DOCSLIB.ORG

Escherichia Coli O157:H7 and Lactoferrin Modulate Immunity in Cattle

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Escherichia Coli O157:H7 and Lactoferrin Modulate Immunity in Cattle Escherichia coli O157:H7 and lactoferrin modulate immunity in cattle Evelien Kieckens Laboratory of Immunology Department of Virology, Parasitology and Immunology Thesis is submitted in fulfillment of the requirement for the degree of Doctor in Veterinary Sciences (PhD), Faculty of Veterinary Medicine, Ghent University, 2016 "A model is a lie that helps you see the truth." Howard Skipper The author and promoters give the permission to consult and to copy parts of this work for personal use only. Any other use is subject to the Copyright Laws. Permission to reproduce any material in this work should be obtained from the author. Promoters: Prof. Dr. Eric Cox Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University Prof. Dr. Daisy Vanrompay Department of Animal Production, Faculty of Bioscience Engineering, Ghent University Prof. Dr. Lieven De Zutter Department of Veterinary Public Health and Food Safety, Faculty of Veterinary Medicine, Ghent University Members of the Examination Committee: Prof. Dr. Piet Deprez (Chairman of the Examination Committee) Department of Internal medicine and clinical biology of large animals Faculty of Veterinary Medicine, Ghent University, Belgium Prof. Dr. Herman Favoreel (Secretary of the Examination Committee) Department of Virology, Parasitology and Immunology Faculty of Veterinary Medicine, Ghent University, Belgium Dr. ir. Koen De Reu Instituut voor Landbouw en Visserijonderzoek (ILVO), Belgium Prof. Dr. ir. Stefaan De Smet Department of Animal production Faculty of Faculty of Bioscience Engineering, Ghent University, Belgium Prof. Dr. Christian Menge Friedrich-Loeffler-Institut Institute of Molecular Pathogenesis, Jena, Germany Table of Contents Table of Contents List of abbreviations ................................................................................................................ 9 Chapter I: Literature review ................................................................................................... 11 1. Introduction ............................................................................................................... 13 2. Shiga toxin-producing Escherichia coli ........................................................................... 14 2.1 Nomenclature and taxonomy of Shiga toxin-producing Escherichia coli .................... 14 2.2 Pathogenesis ........................................................................................................ 16 2.3 Shiga toxin classification, structure, and role in pathogenesis ................................. 16 2.4 Colonization by formation of A/E lesions ............................................................. 19 2.5 The pO157 plasmid .............................................................................................. 22 2.6 Effector molecules................................................................................................ 22 2.7 E. coli O157:H7 infection ...................................................................................... 29 2.8 Immune responses against EHEC ......................................................................... 33 2.9 Strategies to reduce E. coli O157:H7 colonization in ruminants ............................... 40 3. Lactoferrin .................................................................................................................. 44 3.1 Introduction ........................................................................................................ 44 3.2 Structure of LF .................................................................................................... 44 3.3 Natural occurrence of LF ..................................................................................... 45 3.4 Biological functions and applications of LF ........................................................... 46 3.5 Modulation of the immune system by LF .............................................................. 47 3.6 Effect of LF on E. coli O157:H7 ............................................................................ 49 Chapter II: Aims of the study ................................................................................................. 51 Chapter III: Experimental work: Immunosuppressive effects of E. coli O157:H7 ....................... 55 3.1 Abstract .................................................................................................................... 57 3.2 Introduction.............................................................................................................. 58 3.3 Materials and methods .............................................................................................. 60 3.4 Results ..................................................................................................................... 63 3.5 Discussion ................................................................................................................ 78 3.7 Conclusions .............................................................................................................. 80 Chapter IV: Experimental work: Modulation of systemic immune responses by bLF ............... 83 4.1 Abstract .................................................................................................................... 85 4.2. Introduction............................................................................................................. 85 4.3. Materials and methods ............................................................................................. 87 4.4. Results .................................................................................................................... 90 4.5 Discussion ................................................................................................................ 98 7 Table of Contents 4.6 Conclusions ............................................................................................................ 101 4.7 Acknowledgments................................................................................................... 101 Chapter V: Experimental work: Effect of Stx2/bLF on release of proinflammatory cytokines .. 103 5.1 Abstract .................................................................................................................. 105 5.2 Introduction............................................................................................................ 