Genetic Fingerprinting of Palestinian Olive (Olea Europea L.) Cultivars Using SNP Markers

Total Page:16

File Type:pdf, Size:1020Kb

Genetic Fingerprinting of Palestinian Olive (Olea Europea L.) Cultivars Using SNP Markers Jordan Journal of Agricultural Sciences, Volume 5, No.3, 2009 Genetic Fingerprinting of Palestinian Olive (Olea europea L.) Cultivars Using SNP Markers Rezq A. Basheer-Salimia* , Murad K. Awad * and Panagiotis K. Kalaitzis ** ABSTRACT The study of the genetic relationships among Palestinian olive cultivars is very important in order to assess their genetic diversity and structural details. A collection of five cultivars including Roomi, Souri, Improved Nabali, Barenge K18 and Wild Type were analyzed by using the sequences of two genes' fragments in which a panel of twenty-five Single Nucleotide Polymorphisms (SNPs) were identified. It is found that this group of SNPs is not efficient enough to discriminate among all of the cultivars. However, it is useful for varietal survey and construction of a database of Palestinian olive cultivars and for providing additional information that could constitute the basis for a rational scheme of breeding programs. Keywords: Genetic fingerprinting, SNP markers, Olive (Olea europea L.). INTRODUCTION The archaeological findings demonstrate that the Syrian- Palestinian region was the center of origin of olive The Olive (Olea europea L.) is the most important cultivation (Zohary and Hopf, 1994; Remesal- crop in Palestinian agriculture in terms of area covered Rodriguez, 1996; Basheer-Salimia, 2004). as well as economic returns. It covers about (100000) Genetically, olive, an ancient tree (Lopes et al., hectares distributed all over the West Bank and Gaza 2004), is an outcrossing diploid species (2n = 46) (Reale strip and it is distinguished as the major tree in the rain et al., 2006) cultivated throughout the Mediterranean fed areas, covering about 45% of the total cultivated area basin (Reale et al., 2006; Taamalli et al., 2006). in the West Bank and contributes to about 40% of total Nowadays, olive cultivation is significant to the rustic fruit production (PCBS, 2005). economy as well as to the environmental equilibrium of Olive in the family of Oleaceae is one of the oldest the producing regions (Lopes et al., 2004). known cultivated trees worldwide and the Identification of olive cultivars is actually Mediterranean region is considered its center of origin. sophisticated because of the huge number of varietal synonyms and homonyms (Bandelj et al., 2002). Hence, *Department of Plant Production and Protection, Faculty of Agriculture, Hebron University, Hebron, P.O.Box 40, there is a crucial necessity for the development of Palestine. methods that denominate olive efficiently and swiftly **Department of Horticultural Genetics and (Torre et al., 2004). In olive, DNA markers are being Biotechnology, Mediterranean Agronomic Institute of Chania, Chania, Greece. developed to identify and characterize olive cultivars Email: rezqbasheer@hebron.edu and to determine the varietal composition (Consolandi et Received on 11/6/2008 and Accepted for Publication on al., 2007) including randomly amplified polymorphic 11/11/2008. DNAs (RAPDs) (Hess et al., 2000; Besnard et al., -282- © 2009 DAR Publishers/University of Jordan. All Rights Reserved. Genetic Fingerprinting… Rezq A. Basheer-Salimia et al. 2001; Sanz-Cortez et al., 2001; Nikoloudakis et al., (Consolandi et al., 2007), they can be widely used for 2003; Shu-Biao and Sedgley, 2004 ), Amplified certification of cultivars and lines (Saghai Maroof et al., Fragment Length Polymorphisms (AFLPs) (Belaj et al., 1994; Khlestkina and Salina, 2006; Shirasawa et al., 2003; Sanz-Cortez et al., 2003; Sensi et al., 2003; Owen 2006). et al., 2005), Restriction Fragment Length The aim of this study is to establish an SNPs Polymorphisms (RFLPs) (Besnard and Breville, 2000; database for the Palestinian olive cultivars and to ensure Besnard et al., 2001; De Caraffa et al., 2002), Sequence that all future projects in the related field are conducted Characterized Amplified Regions (SCARs) (Hernandez on the same cultivars. et al., 2001a; Hernandez et al., 2001b; Mekuria et al., 2002; Shu-Biao and Sedgley, 2004), Simple Sequence MATERIALS AND METHODS: Repeats (SSRs) or Microsatellite Markers (Rallo et al., Plant Materials: Fresh leaves of the five Palestinian 2000; Sefc et al., 2000; Bandelj et al., 2002, Carriero et