DOCSLIB.ORG

Valencia Robertae, a New Killifish from Southern Greece (Cyprinodontiformes: Valenciidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Valencia Robertae, a New Killifish from Southern Greece (Cyprinodontiformes: Valenciidae) 289 Ichthyol. Explor. Freshwaters, Vol. 24, No. 4, pp. 289-298, 11 figs., April 2014 © 2014 by Verlag Dr. Friedrich Pfeil, München, Germany – ISSN 0936-9902 Valencia robertae, a new killifish from southern Greece (Cyprinodontiformes: Valenciidae) Jörg Freyhof*, Heiko Kärst** and Matthias Geiger* Valencia robertae, new species, from the lower Pinios in northern Peloponnese and Mornos Rivers in southern mainland of Greece is distinguished from V. letourneuxi and V. hispanica by having short lateral bars or vertically elongated small blotches along the midlateral body and an almost triangular anal fin in females, prominent lat- eral bars between the axial blotch and the caudal-fin base and a long anal fin reaching almost or to the first caudal-fin rays in males larger than 27 mm SL. It is also distinguished by 32 fixed, diagnostic nucleotide substitu- tions in the mtDNA COI barcode region. Introduction hof, 1997). Both species usually inhabit densely vegetated springs, slowly flowing streams and The killifish family Valenciidae is the only fish marshes close to the Mediterranean coast where family endemic to Europe and the Mediterranean they are often the victims of habitat modifications basin. Valencia is the only genus in Valenciidae (Kalogianni et al., 2010). Valencia species are also (Myers, 1928; Parenti, 1981), and two species are very sensitive to competition and predation by known: V. hispanica, the type species, (Valenci- alien Gambusia holbrooki, which has invaded al- ennes, 1846: 214) described from Catalonia, Spain, most all of their habitats (Bianco & Miller, 1989; and V. letourneuxi (Sauvage, 1880) described from Planelles & Reyna, 1996; Barbieri et al., 2000; Kerkyra Island [Corfu], Greece. Gomez Caruana Kalogianni et al. 2010). Therefore, both species et al. (1984) described an additional species from are of major conservation concern. Due to their Spain, Valencia lozanoi; Fernández-Delgado et al. continuing deteriorating conservation status, both (1986) identified it as an alien species of the new- have been included (as V. hispanica) in the Ap- world genus Fundulus. pendix II of the Bern Convention as endangered The ranges of the two currently valid Valencia and strictly protected species, and have been are largely disjunct. Valencia hispanica is endemic characterized as priority species for conservation to the central Mediterranean coast of Spain be- in Annex II of the European Union Habitats Direc- tween Tortosa and Cape San Antonio, and V. le- tive 92/43/EEC (Barbieri et al., 2002; Kalogianni tourneuxi is endemic to Western Greece and Al- et al. 2010). In 1996, both Valencia were assessed bania between Lake Butrint (Albania) and Alfios as Endangered by IUCN, and in 2005 reclassified River (Peloponnese) drainages (Kottelat & Frey- as Critically Endangered (Crivelli, 2006a-b). * Zoological Research Museum Alexander Koenig, Leibniz Institute for Animal Biodiversity, Adenauerallee 160, 53113 Bonn, Germany. E-mail: [email protected] ** Ludwig-Erhard-Strasse 18, 76571 Gaggenau, Germany. Ichthyol. Explor. Freshwaters, Vol. 24, No. 4 290 Valencia letourneuxi is further protected by Presi- projections. Methods for counts and measure- dential Decree No. 67/1981 of the Greek State ments follow Kottelat & Freyhof (2007). Standard (Barbieri et al., 2002) and has been recently listed length (SL) is measured from the tip of the upper among “The World’s 100 most threatened species” lip to the end of the hypural complex. The length (Baillie & Butcher, 2012). Due to the strict conserva- of the caudal peduncle is measured from behind tion legislations, special permissions are needed the base of the last anal-fin ray to the end of the to collect Valencia in the wild. As several popula- hypural complex, at mid-height of the caudal-fin