DOCSLIB.ORG

PCR with Deoxyinosine-Containing Primers Using DNA Polymerases with Proofreading Activity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PCR with Deoxyinosine-Containing Primers Using DNA Polymerases with Proofreading Activity Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press EEIIIIIII Technical Tips As the application of PCR has expanded, PCR with more amplified products have been used sense primer (5'-93') .................................... Deoxyinosine- for cloning and mutagenesis. Although Mea-922 ACTATTAAGTTTGGGATAGAAACTA Taq polymerase (from eubacterium Ther- containing mus aquaticus) is the most convenient and intensively studied enzyme to antisense primer (5'-93') Primers Using .................................... date, one of its drawbacks is a relatively Mea-ll05 CTCCTACTCCCATGGCATAGCTCCA DNA Polymerases high misincorporation (error) rate .................................... (- 1 x 10- s), which may be problematic Mea-l105M CTCCTACTCCCATGGCATAACTCCA GG A C A with Proofreading in some applications. Recently several G T DNA polymerases with 3'--~ 5' exonu- .................................... Activity Mea-lll0I CTCCTACTCCCATGGCATAICTCCA clease (proofreading) activity have be- Mea-lll6I CTCCTACTCCCATIGCATAACTCCA come commercially available, namely Mea-l125I CTCCIACTCCCATGGCATAGCTCCA Deep Vent (from archaebacterium Pyro- FIGURE 1 Primers used in this study. coccus sp.), Pfu (from archaebacterium Hiroshi Fujiwara, 1'2 Keiko Pyrococcus furiosus), and U1Tma DNA Fujiwara, 1'2 and Ken polymerases (from eubacterium Thermo- Hashimoto ~ toga maritima). They could yield lower clef II thermal cycler (Coy Laboratory misincorporation rates (-2• -6) and Products Inc., Ann Arbor, MI) with a 50- 1Department of Dermatology, Wayne greater stability at high temperature, ac- i~l mixture of every combination of the State University, Detroit, Michigan cording to the manufacturers' specifica- following conditions: annealing for 1 48201; 2Department of Dermatology, tion. min, from 40~ to 75~ in increments of Niigata University, Niigata, Japan Degenerate primers with mixed bases 5~ extension for 1 rain at 75~ dena- have been used in many applications, turing for 30 sec at 95~ MgCl 2 at 1, 2, or such as identification of members of 3 mM; dNTPs at 50, 100, or 200 ~M each. gene families, (1> and simultaneous de- Primers (1 I~M of each) and 1.5 units of tection of viruses with conserved ge- UITma DNA polyymerase (Perkin-Elmer nomic sequences. (2~ Substitution of a Corp., Norwalk, CT) were used. In the mixed-base position with deoxyinosine first cycle, both denaturation and an- (dI) was reported to make the amplifica- nealing with lengthened to 5 rain, and tion more effective. (3> Although we tried the last extension step was carried out to identify paramyxovirus RNA in lupus for 10 min. A control amplification was erythematosus tissues with degenerate performed with Taq Polymerase (Pro- primers, we were able to amplify the se- mega, Madison, WI). To compare exonu- quence with Taq polymerase but not clease effect, recombinant Pfu DNA poly- with Pfu or Deep Vent polymerases. In merase (Stratagene, La Jolla, CA) and this report we present a successful ampli- Deep Vent DNA polymerase (New En- fication of a viral sequence with primers gland Biolabs, Inc., Beverly, MA), both containing dI in various positions, using Exo + and Exo- forms, were used under U1Tma DNA polymerase. comparable conditions. Immediately af- ter the amplification, 5 i~l of each sample was run on a 2% agarose gel, electro- MATERIALS AND METHODS Viral RNA was extracted from the super- natant of measles virus culture (Edmon- ston strain, American Type Culture Col- lection, Rockville, MD) with guanidium thiocyanate. (4~ The RNA was reverse transcribed with SuperScript II RNase H- Reverse