmic reticulumgolgi- intermediate compartment. J. Virol. 74, 3842-3851. Sandri-Goldin, R. M. (1998). ICP27 mediates HSV RNA-export by shuttling through a leucine-rich nuclear export signal and binding viral intronless RNAs through an RGG motif. Genes Dev. 12, 868- 879. Sandri-Goldin, R.M. and Mendoza, G. E. (1992). A herpesvirus regulatory protein appears to act post-transcriptionally by affecting mRNA processing. Genes Dev. 6, 848-863. Sandri-Goldin, R. M. (2001). Nuclear export of herpes virus RNA. Curr. Top. Microbiol. Immunol. 259, 2-23. Sandri-Goldin, R. M. (2004). Viral regulation of mRNA-export. J. Virol. 78, 4389-4396. Sandri-Goldin, R. M. (2008). The many roles of the regulatory protein ICP27 during herpes simplex virus infection. Front. Biosci. 13, 5241-5256. Schierling, K., Stamminger, T., Mertens, T., and Winkler, M. (2004). Human cytomegalovirus tegument proteins ppUL82 (pp71) and ppUL35 interact and cooperatively activate the major immediate-early enhancer. J. Virol. 78, 9512-9523.

106 References

Sciortino, M. T., Suzuki, M., Taddeo, B., and Roizman, B. (2001). RNAs extracted from herpes simplex virus 1 virions: apparent selectivity of viral but not cellular RNAs packaged in virions. J. Virol. 75, 8105-8116. Sedlackova, L., Perkins, K. D., Meyer, J., Strain, A. K., Goldman, O., and Rice, S. A. (2010). Identification of an ICP27-response element in the coding region of a herpes simplex virus type 1 late gene. J. Virol. 84, 2707-2718. Segref, A., Sharma, K., Doye, V., Hellwig, A., Huber, J., Luhrmann, R., and Hurt, E. (1997). Mex67p, a novel factor for nuclear mRNA-export, binds to both poly(A)+ RNA and nuclear pores. EMBO J. 16, 3256-3271. Semmes, O. J., Chen, L., Sarisky, R. T., Gao, Z., Zhong, L., and Hayward, S. D. (1998). Mta has properties of an RNA-export protein and increases cytoplasmic accumulation of Epstein-Barr virus replication gene mRNA. J. Virol. 72, 9526-9534. Sergeant, A., Gruffat, H., and Manet, E. (2008). The Epstein-Barr virus (EBV) protein EB is an mRNA-export factor essential for virus production. Front. Biosci. 13, 3798-3813. Sinclair, J. (2008). Human cytomegalovirus: Latency and reactivation in the myeloid lineage. J. Clin. Virol. 41, 180-185. Sindre, H., Tjoonnfjord, G. E., Rollag, H., Ranneberg-Nilsen, T., Veiby, O. P., Beck, S., Degre, M. and Hestdal, K. (1996). Human cytomegalovirus suppression of and latency in early hematopoietic progenitor cells. Blood 88, 4526-4533. Sinzger, C., Grefte, A., Plachter, B., Gouw, A. S., The, T. H. and Jahn, G. (1995). Fibroblasts, epithelial cells, endothelial cells and smooth muscle cells are major targets of human cytomegalovirus infection in lung and gastrointestinal tissues. J. Gen. Virol. 76 (Pt 4), 741-750. Sinzger, C. and Jahn, G. (1996). Human cytomegalovirus cell tropism and pathogenesis. Intervirology 39, 302-319. Soliman, T. M., Sandri-Goldin, R. M., and Silverstein, S. J. (1997). Shuttling of the herpes simplex virus type 1 regulatory protein ICP27 between the nucleus and cytoplasm mediates the expression of late proteins. J. Virol. 71, 9188-9197. Song, B., Yeh, K. C., Liu, J., and Knipe, D. M. (2001). Herpes simplex virus gene products required for viral inhibition of expression of G1-phase functions. Virology 290, 320-328. Souki, S. K., Gershon, P. D., and Sandri-Goldin, R. M. (2009). Arginine methylation of the ICP27 RGG box regulates ICP27 export and is required for efficient herpes simplex virus 1 replication. J. Virol. 83, 5309-5320. Souki, S. K. and Sandri-Goldin, R. M. (2009). Arginine methylation of the ICP27 RGG box regulates the functional interactions of ICP27 with SRPK1 and Aly/REF during herpes simplex virus 1 infection. J. Virol. 83, 8970-8975. Spaete, R. R., Gehrz, R. C., and Landini, M. P. (1994). Human cytomegalovirus structural proteins. J. Gen. Virol. 75, 3287-3308. Speir, E., Huang, E. S., Modali, R., Leon, M. B., Shawl, F., Finkel, T., and Epstein, S. E. (1995). Interaction of human cytomegalovirus with p53: possible role in coronary restenosis. Scand. J. Infect. Dis. Suppl. 99, 78-81. Stagno, S., Brasfield, D. M., Brown, M. B., Cassell, G. H., Pifer, L. L., Whitley, R. J., and Tiller, R. E. (1981). Infant pneumonitis associated with cytomegalovirus, Chlamydia, Pneumocystis, and Ureaplasma: a prospective study. Pediatrics 68, 322-329. Stagno, S., Pass, R. F., Cloud, G., Britt, W. J., Henderson, R. E., Walton, P. D., Veren, D. A., Page, F., and Alford, C. A. (1986). Primary cytomegalovirus infection in pregnancy. Incidence, transmission to fetus, and clinical outcome. JAMA 256, 1904-1908. Stamminger, T., Gstaiger, M., Weinzierl, K., Lorz, K., Winkler, M., and Schaffner, W. (2002). Open reading frame UL26 of human cytomegalovirus encodes a novel tegument protein that contains a strong transcriptional activation domain. J. Virol. 76, 4836-4847. Strasser, K., Masuda, S., Mason, P., Pfannstiel, J., Oppizzi, M., Rodriguez-Navarro, S., Rondon, A. G., Aguilera, A., Struhl, K., Reed, R., and Hurt, E. (2002). TREX is a conserved complex coupling transcription with messenger RNA-export. Nature 417, 304-308.

