DOCSLIB.ORG

Mouse Ssc4d Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Ssc4d Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ssc4d Knockout Project (CRISPR/Cas9) Objective: To create a Ssc4d knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ssc4d gene (NCBI Reference Sequence: NM_001160366 ; Ensembl: ENSMUSG00000029699 ) is located on Mouse chromosome 5. 11 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000111152). Exon 2~11 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 0.06% of the coding region. Exon 2~11 covers 100.0% of the coding region. The size of effective KO region: ~9451 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 7 8 9 10 11 Legends Exon of mouse Ssc4d Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(28.45% 569) | C(23.6% 472) | T(24.75% 495) | G(23.2% 464) Note: The 2000 bp section upstream of start codon is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(25.45% 509) | C(25.65% 513) | T(25.8% 516) | G(23.1% 462) Note: The 2000 bp section downstream of stop codon is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr5 - 135970348 135972347 2000 browser details YourSeq 226 658 1400 2000 91.3% chr1 + 27412071 27538199 126129 browser details YourSeq 165 510 819 2000 88.9% chr19 - 4054480 4054782 303 browser details YourSeq 164 653 1149 2000 93.6% chr16 + 33166535 33167153 619 browser details YourSeq 155 638 827 2000 89.9% chr1 - 93632205 93632386 182 browser details YourSeq 155 653 906 2000 88.2% chr3 + 129790725 129790956 232 browser details YourSeq 152 655 837 2000 89.4% chr11 - 79732749 79732917 169 browser details YourSeq 152 638 826 2000 96.4% chr3 + 63975362 63975849 488 browser details YourSeq 151 520 821 2000 89.0% chr6 - 87940008 87940305 298 browser details YourSeq 151 652 835 2000 90.0% chr14 - 66283790 66283964 175 browser details YourSeq 151 654 825 2000 94.2% chr11 - 105185393 105185568 176 browser details YourSeq 150 649 825 2000 90.6% chr15 + 83139993 83140163 171 browser details YourSeq 150 654 835 2000 92.7% chr12 + 36097560 36097746 187 browser details YourSeq 150 654 826 2000 91.9% chr11 + 6577136 6577306 171 browser details YourSeq 149 436 771 2000 86.3% chr16 - 13845629 13845869 241 browser details YourSeq 148 638 823 2000 88.5% chr16 - 62358719 62358896 178 browser details YourSeq 148 634 825 2000 88.4% chr15 + 100538347 100538524 178 browser details YourSeq 147 653 825 2000 90.4% chr2 - 20817049 20817214 166 browser details YourSeq 147 654 823 2000 91.4% chr16 - 90723459 90723622 164 browser details YourSeq 146 654 829 2000 92.5% chr3 - 131616025 131616501 477 Note: The 2000 bp section upstream of start codon is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr5 - 135958895 135960894 2000 browser details YourSeq 184 1500 1881 2000 89.0% chr4 - 141138009 141138358 350 browser details YourSeq 181 1620 1889 2000 89.2% chrX - 139411206 139411415 210 browser details YourSeq 181 1510 1876 2000 89.3% chr12 - 83616029 83616306 278 browser details YourSeq 180 1510 1867 2000 87.1% chr5 - 129079497 129079713 217 browser details YourSeq 176 1695 1889 2000 93.2% chr11 - 20198740 20198930 191 browser details YourSeq 176 1686 1889 2000 94.1% chr10 - 62924885 62925092 208 browser details YourSeq 176 1695 1886 2000 94.8% chr1 - 156676932 156677122 191 browser details YourSeq 175 1688 1891 2000 94.0% chr11 + 94589039 94589251 213 browser details YourSeq 174 1506 1876 2000 86.5% chr1 - 4877234 4877508 275 browser details YourSeq 173 1695 1889 2000 95.4% chr8 - 25583500 25583698 199 browser details YourSeq 173 1695 1889 2000 95.3% chr5 - 7084557 7084754 198 browser details YourSeq 173 1695 1889 2000 95.4% chr2 - 119129123 119129327 205 browser details YourSeq 173 1695 1889 2000 95.8% chr8 + 60903518 60903724 207 