Transcriptase (GIBCO BRL, Gaithersburg, MD) with random prim- ers, and cDNA from -1 ng of RNA was used as a template for amplification. The sense primer was positioned at codons 922-946 of measles NP gene (GenBank accession number K01711), and the an- FIGURE 2 Measles virus amplification with tisense primer at codons 1105-1129. Taq or UITma. (Lane M) 123-bp DNA ladder; Five antisense primers were prepared to (lanes i-5) Taq; (lanes 6-10) U1Tma; (lanes compare the effect of mixed bases or po- 1,6) Mea-1105 for antisense primer; (lanes sition of dI (Fig. 1). Forty cycles of hot- 2, 7) Mea-1105M; (lanes 3,8) Mea-1110I; (lanes start PCR were performed in a TempCy- 4,9) Mea-1120I; (lanes 5,10) Mea-1125I. 4:239-2409 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/95 $5.00 PCR Methods and Applications 239 Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Technical was recently published, and the incom- 5. Knittel, T. and D. Picard. 1993. PCR with patibility of the proofreading enzyme degenerate primers containing deoxyi- and dI was suggested. (s) Here, we dem- nosine fails with Pfu DNA polymerase. onstrated that U1Tma was the only Exo § PCR Methods Applic. 2: 346-347. polymerase that was used successfully 6. Gregoire, L., M. Arella, J. Campione-Pic- cardo, and W.D. Lancaster. 1989. Ampli- with degenerate primers. The position of fication of human papilloma virus DNA dI in the primer did not affect the result, sequences by using conserved primers. J. and when we incorporated up to seven Clin. Biol. 27: 2660-2665. dI in papilloma virus primers, (6) U1Tma, 7. Finckh, U. 1992. Optimization strategies. but not Pfu or Deep Vent, amplified an In PCR: Clinical diagnostics and research FIGURE 3 With Pfu (Exo + or Exo-) (Lane M) 850 bp sequence as efficiently as Taq (H. (ed. A. Rolfs, I. Schuller, U. Finckh, and I. 123-bp DNA ladder; (lanes 1-5) Exo + Pfu; Fujiwara, K. Fujiwara, and K. Hashimoto, Weber-Rolfs), pp. 22--23, Springer-Verlag, (lanes 6-10) Exo- Pfu; (lanes 1,6) Mea-1105 unpubl.). According to the manufac- Berlin, Germany. for antisense primer; (lanes 2,7) Mea-1105M; turer, U1Tma was modified to reduce its 8. Keohavong, P., L. Ling, C. Dias, and W.G. Thilly. 1993. Predominant mutations in- (lanes 3,8) Mea-1110I; Lanes 4,9) Mea-1116I; 3'---~ 5' exonuclease activity relative to duced by the Thermococcus litoralis, Vent (lanes 5,10) Mea-1125I. native DNA polymerase. Although the DNA Polymerase during DNA amplifica- exonuclease activity is not the only fac- tion in vitro. PCR Methods Applic. 2: 288- tor that determines compatibility, as we 292. phoresed with ethidium bromide, and found with Pfu, the reduction of the ex- 9. Kwok, S., S.-Y. Chang, J.J. Sninsky, and A. visualized on a UV illuminator. onuclease activity could, at least par- Wang. 1994. A guide to the design and tially, contribute to successful amplifica- use of mismatched and degenerate prim- tion, as shown with Exo- Deep Vent. In ers. PCR Methods Applic. 3: $39-$47. RESULTS AND DISCUSSION the case of Pfu it is possible that the poly- With both U1Tma and Taq polymerases, merase activity could not cross a dI on Received June 21, 1994; accepted in expected bands of 208 bp were obtained the template strand. revised form December 22, 1994. with every combination of primers, re- It is still necessary to determine opti- gardless of mixed bases or dI (Fig. 2). mal PCR conditions empirically. (7) The The most effective amplification was choice of DNA polymerase should be achieved at the annealing temperature made carefully, as each enzyme has its of 55~ with both U1Tma and Taq. In characteristic misincorporation, (8) and if contrast, with Pfu (Exo § or Exo-) poly- one uses a prooofreading enzyme, care- merase we obtained positive results with ful optimization is required. (9) Although the primer with mixed bases, Mea- the specifications of polymerases look 1105M, but not with the primers con- similar on data sheets, one needs to taining dI, Mea-1110I, 1116I, 1125I (Fig. choose a polymerase carefully for the 3). Deep Vent polymerase (Exo +) specific needs of the application. worked only with the nondegenerate primer, Mea-1105. Exo- Deep Vent REFERENCES could amplify measles virus sequence with any of the primers (Fig. 4). 