107 References

Strasser, K. and Hurt, E. (2000). Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA-export. EMBO J. 19, 410-420. Strasser, K. and Hurt, E. (2001). Splicing factor Sub2p is required for nuclear mRNA-export through its interaction with Yra1p. Nature 413, 648-652. Stutz, F., Bachi, A., Doerks, T., Braun, I. C., Seraphin, B., Wilm, M., Bork, P., and Izaurralde, E. (2000). REF, an evolutionary conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA 6, 638-650. Taylor, H. P. and Cooper, N. R. (1990). The human cytomegalovirus receptor on fibroblasts is a 30- kilodalton membrane protein. J. Virol. 64, 2484-2490. Tischer, B. K., von Einem, J., Kaufer, B., and Osterrieder, N. (2006). Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40, 191-197. Thomas, S. L., Oft, M., Jaksche, H., Casari, G., Heger, P., Dobrovnik, M., Bevec, D., and Hauber, J. (1998). Functional analysis of the human immunodeficiency virus type 1 Rev protein oligomerization interface. J. Virol. 72, 2935-2944. Thomas, M. (2005). Funktionelle Charakterisierung der Interaktion zwischen dem Transaktivatorprotein pUL69 des humanen Cytomegalovirus und den zellullären mRNA Exportfaktoren UAP56/URH49. Diploma thesis at the University Erlangen-Nuremberg. Thomas, M., Rechter, S., Milbradt, J., Auerochs, S., Mueller, R., Stamminger, T., and Marschall, M. (2009). Cytomegaloviral protein kinase pUL97 interacts with the nuclear mRNA-export factor pUL69 to modulate its intranuclear localization and activity. J. Gen. Virol. 90, 567-578. Thomas, M., Lischka, P., Mueller, R., and Stamminger T. (2011). The cellular DExD/H-box RNA- helicases UAP56 and URH49 exhibit CRM-1 independent nucleocytoplasmic shuttling activity. PLoS One 6, epub:22671. Todaro, G. J. and Green, H. (1963). Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J. Cell Biol. 17, 299-313. Tooze, J., Hollinshead, M., Reis, B., Radsak, K., and Kern, H. (1993). Progeny vaccinia and human cytomegalovirus particles utilise early endosomal cisternae for their envelopes. Eur. J. Cell Biol. 60, 163-178. Toth, Z., Lischka, P., and Stamminger, T. (2006). RNA-binding of the human cytomegalovirus transactivator protein UL69, mediated by arginine-rich motifs, is not required for nuclear export of unspliced RNA. Nucleic Acids Res. 34, 1237-1249. Toth, Z. and Stamminger, T. (2008). The human cytomegalovirus regulatory protein UL69 and its effect on mRNA-export. Front Biosci. 13, 2939-2949. Trommer, E. (2001). Funktionelle Analyse des nukleären Exportsignals des Regulatorproteins pUL69 des humanen Cytomegalovirus. MD thesis at the University Erlangen-Nuremberg. Tsutsui, Y., Kosugi, I., and Kawasaki, H. (2005). Neuropathogenesis in cytomegalovirus infection: indication of the mechanisms using mouse models. Rev. Med. Virol. 15, 327-345. Vancikova, Z. and Dvorak, P. (2001). Cytomegalovirus infection in immunocompetent and immunocompromised individuals-a review. Curr. Drug Targets. Immune Endocr. Metabol. Disord. 1, 179-187. van Zeijl, M., Fairhurst, J., Baum, E. Z., Sun, L., and Jones, T. R. (1997). The human cytomegalovirus UL97 protein is phosphorylated and a component of virions. Virology 231, 72-80. Waldo, F. B., Britt, W. J., Tomana, M., Julian, B. A., and Mestecky, J. (1989). Nonspecific mesangial staining with antibodies against cytomegalovirus in immunoglobulin-A nephropathy. Lancet 1, 129-131. Warming, S., Costantino, N., Court, D. L., Jenkins, N. A., and Copeland, N. G. (2005). Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 33, epub:36. Wathen, M. W. and Stinski, M. F. (1982). Temporal patterns of human cytomegalovirus transcription: mapping the viral RNAs synthesized at immediate early, early, and late times after infection. J. Virol. 41, 462-477.