tions are still declining (see Perdikaris et al., 2010 base. The last two branched rays articulating on for Greek Kalamas population) and many popula- a single pterygiophore in the dorsal and anal fins 1 tions seem to be small, collection should be limited are noted as “1 /2”. Numbers in parentheses after to a minimum and only for important reasons. a given count are numbers of individuals exam- Within an European initiative to generate ined with that count. The holotype is included in DNA barcode data for all freshwater fishes of the calculation of means and SD. Europe (www.fredie.eu), we received materials Abbreviations used: bp, base-pairs; SL, of V. hispanica from the tissue collection of the standard length; HL, lateral head length; CMK, National Museum of Natural Sciences in Madrid Collection of Maurice Kottelat, Cornol; FSJF, (I. Doadrio, pers. comm.). No tissues of V. letour- Fischsammlung J. Freyhof, Berlin; MNCN, Na- neuxi were available in collections, but at least tional Museum of Natural Sciences, Madrid; four captive populations of this species exist since ZFMK, Zoologisches Forschungsmuseum Alexan- before the mid-1990th in Europe (fom Corfu, der Koenig, Bonn. Pinios, Mornos and Lake Butrint). Furthermore, in 2011, JF, Maria Stoumboudi & Roberta Barbieri DNA extraction and PCR. Genomic DNA was caught one female V. letourneuxi (Fig. 9) in the extracted using Machery & Nagel NucleoSpin® lower Acheron, from which a fin could be taken. Tissue kits following the manufacturer’s protocol Sequencing the mitochondrial COI barcode region on an Eppendorf EpMotion® pipetting-roboter from the material mentioned above, revealed that with vacuum manifold. The standard vertebrate the Pinios and Mornos populations are geneti- DNA barcode region of COI (cytochrome c oxi- cally very distinct from the other three popula- dase subunit 1) was amplified using a M13 tailed tions examined. It had never been stated in any primer cocktail including FishF2_t1 (5' TG- of the above cited studies that two species might TAAAACGACGGCCAGTCGACTAAT- be involved in V. letourneuxi, as indicated by our CATAAAGATATCGGCAC), FishR2_t1 (5' CAG- molecular data. The aim of this study was to test GAAACAGCTATGACACTTCAGGGTGAC- whether the molecular groups of Albanian and CGAAGAATCAGAA), VF2_t1 (5' TGTAAAAC- Greek Valencia might indeed represent two spe- GACGGCCAGTCAACCAACCACAAAGACAT- cies. TGGCAC) and FR1d_t1 (5' CAGGAAACAGC- TATGACACCTCAGGGTGTCCGAARAAYCAR- AA) (Ivanova et al. 2007). Sequencing of the Material and methods ExoSAP-IT (USB) purified PCR product in both directions was conducted at Macrogen Europe All fish were preserved in 5 % formaldehyde and Laboratories with forward sequencing primer stored in 70 % ethanol. Measurements were made M13F (5' GTAAAACGACGGCCAGT) and reverse with dial caliper and recorded to 0.1 mm. All sequencing primer M13R-pUC (5' CAGGAAA- measurements are made point to point, never by CAGCTATGAC). Table 1. List of the 32 diagnostic nucleotide substitutions found in the 610 base pairs long mtDNA COI barcode region. Nucleotide position is given with reference to the complete mitochondrial genome of Oryzias latipes (GenBank accession number AP004421). 5596 5634 5637 5667 5679 5682 5718 5739 5745 5754 5769 5805 5808 5817 5847 5850 5883 5901 5908 5958 V. hispanica (5) TCCATGGTAGGTAGCAAACT V. letourneuxi (7) TCCATGCTAGGTAGCAAACT V. robertae (8) CTTGCATCGAACCATGTTTC Freyhof et al.: Valencia robertae 291 Molecular data analysis. Data processing and ing to or almost to the base of the caudal fin in sequence assembly was done in Geneious Pro individuals longer than 30 mm SL (vs. to middle (Biomatters 2013) and the Muscle algorithm (Ed- of caudal peduncle). gar, 2004) was used to create a DNA sequence Valencia robertae is distinguished from V. hispa- alignment. SpeciesIdentifier (Meier et al. 2006) nica by having a hyaline to bluish caudal fin (vs. was used to compute Kimura2-corrected dis- yellow to orange) with a bold black posterior tances (K2P), and screening for diagnostic