Cytotoxic T Lymphocytes Block Tumor Growth Both by Lytic Activity And

Total Page:16

File Type:pdf, Size:1020Kb

Cytotoxic T Lymphocytes Block Tumor Growth Both by Lytic Activity And Published OnlineFirst August 15, 2014; DOI: 10.1158/2326-6066.CIR-14-0098 Research Article Cancer Immunology Research Cytotoxic T Lymphocytes Block Tumor Growth Both by Lytic Activity and IFNg-Dependent Cell-Cycle Arrest Hirokazu Matsushita1, Akihiro Hosoi1,2, Satoshi Ueha3, Jun Abe3, Nao Fujieda1,2, Michio Tomura4, Ryuji Maekawa2, Kouji Matsushima3, Osamu Ohara5, and Kazuhiro Kakimi1 Abstract To understand global effector mechanisms of CTL therapy, we spotty apoptotic or necrotic areas. Thus, tumor growth suppres- performed microarray gene expression analysis in a murine model sion was largely dependent on G1 cell-cycle arrest rather using pmel-1 T-cell receptor (TCR) transgenic T cells as effectors than killing by CTLs. Neutralizing antibody to IFNg prevented and B16 melanoma cells as targets. In addition to upregulation of both tumor growth inhibition and G1 arrest. The mechanism of genes related to antigen presentation and the MHC class I path- G1 arrest involved the downregulation of S-phase kinase-associ- way, and cytotoxic effector molecules, cell-cycle–promoting genes ated protein 2 (Skp2) and the accumulation of its target were downregulated in the tumor on days 3 and 5 after CTL cyclin-dependent kinase inhibitor p27 in the B16-fucci tumor transfer. To investigate the impact of CTL therapy on the cell cycle cells. Because tumor-infiltrating CTLs are far fewer in number than of tumor cells in situ, we generated B16 cells expressing a the tumor cells, we propose that CTLs predominantly regulate fluorescent ubiquitination-based cell-cycle indicator (B16-fucci) tumor growth via IFNg-mediated profound cytostatic effects and performed CTL therapy in mice bearing B16-fucci tumors. rather than via cytotoxicity. This dominance of G1 arrest over Three days after CTL transfer, we observed diffuse infiltration other mechanisms may be widespread but not universal because of CTLs into the tumor with a large number of tumor cells IFNg sensitivity varied among tumors. Cancer Immunol Res; 1–11. arrested at the G1 phase of the cell cycle, and the presence of Ó2014 AACR. Introduction thought to be important for tumor elimination (9–11). None- theless, cytokines such as IFNg and TNFa produced by T cells are Adoptive T-cell immunotherapy (ACT) using autologous also likely to contribute to the prevention of tumor growth by ACT tumor-infiltrating lymphocytes (TIL) can be highly effective for via mechanisms other than cell lysis (12–14). treating melanoma (1). The recent development of genetically IFNg is a critical cytokine for antitumor immunity under natural engineered T cells stably expressing exogenous T-cell receptors and therapeutic conditions (15, 16). It enhances tumor immuno- (TCR) or chimeric antigen receptors (CAR) specific for tumor- genicity by upregulating components of the MHC antigen proces- associated antigens offers the possibility of testing the efficacy of sing and presentation pathway. It also induces the expression of ACT against a wide range of cancer types in addition to melanoma chemokines, including the angiostatic chemokines CXCL9 (MIG), (2, 3). Many clinical trials have now been conducted using CXCL10 (IP-10), and CXCL11 (I-TAC), that block neovasculariza- genetically engineered T cells specific for tumor antigens as well tion in the tumor and recruit effector immune cells (17–19). as TILs, and some objective responses have been achieved (4, 5). It Furthermore, IFNg has been reported to exert antiproliferative is clear from mouse models that adoptively transferred antigen- effects on the developing tumor (20, 21), and it triggers apoptosis specific T cells are capable of eradicating established cancer (6–8), of tumor cells by inducing proapoptotic molecules (22, 23). and the ability of CTLs to directly kill tumor and/or stromal cells is To understand the global antitumor effect mediated by ACT, we used the B16 melanoma pmel-1 TCR-transgenic T-cell model to perform a gene expression analysis of ACT-treated tumors. On the 1Department of Immunotherapeutics, The University of Tokyo Hospi- tal,Tokyo, Japan. 2Medinet Co Ltd.,Yokohama, Japan. 