105 5.2 Materials and methods ............................................................................................ 107 5.3 Results ................................................................................................................... 111 5.4 Discussion .............................................................................................................. 116 5.5 Conclusions ............................................................................................................ 119 Chapter VI: Experimental work: Effect of bLF on release and bioactivity of Stx ..................... 121 6.1 Abstract .................................................................................................................. 123 6.2 Introduction............................................................................................................ 123 6.3 Methods ................................................................................................................. 125 6.4 Results ................................................................................................................... 129 6.5 Discussion .............................................................................................................. 139 6.6 Conclusions ............................................................................................................ 142 6.7 Acknowledgements ................................................................................................. 142 Chapter VII: General discussion & future perspectives .......................................................... 143 Summary ............................................................................................................................ 153 Summary ............................................................................................................................ 155 Samenvatting ...................................................................................................................... 159 Samenvatting ...................................................................................................................... 161 References ........................................................................................................................... 165 References ........................................................................................................................... 167 Curriculum Vitae & Bibliography ........................................................................................ 197 Curriculum Vitae ................................................................................................................. 199 Bibliography ........................................................................................................................ 200 Dankwoord ......................................................................................................................... 203 8 List of abbreviations List of abbreviations A/E lesions: attaching and
Load more

Recommended publications
  • CSE642 Final Version
    Eindhoven University of Technology MASTER Dimensionality reduction of gene expression data Arts, S. Award date: 2018 Link to publication Disclaimer This document contains a student thesis (bachelor's or master's), as authored by a student at Eindhoven University of Technology. Student theses are made available in the TU/e repository upon obtaining the required degree. The grade received is not published on the document as presented in the repository. The required complexity or quality of research of student theses may vary by program, and the required minimum study period may vary in duration. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain Eindhoven University of Technology MASTER THESIS Dimensionality Reduction of Gene Expression Data Author: S. (Sako) Arts Daily Supervisor: dr. V. (Vlado) Menkovski Graduation Committee: dr. V. (Vlado) Menkovski dr. D.C. (Decebal) Mocanu dr. N. (Nikolay) Yakovets May 16, 2018 v1.0 Abstract The focus of this thesis is dimensionality reduction of gene expression data. I propose and test a framework that deploys linear prediction algorithms resulting in a reduced set of selected genes relevant to a specified case. Abstract In cancer research there is a large need to automate parts of the process of diagnosis, this is mainly to reduce cost, make it faster and more accurate.
    [Show full text]
  • Endogenous Enterobacteriaceae Underlie Variation in Susceptibility to Salmonella Infection
    ARTICLES https://doi.org/10.1038/s41564-019-0407-8 Endogenous Enterobacteriaceae underlie variation in susceptibility to Salmonella infection Eric M. Velazquez1, Henry Nguyen1, Keaton T. Heasley1, Cheng H. Saechao1, Lindsey M. Gil1, Andrew W. L. Rogers1, Brittany M. Miller1, Matthew R. Rolston1, Christopher A. Lopez1,2, Yael Litvak 1, Megan J. Liou1, Franziska Faber 1,3, Denise N. Bronner1, Connor R. Tiffany1, Mariana X. Byndloss1,2, Austin J. Byndloss1 and Andreas J. Bäumler 1* Lack of reproducibility is a prominent problem in biomedical research. An important source of variation in animal experiments is the microbiome, but little is known about specific changes in the microbiota composition that cause phenotypic differences. Here, we show that genetically similar laboratory mice obtained from four different commercial vendors exhibited marked phenotypic variation in their susceptibility to Salmonella infection. Faecal microbiota transplant into germ-free mice repli- cated donor susceptibility, revealing that variability was due to changes in the gut microbiota composition. Co-housing of mice only partially transferred protection against Salmonella infection, suggesting that minority species within the gut microbiota might confer this trait. Consistent with this idea, we identified endogenous Enterobacteriaceae, a low-abundance taxon, as a keystone species responsible for variation in the susceptibility to Salmonella infection. Protection conferred by endogenous Enterobacteriaceae could be modelled by inoculating mice with probiotic Escherichia coli, which conferred resistance by using its aerobic metabolism to compete with Salmonella for resources. We conclude that a mechanistic understanding of phenotypic variation can accelerate development of strategies for enhancing the reproducibility of animal experiments. recent survey suggests that the majority of researchers Results have tried and failed to reproduce their own experiments To determine whether genetically similar strains of mice obtained A or experiments from other scientists1.