browser details YourSeq 173 1695 1889 2000 95.4% chr2 + 34715714 34715912 199 browser details YourSeq 173 1695 1889 2000 95.4% chr11 + 76281872 76282070 199 browser details YourSeq 173 1695 1889 2000 95.4% chr1 + 86467852 86468050 199 browser details YourSeq 172 1695 1876 2000 97.3% chr9 - 122346692 122346873 182 browser details YourSeq 171 1427 1876 2000 88.1% chrX - 73834048 73834462 415 browser details YourSeq 171 1695 1889 2000 94.8% chr2 + 165030009 165030207 199 Note: The 2000 bp section downstream of stop codon is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Ssc4d scavenger receptor cysteine rich family, 4 domains [ Mus musculus (house mouse) ] Gene ID: 109267, updated on 12-Aug-2019 Gene summary Official Symbol Ssc4d provided by MGI Official Full Name scavenger receptor cysteine rich family, 4 domains provided by MGI Primary source MGI:MGI:1924709 See related Ensembl:ENSMUSG00000029699 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Srcrb4d; S4D-SRCRB; SRCRB-S4D; C330016E03Rik Expression Ubiquitous expression in ovary adult (RPKM 2.1), genital fat pad adult (RPKM 2.0) and 28 other tissues See more Orthologs human all Genomic context Location: 5; 5 G2 See Ssc4d in Genome Data Viewer Exon count: 11 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 5 NC_000071.6 (135960220..135974535, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 5 NC_000071.5 (136436093..136450346, complement) Chromosome 5 - NC_000071.6 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 7 transcripts Gene: Ssc4d ENSMUSG00000029699 Description scavenger receptor cysteine rich family, 4 domains [Source:MGI Symbol;Acc:MGI:1924709] Gene Synonyms C330016E03Rik, Srcrb4d Location Chromosome 5: 135,960,211-135,974,531 reverse strand. GRCm38:CM000998.2 About this gene This gene has 7 transcripts (splice variants), 140 orthologues, 16 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ssc4d-203 ENSMUST00000111152.7 2745 586aa ENSMUSP00000106782.1 Protein coding CCDS51664 A1L0T3 TSL:5 GENCODE basic APPRIS P1 Ssc4d-204 ENSMUST00000111153.7 2745 586aa ENSMUSP00000106783.1 Protein coding CCDS51664 A1L0T3 TSL:5 GENCODE basic APPRIS P1 Ssc4d-201 ENSMUST00000054895.3 1191 134aa ENSMUSP00000050439.3 Protein coding - G3X988 TSL:1 GENCODE basic Ssc4d-206 ENSMUST00000154181.1 819 174aa ENSMUSP00000123008.1 Protein coding - D3YUQ6 CDS 3' incomplete TSL:5 Ssc4d-205 ENSMUST00000153823.7 498 166aa ENSMUSP00000122958.1 Protein coding - F7AS28 CDS 5' and 3' incomplete TSL:3 Ssc4d-202 ENSMUST00000111150.1 459 108aa ENSMUSP00000106780.1 Protein coding - D3YZ07 TSL:2 GENCODE basic Ssc4d-207 ENSMUST00000154696.1 348 116aa ENSMUSP00000117071.1 Protein coding - F6ZA92 CDS 5' and 3' incomplete TSL:5 Page 7 of 9 https://www.alphaknockout.com 34.32 kb Forward strand 135.96Mb 135.97Mb 135.98Mb Genes Zp3-202 >nonsense mediated decay (Comprehensive set... Zp3-201 >protein coding Contigs AC084162.3 > AC087420.4 > Genes (Comprehensive set... < Ssc4d-204protein coding < Ssc4d-203protein coding < Ssc4d-201protein coding < Ssc4d-206protein coding < Ssc4d-202protein coding < Ssc4d-205protein coding < Ssc4d-207protein coding Regulatory Build 135.96Mb 135.97Mb 135.98Mb Reverse strand 34.32 kb Regulation Legend CTCF Enhancer Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000111152 < Ssc4d-203protein coding Reverse strand 14.28 kb ENSMUSP00000106... MobiDB lite Low complexity (Seg) Superfamily SRCR-like domain superfamily SMART SRCR-like domain Prints SRCR domain Pfam SRCR domain PROSITE profiles SRCR domain PROSITE patterns SRCR domain PANTHER PTHR19331 PTHR19331:SF439 Gene3D SRCR-like domain superfamily All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 586 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC.