olive cultivars (Roomi, Souri, Improved Nabali, Barenge al., 2002; Cipriani et al., 2002; Shu-Biao and Sedgley, K18 and Wild Type) were randomly collected and piled 2004), Inter-Simple Sequence Repeats (ISSRs) (Hess et up in October 2006 from single plants on the campus of al., 2000; Vargas and Kadereit, 2001) and Single Hebron University (Hebron, Palestine) (Table 1). The Nucleotide Polymorphisms (SNPs) (Palmieri et al., first four cultivars represent some of the eminent 2004; Reale et al., 2006; Consolandi et al., 2007). cultivated cultivars in Palestine. Subsequently, these Single Nucleotide Polymorphisms (SNPs) are the samples were brought and stored at 4°C at most abundant form of genetic variation in most Mediterranean Agronomic Institute of Chania (Chania- organisms (Khlestkina and Salina, 2006). Because of their Greece) where this research was carried out. ability to distinguish among very similar cultivars Table (1): List of olive cultivars analyzed in this study. No. Code Cultivar name Source 1 PA1 Barenge K18 Hebron University Campus, Palestine 2 PA2 Improved Nabali Hebron University Campus, Palestine 3 PA3 Roomi Hebron University Campus, Palestine 4 PA4 Souri Hebron University Campus, Palestine 5 PA5 Wild TypeHebron University Campus, Palestine DNA Extraction: The choice of DNA extraction (Woolley et al., 2001) and Phenol/chloroform purification protocol depends on the quality and the quantity of the and ethanol precipitation were carried out as described in: DNA needed, nature of samples and the presence of (Sambrook et al., 1989)] was used for DNA extraction natural substances that may interfere with the extraction from the leaves of the five cultivars. The use of and subsequent analysis (Semagn et al., 2006). Therefore, cycloartenol synthase and lupeol synthase genes, which CTAB method by Woolley (Woolley et al., 2001) with are entailed in sterol biosynthesis (Haralampidis et al., few modifications [RNase was added additionally to 2001; Stiti et al., 2007), is based on what has been found -283- Jordan Journal of Agricultural Sciences, Volume 5, No.3, 2009 in the olive genome (Palmieri et al., In Press; Reale et al., PCR reaction mix up to the appropriate volume. 2006). The amplifications of cycloartenol synthase and Polymerase chain reaction was carried out by initial lupeol synthase were carried out by Polymerase Chain denaturation of template DNA for 10 minutes at 95°C, Reaction (PCR) using their primer pairs Cyclo2, Cyclo3 followed by 35 cycles of denaturation (95°C for 30 s), and Lup, respectively. annealing (60°C for 30 s)and extension (72°C for 60 s), PCR: Its amplifications were carried out using 1 x with a final extension step at 72°C for 10 minutes. PCR AmpliTaqGold® PCR buffer (100mM Tris-HCl (pH products were then purified using (Strata Prep® DNA 8.3), 500mM KCl), 2.5 mM MgCl2, 200 µM for each Gel Extraction Kit). To check the quality as well as the dNTP, 0.3 µM for forward and reverse primers (Table quantity of the DNA of these amplicons before the 2), 0.05 U/µL of AmpliTaqGold® polymerase (an ultra sequencing step of those samples, 1 µl of loading buffer pure and stable polymerase with proof reading activity) and 3 µl of the purified DNA of each cultivar was loaded and 5 µL of DNA template (25 ng/µl) per 100 µL of on a 2% (v/v) agarose gel stained with ethidium bromide reaction volume. Sterile-ddH2O was also added to the and visualized with UV light. Table (2): Primers used for targeted amplification strategy. NCBI Amplico Primer Ta Extension Locus name Primer sequence (5`→3`) accession n size Reference name (oC) time (min.) no. (bp) Cycl2-F 5`ATTCTTTTGGCTACTTGGACATCTTT3` Cycl2-R 5`AACCCTCAGCTGTGCAATCTG3` (Reale et AY847065 60 1 901 Cycl3-F 5`ATTTCAGATTGCACAGCTGAGG3` al., 2006) Cycloartenol synthase Cycl3-R 5`ATCCTGAGGAAATCATCTCCATTT3` Cyc2a-F 5`ATTCTTTTGGCTACTTGGACATCT3` Present AY847065 50 0.5 257 Cyc2a-R 5`GGAGATTGTAGCAATGTTGATATG3` study Lup-F 5`CTAACTCGATGGCCGTTTTCTAA3` (Reale et AY847066 60 1 501 Lupeol Lup-R 5`GCAACTCAAATGAATGAATCATGAT3` al., 2006) synthase Lup2-F 5`GCAACTCAAATGAATGAATC3` Present AY847066 50 0.5 ≈300 Lup2-R 5`AACTCATGTTTTGTAGGTG3` study Note: The sequences, Ta (anneling temperature), extension time used for PCR and expected amplicon sizes in the PCR are given. Cyc2a-F/R and Lup2- F/R primer pairs were designed by using PrimerExpress® 2.0 Software (Applied Biosystems) to amplify shorter fragments than those given by Cyclo2- F/R, Cyclo3-F/R