108 References

Wiebusch, L. and Hagemeier, C. (1999). Human cytomegalovirus 86-kilodalton IE2 protein blocks cell cycle progression in G(1). J. Virol. 73, 9274-9283. Williams, B. J., Boyne, J. R., Goodwin, D. J., Roaden, L., Hautbergue, G. M., Wilson, S. A., and Whitehouse, A. (2005). The prototype gamma-2 herpesvirus nucleocytoplasmic shuttling protein, ORF 57, transports viral RNA through the cellular mRNA-export pathway. Biochem. J. 387, 295-308. Winkler, M., Rice, S. A., and Stamminger, T. (1994). UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression. J. Virol. 68, 3943-3954. Winkler, M., Schmolke, S., Plachter, B., and Stamminger, T. (1995). UL69 of HCMV, a homolog of the HSV ICP27, is contained within the tegument of virions and activates the major IE enhancer of HCMV in synergy with the tegument protein pp71. Scand. J. Infect. Dis. Suppl. 99, 8-9. Winkler, M. and Stamminger, T. (1996). A specific subform of the human cytomegalovirus transactivator protein pUL69 is contained within the tegument of virus particles. J. Virol. 70, 8984- 8987. Winkler, M., aus dem Siepen, T., and Stamminger, T. (2000). Functional interaction between pleiotropic transactivator pUL69 of human cytomegalovirus and the human homolog of yeast chromatin regulatory protein SPT6. J. Virol. 74, 8053-8064. Wright, H. T., Goodheart, C. R. and Lielausis, A. (1964). Human Cytomegalovirus. Morphology by negative staining. Virology 23, 429-424. Zenklusen, D., Vinciguerra, P., Strahm, Y., and Stutz, F. (2001). The yeast hnRNP-Like proteins Yra1p and Yra2p participate in mRNA-export through interaction with Mex67p. Mol. Cell Biol. 21, 4219-4232. Zenklusen, D., Vinciguerra, P., Wyss, J. C., and Stutz, F. (2002). Stable mRNP formation and export require cotranscriptional recruitment of the mRNA-export factors Yra1p and Sub2p by Hpr1p. Mol. Cell Biol. 22, 8241-8253. Zagursky, R. J., Baumeister, K., Lomax, N., and Berman, M. L. (1985). Rapid and easy sequencing of large linear double-stranded and supercoiled plasmid DNA. Gene Anal. Tech. 2, 89-94. Zhang, Y., Buchholz, F., Muyrers, J.P., and Stewart, A. F. (1998). A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123-128. Zhi, Y., Sciabica, K. S., and Sandri-Goldin, R. M. (1999). Self-interaction of the herpes simplex virus type 1 regulatory protein ICP27. Virology 257, 341-351. Zielke, B., Thomas, M., Giede-Jeppe, A., Mueller, R., and Stamminger, T. (2011). Characterization of the betaherpesviral pUL69-protein family reveals binding of the cellular mRNA-export factor UAP56 as a prerequisite for stimulation of nuclear mRNA-export and for efficient viral replication. J. Virol. 85, 1804-1819.