nucle- margin in males (vs. reddish-brown). otide substitutions was performed manually from the resulting sequence alignment. Description. See Figures 1-4 for general appear- ance and Table 2 for morphometric data of holo- type and nine paratypes. Dorsal and ventral Valencia robertae, new species profiles straight or gently convex from jaws to (Figs. 1-5) dorsal- and anal-fin origins; concave or straight along caudal peduncle. Body slender, deeper than Holotype. ZFMK 59197, 38.6 mm SL; Greece: wide, compressed posteriorly. Body deepest at River Pinios south of Kavasilas, 37°52'16.4" N about anal-fin origin. Greatest body width at 21°15'53.6" E; from a captive population. pectoral-fin base. Jaws short, snout slightly point- ed. Caudal peduncle compressed laterally, 1.1-1.4 Paratype. ZFMK 59198-59206, 9, 28.6-42.5 mm (males), 1.4-1.7 (females) times longer than deep. SL; same data as holotype. A very small axillary lobe at base of pelvic fin. Pectoral fin rounded, posterior margin reach- Additional material. FSJF 3448, 2, 32.6-33.5 mm SL; ing anterior to vertical of pelvic-fin base. Pelvic-fin Greece: Central prov: Chiliadou Springs in Mornos origin distinctly in front of dorsal-fin origin. delta, 38°24' N 21°55' E; from a captive population. Pelvic fin short, tip reaching to anus in males, not Material used in the molecular genetic analysis: reaching to anus in females. Pelvic-fin bases very ZFMK 53006-53007 (GenBank accession numbers: KF767519, KF767509); ZFMK 53077-53080 (GenBank closely together, almost fused. Anus situated accession numbers: KF767514, KF767521, KF767513, directly in front of anal-fin origin. Urogenital KF767512); same data as holotype. – FSJF-DNA 2460; papillae slightly prolonged in females. In females, Greece: Central prov: Chiliadou Springs in Mornos anal fin almost triangular with almost straight delta, 38°24' N 21°55' E; from a captive population posterior margin, last ray reaching to slightly (GenBank accession numbers: KF767516, KF767524). behind middle of caudal peduncle. In males, anal fin elongated, reaching to or almost to base of Diagnosis. Valencia robertae is distinguished from caudal fin in individuals larger than 30 mm SL. V. letourneuxi (Figs. 8-11) by the presence in fe- Dorsal-fin origin above 2nd-4th branched anal-fin males of short lateral bars or small vertically ray. Dorsal fin roundish in females, reaching to elongated blotches along flanks (vs.
Load more

Recommended publications
  • Deterministic Shifts in Molecular Evolution Correlate with Convergence to Annualism in Killifishes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deterministic shifts in molecular evolution correlate with convergence to annualism in killifishes Andrew W. Thompson1,2, Amanda C. Black3, Yu Huang4,5,6 Qiong Shi4,5 Andrew I. Furness7, Ingo, Braasch1,2, Federico G. Hoffmann3, and Guillermo Ortí6 1Department of Integrative Biology, Michigan State University, East Lansing, Michigan 48823, USA. 2Ecology, Evolution & Behavior Program, Michigan State University, East Lansing, MI, USA. 3Department of Biochemistry, Molecular Biology, Entomology, & Plant Pathology, Mississippi State University, Starkville, MS 39759, USA. 4Shenzhen Key Lab of Marine Genomics, Guangdong Provincial Key Lab of Molecular Breeding in Marine Economic Animals, BGI Marine, Shenzhen 518083, China. 5BGI Education Center, University of Chinese Academy of Sciences, Shenzhen 518083, China. 6Department of Biological Sciences, The George Washington University, Washington, DC 20052, USA. 7Department of Biological and Marine Sciences, University of Hull, UK. Corresponding author: Andrew W. Thompson, [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: The repeated evolution of novel life histories correlating with ecological variables offer opportunities to test scenarios of convergence and determinism in genetic, developmental, and metabolic features. Here we leverage the diversity of aplocheiloid killifishes, a clade of teleost fishes that contains over 750 species on three continents.