and Lup-F/R and their PCR products will be used for the genotyping step. To check the uniqueness of the complementary DNA region against new primers, a BLASTn search (Altschul et al., 1990) was carried out. SNP Discovery: It was carried out based on the (LS) primers, Table 2, and on the sequencing of PCR amplification of DNA fragments using locus-specific products instantly from all five olive cultivars. -284- Genetic Fingerprinting… Rezq A. Basheer-Salimia et al. Sequencing was performed with one of the PCR primers Mix, 3 µL of previously cleaned up PCR product, 1 µL using BigDye® Terminator cycle sequencing in an ABI of 2 pM SNP primer (Table 3) and 1 µL sterile-ionized- ® Prism 310 Genetic Analyzer (Applied Biosystems). distil H2O. The mixture was incubated at 95°C for 25 Three methods; namely visual inspection, BioEdit cycles for 10 s, 50°C for 5 s, 60°C for 30 s and software (Hall, 1999) and SeqDoc software (Crowe, eventually at 4°C. The whole primer extension product 2005) were used to identify the polymorphisms among (10 µl) was mixed with 1 µL shrimp alkaline the sequencing traces obtained from Genetic Analyzer phosphatase (USB Corporation), incubated at 37°C for by aligning them against each other. 60 minutes and ultimately at 75°C for 15 minutes . SNP Genotyping Subsequently, 0.5 µL of the sample was blended with Genotyping of the cultivars’ SNPs was carried out in 0.5 µl of GeneScan™ -120 LIZ™ size standard and 9 µL 10 µl reactions.
Recommended publications
  • Evolution and Sustainability of the Olive Production Systems
    Evolution and sustainability of the olive production systems Fernandez Escobar R., de la Rosa R., Leon L., Gomez J.A., Testi F., Orgaz M., Gil-Ribes J.A., Quesada-Moraga E., Trapero A. in Arcas N. (ed.), Arroyo López F.N. (ed.), Caballero J. (ed.), D'Andria R. (ed.), Fernández M. (ed.), Fernandez Escobar R. (ed.), Garrido A. (ed.), López-Miranda J. (ed.), Msallem M. (ed.), Parras M. (ed.), Rallo L. (ed.), Zanoli R. (ed.). Present and future of the Mediterranean olive sector Zaragoza: CIHEAM / IOC Options Méditerranéennes : Série A. Séminaires Méditerranéens; n. 106 2013 pages 11-42 Article available on line / Article disponible en ligne à l’adresse : -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- http://om.ciheam.org/article.php?IDPDF=6803 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- To cite this article / Pour citer cet article -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Fernandez Escobar R., de la Rosa R., Leon L., Gomez J.A., Testi F., Orgaz M., Gil-Ribes J.A., Q uesada- Moraga E., Trapero A. Evolution and sustainability of the olive production systems. In : Arcas N. (ed.), Arroyo López F.N. (ed.), Caballero J. (ed.), D'Andria R. (ed.), Fernández M. (ed.), Fernandez
    [Show full text]
  • For Peer Review
    Journal of the Science of Food and Agriculture Impact assessment of mechanical harvest on fruit physiology and consequences on oil physicochemical and sensorial quality from ‘Manzanilla de Sevilla’ and ‘Manzanilla Cacereña’ super-high density hedgerows. A For Peerpreliminary Review study Journal: Journal of the Science of Food and Agriculture Manuscript ID: JSFA-14-1781.R1 Wiley - Manuscript type: Research Article Date Submitted by the Author: 15-Oct-2014 Complete List of Authors: Morales-Sillero, Ana; Universidad de Sevilla, Departamento de Ciencias Agroforestales Garcia, Jose; Instituto de la Grasa, Fisiología y Tecnología de Productos Vegetales Olea europaea L, SHD orchards, grape straddle harvester, ethylene Key Words: production, oxidative stability, phenols JSFA@wiley.com Page 1 of 30 Journal of the Science of Food and Agriculture 1 2 3 Impact assessment of mechanical harvest on fruit physiology and consequences on 4 5 oil physicochemical and sensorial quality from ‘Manzanilla de Sevilla’ and 6 7 ‘Manzanilla Cacereña’ super-high density hedgerows. A preliminary study 8 9 10 11 12 Running title: Impact of grape harvester on fruit physiology and oil quality from 13 14 SHD olive hedgerows 15 16 17 18 Ana Morales-Sillero,Fora José MªPeer García b* Review 19 20 * b 21 Correspondence to: José Mª García Dpto. Fisiología y Tecnología de Productos 22 23 Vegetales. Instituto de la Grasa (CSIC). Avda. Padre García Tejero 4, 41012 Sevilla, 24 25 Spain. E-mai:l jmgarcia@cica.es 26 27 28 29 a 30 Dpto. Ciencias Agroforestales, ETSIA, Universidad de Sevilla, Carretera de Utrera, 31 32 km 1, 41013 Sevilla, Spain. 33 34 b Dpto.