1. Compton, T. 1990. Degenerate primers The failure of Pfu polymerase to am- for DNA amplification. In PCR protocols: A guide to methods and applications (ed. M.A. plify DNA with primers containing dI Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White), pp. 39-45. Academic Press, San Diego, CA. 2. Ting, Y. and M.M. Manos. 1990. Detec- tion and typing of genital human papil- lomaviruses. In PCR protocols: A guide to methods and applications (ed. M.A. Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White), pp. 356-367. Academic Press, San Diego, CA. 3. Knoth, K., S. Roberds, D. Poteet, and M. Tamkun. 1988. Highly degenerate, inos- ine-containing primers specifically am- plify rare cDNA using the polymerase FIGURE 4 With Deep Vent (Exo + or Exo-). chain reaction. Nucleic Acids Res. (Lane M) 123-bp DNA ladder; (lanes 1-5) 16: 10932. Exo § Deep Vent; (lanes 6-10) Exo- Deep 4. Chomczynski, P. and N. Sacchi. 1987. Sin- Vent; (lanes 1,6) Mea-1105 for antisense gle-step method of RNA isolation by acid primer; (lanes 2,7) Mea-1105M; (lanes 3,8) guanidium thiocyanate-phenol-chloro- Mea-1110I; (lanes 4,9) Mea-1116I; (lanes 5,I0) form extraction. Anal. Biochem. 162: 156- Mea-1125I. 159. 240 PCR Methods and Applications Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press PCR with deoxyinosine-containing primers using DNA polymerases with proofreading activity. H Fujiwara, K Fujiwara and K Hashimoto Genome Res. 1995 4: 239-240 License Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here. To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions Copyright © Cold Spring Harbor Laboratory Press.
Load more

Recommended publications
  • RT-PCR Protocol Utilizing RT-PCR
    Protocol TD-P Revision 1.0 Creation Date: 2/18/2019 Revision Date: 4/24/2019 Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Utilizing RT-PCR Kit Introduction Our RT-PCR Kit combines two powerful mixtures: i) 5x Master Mix and ii) Hot start Taq 2x master mix with a standard buffer for 2-step RT-PCR. The two mixtures require minimal handling during the reaction setup and offer consistent and robust RT-PCR reactions. First strand cDNA synthesis is achieved by using the 5x Master Mix, which contains Reverse Transcriptase, recombinant RNase inhibitor, dNTPs, an optimized buffer, MgCl2 and protein stabilizers. Reverse Transcriptase is a recombinant MMLV reverse transcriptase with reduced RNase H activity and increased thermostability. This kit also provides two optimized primers and nuclease-free water. An anchored Oligo-dT primer [d(T)23VN] forces the primer to anneal to the beginning of the polyA tail and the random hexamer primer mix provides random and consistent priming sites covering the entire RNA templates including both mRNAs and non- polyadenylated RNAs. In addition, this kit is highly efficient at producing full-length cDNA from long RNA templates at temperatures between 42-55°C. The amplification step features a high quality Hot Start Taq DNA Polymerase, which offers higher fidelity and better amplification in a master mix format. RT-PCR product can be generated up to 6 kb. Our RT-PCR Kit can be used for cDNA synthesis followed by gene expression data validation. The advantages of our RT-PCR Kit include robust and active cDNA synthesis at temperatures up to 55°C and high efficiency at producing full-length cDNA from as little as 50 pg of total RNA.