    [Show full text]
  • The Mystery of the Banded Killifish Fundulus Diaphanus Population Explosion: Where Did They All Come From?
    The Mystery of the Banded KillifishFundulus ( diaphanus) Population Explosion: Where Did They All Come from? Philip W. Willink, Jeremy S. Tiemann, Joshua L. Sherwood, Eric R. Larson, Abe Otten, Brian Zimmerman 3 American Currents Vol. 44, No. 4 THE MYSTERY OF THE BANDED KILLIFISH FUNDULUS DIAPHANUS POPULATION EXPLOSION: WHERE DID THEY ALL COME FROM? Philip W. Willink, Jeremy S. Tiemann, Joshua L. Sherwood, La Grange Park, IL Illinois Natural History Survey Illinois Natural History Survey Eric R. Larson, Abe Otten, Brian Zimmerman University of Illinois at Scott Community The Ohio State University Urbana-Champaign College Stream and River Ecology Lab Banded Killifish Fundulus diaphanus are no strangers to NAN- and have not been seen since, they were only known from a hand- FAers. Over the past several years, there have been multiple arti- ful of inland lakes in the far northeastern corner the state (Fig. 1). cles in American Currents covering their distribution (Hatch 2015; Even there, population numbers were low. Schmidt 2016a, 2018; Olson and Schmidt 2018; Li 2019), stocking So it was with great excitement that in the early 2000s Illinois to restore populations (Bland 2013; Schmidt 2014), and appear- ichthyologists started to find more and more presumed Western ance in a hatchery (Schmidt 2016b). Their range extends from the Banded Killifish in Lake Michigan (Willink et al. 2018). They Canadian Maritime provinces south along the Atlantic coast to were even showing up in downtown Chicago (Willink 2011). It the Carolinas, as well as westward through the Great Lakes region was hoped that this range expansion was evidence of an uncom- to the upper Mississippi watershed.
    [Show full text]
  • Gene Expression After Freshwater Transfer in Gills and Opercular Epithelia of Killifish: Insight Into Divergent Mechanisms of Ion Transport Graham R
    The Journal of Experimental Biology 208, 2719-2729 2719 Published by The Company of Biologists 2005 doi:10.1242/jeb.01688 Gene expression after freshwater transfer in gills and opercular epithelia of killifish: insight into divergent mechanisms of ion transport Graham R. Scott1,*, James B. Claiborne2, Susan L. Edwards2,3, Patricia M. Schulte1 and Chris M. Wood4 1Department of Zoology, University of British Columbia, Vancouver BC, Canada V6T 1Z4, 2Department of Biology, Georgia Southern University, Statesboro, GA 30460-8042, USA, 3Department of Physiology and Pharmacology, James Cook University, Cairns, QLD 4879, Australia and 4Department of Biology, McMaster University, Hamilton ON, Canada L8S 4K1 *Author for correspondence (e-mail: [email protected]) Accepted 17 May 2005 Summary We have explored the molecular basis for differences in epithelium, NHE2 was not expressed; furthermore, physiological function between the gills and opercular Na+,K+-ATPase activity was unchanged after transfer to epithelium of the euryhaline killifish Fundulus freshwater, CA2 mRNA levels decreased, and NHE3 levels heteroclitus. These tissues are functionally similar in increased. Consistent with their functional similarities in seawater, but in freshwater the gills actively absorb Na+ seawater, killifish gills and opercular epithelium expressed – + + + + – but not Cl , whereas the opercular epithelium actively Na ,K -ATPase α1a, Na ,K ,2Cl cotransporter 1 absorbs Cl– but not Na+. These differences in freshwater (NKCC1), cystic fibrosis transmembrane conductance physiology are likely due to differences in absolute levels regulator (CFTR) Cl– channel and the signalling protein of gene expression (measured using real-time PCR), as 14-3-3a at similar absolute levels. Furthermore, NKCC1 several proteins important for Na+ transport, namely and CFTR were suppressed equally in each tissue after Na+,H+-exchanger 2 (NHE2), carbonic anhydrase 2 (CA2), freshwater transfer, and 14-3-3a mRNA increased in both.