109 Appendix

I Appendix

Publication & Presentations

Publication

Zielke B., Thomas, M., Giede-Jeppe, A., Mueller, R., and Stamminger, T. (2011). Characterization of the betaherpesviral pUL69-protein family reveals binding of the cellular mRNA-export factor UAP56 as a prerequisite for stimulation of nuclear mRNA-export and for efficient viral replication. J. Virol. 85, 1804-1819.

Zielke, B., Wagenknecht, N., Pfeifer, C., Zielke, K., Thomas, M., and Stamminger, T. Transfer of the UAP56-interaction motif of human cytomegalovirus pUL69 to its murine cytomegalovirus homolog converts the protein into a functional mRNA-export factor that can substitute for pUL69 during viral infection. Submitted.

Presentations at Scientific Congresses

Oral Presentations

Identification of RNAs that are targeted by the HCMV mRNA-export factor pUL69 during infection. 13th International CMV/Betaherpesvirus Workshop, Nuremberg, 14.-19. May 2011.

Identification of UAP56-interaction as a conserved feature of cytomegaloviral mRNA- export that is required for efficient replication of HCMV. 35th International Herpesvirus Workshop, Salt Lake City, 24.-29. July 2010.

Comparative analyses of putative mRNA-export factors encoded by the UL69- homologous genes of betaherpesvirinae. Bayreuther Strukturtage, Thurnau, 21.-23. July 2010.

Comparative analyses of putative mRNA-export factors encoded by the UL69- homologous genes of betaherpesvirinae. Bayreuther Strukturtage, Thurnau, 22.-24. July 2009.

Poster Presentations

Identification of response elements within viral and cellular mRNAs that are targeted by the HCMV-encoded mRNA-export factor pUL69 during infection. 22nd Annual Meeting of the Society for Virology (GfV), Essen, 14.-17. March 2012.

Transfer of the UAP56-interaction motif of HCMV pUL69 to its MCMV homolog pM69 converts the protein into a functional mRNA-export factor. 22nd Annual Meeting of the Society for Virology (GfV), Essen, 14.-17. March 2012.

Establishment of an RNA-immunoprecipitation assay to identify RNAs that are targeted by the mRNA-export factor pUL69 during HCMV-infection. 36th International Herpesvirus Workshop, Gdansk, 24.-28. July 2011.

Identification of RNAs that are targeted by the HCMV mRNA-export factor pUL69 during infection. 13th International CMV/Betaherpesvirus Workshop, Nuremberg, 14.-19. May 2011.

110 Appendix

Identification of RNAs that are targeted by the HCMV mRNA-export factor pUL69 during infection. 21st Annual Meeting of the Society for Virology (GfV), Freiburg, 23.-26. March 2011.

Comparative analyses of putative mRNA-export factors encoded by the UL69- homologous genes of betaherpesvirinae. Bayreuther Strukturtage, Thurnau, 21.-23. July 2010.

Comparative analyses of putative mRNA-export factors encoded by the UL69- homologous genes of betaherpesvirinae. 4th European Congress of Virology, Lake Como, 7.-11. April 2010. pUL69-homologous proteins of various betaherpesviruses share functional characteristics with their HCMV counterpart. 34th International Herpesvirus Workshop, Ithaca, 25.-31. July 2009.

Comparative analyses of putative mRNA-export factors encoded by the UL69- homologous genes of betaherpesvirinae. Bayreuther Strukturtage, Thurnau, 22.-24. July 2009. pUL69-homologous proteins of various betaherpesviruses share functional characteristics with their HCMV counterpart. 20th Annual Meeting of the Society for Virology (GfV), Leipzig, 18.-21. March 2009.