    [Show full text]
  • Pfu DNA Polymerase Deoxynucleoside-Triphosphate: DNA Deoxynucleotidyl-Transferase (DNA-Directed); EC 2.7.7.7
    Version 060918 G:\products\productflyer\pcr\polymerasen\proof\descr_m3004_pfu_en.docx ENAXXON fon: +49(0)731 – 3608 123 X G fax: +49(0)731 – 3608 962 b i o s c i e n c e E-Mail: [email protected] Pfu DNA Polymerase Deoxynucleoside-triphosphate: DNA deoxynucleotidyl-transferase (DNA-directed); EC 2.7.7.7 Product Cat# Package size Pfu DNA Polymerase (proof-reading polymerase) M3004.0250 250 units Pfu DNA Polymerase (proof-reading polymerase) M3004.0500 2 x 250 units Pfu DNA Polymerase (proof-reading polymerase) M3004.1250 5 x 250 units Description The Genaxxon bioscience Pfu DNA Polymerase is a thermostable enzyme possessing 5‘-3‘ DNA polymerase and 3‘-5‘ proof reading exonuclease activities. It is isolated from the hyperthermophilic marine archae Pyroccocus furiosus (Pfu). The enzyme provides extremely high fidelity. Whereas the enzyme is not able to amplify long fragments as efficiently as the Genaxxon Taq polymerase because of its very high exonuclease activity. To overcome this restriction we recommend to use the Genaxxon ReproFast DNA Polymerase, which will provide a more robust synthesis of longer amplification products (Barnes et al. (1994) Proc. Natl. Acad. Sci., USA 91, 2216-2220). Use of the Genaxxon Pfu DNA Polymerase in amplification results in blunt-ended products, which is not recommended for cloning into T/A vectors. Concentration: 2.5 units/µL Unit definition: One unit is defined as the amount of enzyme that incorporates 10nmoles of dNTPs into acid-insoluble form in 30 min at 72°C under the assay conditions (25mM TAPS (tris-(hydroxymethyl)methyl-amino-propane-sulphonic acid, sodium salt) pH9.3 (at 25°C), 50mM KCl, 2mM MgCl2, 1mM ß-mercaptoethanol) and activated calf thymus DNA as substrate.
    [Show full text]
  • Biotechnology Explorer™
    Biotechnology Explorer™ GAPDH PCR Module Instruction Manual Catalog #166-5010EDU explorer.bio-rad.com This kit is shipped at 4°C. Open immediately upon arrival and store reagents at –20°C within 2 weeks. Duplication of any part of this document permitted for classroom use only. Please visit explorer.bio-rad.com to access our selection of language translations for Biotechnology Explorer kit curricula. For technical support, call your local Bio-Rad office or, in the U.S., call 1-800-424-6723 Dear Educator: Amplification as the path to visualization of DNA Molecular biologists are faced with the classic needle in a haystack problem. Often we must find a few copies of a piece of DNA that code for a given gene in the haystack of DNA comprising the entire genome. Even if there are a thousand copies of the same piece of DNA it is often still difficult to locate them. However by selectively amplifying only that specific piece of DNA we can separate it from the rest of the DNA and visualize it. Once we can visualize the DNA, we can use the tools of molecular biology to open the whole vista of genetic engineering. We can work with the DNA to make discoveries in science, agriculture, and medicine. The method used to amplify the DNA is the polymerase chain reaction (PCR). PCR is capable of repeatedly doubling the amount of specific DNA. After many PCR cycles a million-fold or billion-fold times as much DNA is generated. Because of the increasing use of PCR in science it is important to provide students with an understanding of the basic principles and applications of PCR.