    [Show full text]
  • Table 7: Species Changing IUCN Red List Status (2018-2019)
    IUCN Red List version 2019-3: Table 7 Last Updated: 10 December 2019 Table 7: Species changing IUCN Red List Status (2018-2019) Published listings of a species' status may change for a variety of reasons (genuine improvement or deterioration in status; new information being available that was not known at the time of the previous assessment; taxonomic changes; corrections to mistakes made in previous assessments, etc. To help Red List users interpret the changes between the Red List updates, a summary of species that have changed category between 2018 (IUCN Red List version 2018-2) and 2019 (IUCN Red List version 2019-3) and the reasons for these changes is provided in the table below. IUCN Red List Categories: EX - Extinct, EW - Extinct in the Wild, CR - Critically Endangered [CR(PE) - Critically Endangered (Possibly Extinct), CR(PEW) - Critically Endangered (Possibly Extinct in the Wild)], EN - Endangered, VU - Vulnerable, LR/cd - Lower Risk/conservation dependent, NT - Near Threatened (includes LR/nt - Lower Risk/near threatened), DD - Data Deficient, LC - Least Concern (includes LR/lc - Lower Risk, least concern). Reasons for change: G - Genuine status change (genuine improvement or deterioration in the species' status); N - Non-genuine status change (i.e., status changes due to new information, improved knowledge of the criteria, incorrect data used previously, taxonomic revision, etc.); E - Previous listing was an Error. IUCN Red List IUCN Red Reason for Red List Scientific name Common name (2018) List (2019) change version Category
    [Show full text]
  • The African Turquoise Killifish: a Model for Exploring Vertebrate Aging and Diseases in the Fast Lane
    Downloaded from symposium.cshlp.org on June 11, 2016 - Published by Cold Spring Harbor Laboratory Press The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane 1 1,2 ITAMAR HAREL AND ANNE BRUNET 1Department of Genetics, Stanford University, Stanford, California 94305 2Glenn Laboratories for the Biology of Aging at Stanford, Stanford, California 94305 Correspondence: [email protected] Why and how organisms age remains a mystery, and it defines one of the biggest challenges in biology. Aging is also the primary risk factor for many human pathologies, such as cancer, diabetes, cardiovascular diseases, and neurodegenerative diseases. Thus, manipulating the aging rate and potentially postponing the onset of these devastating diseases could have a tremendous impact on human health. Recent studies, relying primarily on nonvertebrate short-lived model systems, have shown the importance of both genetic and environmental factors in modulating the aging rate. However, relatively little is known about aging in vertebrates or what processes may be unique and specific to these complex organisms. Here we discuss how advances in genomics and genome editing have significantly expanded our ability to probe the aging process in a vertebrate system. We highlight recent findings from a naturally short-lived vertebrate, the African turquoise killifish, which provides an attractive platform for exploring mechanisms underlying vertebrate aging and age-related diseases. MODELING AGING IN THE ing vertebrate aging and age-related diseases (Harel et al. LABORATORY 2015). Aging research has greatly benefited from investigating short-lived nonvertebrate models (Fig. 1A), specifically THE AFRICAN TURQUOISE KILLIFISH yeast (Saccharomyces cerevisiae), worm (Caenorhabdi- tis elegans), and fly (Drosophila melanogaster).
