DOCSLIB.ORG

Anticancer Imidazoacridinone C-1311 Is Effective in Androgen-Dependent and Androgen-Independent Prostate Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Anticancer Imidazoacridinone C-1311 Is Effective in Androgen-Dependent and Androgen-Independent Prostate Cancer Cells Biomedicines 2020, 8, 292 1 of 14 Anticancer Imidazoacridinone C-1311 is Effective in Androgen-Dependent and Androgen-Independent Prostate Cancer Cells Magdalena Niemira, Barbara Borowa-Mazgaj, Samuel B. Bader, Adrianna Moszyńska, Marcin Ratajewski, Kaja Karaś, Mirosław Kwaśniewski, Adam Krętowski, Zofia Mazerska, Ester M. Hammond and Anna Skwarska Supplementary Materials A C-1212 C-1310 C-1311 C-1330 C-1371 C-1415 C-1492 B C-1296 C-1298 C-1299 C-1303 C-1305 C-1531 C-1533 Figure S1. Chemical structures of (A) imidazoacridinones and (B) triazoloacridinones. Biomedicines 2020, 8, 292 2 of 14 A 120 C-1212 C-1310 80 C-1311 C-1330 C-1371 40 C-1415 Cell viability (% of Ctr) (% of Cell viability C-1492 0 0.0001 0.001 0.01 0.1 1 10 100 Imidazoacridinones [M] B 120 C-1296 C-1298 80 C-1299 C-1303 C-1305 40 C-1531 C-1533 Cell viability (% of Ctr) (% of Cell viability 0 0.0001 0.001 0.01 0.1 1 10 100 Triazaoloacridinones [M] Figure S2. Cytotoxic activity of (A) imidazoacridinones and (B) triazoloacridinones in AR-dependent prostate cancer LNCaP cells. Cells were treated for 72 h and cell viability was measured using MTT assay. Percent of viable cells was calculated relative to dimethyl sulfoxide (DMSO) treated cells (Ctr). Dose-response curves were prepared using GraphPad Prism 8 software. Data are mean ± SD, n = 3. Biomedicines 2020, 8, 292 3 of 14 A B -log(p-value) -log(p-value) 0 20 40 60 80 100 0 5 10 15 20 Mitotic cell cycle (GO:0000278) Cell cycle: G2/M DNA damage checkpoint regulation Cell cycle (GO:0007049) Cell cycle control of chromosomal replication Chromosome organization (GO:0051276) Role of BRCA1 in DNA damage response Mitotic cell cycle process (GO:1903047) Hereditary Breast Cancer signaling Cell cycle process (GO:0022402) ATM signaling DNA conformation change (GO:0071103) Mitotic roles of polo-like kinase Cell division (GO:0051301) Role of CHK proteins in cell cycle checkpoint control Mitotic cell cycle phase transition (GO:0044772) p53 signaling Nuclear division (GO:0000280) GADD45 signaling Cell cycle phase transition (GO:0044770) DNA damage-induced 14-3-3σ signaling -log(p-value) -log(p-value) 0 5 10 15 0 5 10 Regulation of cellular metabolic process (GO:0031323) Glycolisis I Regulation of primary nitrogen compound metabolic process (GO:0051171) Gluconeogenesis I Regulation of primary metabolic process (GO:0080090) Adipogenesis pathway Regulation of metabolic process (GO:0019222) Estrogen-mediated S-phase Entry Regulation of RNA biosynthetic process (GO:2001141) Activation of IRF by Cytosolic Pattern Recognition Receptors Regulation of RNA metabolic process (GO:0051252) Role of BRCA1 in DNA Damage Response Regulation of macromolecule metabolic process (GO:0060255) p53 Signaling Response to external stimuli (GO:0009605) Cell Cycle: G1/S Checkpoint Regulation Heterocycle biosynthetic process (GO:0018130) IL-17A Signaling in Fibroblasts Regulation of cellular biosynthetic process (GO:0031326) Glucocorticoid Receptor Signaling Figure S3. Top 10 GO: Biological process terms (A) and the most representative altered canonical pathways (B) in PCa cells