    [Show full text]
  • The Heterodimeric Primase from the Euryarchaea Pyrococcus Abyssi: A
    Journal of Molecular Biology Archimer, archive institutionnelle de l’Ifremer Article in Press http://www.ifremer.fr/docelec/ Acceptation date : 5 October 2007 http://dx.doi.org/10.1016/j.jmb.2007.10.015 © 2007 Elsevier ailable on the publisher Web site The heterodimeric primase from the Euryarchaea Pyrococcus abyssi: a multifunctional enzyme for initiation and repair ? Magali Le Breton1, Ghislaine Henneke1, Cédric Norais2, Didier Flament1, Hannu Myllykallio2, Joël Querellou1 and Jean-Paul Raffin1,∗. 1. Ifremer, UMR6197, Laboratoire de Microbiologie des Environnements Extrêmes, BP 70, F-29280 blisher-authenticated version is av Plouzané, France. 2. Institut de Génétique et Microbiologie, UMR8621, Université Paris-sud, 91405 Orsay, France ∗Corresponding author: Jean Paul Raffin, Ifremer, Laboratoire de Microbiologie des Environnements Extrêmes, BP 70, 29280 Plouzané, France. Phone: 33(0)2 98 22 45 39 ; [email protected] Abstract: We report the characterization of the DNA primase complex of the hyperthermophilic archaeon Pyrococcus abyssi (Pab). The Pab DNA primase complex is composed of two proteins, Pabp41 and Pabp46, showing sequence similarities respectively to the p49 and p58 subunits of the eukaryotic polymerase α-primase complex. Both subunits were expressed, purified and characterized. The Pabp41 subunit alone had no RNA synthesis activity but could synthesize long (up to 3 kb) DNA strands. Addition of the Pabp46 subunit increased the rate of DNA synthesis but decreased the length of the DNA fragments synthesized and conferred RNA synthesis capability. Moreover, in our experimental conditions, Pab DNA primase had comparable affinities for ribo- and ccepted for publication following peer review. The definitive pu deoxyribonucleotides, and its activity was dependent on the presence of Mg2+ and Mn2+.
    [Show full text]
  • In Vitro and in Vivo Models Analyzing Von Hippel-Lindau Disease-Specific Mutations
    [CANCER RESEARCH 64, 8595–8603, December 1, 2004] In vitro and In vivo Models Analyzing von Hippel-Lindau Disease-Specific Mutations W. Kimryn Rathmell,1,3 Michele M. Hickey,1,2 Natalie A. Bezman,1 Christie A. Chmielecki,3 Natalie C. Carraway,3 and M. Celeste Simon1,2 1Abramson Family Cancer Research Institute and the Department of Cell and Molecular Biology, and 2Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, Pennsylvania; and 3Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina ABSTRACT transport and droplet formation (8, 9). Unregulated expression of the full complement of hypoxia response genes is surmised to contribute Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene much of the clinical and pathological phenotype of renal cell carci- cause tissue-specific tumors, with a striking genotype-phenotype correla- noma, which is characterized as a highly vascular, glycolytic, lipid- tion. Loss of VHL expression predisposes to hemangioblastoma and clear cell renal cell carcinoma, whereas specific point mutations predispose to rich tumor that can be associated with polycythemia (10, 11). Detailed pheochromocytoma, polycythemia, or combinations of hemangioblas- studies of the effects of VHL loss have identified the regulation of the toma, renal cell carcinoma, and/or pheochromocytoma. The VHL protein hypoxia response pathway via the proteasomal degradation of HIF1␣ (pVHL) has been implicated in many cellular activities including the and HIF2␣ as a major activity of the VHL protein (pVHL; refs. hypoxia response, cell cycle arrest, apoptosis, and extracellular matrix 12–15). The pVHL acts as the substrate receptor for an E3 ubiquitin Ϫ Ϫ remodeling.
    [Show full text]
  • High-Fidelity Amplification Using a Thermostable DNA Polymerase Isolated from P’~Ococcusfuriosus
    Gette, 108 (1991) 1-6 8 1991 Elsevier Science Publishers B.V. All rights reserved. 0378-l 119/91/SO3.50 GENE 06172 High-fidelity amplification using a thermostable DNA polymerase isolated from P’~OCOCCUSfuriosus (Polymerase chain reaction; mutation frequency; lack; proofreading; 3’40-5 exonuclease; recombinant DNA; archaebacteria) Kelly S. Lundberg”, Dan D. Shoemaker*, Michael W.W. Adamsb, Jay M. Short”, Joseph A. Serge* and Eric J. Mathur” “ Division of Research and Development, Stratagene, Inc., La Jolla, CA 92037 (U.S.A.), and h Centerfor Metalloen~~vme Studies, University of Georgia, Athens, GA 30602 (U.S.A.) Tel. (404/542-2060 Received by M. Salas: 16 May 1991 Revised/Accepted: 11 August/l3 August 1991 Received at publishers: 17 September 1991 -.-- SUMMARY A thermostable DNA polymerase which possesses an associated 3’-to-5’ exonuclease (proofreading) activity has been isolated from the hyperthermophilic archaebacterium, Pyrococcus furiosus (Pfu). To test its fidelity, we have utilized a genetic assay that directly measures DNA polymerase fidelity in vitro during the polymerase chain reaction (PCR). Our results indicate that PCR performed with the DNA polymerase purified from P. furiosus yields amplification products containing less than 10s.~ of the number of mutations obtained from similar amplifications performed with Tuq DNA polymerase. The PCR fidelity assay is based on the ampli~cation and cloning of lad, lac0 and IacZor gene sequences (IcrcIOZa) using either ffil or 7ii~irqDNA poIymerase. Certain mutations within the lucf gene inactivate the Lac repressor protein and permit the expression of /?Gal. When plated on a chromogenic substrate, these Lacl - mutants exhibit a blue-plaque phenotype.