    [Show full text]
  • Draft Risk Assessment Report Nothobranchius Furzeri (Turquoise
    APPLICATION TO AMEND THE LIST OF SPECIMENS SUITABLE FOR LIVE IMPORT Draft Risk Assessment Report 1. Taxonomy of the species a. Family name: Aplocheilidae b. Genus name: Nothobranchius c. Species: N. furzeri d. Subspecies: No e. Taxonomic Reference: http://www.uniprot.org/taxonomy/105023 f. Common Names: Turquoise killifish g. Is the species a genetically-modified organism (GMO)? No 2. Status of the species under CITES Species is not listed in the CITES Appendices. 3. Ecology of the species a. Longevity: what is the average lifespan of the species in the wild and in captivity? The average lifespan of the species in captivity is 13 weeks (1). Wild derived N. furzeri from three different habitats showed a maximum lifespan of 25-32 weeks (1). b. What is the maximum length and weight that the species attains? Provide information on the size and weight range for males and females of the species. As per the original formal description of the species, the standard length of N. furzeri from a wild population ranged from 2.5cm to 4.4cm (2). The maximum length the species can attain is 7cm (3). The mean maximal body weight reported for males is 3.8 ± 1.1 g (range: 0.5 – 6.7 g) and 2.2 ± 0.6 g (range: 0.2 - 3.6 g) for females (4). Growth rates of Nothobranchius in the wild have been reported to be similar to those in captivity (5). c. Discuss the identification of the individuals in this species, including if the sexes of the species are readily distinguishable, and if the species is difficult to distinguish from other species.
    [Show full text]
  • Gill Trematodes (Flukes) in Wild-Caught Killifish (<I>Fundulus
    NOTES Gill Trematodes (Flukes) in Wild-Caught Killifish (Fundulus heteroclitus) DAVID R. GOULDING, BS, RLAT,1* TERRY L. BLANKENSHIP-PARIS, DVM, MS, DIPLOMATE, ACLAM,1 GREGORY A. LEWBART, MS, VMD, DIPLOMATE, ACZM,2 PAGE H. MYERS, BS, LATG,1 TRACY K. DEMIANENKO, BS, RLAT,1 JAMES A. CLARK, LATG,1 AND DIANE B. FORSYTHE, DVM, DIPLOMATE, ACLAM1 Three wild caught killifish (Fundulus heteroclitus) on an Institutional Animal Care and Use Committee-approved protocol were found dead within 2 days after being received. The fish were housed in two separate aquaria. Aquarium water was evaluated, and pH, salinity, ammonia, nitrate, and nitrite levels were within acceptable parameters. Several remaining fish appeared to be slow-moving and were presented for necropsy. Multiple, scattered, ulcerated skin lesions (diameter, 1 to 5 mm) were noted at necropsy and were cultured. No pathogenic bacteria were isolated. Wet-mount samples of the gills revealed multiple cysts at the gill margins, each containing a motile organism. No other gill parasites were detected. A diagnosis of trematodiasis was made. The cysts were identified as encysted metacercariae of a digenetic trematode. We surmise that the large numbers of gill flukes combined with the stress of recent shipment likely caused the observed morbidity and mortality. Sixty-two wild-caught killifish (Fundulus heteroclitus) obtained from Duke Marine Center (Beaufort, N.C.) were group-housed upon receipt in two 38-gallon aquaria containing conditioned brack- ish water. Thirty-six fish were placed in tank A, and 26 fish were placed in tank B. One day after arrival, two fish were found dead in tank B, and 2 days after arrival, one fish was found dead in tank A.
