289 Ichthyol. Explor. Freshwaters, Vol. 24, No. 4, pp. 289-298, 11 figs., April 2014 © 2014 by Verlag Dr. Friedrich Pfeil, München, Germany – ISSN 0936-9902 Valencia robertae, a new killifish from southern Greece (Cyprinodontiformes: Valenciidae) Jörg Freyhof*, Heiko Kärst** and Matthias Geiger* Valencia robertae, new species, from the lower Pinios in northern Peloponnese and Mornos Rivers in southern mainland of Greece is distinguished from V. letourneuxi and V. hispanica by having short lateral bars or vertically elongated small blotches along the midlateral body and an almost triangular anal fin in females, prominent lat- eral bars between the axial blotch and the caudal-fin base and a long anal fin reaching almost or to the first caudal-fin rays in males larger than 27 mm SL. It is also distinguished by 32 fixed, diagnostic nucleotide substitu- tions in the mtDNA COI barcode region. Introduction hof, 1997). Both species usually inhabit densely vegetated springs, slowly flowing streams and The killifish family Valenciidae is the only fish marshes close to the Mediterranean coast where family endemic to Europe and the Mediterranean they are often the victims of habitat modifications basin. Valencia is the only genus in Valenciidae (Kalogianni et al., 2010). Valencia species are also (Myers, 1928; Parenti, 1981), and two species are very sensitive to competition and predation by known: V. hispanica, the type species, (Valenci- alien Gambusia holbrooki, which has invaded al- ennes, 1846: 214) described from Catalonia, Spain, most all of their habitats (Bianco & Miller, 1989; and V. letourneuxi (Sauvage, 1880) described from Planelles & Reyna, 1996; Barbieri et al., 2000; Kerkyra Island [Corfu], Greece. Gomez Caruana Kalogianni et al. 2010). Therefore, both species et al. (1984) described an additional species from are of major conservation concern. Due to their Spain, Valencia lozanoi; Fernández-Delgado et al. continuing deteriorating conservation status, both (1986) identified it as an alien species of the new- have been included (as V. hispanica) in the Ap- world genus Fundulus. pendix II of the Bern Convention as endangered The ranges of the two currently valid Valencia and strictly protected species, and have been are largely disjunct. Valencia hispanica is endemic characterized as priority species for conservation to the central Mediterranean coast of Spain be- in Annex II of the European Union Habitats Direc- tween Tortosa and Cape San Antonio, and V. le- tive 92/43/EEC (Barbieri et al., 2002; Kalogianni tourneuxi is endemic to Western Greece and Al- et al. 2010). In 1996, both Valencia were assessed bania between Lake Butrint (Albania) and Alfios as Endangered by IUCN, and in 2005 reclassified River (Peloponnese) drainages (Kottelat & Frey- as Critically Endangered (Crivelli, 2006a-b). * Zoological Research Museum Alexander Koenig, Leibniz Institute for Animal Biodiversity, Adenauerallee 160, 53113 Bonn, Germany. E-mail: [email protected] ** Ludwig-Erhard-Strasse 18, 76571 Gaggenau, Germany. Ichthyol. Explor. Freshwaters, Vol. 24, No. 4 290 Valencia letourneuxi is further protected by Presi- projections. Methods for counts and measure- dential Decree No. 67/1981 of the Greek State ments follow Kottelat & Freyhof (2007). Standard (Barbieri et al., 2002) and has been recently listed length (SL) is measured from the tip of the upper among “The World’s 100 most threatened species” lip to the end of the hypural complex. The length (Baillie & Butcher, 2012). Due to the strict conserva- of the caudal peduncle is measured from behind tion legislations, special permissions are needed the base of the last anal-fin ray to the end of the to collect Valencia in the wild. As several popula- hypural complex, at mid-height of the caudal-fin tions are still declining (see Perdikaris et al., 2010 base. The last two branched rays articulating on for Greek Kalamas population) and many popula- a single pterygiophore in the dorsal and anal fins 1 tions seem to be small, collection should be limited are noted as “1 /2”. Numbers in parentheses after to a minimum and only for important reasons. a given count are numbers of individuals exam- Within an European initiative to generate ined with that count. The holotype is included in DNA barcode data for all freshwater fishes of the calculation of means and SD. Europe (www.fredie.eu), we received materials Abbreviations used: bp, base-pairs; SL, of V. hispanica from the tissue collection of the standard length; HL, lateral head length; CMK, National Museum of Natural Sciences in Madrid Collection of Maurice Kottelat, Cornol; FSJF, (I. Doadrio, pers. comm.). No tissues of V. letour- Fischsammlung J. Freyhof, Berlin; MNCN, Na- neuxi were available in collections, but at least tional Museum of Natural Sciences, Madrid; four captive populations of this species exist since ZFMK, Zoologisches Forschungsmuseum Alexan- before the mid-1990th in Europe (fom Corfu, der Koenig, Bonn. Pinios, Mornos and Lake Butrint). Furthermore, in 2011, JF, Maria Stoumboudi & Roberta Barbieri DNA extraction and PCR. Genomic DNA was caught