    [Show full text]
  • Imperial Life Sciences
    PRICE LIST 2020/21 Genomics Reagents & Consumables Cell & Imaging Advanced Molecular Diagnostics Imperial Life Sciences One Company Complete Solutions + 91 124 4559 800 - 99 [email protected] Imperial life Sciences (P) Ltd Price list 2020-21 (consumables) M/S NEW ENGLAND BIOLABS INC U Price Rs. (2020- Part No Description - without units Unit Size 21) E6442L NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2 384 rxns 2,47,940.00 E6442S NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2 96 rxns 68,908.00 E7850L NEBNext rRNA Depletion Kit (Bacteria) 24 rxns 1,39,104.00 E7850S NEBNext rRNA Depletion Kit (Bacteria) 6 rxns 38,254.00 E7850X NEBNext rRNA Depletion Kit (Bacteria) 96 rxns 5,00,388.00 E7860L NEBNext rRNA Depletion Kit (Bacteria) with RNA Sample Purification Beads 24 rxns 1,44,900.00 E7860S NEBNext rRNA Depletion Kit (Bacteria) with RNA Sample Purification Beads 6 rxns 39,284.00 E7860X NEBNext rRNA Depletion Kit (Bacteria) with RNA Sample Purification Beads 96 rxns 5,21,640.00 M0460T T7 RNA Polymerase (High Concentration) 50,000 units 72,643.00 M0467S Salt-T4 DNA Ligase 20,000 units 8,243.00 M0467L Salt-T4 DNA Ligase 100,000 units 32,973.00 M0470T Hi-T7 RNA Polymerase (High Concentration) 50,000 units 87,584.00 M2622L Hi-T4 DNA Ligase 100,000 units 32,973.00 M2622S Hi-T4 DNA Ligase 20,000 units 8,243.00 R0739L BsmBI-v2 1,000 units 38,254.00 R0739S BsmBI-v2 200 units 9,402.00 B0201S T4 Polynucleotide Kinase Reaction Buffer 4.0 ml 3,091.00 B0202S T4 DNA Ligase Reaction Buffer
    [Show full text]
  • Pfu DNA Polymerase
    344PR-01 G-Biosciences, St Louis, MO. USA ♦ 1-800-628-7730 ♦ 1-314-991-6034 ♦ [email protected] A Geno Technology, Inc. (USA) brand name Pfu DNA Polymerase INTRODUCTION Pfu DNA polymerase, derived from the hyperthermophilic archae Pyrococcus furiosus, has superior thermostability and proofreading properties compared to other thermostable polymerase. Its molecular weight is 90 kD. It can amplify DNA target up to 2kb. The elongation velocity is 0.2~0.4kb/min (70~75°C). Pfu DNA polymerase possesses 3' to 5' exonuclease proofreading activity that enables the polymerase to correct nucleotide-misincorporation errors. This means that Pfu DNA polymerase-generated PCR fragments will have fewer errors than Taq-generated PCR inserts. Using Pfu DNA polymerase in your PCR reactions results in blunt-ended PCR products, which are ideal for cloning into blunt-ended vectors. Pfu DNA polymerase is superior for techniques that require high-fidelity DNA synthesis. ITEM(S) SUPPLIED Cat. # 786-816 Pfu DNA Polymerase (2.5U/µl) 500U 10X Pfu Buffer (Mg2+ plus) 2 x 1.4ml 6X Loading Buffer 1ml STORAGE CONDITIONS The kit is shipped at ambient temperature. Upon arrival, store at -20oC. Storage buffer is 20mM Tris.HCl (pH8.0), 100mM KCl, 3mM MgCl2, 1mM DTT, 0.1% Nonidet® P-40, 0.1% Tween® 20, 0.2mg/ml BSA, 50% (v/v) glycerol. 10X Pfu BUFFER 200mM Tris-HCl (pH8.8), 100mM KCl, 100mM (NH4)2SO4, 20mM MgSO4, 1% Triton® X-100 and 1mg/ml BSA. UNIT DEFINITION One unit (U) of Pfu polymerase is defined as the amount of enzyme needed to catalyze the incorporation of 10 nanomoles of deoxyribonucleotides into acid-insoluble material in 30 minutes at 70°C using herring sperm DNA as a substrate.