    [Show full text]
  • Compare and Contrast the Water Environment Between Death Valley Pupfish Specie and Devil’S Hole Pupfish Specie
    Compare and Contrast the Water environment between Death Valley Pupfish Specie and Devil’s Hole Pupfish Specie By Roy Tianran Gao 1 Table of Contents Title page 1 Abstract 3 Introduction and Background 3 Water Temperature 4 Salinity 6 Water Level 7 Conservation 10 Conclusion 11 References 12 2 ABSTRACT The two types of pupfish (Cyprinodon) in Death Valley National Park are Death Valley pupfish and Devil’s Hole pupfish. Death Valley pupfish has been existed over 10,000 years and Devil’s Hole pupfish has been existed for over 20,000 years. Both of the pupfishes are endangered species. The average number of Death Valley pupfish has decreased by about 100 since 1990s, and the number of Devil’s Hole pupfish has decreased by 400 since 1995. Comparing the water level, water temperature and the water salinity between the two species of pupfish would help to define the living requirements and reason of decreasing population. The research toward the result is based on 7 journal articles, 4 websites, and 1 book. As the result shows, Death Valley Pupfish and Devil’s Hole Pupfish live in different water environments and functioned differently. Understanding the water environment of the two types of pupfishes will help people building new habitats for pupfishes and increase their population so that would be possible to avoid the extinction of pupfishes from the earth. INTRODUCTION AND BACKGROUND Pupfish is a small killifish in the Southwest of America. There are five pupfish species in Death Valley which are Armargosa pupfish, Saratoga Pupfish, Devil’s Hole pupfish, Death Valley pupfish, and Cotton ball Marsh pupfish (National Park Service, 2008).
    [Show full text]
  • Lagoon Resident Fish Species of Conservation Interest According to the Habitat Directive (92/43/CEE): a Review on Their Potential Use As Ecological Indicator Species
    water Review Lagoon Resident Fish Species of Conservation Interest According to the Habitat Directive (92/43/CEE): A Review on Their Potential Use as Ecological Indicator Species Chiara Facca * , Francesco Cavraro, Piero Franzoi and Stefano Malavasi Department of Environmental Sciences, Informatics and Statistics, Ca’ Foscari University of Venice, via Torino 155, 30175 Venice, Italy; [email protected] (F.C.); [email protected] (P.F.); [email protected] (S.M.) * Correspondence: [email protected]; Tel.: +39-(0)-41-234-7733 Received: 22 May 2020; Accepted: 17 July 2020; Published: 20 July 2020 Abstract: Transitional waters are fragile ecosystems with high ecological, social and economic values, that undergo numerous threats. According to the information provided by European Member States in the framework of the European Directive 92/43/EEC (Habitat Directive), the main threat to these ecosystems is represented by morphological and hydrological changes. The present work focuses on six lagoon fish species included in the Habitat Directive annex II (species requiring conservation measures: Aphanius fasciatus, A. iberus, Knipowitschia panizzae, Ninnigobius canestrinii, Valencia hispanica and V. letourneuxi) that spend their entire life cycle in the Mediterranean priority habitat 1150* “Coastal lagoons”. The overview of the current scientific literature allowed us to highlight how the presence and abundance of these species may provide important indications on the conservation status of coastal lagoon habitats. In fact, their occurrence, distribution and biology depend on the presence of peculiar structures, such as salt marshes, small channels, isolated pools and oligohaline areas. Coastal lagoon fragmentation and habitat loss have led to a significant reduction in genetic diversity or local population extinction.
    [Show full text]
  • Freshwater Fishes and Lampreys of Greece
    HELLENIC CENTRE FOR MARINE RESEARCH Monographs on Marine Sciences No. 8 Freshwater Fishes and Lampreys of Greece An Annotated Checklist Barbieri R., Zogaris S., Kalogianni E., Stoumboudi M. Th, Chatzinikolaou Y., Giakoumi S., Kapakos Y., Kommatas D., Koutsikos N., Tachos, V., Vardakas L. & Economou A.N. 2015 Freshwater Fishes and Lampreys of Greece An Annotated Checklist HELLENIC CENTRE FOR MARINE RESEARCH Monographs on Marine Sciences No. 8 Freshwater Fishes and Lampreys of Greece An Annotated Checklist Barbieri R., Zogaris S., Kalogianni E., Stoumboudi M. Th, Chatzinikolaou Y., Giakoumi S., Kapakos Y., Kommatas D., Koutsikos N., Tachos, V., Vardakas L. & Economou A.N. 2015 Monographs on Marine Sciences 8 Authors: Barbieri R., Zogaris S., Kalogianni E., Stoumboudi M.Th., Chatzinikolaou