Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press EEIIIIIII Technical Tips As the application of PCR has expanded, PCR with more amplified products have been used sense primer (5'-93') .................................... Deoxyinosine- for cloning and mutagenesis. Although Mea-922 ACTATTAAGTTTGGGATAGAAACTA Taq polymerase (from eubacterium Ther- containing mus aquaticus) is the most convenient and intensively studied enzyme to antisense primer (5'-93') Primers Using .................................... date, one of its drawbacks is a relatively Mea-ll05 CTCCTACTCCCATGGCATAGCTCCA DNA Polymerases high misincorporation (error) rate .................................... (- 1 x 10- s), which may be problematic Mea-l105M CTCCTACTCCCATGGCATAACTCCA GG A C A with Proofreading in some applications. Recently several G T DNA polymerases with 3'--~ 5' exonu- .................................... Activity Mea-lll0I CTCCTACTCCCATGGCATAICTCCA clease (proofreading) activity have be- Mea-lll6I CTCCTACTCCCATIGCATAACTCCA come commercially available, namely Mea-l125I CTCCIACTCCCATGGCATAGCTCCA Deep Vent (from archaebacterium Pyro- FIGURE 1 Primers used in this study. coccus sp.), Pfu (from archaebacterium Hiroshi Fujiwara, 1'2 Keiko Pyrococcus furiosus), and U1Tma DNA Fujiwara, 1'2 and Ken polymerases (from eubacterium Thermo- Hashimoto ~ toga maritima). They could yield lower clef II thermal cycler (Coy Laboratory misincorporation rates (-2• -6) and Products Inc., Ann Arbor, MI) with a 50- 1Department of Dermatology, Wayne greater stability at high temperature, ac- i~l mixture of every combination of the State University, Detroit, Michigan cording to the manufacturers' specifica- following conditions: annealing for 1 48201; 2Department of Dermatology, tion. min, from 40~ to 75~ in increments of Niigata University, Niigata, Japan Degenerate primers with mixed bases 5~ extension for 1 rain at 75~ dena- have been used in many applications, turing for 30 sec at 95~ MgCl 2 at 1, 2, or such as identification of members of 3 mM; dNTPs at 50, 100, or 200 ~M each. gene families, (1> and simultaneous de- Primers (1 I~M of each) and 1.5 units of tection of viruses with conserved ge- UITma DNA polyymerase (Perkin-Elmer nomic sequences. (2~ Substitution of a Corp., Norwalk, CT) were used. In the mixed-base position with deoxyinosine first cycle, both denaturation and an- (dI) was reported to make the amplifica- nealing with lengthened to 5 rain, and tion more effective. (3> Although we tried the last extension step was carried out to identify paramyxovirus RNA in lupus for 10 min. A control amplification was erythematosus tissues with degenerate performed with Taq Polymerase (Pro- primers, we were able to amplify the se- mega, Madison, WI). To compare exonu- quence with Taq polymerase but not clease effect, recombinant Pfu DNA poly- with Pfu or Deep Vent polymerases. In merase (Stratagene, La Jolla, CA) and this report we present a successful ampli- Deep Vent DNA polymerase (New En- fication of a viral sequence with primers gland Biolabs, Inc., Beverly, MA), both containing dI in various positions, using Exo + and Exo- forms, were used under U1Tma DNA polymerase. comparable conditions. Immediately af- ter the amplification, 5 i~l of each sample was run on a 2% agarose gel, electro- MATERIALS AND METHODS Viral RNA was extracted from the super- natant of measles virus culture (Edmon- ston strain, American Type Culture Col- lection, Rockville, MD) with guanidium thiocyanate. (4~ The RNA was reverse transcribed with SuperScript II RNase H- Reverse Transcriptase (GIBCO BRL, Gaithersburg, MD) with random prim- ers, and cDNA from -1 ng of RNA was used as a template for amplification. The sense primer was positioned at codons 922-946 of measles NP gene (GenBank accession number K01711), and the an- FIGURE 2 Measles virus amplification with tisense primer at codons 1105-1129. Taq or UITma. (Lane M) 123-bp DNA ladder; Five antisense primers were prepared to (lanes i-5) Taq; (lanes 6-10) U1Tma; (lanes compare the effect of mixed bases or po- 1,6) Mea-1105 for antisense primer; (lanes sition of dI (Fig. 1). Forty cycles of hot- 2, 7) Mea-1105M; (lanes 3,8) Mea-1110I; (lanes start PCR were performed in a TempCy- 4,9) Mea-1120I; (lanes 5,10) Mea-1125I. 4:239-2409 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/95 $5.00 PCR Methods and Applications 239 Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Technical was recently published, and the incom- 5. Knittel, T. and D. Picard. 1993. PCR with patibility of the proofreading enzyme degenerate primers containing deoxyi- and dI was suggested. (s) Here, we dem- nosine fails with Pfu DNA polymerase. onstrated that U1Tma was the only Exo § PCR Methods Applic. 