    [Show full text]
  • Saccharomyces Cerevisiae Aspartate Kinase Mechanism and Inhibition
    In compliance with the Canadian Privacy Legislation some supporting forms may have been removed from this dissertation. While these forms may be included in the document page count, their removal does not represent any loss of content from the dissertation. Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry FUNGAL ASPARTATE KINASE MECHANISM AND INHIBITION By DAVID C. BAREICH, B.Sc. A Thesis Submitted to the School of Graduate Studies in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy McMaster University © Copyright by David C. Bareich, June 2003 1 Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry FUNGAL ASPARTATE KINASE MECHANISM AND INHIBITION Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry DOCTOR OF PHILOSOPHY (2003) McMaster University (Biochemistry) Hamilton, Ontario TITLE: Saccharomyces cerevisiae aspartate kinase mechanism and inhibition AUTHOR: David Christopher Bareich B.Sc. (University of Waterloo) SUPERVISOR: Professor Gerard D. Wright NUMBER OF PAGES: xix, 181 11 Ph.D. Thesis - D. Bareich McMaster University - Department of Biochemistry ABSTRACT Aspartate kinase (AK) from Saccharomyces cerevisiae (AKsc) catalyzes the first step in the aspartate pathway responsible for biosynthesis of L-threonine, L-isoleucine, and L-methionine in fungi. Little was known about amino acids important for AKsc substrate binding and catalysis. Hypotheses about important amino acids were tested using site directed mutagenesis to substitute these amino acids with others having different properties. Steady state kinetic parameters and pH titrations of the variant enzymes showed AKsc-K18 and H292 to be important for binding and catalysis. Little was known about how the S. cerevisiae aspartate pathway kinases, AKsc and homoserine kinase (HSKsc), catalyze the transfer of the y-phosphate from adenosine triphosphate (ATP) to L-aspartate or L-homoserine, respectively.
    [Show full text]
  • Artificial Human Telomeres from DNA Nanocircle Templates
    Artificial human telomeres from DNA nanocircle templates Ulf M. Lindstro¨ m*, Ravi A. Chandrasekaran*, Lucian Orbai*, Sandra A. Helquist*, Gregory P. Miller*, Emin Oroudjev†, Helen G. Hansma†, and Eric T. Kool*‡ *Department of Chemistry, Stanford University, Stanford, CA 94305-5080; and †Department of Physics, University of California, Santa Barbara, CA 93106 Edited by Peter B. Dervan, California Institute of Technology, Pasadena, CA, and approved October 9, 2002 (received for review July 3, 2002) Human telomerase is a reverse-transcriptase enzyme that synthe- sizes the multikilobase repeating hexamer telomere sequence (TTAGGG)n at the ends of chromosomes. Here we describe a designed approach to mimicry of telomerase, in which synthetic DNA nanocircles act as essentially infinite catalytic templates for efficient synthesis of long telomeres by DNA polymerase enzymes. Results show that the combination of a nanocircle and a DNA polymerase gives a positive telomere-repeat amplification proto- col assay result for telomerase activity, and similar to the natural enzyme, it is inhibited by a known telomerase inhibitor. We show that artificial telomeres can be engineered on human chromo- somes by this approach. This strategy allows for the preparation of synthetic telomeres for biological and structural study of telomeres and proteins that interact with them, and it raises the possibility of telomere engineering in cells without expression of telomerase itself. Finally, the results provide direct physical support for a recently proposed rolling-circle mechanism for telomerase- independent telomere elongation. rolling-circle replication ͉ primer extension ͉ telomerase ͉ TRAP assay he telomerase enzyme synthesizes the multikilobase repeat- Ting hexamer telomere sequence (TTAGGG)n at the ends of chromosomes (1–3).