Load more

Recommended publications
  • CSE642 Final Version
    Eindhoven University of Technology MASTER Dimensionality reduction of gene expression data Arts, S. Award date: 2018 Link to publication Disclaimer This document contains a student thesis (bachelor's or master's), as authored by a student at Eindhoven University of Technology. Student theses are made available in the TU/e repository upon obtaining the required degree. The grade received is not published on the document as presented in the repository. The required complexity or quality of research of student theses may vary by program, and the required minimum study period may vary in duration. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain Eindhoven University of Technology MASTER THESIS Dimensionality Reduction of Gene Expression Data Author: S. (Sako) Arts Daily Supervisor: dr. V. (Vlado) Menkovski Graduation Committee: dr. V. (Vlado) Menkovski dr. D.C. (Decebal) Mocanu dr. N. (Nikolay) Yakovets May 16, 2018 v1.0 Abstract The focus of this thesis is dimensionality reduction of gene expression data. I propose and test a framework that deploys linear prediction algorithms resulting in a reduced set of selected genes relevant to a specified case. Abstract In cancer research there is a large need to automate parts of the process of diagnosis, this is mainly to reduce cost, make it faster and more accurate.
    [Show full text]
  • Caractérisation De Nouveaux Gènes Et Polymorphismes Potentiellement Impliqués Dans Les Interactions Hôtes-Pathogènes
    Aix-Marseille Université, Faculté de Médecine de Marseille Ecole Doctorale des Sciences de la Vie et de la Santé THÈSE DE DOCTORAT Présentée par Charbel ABOU-KHATER Date et lieu de naissance: 08-Juilllet-1990, Zahlé, LIBAN En vue de l’obtention du grade de Docteur de l’Université d’Aix-Marseille Mention: Biologie, Spécialité: Microbiologie Caractérisation de nouveaux gènes et polymorphismes potentiellement impliqués dans les interactions hôtes-pathogènes Publiquement soutenue le 5 Juillet 2017 devant le jury composé de : Pr. Daniel OLIVE Directeur de Thèse Pr. Brigitte CROUAU-ROY Rapporteur Dr. Benoît FAVIER Rapporteur Dr. Pierre PONTAROTTI Examinateur Thèse codirigée par Pr. Daniel OLIVE et Dr Laurent ABI-RACHED Laboratoires d’accueil URMITE Research Unit on Emerging Infectious and Tropical Diseases, UMR 6236, Faculty of Medicine, 27, Boulevard Jean Moulin, 13385 Marseille, France CRCM, Centre de Recherche en Cancérologie de Marseille,Inserm 1068, 27 Boulevard Leï Roure, BP 30059, 13273 Marseille Cedex 09, France 2 Acknowledgements First and foremost, praises and thanks to God, Holy Mighty, Holy Immortal, All-Holy Trinity, for His showers of blessings throughout my whole life and to whom I owe my very existence. Glory to the Father, and to the Son, and to the Holy Spirit: now and ever and unto ages of ages. I would like to express my sincere gratitude to my advisors Prof. Daniel Olive and Dr. Laurent Abi-Rached, for the continuous support, for their patience, motivation, and immense knowledge. Someday, I hope to be just like you. A special thanks to my “Godfather” who perfectly fulfilled his role, Dr.