3Department of basis of these results, we focused on genes controlling the cell cycle Molecular Preventive Medicine, Graduate School of Medicine, The and arresting growth of B16 tumor cells in this model. We University of Tokyo,Tokyo, Japan. 4Center for Innovation in Immunor- examined the effects on tumor cells of the IFNg produced by egulative Technology and Therapeutics, Kyoto University Graduate in situ School of Medicine, Kyoto, Japan. 5Department of Human Genome the CTLs using cell-cycle status indicators and investigated Research, Kazusa DNA Research Institute, Chiba, Japan. the mechanism of cell-cycle arrest. Furthermore, we demonstrate Note: Supplementary data for this article are available at Cancer Immunology the importance of cell-cycle arrest induced by CTL-derived IFNg in Research Online (http://cancerimmunolres.aacrjournals.org/). the regulation of tumor growth. Corresponding Author: Kazuhiro Kakimi, Department of Immunotherapeutics, The University of Tokyo Hospital, 7-3-1 Hongo, Bunkyo-Ku, Tokyo 113-8655, Materials and Methods Japan. Phone: 81-3-5805-3161; Fax: 81-3-5805-3164; E-mail: Mice, tumor cells, and peptides [email protected] Six-week-old male C57BL/6 mice were purchased from Japan doi: 10.1158/2326-6066.CIR-14-0098 SLC. Mice transgenic for the pmel-1-TCR, which recognizes the H- b Ó2014 American Association for Cancer Research. 2D –restricted epitope EGSRNQDWL from gp100 (gp10025–33), www.aacrjournals.org OF1 Downloaded from cancerimmunolres.aacrjournals.org on September 27, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst August 15, 2014; DOI: 10.1158/2326-6066.CIR-14-0098 Matsushita et al. were obtained from The Jackson Laboratory. All mice were housed BioLegend: PerCP/Cy5.5-conjugated anti-CD45, Alexa Fluor647– in a pathogen-free environment, and all animal procedures were conjugated anti-CD90.1,and APC-Cy7–conjugated anti-CD8.Data conducted in accordance with institutional guidelines. All animal were analyzed with the Kaluza software (Beckman Coulter). experiments were approved by the University of Tokyo Ethics Committee for Animal Experiments (10-P-127). The H-2Db– Comprehensive gene expression analysis restricted peptide human gp100 (hgp10025–33, KVPRNQDWL) Gene expression profiling data of B16 tumor tissues on differ- was purchased from GenScript Japan at a purity of >90%, with free ent days were obtained by Agilent whole-mouse genome micro- amino and carboxyl terminals. B16F10, FBL3, and 3LL cell lines array. Total RNA was extracted with TRizol (Invitrogen) from B16 were maintained in culture medium consisting of DMEM with tumor tissues and fluorescently labeled using a One-Color Agilent 10% FCS, 100 U/mL penicillin, and 100 mg/mL streptomycin. Quick Amp Labeling Kit. The microarray slides were hybridized, EL4, P815, and CT26 were cultured in RPMI-1640 medium washed, and read on an Agilent Microarray scanner following the supplemented with 10% FCS, 100 U/mL penicillin, and 100 manufacturer's instructions, and raw fluorescence signal intensi- mg/mL streptomycin. All cell lines were tested for mycoplasma by ties were generated by Agilent Feature Extraction Software v9.5. the MycoAlert Mycoplasma Detection kit (Lonza). Cellular mor- The signals were normalized to align at 75th percentile, and then in vitro phology and growth curve were checked in all cell lines. turned into log2 ratio against day 1 in untreated and CTL-treated B16F10 and B16-fucci cells were authenticated by transplantation groups. We began with 45,018 probes, and removed probes if for assessing growth ability in vivo. their gIsWellAboveBG flag values were 0 at all samples, and then filtered out log2 ratio values that were unvarying (between À1 and Dendritic cell preparation and CTL stimulation 1) at all time points. We obtained 10,855 probes and ran hier- Dendritic cells (DC) were obtained by 8-day culture of archical clustering (standard correlation, UPGMA) on them. All C57BL/6-derived bone marrow cells with granulocyte-macro- data were analyzed with the Subio Platform and Basic Plug-in phage colony-stimulating factor (GM-CSF), as described pre- v1.16 (Subio Inc.). The microarray data are available from the viously (24). Briefly, bone marrow cells obtained from tibias Gene Expression Omnibus (GEO) database (series accession and femurs of C57BL/6 mice were cultured in RPMI-1640 number