    [Show full text]
  • High-Level Expression, Purification, and Thermus Aquatlcus DNA
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press High-level Expression, Purification, and Enzymatic Characterization of Full-length Thermus aquatlcus DNA Polymerase and a Truncated Form Deficient in 5' to 3' Exonuclease Activity Frances C. Lawyer, 1 Susanne Stoffel, 1 Randall K. Saiki, 2 Sheng-Yung Chang, 3 Phoebe A. Landre, ~ Richard D. Abrarnson, 1 and David H. Gelfand 1 1Program in Core Research and Departments of 2Human Genetics and 3Infectious Disease, Roche Molecular Systems, Alameda, California 94501 The Thermus aquaticus DNA poly- life of 9 min at 97.5~ The Stoffel I in the native host is quite low (0.01- merase I (Taq Pol I) gene was cloned fragment has a half-life of 21 min at 0.02% of total protein). The cloning and into a plasmid expression vector that 97.5~ Taq Pol I contains a polymer- expression of full-length 94-kD Taq Pol I utilizes the strong bacteriophage ization-dependent 5' to 3' exonu- in E. coli under control of the E. coli lac PL promoter. A truncated form of Taq clease activity whereas the Stoffel promoter r or the tac promoter (7~ has Pol I was also constructed. The two fragment, deleted for the 5' to 3' ex- been reported. Because polymerase constructs made it possible to com- onuclease domain, does not possess yields in these constructs were low pare the full-length 832-amino-acid that activity. A comparison is made (-0.01% of total protein in our initial Taq Pol I and a deletion derivative among thermostable DNA poly- construct; see ref.
    [Show full text]
  • BIOTOOLS Pfu DNA POLYMERASE (1 U/Μl)
    WARRANTY Products are guaranteed to conform to the quality and content indicated on each vial and external labels during their shelf life. BIOTOOLS obligation and purchaser’s rights under this warranty are limited to the replacement by BIOTOOLS of any product that is shown defective in fabrication, and that must be returned to BIOTOOLS, freight prepaid, or at BIOTOOLS’ option, replacement of the purchasing price. Any complaint on damaged goods during transport must be directed to the handling or transport agent. Product for Research Use Only. This product must be used by qualified professionals only. It is the responsibility of the user to ascertain that a given product is adequate for a given application. Any product not fulfilling the specifications included in the product sheet will be replaced. This warranty limits our responsibility to the replacement of the product. No other warranties, of any kind, express or implied, including, without limitation, implicit warranties of commercialisation ability or adequacy for a given BIOTOOLS Pfu DNA POLYMERASE (1 U/l) purpose, are provided by BIOTOOLS. BIOTOOLS will not be held responsible for any direct, indirect, consequential or incidental damage resulting of the use, misuses, results of the use or inability to use any product. Produced by: REF. FORMAT CONTENT BIOTOOLS, Biotechnological & Medical Laboratories, S.A. have been evaluated and certified to accomplish ISO 9001:2000 requirements for the following activities: Research and development of biotechnology products and manufacture of biotechnology and in vitro products. Valle de Tobalina – 52 – Nave 39, 28021 Madrid – Spain BIOTOOLS Pfu DNA Polymerase (1 U/µl) 10.501 100 U © 2008 BIOTOOLS, Biotechnological & Medical Laboratories, S.A.
    [Show full text]