    [Show full text]
  • Unique Adaptations in Neonatal Hepatic Transcriptome, Nutrient
    Palombo et al. BMC Genomics (2021) 22:280 https://doi.org/10.1186/s12864-021-07538-w RESEARCH ARTICLE Open Access Unique adaptations in neonatal hepatic transcriptome, nutrient signaling, and one- carbon metabolism in response to feeding ethyl cellulose rumen-protected methionine during late-gestation in Holstein cows Valentino Palombo1,2, Abdulrahman Alharthi2,3, Fernanda Batistel4, Claudia Parys5, Jessie Guyader5, Erminio Trevisi6, Mariasilvia D’Andrea1 and Juan J. Loor2* Abstract Background: Methionine (Met) supply during late-pregnancy enhances fetal development in utero and leads to greater rates of growth during the neonatal period. Due to its central role in coordinating nutrient and one-carbon metabolism along with immune responses of the newborn, the liver could be a key target of the programming effects induced by dietary methyl donors such as Met. To address this hypothesis, liver biopsies from 4-day old calves (n = 6/group) born to Holstein cows fed a control or the control plus ethyl-cellulose rumen-protected Met for the last 28 days prepartum were used for DNA methylation, transcriptome, metabolome, proteome, and one-carbon metabolism enzyme activities. Results: Although greater withers and hip height at birth in Met calves indicated better development in utero, there were no differences in plasma systemic physiological indicators. RNA-seq along with bioinformatics and transcription factor regulator analyses revealed broad alterations in ‘Glucose metabolism’, ‘Lipid metabolism, ‘Glutathione’, and ‘Immune System’ metabolism due to enhanced maternal Met supply. Greater insulin sensitivity assessed via proteomics, and efficiency of transsulfuration pathway activity suggested beneficial effects on nutrient metabolism and metabolic-related stress. Maternal Met supply contributed to greater phosphatidylcholine synthesis in calf liver, with a role in very low density lipoprotein secretion as a mechanism to balance metabolic fates of fatty acids arising from the diet or adipose-depot lipolysis.
    [Show full text]
  • Supplementary Information for Table of Contents
    Supplementary Information for Tracing the origin of a new organ by inferring the genetic basis of rumen evolution Table of contents Supplementary Notes Supplementary Figures Supplementary Tables References 1 1 Supplementary Notes 2 Part 1. Phylogeny relationship and sample collection 3 1.1 Construction of the phylogenetic tree 4 To present the evolutionary panorama of the multi-chambered stomach evolution in 5 Cetartiodactyla, we constructed a phylogenetic tree using four-fold degenerate sites 6 using single-copy orthologous genes from nine species (human, horse, camel, pig, 7 hippo, killer whale, lesser mouse-deer, roe deer, and sheep) as representatives of the 8 major taxonomy. A final maximum likelihood tree was generated using IQ-TREE 9 multicore (version 1.6.6.a)1 with the parameters “-bb 1000 -m TEST -o Human” (Fig. 10 S17). Note that one of the families in the Suina, the Tayassuidae, has one stomach 11 with three chambers. Although no genomes of species in the Tayassuidae are 12 available, we chose the peccary as the representative of Tayassuidae and present the 13 position of the peccary according to the results of mitochondrial genomes2. The 14 newick format of tree result is as follows: (((((LesserMouse- 15 deer:0.1383065387,(Roedeer:0.0549981637,Sheep:0.0511103239)100:0.0574393138) 16 100:0.0488086408,(Killerwhale:0.0631824323,Hippo:0.0758665489)100:0.00822769 17 45)100:0.0179186732,Pig:0.1394609521)100:0.0101113682,Camel:0.1196798498)10 18 0:0.0411710418,Horse:0.1192130573,Human:0.1795944986); 19 1.2 RNA-seq analysis 20 1.2.1 Collection and sources of samples for RNA-seq 21 We collected and sequenced a total of 323 tissue samples from 11 Texel ♂ × Kazakh 22 ♀ hybrid sheep (Ovis aries) in Yili city (Xinjiang, China) (210 sequenced and 123 23 used in another paper at our laboratory)3.