GSE57304; sample accession numbers GSM1379331– medium supplemented with 10% FCS, 10 mmol/L HEPES, 5 Â GSM1379344). À À 10 5 mol/L 2-mercaptoethanol, 1 Â 10 3 mol/L sodium pyru- For quantitative gene panel–based PCR, Cell Cycle RT2 Profiler vate, 1% nonessential amino acids, 100 U/mL penicillin, 100 PCR arrays (SABioscience; http://www.sabiosciences.com/ mg/mL streptomycin, and 20 ng/mL GM-CSF (PeproTech) for 8 rt_pcr_product/HTML/PAMM-020Z.html) were used to simulta- days. On days 3 and 6, half of the medium was replaced with neously examine the mRNA levels of 84 genes in 96-well PCR fresh medium containing GM-CSF. DCs were further incubated array plates. Total RNA was prepared using TRizol according to the with 1 mg/mL lipopolysaccharide for 16 hours and then pulsed manufacturer's instructions (Invitrogen), and reverse-transcribed with 1 mg/mL hgp100 peptide for 3 hours to obtain mature using RT2 First Strand kits (SABioscience). Real-time PCR was DCs. To prepare CTLs, 1 Â 107 spleen cells from pmel-1 TCR- performed as instructed by the supplier on an ABI PRISM 7900HT transgenic mice were cocultured with 2 Â 105 DCs in a medium Sequence Detection System (Life Technologies). Data were ana- containing 50 U/mL IL2 (Chiron Corporation). After 3 days of lyzed by a DD cycle threshold method to determine the fold in vitro stimulation, approximately 90% of the harvested cells changes of the mRNA levels (http://www.SABiosciences.com/ þ þ were CD3 CD8 CTLs. pcrarraydataanalysis.php). ACT and anti-IFNg mAb treatment Expression vectors C57BL/6 mice were inoculated subcutaneously with 1 Â 106 CSII-EF-MCS/mAG-hGeminin and CSII-EF-MCS/mKO-cdt1 B16 tumor cells followed by adoptive CTL transfer (1 Â 107 or 4 Â vectors were kindly provided by Dr.
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG
    [Show full text]
  • Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
    Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.
    [Show full text]
  • The Tumor Suppressor Notch Inhibits Head and Neck Squamous Cell
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2015 THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) Shhyam Moorthy Shhyam Moorthy Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons Recommended Citation Moorthy, Shhyam and Moorthy, Shhyam, "THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN)" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 638. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/638 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) by Shhyam Moorthy, B.S.
    [Show full text]
  • Mammalian Atypical E2fs Link Endocycle Control to Cancer
    Mammalian Atypical E2Fs Link Endocycle Control to Cancer DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Zi Chen Graduate Program in Integrated Biomedical Science Program The Ohio State University 2011 Dissertation Committee: Gustavo Leone, PhD, Advisor Michael Ostrowski, PhD Clay Marsh, MD Tsonwin Hai, PhD Kathryn Wikenheiser-Brokamp, MD PhD Copyright by Hui-Zi Chen 2011 Abstract The endocycle is a developmentally programmed variant cell cycle consisting of successive S (DNA synthesis) and G (Gap) phases without an intervening M phase or cytokinesis. As a consequence of the regulated “decoupling” of DNA replication and mitosis, which are two central processes of the traditional cell division program, endocycling cells acquire highly polyploid genomes after having undergone multiple rounds of whole genome reduplication. Although essential for metazoan development, relatively little is known about the regulation of endocycle or its physiologic role in higher vertebrates such as the mammal. A substantial body of work in the model organism Drosophila melanogaster has demonstrated an important function for dE2Fs in the control of endocycle. Genetic studies showed that both endocycle initiation and progression is severely disrupted by altering the expression of the fly E2F activator (dE2F1) or repressor (dE2F2). In mammals, the E2F family is comprised of nine structurally related proteins, encoded by eight distinct genes, that can be classified into transcriptional activators (E2f1, E2f2, E2f3a and E2f3b) or repressors (E2f4, E2f5, E2f6, E2f7 and E2f8). The repressor subclass may then be further divided into canonical (E2f4, E2f5 and E2f6) or atypical E2fs (E2f7 and E2f8).