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/Ijsem.0.001485
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/ijsem.0.001485 Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Mobolaji Adeolu,† Seema Alnajar,† Sohail Naushad and Radhey S. Gupta Correspondence Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Radhey S. Gupta L8N 3Z5, Canada [email protected] Understanding of the phylogeny and interrelationships of the genera within the order ‘Enterobacteriales’ has proven difficult using the 16S rRNA gene and other single-gene or limited multi-gene approaches. In this work, we have completed comprehensive comparative genomic analyses of the members of the order ‘Enterobacteriales’ which includes phylogenetic reconstructions based on 1548 core proteins, 53 ribosomal proteins and four multilocus sequence analysis proteins, as well as examining the overall genome similarity amongst the members of this order. The results of these analyses all support the existence of seven distinct monophyletic groups of genera within the order ‘Enterobacteriales’. In parallel, our analyses of protein sequences from the ‘Enterobacteriales’ genomes have identified numerous molecular characteristics in the forms of conserved signature insertions/deletions, which are specifically shared by the members of the identified clades and independently support their monophyly and distinctness. Many of these groupings, either in part or in whole, have been recognized in previous evolutionary studies, but have not been consistently resolved as monophyletic entities in 16S rRNA gene trees. The work presented here represents the first comprehensive, genome- scale taxonomic analysis of the entirety of the order ‘Enterobacteriales’.
    [Show full text]
  • Caractérisation De Nouveaux Gènes Et Polymorphismes Potentiellement Impliqués Dans Les Interactions Hôtes-Pathogènes
    Aix-Marseille Université, Faculté de Médecine de Marseille Ecole Doctorale des Sciences de la Vie et de la Santé THÈSE DE DOCTORAT Présentée par Charbel ABOU-KHATER Date et lieu de naissance: 08-Juilllet-1990, Zahlé, LIBAN En vue de l’obtention du grade de Docteur de l’Université d’Aix-Marseille Mention: Biologie, Spécialité: Microbiologie Caractérisation de nouveaux gènes et polymorphismes potentiellement impliqués dans les interactions hôtes-pathogènes Publiquement soutenue le 5 Juillet 2017 devant le jury composé de : Pr. Daniel OLIVE Directeur de Thèse Pr. Brigitte CROUAU-ROY Rapporteur Dr. Benoît FAVIER Rapporteur Dr. Pierre PONTAROTTI Examinateur Thèse codirigée par Pr. Daniel OLIVE et Dr Laurent ABI-RACHED Laboratoires d’accueil URMITE Research Unit on Emerging Infectious and Tropical Diseases, UMR 6236, Faculty of Medicine, 27, Boulevard Jean Moulin, 13385 Marseille, France CRCM, Centre de Recherche en Cancérologie de Marseille,Inserm 1068, 27 Boulevard Leï Roure, BP 30059, 13273 Marseille Cedex 09, France 2 Acknowledgements First and foremost, praises and thanks to God, Holy Mighty, Holy Immortal, All-Holy Trinity, for His showers of blessings throughout my whole life and to whom I owe my very existence. Glory to the Father, and to the Son, and to the Holy Spirit: now and ever and unto ages of ages. I would like to express my sincere gratitude to my advisors Prof. Daniel Olive and Dr. Laurent Abi-Rached, for the continuous support, for their patience, motivation, and immense knowledge. Someday, I hope to be just like you. A special thanks to my “Godfather” who perfectly fulfilled his role, Dr.