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name scavenger receptor cysteine rich domain containing, group B (4 domains) Gene Symbol SRCRB4D Organism Human Gene Summary The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern. Gene Aliases S4D-SRCRB, SRCRB-S4D, SSC4D RefSeq Accession No. NC_000007.13, NT_007933.15 UniGene ID Hs.567684 Ensembl Gene ID ENSG00000146700 Entrez Gene ID 136853 Assay Information Unique Assay ID qHsaCID0011418 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000275560 Amplicon Context Sequence GAGGTGCTCTACTGGTTAACATCTTCCTTGTTGGGGGCTGCGTTGGCAAGAATT CATCACACAGGACAGCCACATCCTCGTAGTGAAAGCAATTGTGGACGCCC Amplicon Length (bp) 74 Chromosome Location 7:76028061-76029652 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 R2 0.9988 cDNA Cq 26.58 cDNA Tm (Celsius) 81.5 gDNA Cq 33.38 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SRCRB4D, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard
    [Show full text]
  • Supplemental Material
    Supplemental Material The Antitumoral Effect of the S- Adenosylhomocysteine Hydrolase Inhibitor, 3-Deazaneplanocin A, is Independent of EZH2 but is Correlated with EGFR Downregulation in Chondrosarcomas Juliette Aury-Landasa Nicolas Girarda Eva Lhuissiera Drifa Adouanea Raphael Delépéeb Karim Boumedienea Catherine Baugéa aBioConnecT EA7451, Normandie Université, UNICAEN, Caen, France, bPRISMM, SF4206 ICORE, Normandie Université, UNICAEN, Comprehensive Cancer Center F. Baclesse, Caen, France Legends of supplementary figures Suppl figure 1: Pretreatment with DZNep reduced CS implantation and growth in xenograft mice model CH2879 cells were treated with DZNep (1 µM) for 5 days before subcutaneous grafting in nude mice. (A) Tumors were measured regularly by a caliper and tumoral volume calculated. (B) 46 days after cell injection, tumors were weighted. Data are expressed as means + SEM. A total of ten mice were used (five pre-treated and five controls). Suppl figure 2: Expression of mRNA of identified genes in DZNep-treated CS and chondrocytes EGFR, MAD1L1 mRNA expression was analyzed by RT-PCR from chondrosarcomas and chondrocytes treated with 1 µM DZNep for 24 h. Data are expressed as means + SEM (N=3-5). *: p-value < 0.05. 1 A 700 B 600 ) pretreatment 3 500 500 * 400 400 * volume (mm volume 300 300 * Tumor 200 200 C 100 100 (mg) weight Tumor 0 0 DZNep 25 30 35 40 45 50 Control Pretreated Time after implantation (days) Suppl figure 1 A 1.6 1.4 EGFR 1.2 Control 1 * DZNep 0.8 * (relative unit) (relative 0.6 * level ** 0.4 mRNA 0.2 0 CH2879 SW1353 JJ012 FS090 HAC 1.41.4 MAD1L1 1.21.2 1 * 0.80.8 (relative unit) (relative 0.6 * level *** 0.40.4 *** mRNA 0.20.2 0 CH2879 SW1353 JJ012 FS090 HAC Suppl figure 2 Table S1: Clinical characteristics of primary chondrosarcomas.