    [Show full text]
  • Cyclin F-Chk1 Synthetic Lethality Mediated by E2F1 Degradation
    bioRxiv preprint doi: https://doi.org/10.1101/509810; this version posted January 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Cyclin F-Chk1 synthetic lethality mediated by E2F1 degradation Kamila Burdova1, Hongbin Yang1, Roberta Faedda1, Samuel Hume1, Daniel Ebner2, Benedikt M Kessler2, Iolanda Vendrell1,2, David H Drewry3, Carrow I Wells3, Stephanie B Hatch2, Vincenzo D’Angiolella1* 1Medical Research Council Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old Road Campus Research Building, Roosevelt Drive, Oxford OX3 7DQ, UK 2Target Discovery Institute, Nuffield Department of Medicine, University of Oxford, Old Road Campus, Roosevelt Drive, Oxford OX3 7FZ, UK 3Structural Genomics Consortium, UNC Eshelman School of Pharmacy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States of America * Corresponding Author: [email protected] Summary Cyclins are central engines of cell cycle progression when partnered with Cyclin Dependent Kinases (CDKs). Among the different cyclins controlling cell cycle progression, cyclin F does not partner with a CDK, but forms an E3 ubiquitin ligase, assembling through the F-box domain, an Skp1-Cul1-F-box (SCF) module. Although multiple substrates of cyclin F have been identified the vulnerabilities of cells lacking cyclin F are not known. Thus, we assessed viability of cells lacking cyclin F upon challenging cells with more than 200 kinase inhibitors. The screen revealed a striking synthetic lethality between Chk1 inhibition and cyclin F loss.
    [Show full text]
  • Cyclin F, RRM2 and SPDL1 and Their Prognostic Significance In
    cancers Article Expression of Genomic Instability-Related Molecules: Cyclin F, RRM2 and SPDL1 and Their Prognostic Significance in Pancreatic Adenocarcinoma Anna Klimaszewska-Wi´sniewska 1,*,†, Karolina Buchholz 1,2,† , Izabela Neska-Długosz 1 , Justyna Dur´slewicz 1 , Dariusz Grzanka 1 , Jan Zabrzy ´nski 1,3 , Paulina Sopo ´nska 4, Alina Grzanka 2 and Maciej Gagat 2 1 Department of Clinical Pathomorphology, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toru´n,85-094 Bydgoszcz, Poland; [email protected] (K.B.); [email protected] (I.N.-D.); [email protected] (J.D.); [email protected] (D.G.); [email protected] (J.Z.) 2 Department of Histology and Embryology, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toru´n,85-092 Bydgoszcz, Poland; [email protected] (A.G.); [email protected] (M.G.) 3 Department of General Orthopaedics, Musculoskeletal Oncology and Trauma Surgery, Poznan University of Medical Sciences, 60-572 Pozna´n,Poland 4 Department of Obstetrics, Gynaecology and Oncology, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toru´n,85-094 Bydgoszcz, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-52-585-42-00; Fax: +48-52-585-40-49 Citation: Klimaszewska-Wi´sniewska, † These authors contributed equally to this paper. A.; Buchholz, K.; Neska-Długosz, I.; Dur´slewicz,J.; Grzanka, D.; Simple Summary: Pancreatic ductal adenocarcinoma (PDAC) is one of the worst prognostic cancers, Zabrzy´nski,J.; Sopo´nska,P.; Grzanka, for which clinically valuable prognostic factors and individualized biomarker-driven cancer therapies A.; Gagat, M.