2: 346-347. polymerase that was used successfully 6. Gregoire, L., M. Arella, J. Campione-Pic- cardo, and W.D. Lancaster. 1989. Ampli- with degenerate primers. The position of fication of human papilloma virus DNA dI in the primer did not affect the result, sequences by using conserved primers. J. and when we incorporated up to seven Clin. Biol. 27: 2660-2665. dI in papilloma virus primers, (6) U1Tma, 7. Finckh, U. 1992. Optimization strategies. but not Pfu or Deep Vent, amplified an In PCR: Clinical diagnostics and research FIGURE 3 With Pfu (Exo + or Exo-) (Lane M) 850 bp sequence as efficiently as Taq (H. (ed. A. Rolfs, I. Schuller, U. Finckh, and I. 123-bp DNA ladder; (lanes 1-5) Exo + Pfu; Fujiwara, K. Fujiwara, and K. Hashimoto, Weber-Rolfs), pp. 22--23, Springer-Verlag, (lanes 6-10) Exo- Pfu; (lanes 1,6) Mea-1105 unpubl.). According to the manufac- Berlin, Germany. for antisense primer; (lanes 2,7) Mea-1105M; turer, U1Tma was modified to reduce its 8. Keohavong, P., L. Ling, C. Dias, and W.G. Thilly. 1993. Predominant mutations in- (lanes 3,8) Mea-1110I; Lanes 4,9) Mea-1116I; 3'---~ 5' exonuclease activity relative to duced by the Thermococcus litoralis, Vent (lanes 5,10) Mea-1125I. native DNA polymerase. Although the DNA Polymerase during DNA amplifica- exonuclease activity is not the only fac- tion in vitro. PCR Methods Applic. 2: 288- tor that determines compatibility, as we 292. phoresed with ethidium bromide, and found with Pfu, the reduction of the ex- 9. Kwok, S., S.-Y. Chang, J.J. Sninsky, and A. visualized on a UV illuminator. onuclease activity could, at least par- Wang. 1994. A guide to the design and tially, contribute to successful amplifica- use of mismatched and degenerate prim- tion, as shown with Exo- Deep Vent. In ers. PCR Methods Applic. 3: $39-$47. RESULTS AND DISCUSSION the case of Pfu it is possible that the poly- With both U1Tma and Taq polymerases, merase activity could not cross a dI on Received June 21, 1994; accepted in expected bands of 208 bp were obtained the template strand. revised form December 22, 1994. with every combination of primers, re- It is still necessary to determine opti- gardless of mixed bases or dI (Fig. 2). mal PCR conditions empirically. (7) The The most effective amplification was choice of DNA polymerase should be achieved at the annealing temperature made carefully, as each enzyme has its of 55~ with both U1Tma and Taq. In characteristic misincorporation, (8) and if contrast, with Pfu (Exo § or Exo-) poly- one uses a prooofreading enzyme, care- merase we obtained positive results with ful optimization is required. (9) Although the primer with mixed bases, Mea- the specifications of polymerases look 1105M, but not with the primers con- similar on data sheets, one needs to taining dI, Mea-1110I, 1116I, 1125I (Fig. choose a polymerase carefully for the 3). Deep Vent polymerase (Exo +) specific needs of the application. worked only with the nondegenerate primer, Mea-1105. Exo- Deep Vent REFERENCES could amplify measles virus sequence with any of the primers (Fig. 4). 1. Compton, T. 1990. Degenerate primers The failure of Pfu polymerase to am- for DNA amplification. In PCR protocols: A guide to methods and applications (ed. M.A. plify DNA with primers containing dI Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White), pp. 39-45. Academic Press, San Diego, CA. 2. Ting, Y. and M.M. Manos. 1990. Detec- tion and typing of genital human papil- lomaviruses. In PCR protocols: A guide to methods and applications (ed. M.A. Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White), pp. 356-367. Academic Press, San Diego, CA. 3. Knoth, K., S. Roberds, D. Poteet, and M. Tamkun. 1988. Highly degenerate, inos- ine-containing primers specifically am- plify rare cDNA using the polymerase FIGURE 4 With Deep Vent (Exo + or Exo-). chain reaction. Nucleic Acids Res. (Lane M) 123-bp DNA ladder; (lanes 1-5) 16: 10932. Exo § Deep Vent; (lanes 6-10) Exo- Deep 4. Chomczynski, P. and N. Sacchi. 1987. Sin- Vent; (lanes 1,6) Mea-1105 for antisense gle-step method of RNA isolation by acid primer; (lanes 2,7) Mea-1105M; (lanes 3,8) guanidium thiocyanate-phenol-chloro- Mea-1110I; (lanes 4,9) Mea-1116I; (lanes 5,I0) form extraction. Anal. Biochem. 162: 156- Mea-1125I. 159. 240 PCR Methods and Applications Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press PCR with deoxyinosine-containing primers using DNA polymerases with proofreading activity. H Fujiwara, K Fujiwara and K Hashimoto Genome Res. 1995 4: 239-240 License Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here. To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions Copyright © Cold Spring Harbor Laboratory Press.