    [Show full text]
  • Unique Adaptations in Neonatal Hepatic Transcriptome, Nutrient
    Palombo et al. BMC Genomics (2021) 22:280 https://doi.org/10.1186/s12864-021-07538-w RESEARCH ARTICLE Open Access Unique adaptations in neonatal hepatic transcriptome, nutrient signaling, and one- carbon metabolism in response to feeding ethyl cellulose rumen-protected methionine during late-gestation in Holstein cows Valentino Palombo1,2, Abdulrahman Alharthi2,3, Fernanda Batistel4, Claudia Parys5, Jessie Guyader5, Erminio Trevisi6, Mariasilvia D’Andrea1 and Juan J. Loor2* Abstract Background: Methionine (Met) supply during late-pregnancy enhances fetal development in utero and leads to greater rates of growth during the neonatal period. Due to its central role in coordinating nutrient and one-carbon metabolism along with immune responses of the newborn, the liver could be a key target of the programming effects induced by dietary methyl donors such as Met. To address this hypothesis, liver biopsies from 4-day old calves (n = 6/group) born to Holstein cows fed a control or the control plus ethyl-cellulose rumen-protected Met for the last 28 days prepartum were used for DNA methylation, transcriptome, metabolome, proteome, and one-carbon metabolism enzyme activities. Results: Although greater withers and hip height at birth in Met calves indicated better development in utero, there were no differences in plasma systemic physiological indicators. RNA-seq along with bioinformatics and transcription factor regulator analyses revealed broad alterations in ‘Glucose metabolism’, ‘Lipid metabolism, ‘Glutathione’, and ‘Immune System’ metabolism due to enhanced maternal Met supply. Greater insulin sensitivity assessed via proteomics, and efficiency of transsulfuration pathway activity suggested beneficial effects on nutrient metabolism and metabolic-related stress. Maternal Met supply contributed to greater phosphatidylcholine synthesis in calf liver, with a role in very low density lipoprotein secretion as a mechanism to balance metabolic fates of fatty acids arising from the diet or adipose-depot lipolysis.
    [Show full text]
  • Mouse Ssc4d Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Ssc4d Knockout Project (CRISPR/Cas9) Objective: To create a Ssc4d knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ssc4d gene (NCBI Reference Sequence: NM_001160366 ; Ensembl: ENSMUSG00000029699 ) is located on Mouse chromosome 5. 11 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000111152). Exon 2~11 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 0.06% of the coding region. Exon 2~11 covers 100.0% of the coding region. The size of effective KO region: ~9451 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 7 8 9 10 11 Legends Exon of mouse Ssc4d Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Supplementary Information for Table of Contents
    Supplementary Information for Tracing the origin of a new organ by inferring the genetic basis of rumen evolution Table of contents Supplementary Notes Supplementary Figures Supplementary Tables References 1 1 Supplementary Notes 2 Part 1. Phylogeny relationship and sample collection 3 1.1 Construction of the phylogenetic tree 4 To present the evolutionary panorama of the multi-chambered stomach evolution in 5 Cetartiodactyla, we constructed a phylogenetic tree using four-fold degenerate sites 6 using single-copy orthologous genes from nine species (human, horse, camel, pig, 7 hippo, killer whale, lesser mouse-deer, roe deer, and sheep) as representatives of the 8 major taxonomy. A final maximum likelihood tree was generated using IQ-TREE 9 multicore (version 1.6.6.a)1 with the parameters “-bb 1000 -m TEST -o Human” (Fig. 10 S17). Note that one of the families in the Suina, the Tayassuidae, has one stomach 11 with three chambers. Although no genomes of species in the Tayassuidae are 12 available, we chose the peccary as the representative of Tayassuidae and present the 13 position of the peccary according to the results of mitochondrial genomes2. The 14 newick format of tree result is as follows: (((((LesserMouse- 15 deer:0.1383065387,(Roedeer:0.0549981637,Sheep:0.0511103239)100:0.0574393138) 16 100:0.0488086408,(Killerwhale:0.0631824323,Hippo:0.0758665489)100:0.00822769 17 45)100:0.0179186732,Pig:0.1394609521)100:0.0101113682,Camel:0.1196798498)10 18 0:0.0411710418,Horse:0.1192130573,Human:0.1795944986); 19 1.2 RNA-seq analysis 20 1.2.1 Collection and sources of samples for RNA-seq 21 We collected and sequenced a total of 323 tissue samples from 11 Texel ♂ × Kazakh 22 ♀ hybrid sheep (Ovis aries) in Yili city (Xinjiang, China) (210 sequenced and 123 23 used in another paper at our laboratory)3.