    [Show full text]
  • Evaluation of Pomological Traits and Classification of Some Olive Cultivars in Zanjan Province
    ”ﻣﺠﻠﻪ ﺑﻪﻧﮋادي ﻧﻬﺎل و ﺑﺬر” ﺟﻠﺪ 1-28، ﺷﻤﺎره 1، ﺳﺎل 1391ت ﻣﺠﻠﻪ ﺑﻪﻧﮋادي ﻧﻬﺎل و ﺑﺬر ﺟﻠﺪ 1-29 ، ﺷﻤﺎره 4، ﺳﺎل 1392 ارزﻳﺎﺑﻲ ﺧﺼﻮﺻﻴﺎت ﭘﻮﻣﻮﻟﻮژﻳﻜﻲ و ﮔﺮوهﺑﻨﺪي ﺑﺮﺧﻲ ارﻗﺎم زﻳﺘﻮن در اﺳﺘﺎن زﻧﺠﺎن Evaluation of Pomological Traits and Classification of some Olive Cultivars in Zanjan Province اﻟﻬﺎم ﭘﻮراﺳﻜﻨﺪري1، ﻋﻠﻲ ﺳﻠﻴﻤﺎﻧﻲ2، ﺟﻼل ﺻﺒﺎ3 و ﻣﻬﺪي ﻃﺎﻫﺮي4 1، 2 و 3- ﺑﻪ ﺗﺮﺗﻴﺐ داﻧﺸﺠﻮي ﺳﺎﺑﻖ ﻛﺎرﺷﻨﺎﺳﻲ ارﺷﺪ ﻋﻠﻮم ﺑﺎﻏﺒﺎﻧﻲ، اﺳﺘﺎدﻳﺎر و داﻧﺸﻴﺎر، داﻧﺸﻜﺪه ﻛﺸﺎورزي، داﻧﺸﮕﺎه زﻧﺠﺎن 4- ﻣﺮﺑﻲ، ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﻛﺸﺎورزي و ﻣﻨﺎﺑﻊ ﻃﺒﻴﻌﻲ زﻧﺠﺎن ﺗﺎرﻳﺦ درﻳﺎﻓﺖ: 6/6/1391 ﺗﺎرﻳﺦ ﭘﺬﻳﺮش: 1391/12/10 ﭼﻜﻴﺪه ﭘﻮراﺳﻜﻨﺪري، ا .، ﺳﻠﻴﻤﺎﻧﻲ، ع .، ﺻﺒﺎ، ج . و ﻃﺎﻫﺮي، م. 1392. ارزﻳﺎﺑﻲ ﺧﺼﻮﺻﻴﺎت ﭘﻮﻣﻮﻟﻮژﻳﻜﻲ و ﮔﺮوهﺑﻨﺪي ﺑﺮﺧﻲ ارﻗـﺎم زﻳﺘـﻮن در اﺳـﺘﺎن زﻧﺠـﺎن . ﻣﺠﻠـﻪ ﺑﻪﻧﮋادي ﻧﻬﺎل و ﺑﺬر 29-1: 636 - 623. ﺑﺮاي ﺑﺮرﺳﻲ ﺧﺼﻮﺻﻴﺎت ﻣﻴﻮه و ﮔﺮوه ﺑﻨﺪي ارﻗﺎم زﻳﺘﻮن، آزﻣﺎﻳـﺸﻲ روي ﺑﻴـﺴﺖ رﻗـﻢ زﻳﺘـﻮن ﻃـﻲ دو ﺳـﺎ ل (1390-1389) در اﻳﺴﺘﮕﺎه ﺗﺤﻘﻴﻘﺎت زﻳﺘﻮن ﮔﻴﻠﻮان (زﻧﺠﺎن) اﻧﺠﺎم ﺷﺪ . آزﻣﺎﻳﺶ در ﻗﺎﻟﺐ ﻃـﺮح اﺳـﭙﻠﻴﺖ ﭘـﻼت در زﻣﺎن ﺑﺎ ﻃﺮح ﭘﺎﻳﻪ ﻛﺎﻣﻼً ﺗﺼﺎدﻓﻲ ﺑﺎ ﺳﻪ ﺗﻜﺮار اﺟﺮا ﺷﺪ . ﮔﺮوهﺑﻨﺪي ارﻗﺎم ﺑﺮ اﺳﺎس ﺻـﻔﺎت وزن ﺗـﺮ و ﺧـﺸﻚ ﻣﻴـﻮه، ﻧﺴﺒﺖ ﮔﻮﺷﺖ ﺑﻪ ﻫﺴﺘﻪ و درﺻﺪ روﻏﻦ ﺑﺎ اﺳﺘﻔﺎده از ﺗﺠﺰﻳﻪ ﺧﻮﺷﻪ اي و ﺗﺠﺰﻳﻪ ﺑﻪ ﻣﺆﻟﻔﻪﻫﺎي اﺻﻠﻲ اﻧﺠﺎم ﺷـﺪ . ﻧﺘـﺎﻳﺞ ﺗﺠﺰﻳﻪ وارﻳﺎﻧﺲ ﺗﻔﺎوت ﻣﻌﻨﻲ داري ﻣﻴﺎن رﻗﻢ، ﺳﺎل و اﺛﺮ ﻣﺘﻘﺎﺑﻞ ﺑﺮاي اﻛﺜﺮ ﺻﻔﺎت ﻧﺸﺎن داد . ﺑﺮ اﺳﺎس ﻧﺘـﺎﻳﺞ ﺗﺠﺰﻳـﻪ ﺧﻮﺷﻪ اي و ﺗﺠﺰﻳﻪ ﺑﻪ ﻣﺆﻟﻔﻪ ﻫﺎي اﺻﻠﻲ، ارﻗﺎم از ﻧﻈﺮ ﺻﻔﺎت ارزﻳﺎﺑﻲ ﺷﺪه ﺑﻪ ﺧﻮﺑﻲ از ﻳﻚ دﻳﮕﺮ ﺗﻔﻜﻴﻚ ﺷـﺪﻧﺪ . ﺑـﺮ اﻳﻦ اﺳﺎس، ارﻗ ﺎم ﻛﺎرﻳﺪوﻟﻴﺎ، ﭘﻴﻜﻮآل، وﻟﻴﻮﺗﻴﻜﻲ و ﻛﺎﻳﺴﻲ ﺑﻴﺸﺘﺮﻳﻦ وزن ﻣﻴﻮه و ﻧﺴﺒﺖ ﮔﻮﺷﺖ ﺑﻪ ﻫﺴﺘﻪ را داﺷـﺘﻨﺪ و ﺑﻪ ﻋﻨﻮان ارﻗﺎم ﻣﻨﺎﺳﺐ ﻛﻨﺴﺮوي وSID ارﻗﺎم ﻛﺎﻳﻠﺘﻪ، of ﻛﺮوﻧﺎﺋﻴﻜﻲ، آرﺑﻜﻴﻦ، ﻟﭽﻴﻨﻮ، ﺑﻠﻴﺪي و ﻧﺒﺎﻟﻲ ﺑﺎ Archiveدرﺻﺪ ﺑﺎﻻي روﻏﻦ ﺑﻪ ﻋﻨﻮان ارﻗﺎم روﻏﻨﻲ ﺷﻨﺎﺳﺎﺋﻲ ﺷﺪﻧﺪ .
    [Show full text]
  • Pdf 266.47 K