    [Show full text]
  • Escherichia Coli O157:H7 and Lactoferrin Modulate Immunity in Cattle
    Escherichia coli O157:H7 and lactoferrin modulate immunity in cattle Evelien Kieckens Laboratory of Immunology Department of Virology, Parasitology and Immunology Thesis is submitted in fulfillment of the requirement for the degree of Doctor in Veterinary Sciences (PhD), Faculty of Veterinary Medicine, Ghent University, 2016 "A model is a lie that helps you see the truth." Howard Skipper The author and promoters give the permission to consult and to copy parts of this work for personal use only. Any other use is subject to the Copyright Laws. Permission to reproduce any material in this work should be obtained from the author. Promoters: Prof. Dr. Eric Cox Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University Prof. Dr. Daisy Vanrompay Department of Animal Production, Faculty of Bioscience Engineering, Ghent University Prof. Dr. Lieven De Zutter Department of Veterinary Public Health and Food Safety, Faculty of Veterinary Medicine, Ghent University Members of the Examination Committee: Prof. Dr. Piet Deprez (Chairman of the Examination Committee) Department of Internal medicine and clinical biology of large animals Faculty of Veterinary Medicine, Ghent University, Belgium Prof. Dr. Herman Favoreel (Secretary of the Examination Committee) Department of Virology, Parasitology and Immunology Faculty of Veterinary Medicine, Ghent University, Belgium Dr. ir. Koen De Reu Instituut voor Landbouw en Visserijonderzoek (ILVO), Belgium Prof. Dr. ir. Stefaan De Smet Department of Animal production Faculty of Faculty of Bioscience Engineering, Ghent University, Belgium Prof. Dr. Christian Menge Friedrich-Loeffler-Institut Institute of Molecular Pathogenesis, Jena, Germany Table of Contents Table of Contents List of abbreviations ................................................................................................................ 9 Chapter I: Literature review ..................................................................................................
    [Show full text]
  • Comparison of Selection Signatures Between Korean Native and Commercial Chickens Using 600K SNP Array Data
    G C A T T A C G G C A T genes Article Comparison of Selection Signatures between Korean Native and Commercial Chickens Using 600K SNP Array Data Sunghyun Cho 1, Prabuddha Manjula 1, Minjun Kim 1,2, Eunjin Cho 1, Dooho Lee 1, Seung Hwan Lee 1,2, Jun Heon Lee 1,2 and Dongwon Seo 1,2,* 1 Division of Animal and Dairy Science, Chungnam National University, Daejeon 34134, Korea; [email protected] (S.C.); [email protected] (P.M.); [email protected] (M.K.); fl[email protected] (E.C.); [email protected] (D.L.); [email protected] (S.H.L.); [email protected] (J.H.L.) 2 Bio-AI Convergence Research Center, Chungnam National University, Daejeon 34134, Korea * Correspondence: [email protected]; Tel.: +82-42-821-5878 Abstract: Korean native chickens (KNCs) comprise an indigenous chicken breed of South Korea that was restored through a government project in the 1990s. The KNC population has not been developed well and has mostly been used to maintain purebred populations in the government research institution. We investigated the genetic features of the KNC population in a selection signal study for the efficient improvement of this breed. We used 600K single nucleotide polymorphism data sampled from 191 KNCs (NG, 38; NL, 29; NR, 52; NW, 39; and NY, 33) and 54 commercial chickens (Hy-line Brown, 10; Lohmann Brown, 10; Arbor Acres, 10; Cobb, 12; and Ross, 12). Haplotype phasing was performed using EAGLE software as the initial step for the primary data analysis. Pre-processed data were analyzed to detect selection signals using the ‘rehh’ package in R software.
