Novel Genes Associated with Amyotrophic Lateral Sclerosis: Diagnostic and Clinical Implications
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG -
Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies. -
The Tumor Suppressor Notch Inhibits Head and Neck Squamous Cell
The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2015 THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) Shhyam Moorthy Shhyam Moorthy Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons Recommended Citation Moorthy, Shhyam and Moorthy, Shhyam, "THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN)" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 638. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/638 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) by Shhyam Moorthy, B.S. -
Mammalian Atypical E2fs Link Endocycle Control to Cancer
Mammalian Atypical E2Fs Link Endocycle Control to Cancer DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Zi Chen Graduate Program in Integrated Biomedical Science Program The Ohio State University 2011 Dissertation Committee: Gustavo Leone, PhD, Advisor Michael Ostrowski, PhD Clay Marsh, MD Tsonwin Hai, PhD Kathryn Wikenheiser-Brokamp, MD PhD Copyright by Hui-Zi Chen 2011 Abstract The endocycle is a developmentally programmed variant cell cycle consisting of successive S (DNA synthesis) and G (Gap) phases without an intervening M phase or cytokinesis. As a consequence of the regulated “decoupling” of DNA replication and mitosis, which are two central processes of the traditional cell division program, endocycling cells acquire highly polyploid genomes after having undergone multiple rounds of whole genome reduplication. Although essential for metazoan development, relatively little is known about the regulation of endocycle or its physiologic role in higher vertebrates such as the mammal. A substantial body of work in the model organism Drosophila melanogaster has demonstrated an important function for dE2Fs in the control of endocycle. Genetic studies showed that both endocycle initiation and progression is severely disrupted by altering the expression of the fly E2F activator (dE2F1) or repressor (dE2F2). In mammals, the E2F family is comprised of nine structurally related proteins, encoded by eight distinct genes, that can be classified into transcriptional activators (E2f1, E2f2, E2f3a and E2f3b) or repressors (E2f4, E2f5, E2f6, E2f7 and E2f8). The repressor subclass may then be further divided into canonical (E2f4, E2f5 and E2f6) or atypical E2fs (E2f7 and E2f8). -
Cyclin F-Chk1 Synthetic Lethality Mediated by E2F1 Degradation
bioRxiv preprint doi: https://doi.org/10.1101/509810; this version posted January 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Cyclin F-Chk1 synthetic lethality mediated by E2F1 degradation Kamila Burdova1, Hongbin Yang1, Roberta Faedda1, Samuel Hume1, Daniel Ebner2, Benedikt M Kessler2, Iolanda Vendrell1,2, David H Drewry3, Carrow I Wells3, Stephanie B Hatch2, Vincenzo D’Angiolella1* 1Medical Research Council Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old Road Campus Research Building, Roosevelt Drive, Oxford OX3 7DQ, UK 2Target Discovery Institute, Nuffield Department of Medicine, University of Oxford, Old Road Campus, Roosevelt Drive, Oxford OX3 7FZ, UK 3Structural Genomics Consortium, UNC Eshelman School of Pharmacy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States of America * Corresponding Author: [email protected] Summary Cyclins are central engines of cell cycle progression when partnered with Cyclin Dependent Kinases (CDKs). Among the different cyclins controlling cell cycle progression, cyclin F does not partner with a CDK, but forms an E3 ubiquitin ligase, assembling through the F-box domain, an Skp1-Cul1-F-box (SCF) module. Although multiple substrates of cyclin F have been identified the vulnerabilities of cells lacking cyclin F are not known. Thus, we assessed viability of cells lacking cyclin F upon challenging cells with more than 200 kinase inhibitors. The screen revealed a striking synthetic lethality between Chk1 inhibition and cyclin F loss. -
Cyclin F, RRM2 and SPDL1 and Their Prognostic Significance In