    DOI: http://dx.doi.org/10.22092/cbj.2012.100455 Genetic and morphological variation in Iranian olive (Olea europaea L.) germplasm E. Dastkara*, A. Soleimanib, H. Jafaryc, and M. R. Naghavid a,cAgricultural and Natural Resources Research Center of Zanjan Province, Zanjan, Iran bFaculty of Agriculture, University of Zanjan, Zanjan, Iran. dAgricultural and Natural Resources Campus, University of Tehran, Karaj, Iran *Corresponding author’s E-mail address: edastkar@yahoo.com Received: March 2013 Accepted: October 2013 ABSTRACT Dastkar, E., Soleimani, A., Jafary, H., and Naghavi, M. R. 2013. Genetic and morphological variation in Iranian olive (Olea europaea L.) germplasm. Crop Breeding Journal 3(2):99-106. Olive cultivars with specific characteristics have been developed thanks to Iran’s particular climatic conditions and long-term olive cultivation. The genetic variation and relationships among 40 olive cultivars, as well as 17 unknown genotypes from the national olive collection orchard at Tarom Research Station, Zanjan, Iran, were evaluated using SSR markers. Using 10 microsatellite primer pairs, 43 polymorphic bands were obtained on 57 olive genotypes. In addition to molecular markers, 14 morphological traits were measured in all olive genotypes. Based on discriminant and cluster analysis, the group of Iranian genotypes showed the greatest genetic distance from Spanish, Greek, Syrian, Italian and French groups. Based on cluster analysis using molecular and morphological data, most of the unknown genotypes showed high genetic similarity with genotypes from Spain and Syria. Despite the high genetic variation among cultivars in each group, geographical origin had significant impact on observed variability using Shannon’s information index and polymorphism information of olive accessions.