Y., Giakoumi S., Kapakos Y., Kommatas D., Koutsikos N., Tachos V., Vardakas L. & Economou A.N. Fish drawings: R. Barbieri English text editing: S. Zogaris, E. Kalogianni, E. Green Design and production: Aris Vidalis Scientific reviewers: Jörg Freyhof, Dimitra Bobori Acknowledgements We would like to thank the following people for significant assistance in the field, for providing unpublished information, and/or support during the preparation of this work: Apostolos Apostolou, Nicolas Bailly, Bill Beaumont, Dimitra Bobori, Giorgos Catsadorakis, Charalambos Daoulas, Elias Dimitriou, Panayiotis Dimopoulos, Uwe Dussling, Panos S. Economidis, Jörg Freyhof, Zbigniew Kaczkowski, Nektarios Kalaitzakis, Stephanos Kavadas, Maurice Kottelat, Emmanuil Koutrakis, David Koutsogianopoulos, Marcello Kovačić, Ioannis Leonardos, Danilo Mrdak, Theodoros Naziridis, Elena Oikonomou, Kostas G. Papakonstatinou, Ioannis Paschos, Kostas Perdikaris, Olga Petriki, Radek Šanda, Nikolaos Skoulikidis, Manos Sperelakis, Kostas Tsigenopoulos, Maarten Vanhove, Haris Vavalidis, Jasna Vukić , Brian Zimmerman and the HCMR library staff (Anavissos Attiki).
    [Show full text]
  • The National Biological Diversity Strategy and Action Plan 2007
    THE NATIONAL BIOLOGICAL DIVERSITY STRATEGY AND ACTION PLAN 2007 The National Biological Diversity Strategy and Action Plan Prepared by Republic of Turkey Ministry of Environment and Forestry General Directorate of Nature Conservation and National Parks Department of Nature Conservation National Focal Point of Convention on Biological Diversity ISBN: 978-605-393-030-3 © All rights reserved by Republic of Turkey Ministry of Environment and Forestry Republic of Turkey Ministry of Environment and Forestry General Directorate of Nature Conservation and National Parks Department of Nature Conservation National Focal Point of Convention on Biological Diversity Söğütözü Cad. 14/E 14. Kat Beştepe/Ankara Phone: 0312 207 60 61-62 Fax: 0312 207 58 91 Web: www.cbd.gov.tr Web: www.cevreorman.gov.tr Graphic design Abdullah Dalkılıç Press Tasarım Ofset 1st Press / Ankara 2008 Phone: 0312 384 75 04 Living resources, which are important in terms of food and agriculture and which are steadily decreasing, are counted today among the important advantages a country may possess. The arable lands and water resources of the world are rapidly becoming polluted and disappearing. Scientists think that mankind will in the near future be faced with a serious shortage of water and food. In the light of these developments, the biological diversity of a country is becoming a major strength, especially in terms of genetic resources. As a country that has vital resources for people’s food security. Turkey is one of the fortunate countries of the world from the viewpoint of biological diversity. This considerable wealth both offers our country economic opportunities and imposes upon it the responsibility to establish a conservation- utilization balance.
    [Show full text]
  • Alternative Methods for Assessing Habitat Quality in Freshwater Systems
    Alternative methods for assessing habitat quality in freshwater systems Item Type Thesis or dissertation Authors Mauvisseau, Quentin Citation Mauvisseau, Q 2020, 'Alternative methods for assessing habitat quality in freshwater systems', PhD thesis, University of Derby, Derby Publisher University of Derby Download date 28/09/2021 22:40:52 Link to Item http://hdl.handle.net/10545/625067 University of Derby Alternative methods for assessing habitat quality in freshwater systems Quentin Mauvisseau Doctor of Philosophy 2020 THIS PAGE HAS BEEN INTENTIONALLY LEFT BLANK 2 CONTENTS Figures............................................................................................................................................. 7 Tables .............................................................................................................................................. 9 Appendices .................................................................................................................................... 11 Abbreviations ................................................................................................................................ 12 Preface........................................................................................................................................... 14 Abstract ......................................................................................................................................... 17 Acknowledgment .........................................................................................................................
    [Show full text]