Internal Presentations

Oral Presentations

Characterization of the betaherpesviral pUL69-protein family identifies UAP56- interaction as a prerequisite for stimulation of nuclear mRNA-export and efficient viral replication. Seminar: ’Methods in Molecular Virology’, Institute for Clinical and Molecular Virology, Erlangen, 25. October 2010.

Comparative analyses of putative mRNA-export factors encoded by the UL69- homologous genes of betaherpesvirinae. Seminar: ’Methods in Molecular Virology’, Institute for Clinical and Molecular Virology, Erlangen, 27. April 2009.

111 Appendix

Curriculum Vitae

Personal data Name Barbara Zielke Date of Birth 16. June 1983 Place of Birth Nuremberg, Germany

Education 1989 – 1993 Primary school, Pestalozzi Grundschule, Oberasbach, Germany 1993 – 2000 Secondary school, Dietrich-Bonhoeffer-Gymnasium, Oberasbach, Germany 2000 – 2001 Exchange student at Westchester Academy, High Point, North Carolina, USA 2001 – 2003 Secondary school, Dietrich-Bonhoeffer-Gymnasium, Oberasbach, Germany Higher education entrance qualification (Abitur)

Higher education 2003 – 2008 Friedrich-Alexander-University Erlangen-Nuremberg, Germany Studies in Molecular Medicine 2005 Intermediate examination 2007 Final examination, Master Degree (Dipl.-Mol.Med.) Major subject: virology Minor subjects: pharmacology, molecular biology, neurosciences 2007 – 2008 Diploma thesis: Cloining and expression analysis of betaherpesvirus genes with homology to the UL69 transactivatior of the human cytomegalovirus

Graduation 2008 – 2012 PhD study at the Friedrich-Alexander-University Erlangen-Nuremberg, Institute of Clinical and Molecular Virology PhD thesis: The HCMV-encoded mRNA-export factor pUL69 - functional conservation within the Betaherpesvirinae and identification of mRNA-targets during infection Advisors: Prof. Dr. T. Stamminger, Institute for Clinical and Molecular Virology, Faculty of Medicine, Erlangen, Germany Prof. Dr. A. Burkovski, Division of Microbiology, Faculty of Natural Sciences, Erlangen, Germany Financial support by the BioMedTec International Graduate School of Science (BIGSS) of the Elitenetzwerk Bayern (ENB) and the Interdisziplinäres Zentrum für Klinisch Forschung, Erlangen (IZKF).

112 Appendix

Acknowledgements

I would like to acknowledge Prof. Dr. Bernhard Fleckenstein for giving me the opportunity to perform my PhD-thesis at the Institute for Clinical and Molecular Virology, University Hospital Erlangen.

I wish to thank Prof Dr. Andreas Burkovski who kindly agreed to supervise and review my PhD-thesis for the Faculty of Natural Sciences, Friedrich-Alexander-University Erlangen- Nuremberg.

I would like to express my sincere thanks to my advisor, Prof. Dr. Thomas Stamminger, for offering me the great opportunity to work on this project and for providing me with invaluable advice and guidance as well as with constructive feedback during the years.

I am very grateful to Prof. Dr. Robert Slany (Faculty of Natural Sciences, Friedrich- Alexander-University Erlangen-Nuremberg) and to Prof. Dr. Jutta Eichler (Faculty of Natural Sciences, Friedrich-Alexander-University Erlangen-Nuremberg) for taking the time as examiners.

I would like to extend my thanks to the elite graduate school BIGSS of the Elitenetzwerk Bayern (ENB) and the Interdisziplinäres Zentrum für Klinische Forschung, Erlangen (IZKF) for financial support.

Special thanks to all my colleagues of the Stamminger and Marschall lab: it was a great experience to work with you all. Thank you for the friendly atmosphere, for all the help, fun and valuable discussions. I especially thank my “Spange”-co-workers, Marco and Nadine: doing “research” with you was hilarious, frustrating, constructive, manic, supportive, and overwhelming. To sum it up – a HUGE experience I would never want to miss.

My parents receive immense appreciation for their continous support and unconditional love regardless whether I fail or succeed. The deepest words of thankfulness to my twin sister – I hear everything even if you don't say a thing. Finally, lots of thanks to my boyfriend – my personal psychiatrist – for your clueless confidence in me…I know you'll catch me whenever I fall. VIP.

113