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name scavenger receptor cysteine rich domain containing, group B (4 domains) Gene Symbol SRCRB4D Organism Human Gene Summary The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern. Gene Aliases S4D-SRCRB, SRCRB-S4D, SSC4D RefSeq Accession No. NC_000007.13, NT_007933.15 UniGene ID Hs.567684 Ensembl Gene ID ENSG00000146700 Entrez Gene ID 136853 Assay Information Unique Assay ID qHsaCID0011418 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000275560 Amplicon Context Sequence GAGGTGCTCTACTGGTTAACATCTTCCTTGTTGGGGGCTGCGTTGGCAAGAATT CATCACACAGGACAGCCACATCCTCGTAGTGAAAGCAATTGTGGACGCCC Amplicon Length (bp) 74 Chromosome Location 7:76028061-76029652 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 R2 0.9988 cDNA Cq 26.58 cDNA Tm (Celsius) 81.5 gDNA Cq 33.38 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SRCRB4D, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard
    [Show full text]
  • System in the Order Enterobacterales Pieter De Maayer1* , Talia Pillay1 and Teresa A
    Maayer et al. BMC Genomics (2020) 21:100 https://doi.org/10.1186/s12864-020-6529-9 RESEARCH ARTICLE Open Access Comparative genomic analysis of the secondary flagellar (flag-2) system in the order Enterobacterales Pieter De Maayer1* , Talia Pillay1 and Teresa A. Coutinho2 Abstract Background: The order Enterobacterales encompasses a broad range of metabolically and ecologically versatile bacterial taxa, most of which are motile by means of peritrichous flagella. Flagellar biosynthesis has been linked to a primary flagella locus, flag-1, encompassing ~ 50 genes. A discrete locus, flag-2, encoding a distinct flagellar system, has been observed in a limited number of enterobacterial taxa, but its function remains largely uncharacterized. Results: Comparative genomic analyses showed that orthologous flag-2 loci are present in 592/4028 taxa belonging to 5/8 and 31/76 families and genera, respectively, in the order Enterobacterales. Furthermore, the presence of only the outermost flag-2 genes in many taxa suggests that this locus was far more prevalent and has subsequently been lost through gene deletion events. The flag-2 loci range in size from ~ 3.4 to 81.1 kilobases and code for between five and 102 distinct proteins. The discrepancy in size and protein number can be attributed to the presence of cargo gene islands within the loci. Evolutionary analyses revealed a complex evolutionary history for the flag-2 loci, representing ancestral elements in some taxa, while showing evidence of recent horizontal acquisition in other enterobacteria. Conclusions: The flag-2 flagellar system is a fairly common, but highly variable feature among members of the Enterobacterales.