    [Show full text]
  • 100 Years of Breeding
    100 years of breeding CEREAL FIBER FORAGE FRUIT GERMPLASM NUTS OILSEED ORNAMENTAL VEGETABLE PLANT BREEDING ACADEMY RESEARCH AND InfORMATION CENTERS Plant Breeding Program COLLEGE OF AGRICULTURAL AND ENVIRONMENTAL SCIENCES Office of the Dean COLLEGE OF AGRICULTURAL AND ENVIRONMENTAL SCIENCES AOffice ofnote the Dean from the editor ummarizing 100 years of history not only California, but the United Sin plant breeding at UC Davis is States and in many cases the world, a formidable task. As a land-grant to enjoy fresh produce throughout university, UC Davis has played the year. This publication captures a major role in developing and the impact that UC Davis has had managing many of the more than on developing crops through plant 350 plant commodities now grown breeding over the last century and in California. The diversity of crops just as importantly, highlights the ranges across vegetables, fruits, nuts, people who have made this possible. grains, forages, ornamentals and turf. ! In the early 1900s the focus was on a few grain crops, and has expanded considerably since that time. The application of plant breeding and training of breeders at UC Davis ALLEN VAN DEYNZE focused on the unique and diverse (530) 754-6444 California environment, allowing avandeynze@ucdavis.edu Table of contents Peach, processing 20 VEGETABLE Strawberry 22 Artichoke 36 Dean’s address 3 Prune and plum 24 Carrot 37 Celery 38 CEREAL GERMPLASM Garlic 39 Oat 4 Foundation Seed Program 25 Grain legumes 40 Other Triticeae 5 Foundation Plant Services 26 Lettuce 42 Rice
    [Show full text]
  • Analysis of the Olive Genome Irene Consuelo Julca Chávez
    ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼús establertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184 ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de uso establecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/ WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions set by the following Creative Commons license: https://creativecommons.org/licenses/?lang=en Analysis of the Olive genome Irene Consuelo Julca Chavez´ Universitat Autonoma` de Barcelona Faculty of Bioscience Department of Animal Biology, Plant Biology and Ecology TESI DOCTORAL UAB 2017 Analysis of the Olive genome A thesis submitted by Irene Consuelo Julca Chavez´ for the degree of Doctor in Plant Biology and Biotechnology under the direction of Dr. Toni Gabaldon,´ Dr. Pablo Vargas, and tutored by Dr. Josep Allue` This thesis has been inscribed in the Plant Biology and Biotechnology PhD program from the Universitat Autonoma` de Barcelona Director Codirector Dr. Toni Gabaldon´ Dr. Pablo Vargas Centre for Genomic Regulation Royal Botanical Garden of Madrid Tutor PhD student Dr. Josep Allue` Irene Julca Universitat Autonoma` de Barcelona Universitat Autonoma` de Barcelona Barcelona, September 2017 A mis padres Delia Ch´avezy Jos´eJulca. ”Discovery consists of seeing what everybody has seen, and thinking what nobody has thought.” Albert Szent-Gy¨orgyi Acknowledgments A veces pequenas˜ decisiones cambian el curso de nuestras vidas. Todo empezo´ cuando decid´ı dejar el laboratorio y las pipetas por bioinformatica.´ Que idea mas´ loca, iniciar todo de nuevo y encima trabajando en genomas de plantas! En esta historia hubo un poco de suerte porque encontre´ un grupo muy agradable, aqu´ı en Barcelona.