cancers Article Expression of Genomic Instability-Related Molecules: Cyclin F, RRM2 and SPDL1 and Their Prognostic Significance in Pancreatic Adenocarcinoma Anna Klimaszewska-Wi´sniewska 1,*,†, Karolina Buchholz 1,2,† , Izabela Neska-Długosz 1 , Justyna Dur´slewicz 1 , Dariusz Grzanka 1 , Jan Zabrzy ´nski 1,3 , Paulina Sopo ´nska 4, Alina Grzanka 2 and Maciej Gagat 2 1 Department of Clinical Pathomorphology, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toru´n,85-094 Bydgoszcz, Poland; [email protected] (K.B.); [email protected] (I.N.-D.); [email protected] (J.D.); [email protected] (D.G.); [email protected] (J.Z.) 2 Department of Histology and Embryology, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toru´n,85-092 Bydgoszcz, Poland; [email protected] (A.G.); [email protected] (M.G.) 3 Department of General Orthopaedics, Musculoskeletal Oncology and Trauma Surgery, Poznan University of Medical Sciences, 60-572 Pozna´n,Poland 4 Department of Obstetrics, Gynaecology and Oncology, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toru´n,85-094 Bydgoszcz, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-52-585-42-00; Fax: +48-52-585-40-49 Citation: Klimaszewska-Wi´sniewska, † These authors contributed equally to this paper. A.; Buchholz, K.; Neska-Długosz, I.; Dur´slewicz,J.; Grzanka, D.; Simple Summary: Pancreatic ductal adenocarcinoma (PDAC) is one of the worst prognostic cancers, Zabrzy´nski,J.; Sopo´nska,P.; Grzanka, for which clinically valuable prognostic factors and individualized biomarker-driven cancer therapies A.; Gagat, M. -
Multi-Omics Integrative
fcell-09-691540 July 17, 2021 Time: 18:41 # 1 ORIGINAL RESEARCH published: 22 July 2021 doi: 10.3389/fcell.2021.691540 Multi-Omics Integrative Bioinformatics Analyses Reveal Long Non-coding RNA Modulates Genomic Integrity via Competing Endogenous RNA Mechanism and Serves as Novel Biomarkers for Overall Survival in Lung Edited by: Hernandes F. Carvalho, Adenocarcinoma State University of Campinas, Brazil 1,2† 1† 1 3 1 4 Reviewed by: Zhonglin Wang , Ziyuan Ren , Rui Li , Junpeng Ge , Guoming Zhang , Yaodong Xin Karine Damasceno, and Yiqing Qu1* Gonçalo Moniz Institute (IGM), Brazil 1 Apollonia Tullo, Department of Pulmonary and Critical Care Medicine, Qilu Hospital, Cheeloo College of Medicine, Shandong University, 2 3 National Research Council, Italy Jinan, China, School of Physical Science, University of California, Irvine, Irvine, CA, United States, Department of Biology Engineering, Shandong Jianzhu University, Jinan, China, 4 School of Statistics and Management, Shanghai University *Correspondence: of Finance and Economics, Shanghai, China Yiqing Qu [email protected] †These authors have contributed Long non-coding RNA (lncRNA) plays a crucial role in modulating genome instability, equally to this work and share first immune characteristics, and cancer progression, within which genome instability was authorship identified as a critical regulator in tumorigenesis and tumor progression. However, Specialty section: the existing accounts fail to detail the regulatory role of genome instability in lung This article was submitted to adenocarcinoma -
University Pierre and Marie Curie Identification of New Regulators For
University Pierre and Marie Curie Doctoral school : Complexité Du Vivant - ED515 Nuclear Organization and Oncogenesis Unit (INSERM U993) Identification of new regulators for PML Nuclear Bodies By Thibaut Snollaerts Doctoral thesis of BIOCHEMISTRY AND MOLECULAR BIOLOGY OF THE CELL Supervised by Anne Dejean Presented and defended publicly on September 28th 2016 In front of a jury composed of: Dr. Laurent LE CAM INSERM research director Reviewer Dr. Dimitris XIRODIMAS CNRS research director Reviewer Dr. Mounira CHELBI-ALIX INSERM research director Examinator Dr. Robert WEIL CNRS research director Examinator Dr. Frederic DEVAUX UPMC university professor President Prof. Anne DEJEAN INSERM research director Thesis Director (Invited member) 1 La persévérance, c'est ce qui rend l'impossible possible, le possible probable et le probable réalisé. Perseverance is what makes the impossible possible, the possible probable and the probable realized Robert Half 2 Acknowledgements First, I would like to thank all the members of the jury: Laurent Le Cam, Dimitris Xirodimas, Mounira Chelbi-Alix, Robert Weil and Frederic Devaux who, despite a very busy schedule, took the time to take part in this thesis defense jury. I would like to thank Anne Dejean for giving me the opportunity to be part of her research team since my master internship, for giving me the chance to meet very interesting people, and for providing me with many opportunities. Thank you for the trust you put in me to carry out this complicated project as well as for providing the best working conditions, and collaborations to realize it. Thank you for all the things I was able to learn from you, your team and the world of science in which we are involved. -
The Let-7 Microrna Represses Cell Proliferation Pathways in Human Cells