    [Show full text]
  • Multi-Omics Integrative
    fcell-09-691540 July 17, 2021 Time: 18:41 # 1 ORIGINAL RESEARCH published: 22 July 2021 doi: 10.3389/fcell.2021.691540 Multi-Omics Integrative Bioinformatics Analyses Reveal Long Non-coding RNA Modulates Genomic Integrity via Competing Endogenous RNA Mechanism and Serves as Novel Biomarkers for Overall Survival in Lung Edited by: Hernandes F. Carvalho, Adenocarcinoma State University of Campinas, Brazil 1,2† 1† 1 3 1 4 Reviewed by: Zhonglin Wang , Ziyuan Ren , Rui Li , Junpeng Ge , Guoming Zhang , Yaodong Xin Karine Damasceno, and Yiqing Qu1* Gonçalo Moniz Institute (IGM), Brazil 1 Apollonia Tullo, Department of Pulmonary and Critical Care Medicine, Qilu Hospital, Cheeloo College of Medicine, Shandong University, 2 3 National Research Council, Italy Jinan, China, School of Physical Science, University of California, Irvine, Irvine, CA, United States, Department of Biology Engineering, Shandong Jianzhu University, Jinan, China, 4 School of Statistics and Management, Shanghai University *Correspondence: of Finance and Economics, Shanghai, China Yiqing Qu [email protected] †These authors have contributed Long non-coding RNA (lncRNA) plays a crucial role in modulating genome instability, equally to this work and share first immune characteristics, and cancer progression, within which genome instability was authorship identified as a critical regulator in tumorigenesis and tumor progression. However, Specialty section: the existing accounts fail to detail the regulatory role of genome instability in lung This article was submitted to adenocarcinoma
    [Show full text]
  • University Pierre and Marie Curie Identification of New Regulators For
    University Pierre and Marie Curie Doctoral school : Complexité Du Vivant - ED515 Nuclear Organization and Oncogenesis Unit (INSERM U993) Identification of new regulators for PML Nuclear Bodies By Thibaut Snollaerts Doctoral thesis of BIOCHEMISTRY AND MOLECULAR BIOLOGY OF THE CELL Supervised by Anne Dejean Presented and defended publicly on September 28th 2016 In front of a jury composed of: Dr. Laurent LE CAM INSERM research director Reviewer Dr. Dimitris XIRODIMAS CNRS research director Reviewer Dr. Mounira CHELBI-ALIX INSERM research director Examinator Dr. Robert WEIL CNRS research director Examinator Dr. Frederic DEVAUX UPMC university professor President Prof. Anne DEJEAN INSERM research director Thesis Director (Invited member) 1 La persévérance, c'est ce qui rend l'impossible possible, le possible probable et le probable réalisé. Perseverance is what makes the impossible possible, the possible probable and the probable realized Robert Half 2 Acknowledgements First, I would like to thank all the members of the jury: Laurent Le Cam, Dimitris Xirodimas, Mounira Chelbi-Alix, Robert Weil and Frederic Devaux who, despite a very busy schedule, took the time to take part in this thesis defense jury. I would like to thank Anne Dejean for giving me the opportunity to be part of her research team since my master internship, for giving me the chance to meet very interesting people, and for providing me with many opportunities. Thank you for the trust you put in me to carry out this complicated project as well as for providing the best working conditions, and collaborations to realize it. Thank you for all the things I was able to learn from you, your team and the world of science in which we are involved.
    [Show full text]
  • Novel Genes Associated with Amyotrophic Lateral Sclerosis: Diagnostic and Clinical Implications
    Rapid Review Novel genes associated with amyotrophic lateral sclerosis: diagnostic and clinical implications Ruth Chia, Adriano Chiò, Bryan J Traynor Summary Lancet Neurol 2018; 17: 94–102 Background The disease course of amyotrophic lateral sclerosis (ALS) is rapid and, because its pathophysiology is Published Online unclear, few effective treatments are available. Genetic research aims to understand the underlying mechanisms of November 16, 2017 ALS and identify potential therapeutic targets. The first gene associated with ALS was SOD1, identified in 1993 and, http://dx.doi.org/10.1016/ by early 2014, more than 20 genes had been identified as causative of, or highly associated with, ALS. These genetic S1474-4422(17)30401-5 discoveries have identified key disease pathways that are therapeutically testable and could potentially lead to the Laboratory of Neurogenetics, National Institute on Aging, development of better treatments for people with ALS. National Institutes of Health, Bethesda, MD, USA (R Chia PhD, Recent developments Since 2014, seven additional genes have been associated with ALS (MATR3, CHCHD10, TBK1, B J Traynor MD);Department of TUBA4A, NEK1, C21orf2, and CCNF), all of which were identified by genome-wide association studies, whole genome Neurology, Brain Sciences Institute, Johns Hopkins studies, or exome sequencing technologies. Each of the seven novel genes code for proteins associated with one or Hospital, Baltimore, MD, USA more molecular pathways known to be involved in ALS. These pathways include dysfunction in global protein (B J Traynor); Rita Levi homoeostasis resulting from abnormal protein aggregation or a defect in the protein clearance pathway, mitochondrial Montalcini Department of dysfunction, altered RNA metabolism, impaired cytoskeletal integrity, altered axonal transport dynamics, and DNA Neuroscience, University of Turin, Turin, Italy damage accumulation due to defective DNA repair.