    [Show full text]
  • CHECKLIST for CULTIVARS of Salix L. (Willow)
    CHECKLIST for CULTIVARS of Salix L. (willow) International Salix Cultivar Registration Authority FAO - International Poplar Commission FIRST VERSION November 2015 Yulia A. Kuzovkina ISBN: 978-0-692-56242-0 CHECKLIST for CULTIVARS of Salix L. (willow) CONTENTS Introduction…………………………………………………………………………………….3 Glossary………………………………………………………………………………………...5 Cultivar names in alphabetical order………………………………………………………..6 Cultivar names by species…………………………………………………………………...32 Acknowledgements…………………………………………………………………………157 References……………………………………………………………………………………157 AGM = UK Award of Garden Merit plant and other awards made by the RHS Council CPVO = Community Plant Variety Office database (https://cpvoextranet.cpvo.europa.eu/ ) IPC FAO = International Poplar Commission of the Food and Agriculture Organization of the United Nations LNWP = List of Names of Woody Plants: International Standard ENA (European Nurserystock Association) 2010–2015 or 2005–2010 by M. Hoffman. PIO = Plant Information Online (University of Minnesota) PS= PlantScope (www.plantscope.nl) RHS HD= Royal Horticultural Society Horticultural Database RHS PF = Royal Horticultural Society Plant Finder Page 2 CHECKLIST for CULTIVARS of Salix L. (willow) Introduction The Checklist for Cultivars of Salix L. includes all possible cultivar names with comments. The cultivar name entry may include the following: Epithet. Accepted names are given in bold type. Bibliography. This is presented in parentheses after the epithet whenever available and includes the original botanical name to
    [Show full text]
  • Irrigation and Water Quality for Olive.Pdf
    Sustainable irrigation scheduling and water quality for olives Kostas Chartzoulakis ELGO, Institute for Olive Tree, Subtropical Plants and Grapevines, Agrokipio 731 00, Chania, Crete, Greece Abstract Olive trees can grow without irrigation in areas with annual rainfall of 400-600 mm, but for high yields irrigation during the dry months is essential. The critical growth stages for water for olive are: 1) the bud differentiation 2) the flowering and fruit-set and 3) the pit hardening and rapid fruit development. Water deficits may result in reduced number of inflorescences, production of imperfect flowers, flower drop and reduction of the fruit set percentage. Furthermore, it reduces the annual shoot length, leaf area, leaf number and next years‟ yield. Adequate soil water increase the number of fruits (mostly to trees with small or medium production) and the total oil production per plant, while fruit oil content is reduced from 0 to 10%. Irrigation may reduce polyphenol content and increase saturated fatty acids, while K232, K220 values and organoleptic olive oil characteristics are not affected. The irrigation requirements of olive tree vary according to the cultivar and the growth stage. Olive tree is considered as moderately salt tolerant and recent studies suggest that olives can be irrigated with water containing 3200 mg/l of salt (ECw of 5 dS/m) producing new growth at leaf Na levels of 0.4-0.5% d.w. Salt tolerance in olives appears to be cultivar-dependent and is likely due to control of net salt import to the shoot. High salinity generally reduces olive yield. Salinity increases or does not affect oil content of the fruit, although the extent of this reduction changes with cultivar.
    [Show full text]
  • Genetic Mapping of the Incompatibility Locus in Olive and Development of a Linked Sequence-Tagged Site Marker
    Genetic Mapping of the Incompatibility Locus in Olive and Development of a Linked Sequence-Tagged Site Marker Roberto Mariotti, Alice Fornasiero, Soraya Mousavi, Nicolò G.M. Cultrera, Federico Brizioli, Saverio Pandolfi, Valentina Passeri, Martina Rossi, Gabriele Magris, Simone Scalabrin, et al. To cite this version: Roberto Mariotti, Alice Fornasiero, Soraya Mousavi, Nicolò G.M. Cultrera, Federico Brizioli, et al.. Genetic Mapping of the Incompatibility Locus in Olive and Development of a Linked Sequence-Tagged Site Marker. Frontiers in Plant Science, Frontiers, 2020, 10, 10.3389/fpls.2019.01760. hal-02997321 HAL Id: hal-02997321 https://hal.archives-ouvertes.fr/hal-02997321 Submitted on 25 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License ORIGINAL RESEARCH published: 28 January 2020 doi: 10.3389/fpls.2019.01760 Genetic Mapping of the Incompatibility Locus in Olive and Development of a Linked Sequence- Tagged Site Marker † † Roberto Mariotti 1 , Alice Fornasiero 2,3
    [Show full text]
  • Marcadores Moleculares De Dna E Suas Aplicações Na
    African Journal of Biotechnology Vol. 12(8), pp. 767-779, 20 February, 2013 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJBX12.015 ISSN 1684–5315 ©2013 Academic Journals Review Applications of biotechnology in olive Geraldo Magela de Almeida Cançado1*, Tesfahun Alemu Setotaw1 and Juliano Lino Ferreira2 1Plant Biotechnology Laboratory, Empresa de Pesquisa Agropecuária de Minas Gerais (EPAMIG), Caldas, MG, Zip Code 37.780-000, Brazil. 2Embrapa Pecuária Sul. Bagé, RS, Zip Code 96401-970, Brazil. Accepted 21 December, 2012 Many scientific and technological fields make use of biotechnology. Among the most important applications of biotechnology in agriculture are large-scale commercial micropropagation, genetic transformation and the development of transgenic varieties, embryo rescue in plant breeding programs, genotyping based on DNA markers, studies of genetic evolution and diversity, and genome sequencing. These myriad applications of modern biotechnology and molecular biology are being applied to the olive tree, a crop cultivated for thousands of years in many places of the world and whose products are consumed globally. The selection and development of olive cultivars by conventional breeding methods is costly and time consuming, therefore, the application of biotechnology procedures and techniques, such as in vitro cultivation, molecular markers, and genomic and genetic transformation in this species may facilitate the improvement of important traits of this crop, such as biotic and abiotic resistance and tolerance, yield performance and oil quality. In this review, we present current applications of modern biotechnology and molecular biology in olive species. Key words: Olea europaea, tissue culture, molecular markers, genetic transformation, genomic diversity. INTRODUCTION Olive (Olea europaea L.) is a perennial plant species that combination of techniques that permit the manipulation is widely cultivated and consumed worldwide, including in and use of microorganisms, plants and animals with the Brazil.