treated with C-1311. LNCaP and DU-145 cells were treated with 1 µM C- 1311 for 24 h and subjected to RNA-seq analysis (n = 3). Biomedicines 2020, 8, 292 4 of 14 A B 2.0 2.0 Ctr ) ) 0.1 µM C-1311 r r y t y t t t i i C 1 C µM C-1311 v 1.5 v 1.5 i i t s t s c v c v a a e e e g e 1.0 g s 1.0 n s n a a a a r ** r h *** h e e c f c f i i c d c 0.5 d l 0.5 **** l u u o o **** L f L f ( ( 0.0 0.0 r 8 2 0 1 0 1 5 2 Empty Vector ARE-Luc vector t 4 1 1 1 3 7 1 9 C 7 2 3 3 3 3 4 4 -1 -1 -1 -1 -1 -1 -1 -1 C C C C C C C C Dose: 0.1 µM C 1.5 2.5 ) ) r r y y t t t t 2.0 i i C C v v i i t t s 1.0 s c c v v a a 1.5 e e e e g g s s n n a a a a r r 1.0 h h e e c c f 0.5 f i i c c d d l l u u 0.5 o o L L f f ( ( 0.0 0.0 r 6 8 9 3 5 1 3 r 6 8 9 3 5 1 3 t 9 9 9 0 0 3 3 t 9 9 9 0 0 3 3 C 2 2 2 3 3 5 5 C 2 2 2 3 3 5 5 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 C C C C C C C C C C C C C C Dose: 0.1 µM Dose: 1 µM Figure S4. Effect of imidazoacridinones and triazoloacridinones on AR transactivation activity measured by luciferase gene reporter assay. LNCaP-ARE-Luc cells stably expressing luciferase reporter gene linked to AR-responsive promoter were treated with (A) imidazoacridinones at 0.1 µM, or (C) triazoloacridinones (0.1 or 1 µM ) for 24 h. Luciferase activity (fold-change as compared to untreated cells) is shown. Ctr, cells treated with DMSO. Data are mean ± SD, n = 3. Significance: one- way Anova test, *** p < 0.001, ** p < 0.01. (B) LNCaP cells were transiently transfected with empty vector or ARE-Luc vector, treated with C-1311 for 24 h and analyzed for luciferase expression. Data are mean ± SD, n = 3. Significance: one-way Anova test, **** p < 0.0001. Biomedicines 2020, 8, 292 5 of 14 ANG ANLN ARL6IP6 ASF1B ATAD2 AURKA AURKB BCL2L1 BUB1B CADPS2 CCNA2 CCNB2 CCNE2 CCNF CDC20 CDC25A CDC25C CDC6 CDC7 CDCA3 CDCA4 CDCA5 CDCA7 CDK1 CDK2 CDKN3 CENPM CHEK1 CKS1B CKS2 CXCR4 DNMT1 DSN1 DTL DTYMK E2F2 EAF2 ESCO2 FAM64A FAM83D FANCC FANCD2 FANCI FBXO5 FEN1 FIGNL1 FOXM1 GINS2 GINS3 H2AFX HIST1H3H HIST1H4C HIST2H4B HMGB2 HMMR IQGAP3 KIAA0101 KIF20A KLK3 KNTC1 MAD2L1 MCM10 MCM2 MCM3 MCM4 MCM5 MCM7 MELK NCAPD2 NCAPD3 NCAPG NDC80 NMU NUSAP1 PARP1 PBK POLA1 POLA2 POLE2 POLQ PRC1 PRIM1 PTTG1 RAB27A RAD51AP1 RAD54B RAD54L RFC3 RFC4 RFC5 RNASE4 RNASEH2A RRM1 SKP2 SLC25A19 SPAG5 STIL STMN1 TACC3 TGFB3 TIMELESS TK1 TOP2A TPRG1 TRIP13 TROAP TUBB TUBG1 UBE2C UBE2T UGT2A1 0 2 UHRF1 WEE1 XRCC4 ZWINT XRCC2 -2 XRCC3 LNCaP DU-145 Biomedicines 2020, 8, 292 6 of 14 Figure S5. Effect of C-1311 on the expression of AR-regulated genes in AR-negative DU-145 cells. Cells were treated with DMSO or 1 µM C-1311 for 24 h and subjected to RNA-seq. List of genes in the heat map contains genes identified as DEGs in the ‘Androgen receptor targets upregulated by AR’ gene signature for LNCaP cells (see Figure 1B). In DU-145 cells, C-1311 treatment did not affect the expression of genes that were significantly repressed in LNCaP cells. Gene expression values for each gene were normalized to the standard normal distribution to generate log fold change (FC). Genes with |log2FC| > 1 and FDR < 0.05 were considered as differentially expressed genes. Data are from three independent experiments. Biomedicines 2020, 8, 292 7 of 14 A B 6 120 C-1212 C-1310 (µM) 5 * 50 ** C-1311 4 80 * C-1330 * * C-1371 3 * * activity activity IC C-1415 2 40 C-1492 1 Ctr) (% of Cell viability Cytotoxic 0 0 0.0001 0.001 