Research Article The let-7 MicroRNA Represses Cell Proliferation Pathways in Human Cells Charles D. Johnson,1 Aurora Esquela-Kerscher,3 Giovanni Stefani,3 Mike Byrom,1 Kevin Kelnar,1 Dmitriy Ovcharenko,1 Mike Wilson,1 Xiaowei Wang,2 Jeffrey Shelton,1 Jaclyn Shingara,1 Lena Chin,3 David Brown,1 and Frank J. Slack3 1Asuragen, Inc.; 2Ambion, Inc., Austin, Texas, and 3Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, Connecticut Abstract seam cells (5, 15–18). Many human let-7 genes map to regions altered MicroRNAs play important roles in animal development, cell or deleted in human tumors (3), indicating that these genes may differentiation, and metabolism and have been implicated in function as tumor suppressors. In fact, let-7g maps to 3p21, which has been implicated in the initiation of lung cancers (19). Previous human cancer. The let-7 microRNA controls the timing of cell cycle exit and terminal differentiation in Caenorhabditis work has shown that let-7 may also play a role in lung cancer elegans and is poorly expressed or deleted in human lung progression (4, 5, 20). For example, let-7 is expressed at lower levels tumors. Here, we show that let-7 is highly expressed in normal in lung tumors than in normal tissue for patients with both lung tissue, and that inhibiting let-7 function leads to adenocarcinoma and squamous cell carcinoma (4, 5, 20). Under- increased cell division in A549 lung cancer cells. Over- scoring the potential importance of let-7 in lung cancer is the expression of let-7 in cancer cell lines alters cell cycle observation that postoperative survival time in lung cancer patients progression and reduces cell division, providing evidence that directly correlated with let-7 expression levels (4, 20): patients with let-7 functions as a tumor suppressor in lung cells. -
Cytotoxic T Lymphocytes Block Tumor Growth Both by Lytic Activity And
Published OnlineFirst August 15, 2014; DOI: 10.1158/2326-6066.CIR-14-0098 Research Article Cancer Immunology Research Cytotoxic T Lymphocytes Block Tumor Growth Both by Lytic Activity and IFNg-Dependent Cell-Cycle Arrest Hirokazu Matsushita1, Akihiro Hosoi1,2, Satoshi Ueha3, Jun Abe3, Nao Fujieda1,2, Michio Tomura4, Ryuji Maekawa2, Kouji Matsushima3, Osamu Ohara5, and Kazuhiro Kakimi1 Abstract To understand global effector mechanisms of CTL therapy, we spotty apoptotic or necrotic areas. Thus, tumor growth suppres- performed microarray gene expression analysis in a murine model sion was largely dependent on G1 cell-cycle arrest rather using pmel-1 T-cell receptor (TCR) transgenic T cells as effectors than killing by CTLs. Neutralizing antibody to IFNg prevented and B16 melanoma cells as targets. In addition to upregulation of both tumor growth inhibition and G1 arrest. The mechanism of genes related to antigen presentation and the MHC class I path- G1 arrest involved the downregulation of S-phase kinase-associ- way, and cytotoxic effector molecules, cell-cycle–promoting genes ated protein 2 (Skp2) and the accumulation of its target were downregulated in the tumor on days 3 and 5 after CTL cyclin-dependent kinase inhibitor p27 in the B16-fucci tumor transfer. To investigate the impact of CTL therapy on the cell cycle cells. Because tumor-infiltrating CTLs are far fewer in number than of tumor cells in situ, we generated B16 cells expressing a the tumor cells, we propose that CTLs predominantly regulate fluorescent ubiquitination-based cell-cycle indicator (B16-fucci) tumor growth via IFNg-mediated profound cytostatic effects and performed CTL therapy in mice bearing B16-fucci tumors. -
Expression Level Is a Key Determinant of E2F1-Mediated Cell Fate
Cell Death and Differentiation (2017) 24, 626–637 & 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 1350-9047/17 www.nature.com/cdd Expression level is a key determinant of E2F1-mediated cell fate Igor Shats1, Michael Deng1, Adam Davidovich1, Carolyn Zhang1, Jungeun S Kwon2, Dinesh Manandhar3, Raluca Gordân3, Guang Yao2 and Lingchong You*,1,3,4 The Rb/E2F network has a critical role in regulating cell cycle progression and cell fate decisions. It is dysfunctional in virtually all human cancers, because of genetic lesions that cause overexpression of activators, inactivation of repressors, or both. Paradoxically, the downstream target of this network, E2F1, is rarely strongly overexpressed in cancer. E2F1 can induce both proliferation and apoptosis but the factors governing these critical cell fate decisions remain unclear. Previous studies have focused on qualitative mechanisms such as differential cofactors, posttranslational modification or state of other signaling pathways as modifiers of the cell fate decisions downstream of E2F1 activation. In contrast, the importance of the expression levels of E2F1 itself in dictating the downstream phenotypes has not been rigorously studied, partly due to the limited resolution of traditional population-level measurements. Here, through single-cell quantitative analysis, we demonstrate that E2F1 expression levels have a critical role in determining the fate of individual cells. Low levels of exogenous E2F1 promote proliferation, moderate levels induce G1, G2 and mitotic cell cycle arrest, and very high levels promote apoptosis. These multiple anti-proliferative mechanisms result in a strong selection pressure leading to rapid elimination of E2F1-overexpressing cells from the population.