    [Show full text]
  • A Guide to Sorghum Breeding
    A Guide to Sorghum Breeding Second Edition Leland R. House January 1985 ICRISAT International Crops Research Institute for the Semi-Arid Tropics ICRISAT Patancheru P.O. Andhra Pradesh 502 324, India CONTENTS Foreword vii Morphology of Sorghum 12 About This Book viii Roots 12 Acknowledgments ix Culms 13 SECTION 1. THE SORGHUM PLANT: USES, Leaves 13 CHARACTERISTICS, DISTRIBUTION Infloresence 14 Sorghum Uses 1 Panicle 14 Basic Characteristics 2 Raceme 14 Yield Potential 2 Adaptability 2 SECTION 3. GENETICS Fertilizer Response 2 Basic Genetics 27 Water Relations 2 Biological Variation 27 Temperature Relations 2 Basis of Heredity 28 Plant Protection 2 Mitosis 29 Current Production Data 3 Process of Mitosis 29 Sorghum Domestication 3 Meiosis 29 Origin 3 Process of Melosis 31 Early Geographic Spread 4 Gametogenesls and Fertilization 33 Taxonomy 4 Fertilization 33 Species Classifications 4 Single-Factor Inheritance 33 Cultivated Sorghum 7 Basic Laws 33 Wild Sorghum 9 Symbols 36 References 9 Alleles 36 Intermediate Phenotypes 37 SECTION 2. THE SORGHUM PLANT: GROWTH STAGES AND MORPHOLOGY Segregation 37 Growth Stages 11 Test Cross 37 Vegetative Phase 11 Reduction of Heterozygosity by Selfing 38 Germination and Seedling Backcrossing 38 Development 11 Reproductive Phase 11 Independent Assortment 40 Inflorescence Development Dlhybrid Segregation 40 and Fertilization 11 Dihybrld Test Cross 41 Maturation Phase 12 Linkage 42 Seed Development 12 Linked Genes 42 Crossing Over 42 SECTION 4. SORGHUM IMPROVEMENT: Chromosome Mapping 42 METHODS AND PROCEDURES
    [Show full text]
  • 3165-Barros and Cosme-1.Vp
    198 P. MARTINS-LOPES et al.: Markers for Food Traceability, Food Technol. Biotechnol. 51 (2) 198–207 (2013) ISSN 1330-9862 review (FTB-3172) Molecular Markers for Food Traceability Paula Martins-Lopes*, Sónia Gomes, Leonor Pereira and Henrique Guedes-Pinto Institute of Biotechnology and Bioengineering, Centre of Genomics and Biotechnology, University of Trás-os-Montes and Alto Douro (IBB/CGB-UTAD), P.O. Box 1013, PT-5001-801 Vila Real, Portugal Received: August 16, 2012 Accepted: January 17, 2013 Summary DNA analysis with molecular markers has opened a way to understand complex or- ganism's genome. It is presently being widely applied across different fields, where food takes a preeminent position. Constant outbreaks of foodborne illnesses are increasing con- sumer's attention towards more detailed information related to what they are consuming. This overview reports on the areas where food traceability has been considered, and the problems that still remain to be bypassed in order to be widely applied. An outline of the most broadly used PCR-based methods for food traceability is described. Applications in the area of detection of genetically modified organisms, protected denomination of origin, allergenic and intolerance reactions are detailed in order to understand the dimension of the performed studies. Key words: food traceability, DNA extraction, PCR-based methods, molecular markers, GMO Introduction values, (ii) presence of genetically modified organisms (GMO), (iii) allergens (e.g. peanuts, milk, mustard or Traceability/product tracing is defined by the Codex fish), and (iv) food additives. Alimentarius Commission as the ability to follow the movement of a food through specified stage(s) of its pro- GMO legislation varies among countries; according duction, processing, and distribution (1).
    [Show full text]