    [Show full text]
  • The Let-7 Microrna Represses Cell Proliferation Pathways in Human Cells
    Research Article The let-7 MicroRNA Represses Cell Proliferation Pathways in Human Cells Charles D. Johnson,1 Aurora Esquela-Kerscher,3 Giovanni Stefani,3 Mike Byrom,1 Kevin Kelnar,1 Dmitriy Ovcharenko,1 Mike Wilson,1 Xiaowei Wang,2 Jeffrey Shelton,1 Jaclyn Shingara,1 Lena Chin,3 David Brown,1 and Frank J. Slack3 1Asuragen, Inc.; 2Ambion, Inc., Austin, Texas, and 3Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, Connecticut Abstract seam cells (5, 15–18). Many human let-7 genes map to regions altered MicroRNAs play important roles in animal development, cell or deleted in human tumors (3), indicating that these genes may differentiation, and metabolism and have been implicated in function as tumor suppressors. In fact, let-7g maps to 3p21, which has been implicated in the initiation of lung cancers (19). Previous human cancer. The let-7 microRNA controls the timing of cell cycle exit and terminal differentiation in Caenorhabditis work has shown that let-7 may also play a role in lung cancer elegans and is poorly expressed or deleted in human lung progression (4, 5, 20). For example, let-7 is expressed at lower levels tumors. Here, we show that let-7 is highly expressed in normal in lung tumors than in normal tissue for patients with both lung tissue, and that inhibiting let-7 function leads to adenocarcinoma and squamous cell carcinoma (4, 5, 20). Under- increased cell division in A549 lung cancer cells. Over- scoring the potential importance of let-7 in lung cancer is the expression of let-7 in cancer cell lines alters cell cycle observation that postoperative survival time in lung cancer patients progression and reduces cell division, providing evidence that directly correlated with let-7 expression levels (4, 20): patients with let-7 functions as a tumor suppressor in lung cells.
    [Show full text]
  • Expression Level Is a Key Determinant of E2F1-Mediated Cell Fate
    Cell Death and Differentiation (2017) 24, 626–637 & 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 1350-9047/17 www.nature.com/cdd Expression level is a key determinant of E2F1-mediated cell fate Igor Shats1, Michael Deng1, Adam Davidovich1, Carolyn Zhang1, Jungeun S Kwon2, Dinesh Manandhar3, Raluca Gordân3, Guang Yao2 and Lingchong You*,1,3,4 The Rb/E2F network has a critical role in regulating cell cycle progression and cell fate decisions. It is dysfunctional in virtually all human cancers, because of genetic lesions that cause overexpression of activators, inactivation of repressors, or both. Paradoxically, the downstream target of this network, E2F1, is rarely strongly overexpressed in cancer. E2F1 can induce both proliferation and apoptosis but the factors governing these critical cell fate decisions remain unclear. Previous studies have focused on qualitative mechanisms such as differential cofactors, posttranslational modification or state of other signaling pathways as modifiers of the cell fate decisions downstream of E2F1 activation. In contrast, the importance of the expression levels of E2F1 itself in dictating the downstream phenotypes has not been rigorously studied, partly due to the limited resolution of traditional population-level measurements. Here, through single-cell quantitative analysis, we demonstrate that E2F1 expression levels have a critical role in determining the fate of individual cells. Low levels of exogenous E2F1 promote proliferation, moderate levels induce G1, G2 and mitotic cell cycle arrest, and very high levels promote apoptosis. These multiple anti-proliferative mechanisms result in a strong selection pressure leading to rapid elimination of E2F1-overexpressing cells from the population.
    [Show full text]