0.01 0.1 1 10 100 Imidazoacridinones [µM] Figure S6. Cytotoxic activity of C-1311 and other imidazoacridinones in AR-negative DU-145 cells. Cells were treated for 72 h and cell viability was measured using MTT assay. Percent of viable cells was calculated relative to dimethyl sulfoxide (DMSO) treated cells (Ctr). (A) The IC50 values and (B) dose-response curves were prepared using GraphPad Prism 8 software. Data are mean ± SD, n = 3. Significance: one-way Anova with Tukey’s multiple comparison test, ** p< 0.01, * p< 0.05. Biomedicines 2020, 8, 292 8 of 14 80% DMSO 80% DMSO 80% DMSO 24hr 24hr 24hr 48hr 48hr 48hr 60% 60% 60% 72hr 72hr 72hr s l s s l l l l l e 40% e e C 40% 40% C C % % % 20% 20% 20% 0% 0% 0% G1 S G2 4N G1 S G2 4N G1 S G2 4N LNCaP 22Rv1 DU-145 Figure S7. Effect of C-1311 on the PCa cell cycle progression. PCa cells were treated with DMSO or 1 µM C-1311 for 24-72 h, stained with PI and analyzed by flow cytometry. Bar graphs represent the percentage of PCa cells in G1, S, G2/M phase of the cell cycle, and polyploid cells with >4N DNA content. Data are mean ± SD, n = 3. Biomedicines 2020, 8, 292 9 of 14 Ctr C-1311 LNCaP DU-145 PI Annexin V-FITC Figure S8. C-1311 induces apoptosis in PCa cells irrespective of AR-status. Cells were treated with DMSO or 1 µM C-1311 for 72 h, stained with Annexin V/PI and analyzed by flow cytometry. Representative plots show live cells (Annexin V-/PI-, Q4), early-apoptotic cells (Annexin V+/PI-, Q3), late-apoptotic cells (Annexin V+/PI+, Q2), and necrotic cells (Annexin V-/PI+, Q1).
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
    F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Funkce CDK12 a CDK13 V Regulaci Transkripce Hana Paculová
    MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV BIOCHEMIE Funkce CDK12 a CDK13 v regulaci transkripce Disertační práce Hana Paculová Školitel: Mgr. Jiří Kohoutek, Ph.D Brno 2018 Bibliogra cký záznam Autorka: Mgr. Hana Paculová Prrodovedecáá aaául,a鏈 Maaarkáova unvverv,a Úa,av bvochemve Název práce: Funáce CDK12 a CDK13 v regulacv ,ranaárvpce Studijní program: Bvochemve Studijní obor: Bvochemve Školitel: Mgr. Jvr Kohou,eá鏈 Ph.D Akademický rok: 2017/2018 Po et stran: 89 Klí ová slova: Ckálvn-dependen,n ávnaaa鏈 CDK12鏈 ,ranaárvpce鏈 RNA polkmeraaa II鏈 raáovvna vaječnáů鏈 CHK1 Bibliographic entry Author: Mgr. Hana Paculová Facul,k oa acvence鏈 Maaarká unvverav,k Department of Biochemistry Title oF dissertation: CDK12 and CDK13 aunc,von vn ,ranacrvp,von regula,von Degree programme: Bvochemva,rk Field oF study: Bvochemva,rk Supervisor: Mgr. Jvr Kohou,eá鏈 Ph.D Academic year: 2017/2018 Number oF pages: 89 Keywords: Ckclvn-dependen ávnaae鏈 CDK12鏈 ,ranacrvp,von鏈 RNA polkmeraae II鏈 ovarvan cancer鏈 CHK1 Abstrakt Ckálvn-dependen,n ávnaaa 12 (CDK12) je ,ranaárvpčn ávnaaa鏈 á,erá rd expreav avých clových genů ,m鏈 že aoaaorkluje RNA polkmeraau II v průbehu elongačn aáe ,ranaárvpce. CDK12 je apojena do neáolváa bunečných preceaů鏈 což ahrnuje odpoveď na pošáoen DNA鏈 vývoj a bunečnou dvaerencvacv a aea,rvh mRNA. CDK12 bkla popaána jaáo jeden genů鏈 á,eré jaou čaa,o mu,ovánk v hvgh-grade aerónm ovarválnm áarcvnomu鏈 nvcméne vlvv ,ech,o mu,ac na aunácv CDK12 a jejvch role v áarcvnogenev dopoaud nebkla a,anovena. Zjva,vlv jame鏈 že ve,švna mu,ac CDK12鏈 á,eré bklk naleenk v nádorech鏈 brán vk,voren áomplexu CDK12 a Ckálvnem K a vnhvbuj ávnaaovou aá,vvv,u CDK12.
    [Show full text]