one female V. letourneuxi (Fig. 9) in the extracted using Machery & Nagel NucleoSpin® lower Acheron, from which a fin could be taken. Tissue kits following the manufacturer’s protocol Sequencing the mitochondrial COI barcode region on an Eppendorf EpMotion® pipetting-roboter from the material mentioned above, revealed that with vacuum manifold. The standard vertebrate the Pinios and Mornos populations are geneti- DNA barcode region of COI (cytochrome c oxi- cally very distinct from the other three popula- dase subunit 1) was amplified using a M13 tailed tions examined. It had never been stated in any primer cocktail including FishF2_t1 (5' TG- of the above cited studies that two species might TAAAACGACGGCCAGTCGACTAAT- be involved in V. letourneuxi, as indicated by our CATAAAGATATCGGCAC), FishR2_t1 (5' CAG- molecular data. The aim of this study was to test GAAACAGCTATGACACTTCAGGGTGAC- whether the molecular groups of Albanian and CGAAGAATCAGAA), VF2_t1 (5' TGTAAAAC- Greek Valencia might indeed represent two spe- GACGGCCAGTCAACCAACCACAAAGACAT- cies. TGGCAC) and FR1d_t1 (5' CAGGAAACAGC- TATGACACCTCAGGGTGTCCGAARAAYCAR- AA) (Ivanova et al. 2007). Sequencing of the Material and methods ExoSAP-IT (USB) purified PCR product in both directions was conducted at Macrogen Europe All fish were preserved in 5 % formaldehyde and Laboratories with forward sequencing primer stored in 70 % ethanol. Measurements were made M13F (5' GTAAAACGACGGCCAGT) and reverse with dial caliper and recorded to 0.1 mm. All sequencing primer M13R-pUC (5' CAGGAAA- measurements are made point to point, never by CAGCTATGAC). Table 1. List of the 32 diagnostic nucleotide substitutions found in the 610 base pairs long mtDNA COI barcode region. Nucleotide position is given with reference to the complete mitochondrial genome of Oryzias latipes (GenBank accession number AP004421). 5596 5634 5637 5667 5679 5682 5718 5739 5745 5754 5769 5805 5808 5817 5847 5850 5883 5901 5908 5958 V. hispanica (5) TCCATGGTAGGTAGCAAACT V. letourneuxi (7) TCCATGCTAGGTAGCAAACT V. robertae (8) CTTGCATCGAACCATGTTTC Freyhof et al.: Valencia robertae 291 Molecular data analysis. Data processing and ing to or almost to the base of the caudal fin in sequence assembly was done in Geneious Pro individuals longer than 30 mm SL (vs. to middle (Biomatters 2013) and the Muscle algorithm (Ed- of caudal peduncle). gar, 2004) was used to create a DNA sequence Valencia robertae is distinguished from V. hispa- alignment. SpeciesIdentifier (Meier et al. 2006) nica by having a hyaline to bluish caudal fin (vs. was used to compute Kimura2-corrected dis- yellow to orange) with a bold black posterior tances (K2P), and screening for diagnostic nucle- margin in males (vs. reddish-brown). otide substitutions was performed manually from the resulting sequence alignment. Description. See Figures 1-4 for general appear- ance and Table 2 for morphometric data of holo- type and nine paratypes. Dorsal and ventral Valencia robertae, new species profiles straight or gently convex from jaws to (Figs. 1-5) dorsal- and anal-fin origins; concave or straight along caudal peduncle. Body slender, deeper than Holotype. ZFMK 59197, 38.6 mm SL; Greece: wide, compressed posteriorly. Body deepest at River Pinios south of Kavasilas, 37°52'16.4" N about anal-fin origin. Greatest body width at 21°15'53.6" E; from a captive population. pectoral-fin base. Jaws short, snout slightly point- ed. Caudal peduncle compressed laterally, 1.1-1.4 Paratype. ZFMK 59198-59206, 9, 28.6-42.5 mm (males), 1.4-1.7 (females) times longer than deep. SL; same data as holotype. A very small axillary lobe at base of pelvic fin. Pectoral fin rounded, posterior margin reach- Additional material. FSJF 3448, 2, 32.6-33.5 mm SL; ing anterior to vertical of pelvic-fin base. Pelvic-fin Greece: Central prov: Chiliadou Springs in Mornos origin distinctly in front of dorsal-fin origin. delta, 38°24' N 21°55' E; from a captive population. Pelvic fin short, tip reaching to anus in males, not Material used in the molecular genetic analysis: reaching to anus in females. Pelvic-fin bases very ZFMK 53006-53007 (GenBank accession numbers: KF767519, KF767509); ZFMK 53077-53080 (GenBank closely together, almost fused. Anus situated accession numbers: KF767514, KF767521, KF767513, directly in front of anal-fin origin. Urogenital KF767512); same data as holotype. – FSJF-DNA 2460; papillae slightly prolonged in females. In females, Greece: Central prov: Chiliadou Springs in Mornos anal fin almost triangular with almost straight delta, 38°24' N 21°55' E; from a captive population posterior margin, last ray reaching to slightly (GenBank accession numbers: KF767516, KF767524). behind middle of caudal peduncle. In males, anal fin elongated, reaching to or almost to base of Diagnosis. Valencia robertae is distinguished from caudal fin in individuals larger than 30 mm SL. V. letourneuxi (Figs. 8-11) by the presence in fe- Dorsal-fin origin above 2nd-4th branched anal-fin males of short lateral bars or small vertically ray. Dorsal fin roundish in females, reaching to elongated blotches along flanks (vs.