    [Show full text]
  • Supplemental Material
    Supplemental Material The Antitumoral Effect of the S- Adenosylhomocysteine Hydrolase Inhibitor, 3-Deazaneplanocin A, is Independent of EZH2 but is Correlated with EGFR Downregulation in Chondrosarcomas Juliette Aury-Landasa Nicolas Girarda Eva Lhuissiera Drifa Adouanea Raphael Delépéeb Karim Boumedienea Catherine Baugéa aBioConnecT EA7451, Normandie Université, UNICAEN, Caen, France, bPRISMM, SF4206 ICORE, Normandie Université, UNICAEN, Comprehensive Cancer Center F. Baclesse, Caen, France Legends of supplementary figures Suppl figure 1: Pretreatment with DZNep reduced CS implantation and growth in xenograft mice model CH2879 cells were treated with DZNep (1 µM) for 5 days before subcutaneous grafting in nude mice. (A) Tumors were measured regularly by a caliper and tumoral volume calculated. (B) 46 days after cell injection, tumors were weighted. Data are expressed as means + SEM. A total of ten mice were used (five pre-treated and five controls). Suppl figure 2: Expression of mRNA of identified genes in DZNep-treated CS and chondrocytes EGFR, MAD1L1 mRNA expression was analyzed by RT-PCR from chondrosarcomas and chondrocytes treated with 1 µM DZNep for 24 h. Data are expressed as means + SEM (N=3-5). *: p-value < 0.05. 1 A 700 B 600 ) pretreatment 3 500 500 * 400 400 * volume (mm volume 300 300 * Tumor 200 200 C 100 100 (mg) weight Tumor 0 0 DZNep 25 30 35 40 45 50 Control Pretreated Time after implantation (days) Suppl figure 1 A 1.6 1.4 EGFR 1.2 Control 1 * DZNep 0.8 * (relative unit) (relative 0.6 * level ** 0.4 mRNA 0.2 0 CH2879 SW1353 JJ012 FS090 HAC 1.41.4 MAD1L1 1.21.2 1 * 0.80.8 (relative unit) (relative 0.6 * level *** 0.40.4 *** mRNA 0.20.2 0 CH2879 SW1353 JJ012 FS090 HAC Suppl figure 2 Table S1: Clinical characteristics of primary chondrosarcomas.
    [Show full text]
  • Formate Dehydrogenase Gene Diversity in Acetogenic Gut Communities of Lower, Wood-Feeding Termites and a Wood
    2 -1 Formate dehydrogenase gene diversity in acetogenic gut communities of lower, wood-feeding termites and a wood- feeding roach Abstract The bacterial Wood-Ljungdahl pathway for CO2-reductive acetogenesis is important for the nutritional mutualism occurring between wood-feeding insects and their hindgut microbiota. A key step in this pathway is the reduction of CO2 to formate, catalyzed by the enzyme formate dehydrogenase (FDH). Putative selenocysteine- (Sec) and cysteine- (Cys) containing paralogs of hydrogenase-linked FDH (FDHH) have been identified in the termite gut acetogenic spirochete, Treponema primitia, but knowledge of their relevance in the termite gut environment remains limited. In this study, we designed degenerate PCR primers for FDHH genes (fdhF) and assessed fdhF diversity in insect gut bacterial isolates and the gut microbial communities of termites and roaches. The insects examined herein represent the wood-feeding termite families Termopsidae, Kalotermitidae, and Rhinotermitidae (phylogenetically “lower” termite taxa), the wood-feeding roach family Cryptocercidae (the sister taxon to termites), and the omnivorous roach family Blattidae. Sec and Cys FDHH variants were identified in every wood-feeding insect but not the omnivorous roach. Of 68 novel phylotypes obtained from inventories, 66 affiliated phylogenetically with enzymes from T. primitia. These formed two sub-clades (37 and 29 phylotypes) almost completely comprised of Sec-containing and Cys-containing enzymes, respectively. A gut cDNA 2 -2 inventory showed transcription of both variants in the termite Zootermopsis nevadensis (family Termopsidae). The results suggest FDHH enzymes are important for the CO2- reductive metabolism of uncultured acetogenic treponemes and imply that the trace element selenium has shaped the gene content of gut microbial communities in wood-feeding insects.
    [Show full text]