    [Show full text]
  • UC Irvine UC Irvine Electronic Theses and Dissertations
    UC Irvine UC Irvine Electronic Theses and Dissertations Title Investigating developmental and functional deficits in neurodegenerative disease using transcriptomic analyses Permalink https://escholarship.org/uc/item/7wp2w13r Author Lim, Ryan Gar-Lok Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, IRVINE Investigating developmental and functional deficits in neurodegenerative disease using transcriptomic analyses DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences by Ryan Gar-Lok Lim Dissertation Committee: Professor Leslie M. Thompson, Chair Assistant Professor Dritan Agalliu Professor Peter Donovan Professor Suzanne Sandmeyer 2016 Introduction, Figure 1.1 © 2014 Macmillan Publishers Limited. Appendix 1 © 2016 Elsevier Ltd. All other materials © 2016 Ryan Gar-Lok Lim DEDICATION This dissertation is dedicated to my parents, sister, and my wife. I love you all very much and could not have accomplished any of this without your love and support. Please take the time to reflect back on all of the moments we’ve shared, and know, that it is because of those moments I have been able to succeed. This accomplishment is as much yours as it is mine. ii TABLE OF CONTENTS Page LIST OF FIGURES vi LIST OF TABLES ix ACKNOWLEDGMENTS x CURRICULUM VITAE xiii ABSTRACT OF THE DISSERTATION xv Introduction Huntington’s disease, the neurovascular unit and the blood-brain
    [Show full text]
  • Genomic Scans for Selective Sweeps Through Haplotype Homozygosity
    www.nature.com/scientificreports OPEN Genomic scans for selective sweeps through haplotype homozygosity and allelic fxation in 14 indigenous sheep breeds from Middle East and South Asia Sirous Eydivandi1,2*, Mahmoud Amiri Roudbar3, Mohammad Osman Karimi4 & Goutam Sahana2 The performance and productivity of livestock have consistently improved by natural and artifcial selection over the centuries. Both these selections are expected to leave patterns on the genome and lead to changes in allele frequencies, but natural selection has played the major role among indigenous populations. Detecting selective sweeps in livestock may assist in understanding the processes involved in domestication, genome evolution and discovery of genomic regions associated with economically important traits. We investigated population genetic diversity and selection signals in this study using SNP genotype data of 14 indigenous sheep breeds from Middle East and South Asia, including six breeds from Iran, namely Iranian Balochi, Afshari, Moghani, Qezel, Zel, and Lori- Bakhtiari, three breeds from Afghanistan, namely Afghan Balochi, Arabi, and Gadik, three breeds from India, namely Indian Garole, Changthangi, and Deccani, and two breeds from Bangladesh, namely Bangladeshi Garole and Bangladesh East. The SNP genotype data were generated by the Illumina OvineSNP50 Genotyping BeadChip array. To detect genetic diversity and population structure, we used principal component analysis (PCA), admixture, phylogenetic analyses, and Runs of homozygosity. We applied four complementary statistical tests, FST (fxation index), xp-EHH (cross-population extended haplotype homozygosity), Rsb (extended haplotype homozygosity between-populations), and FLK (the extension of the Lewontin and Krakauer) to detect selective sweeps. Our results not only confrm the previous studies but also provide a suite of novel candidate genes involved in diferent traits in sheep.
    [Show full text]
  • Genome Sequence of Indian Peacock Reveals the Peculiar Case of a Glittering
    bioRxiv preprint doi: https://doi.org/10.1101/315457; this version posted May 5, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Genome Sequence of Indian Peacock Reveals the Peculiar Case of a Glittering 2 Bird 3 Authors: Shubham K. Jaiswal+1, Ankit Gupta+1, Rituja Saxena1, Vishnu Prasoodanan P. K.1, 4 Ashok K. Sharma1, Parul Mittal1, Ankita Roy1, Aaron B.A. Shafer3, Nagarjun Vijay2, Vineet 5 K. Sharma*1 6 Affiliation: 7 1Metagenomics and Systems Biology Group, Department of Biological Sciences, Indian 8 Institute of Science Education and Research Bhopal, India 9 2Computational Evolutionary Genomics Lab, Department of Biological Sciences, Indian 10 Institute of Science Education and Research Bhopal, India 11 3Forensic Science and Environmental & Life Sciences, Trent University, Canada 12 13 *Corresponding Author email: 14 Vineet K. Sharma - [email protected] 15 †These authors contributed equally to this work 16 Email addresses of authors: 17 Shubham K. Jaiswal – [email protected], Ankit Gupta - [email protected], Aaron 18 B.A. Shafer - [email protected], Rituja Saxena – [email protected], Vishnu Prasoodanan 19 P. K.- [email protected], Ashok K. Sharma – [email protected], Parul Mittal - 20 [email protected], Ankita Roy – [email protected], Nagarjun Vijay - 21 [email protected] 22 Number of words = 7,341 & Number of Figures = 4 23 1 bioRxiv preprint doi: https://doi.org/10.1101/315457; this version posted May 5, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]