  • Examination of the Transcription Factors Acting in Bone Marrow
    THESIS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY (PHD) Examination of the transcription factors acting in bone marrow derived macrophages by Gergely Nagy Supervisor: Dr. Endre Barta UNIVERSITY OF DEBRECEN DOCTORAL SCHOOL OF MOLECULAR CELL AND IMMUNE BIOLOGY DEBRECEN, 2016 Table of contents Table of contents ........................................................................................................................ 2 1. Introduction ............................................................................................................................ 5 1.1. Transcriptional regulation ................................................................................................... 5 1.1.1. Transcriptional initiation .................................................................................................. 5 1.1.2. Co-regulators and histone modifications .......................................................................... 8 1.2. Promoter and enhancer sequences guiding transcription factors ...................................... 11 1.2.1. General transcription factors .......................................................................................... 11 1.2.2. The ETS superfamily ..................................................................................................... 17 1.2.3. The AP-1 and CREB proteins ........................................................................................ 20 1.2.4. Other promoter specific transcription factor families ...................................................
    [Show full text]
  • Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug
    cancers Article Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug Response Genes in Pediatric Acute Myeloid Leukemia David G.J. Cucchi 1 , Costa Bachas 1 , Marry M. van den Heuvel-Eibrink 2,3, Susan T.C.J.M. Arentsen-Peters 3, Zinia J. Kwidama 1, Gerrit J. Schuurhuis 1, Yehuda G. Assaraf 4, Valérie de Haas 3 , Gertjan J.L. Kaspers 3,5 and Jacqueline Cloos 1,* 1 Hematology, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; [email protected] (D.G.J.C.); [email protected] (C.B.); [email protected] (Z.J.K.); [email protected] (G.J.S.) 2 Department of Pediatric Oncology/Hematology, Erasmus MC–Sophia Children’s Hospital, 3015 CN Rotterdam, The Netherlands; [email protected] 3 Princess Máxima Center for Pediatric Oncology, 3584 CS Utrecht, The Netherlands; [email protected] (S.T.C.J.M.A.-P.); [email protected] (V.d.H.); [email protected] (G.J.L.K.) 4 The Fred Wyszkowski Cancer Research, Laboratory, Department of Biology, Technion-Israel Institute of Technology, 3200003 Haifa, Israel; [email protected] 5 Emma’s Children’s Hospital, Amsterdam UMC, Vrije Universiteit Amsterdam, Pediatric Oncology, 1081 HV Amsterdam, The Netherlands * Correspondence: [email protected] Received: 21 April 2020; Accepted: 12 May 2020; Published: 15 May 2020 Abstract: Novel treatment strategies are of paramount importance to improve clinical outcomes in pediatric AML. Since chemotherapy is likely to remain the cornerstone of curative treatment of AML, insights in the molecular mechanisms that determine its cytotoxic effects could aid further treatment optimization.
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG
    [Show full text]