DOCSLIB.ORG

Journal of Avian Biology JAV-01015 Liu, Y., Chen, G., Huang, Q., Jia, C., Carey, G., Leader, P., Li, Y., Zou, F., Yang, X., Olsson, U

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Journal of Avian Biology JAV-01015 Liu, Y., Chen, G., Huang, Q., Jia, C., Carey, G., Leader, P., Li, Y., Zou, F., Yang, X., Olsson, U Journal of Avian Biology JAV-01015 Liu, Y., Chen, G., Huang, Q., Jia, C., Carey, G., Leader, P., Li, Y., Zou, F., Yang, X., Olsson, U. and Alström, P. 2016. Species delimitation of the white- tailed rubythroat Calliope pectoralis complex (Aves, Turdidae) using an integrative taxonomic approach. – J. Avian Biol. doi: 10.1111/jav.01015 Supplementary material Appendix 1 Table A1. Samples with vouchers and sequences with GenBank accession numbers used in this article (AMNH=American Museum of Natural History, SYSb=Sun Yat-sen University, SCIEA=South China Institute of Endangered Animals). GenBank accession numbers in bold indicate sequences yielded in this study. No. of Taxon Locality Sample ID/Voucher samples COI Cytb ODC Myo Aksu, Xinjiang, China SYSb024 1 KU973742 KU973766 KU973805 KU973785 Nalati Grassland, Xinyuan, Xinjiang, China SYSb1087/IOZ64459 1 KU973743 KU973767 —— KU973786 Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1088/IOZ63178 1 KU973745 KU973769 KU973807 KU973788 C. pectoralis Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1089/IOZ63189 1 KU973746 KU973770 KU973808 KU973789 ballioni Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1090/IOZ63190 1 KU973747 KU973771 KU973809 KU973790 Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1091/IOZ63198 1 KU973748 KU973772 KU973810 KU973791 Kazakhstan Sangster et al. (2010) 1 —— HM633321 HM633739 HM633603 The Tian Shan Observatory, Kazakhstan SYSb462 1 KU973744 KU973768 KU973806 KU973787 Xiadawuxiang, Maqen, Qinghai, China SYSb540/IOZ54456 1 KU973732 KU973755 KU973797 KU973779 Baima Snow Mountain, Deqin, Yunnan, China SYSb770 1 KU973733 KU973756 KU973798 —— Fugong, Nujiang, Yunnan, China SYSb771/KIZ-GLGS0218 1 KU973734 KU973757 KU973799 KU973780 Lushui, Nujiang, Yunnan, China SYSb772/KIZ-GLGS5006 1 KU973735 KU973758 KU973800 KU973781 Yulong Snow Mountain, Lijiang, Yunnan, China SYSb773/KIZ-YL07191 1 KU973736 KU973759 KU973801 KU973782 C. p. Meri Snow Mountain, Deqin, Yunnan, China SYSb774 1 KU973737 KU973760 KU973802 —— tschebaiewi Meri Snow Mountain, Deqin, Yunnan, China SYSb775 1 KU973738 KU973761 —— —— Meri Snow Mountain, Deqin, Yunnan, China SYSb776 1 KU973739 KU973762 —— —— Balang Shan, Wenchuan, Sichuan, China SYSb861 1 —— KU973763 —— —— Tuolin Temple, Zanda, Ngari, Tibet, China SYSb1085/IOZ64458 1 KU973740 KU973764 KU973803 KU973783 Shergyla Mountain, Nyingchi, Tibet, China SYSb1086/IOZ64457 1 KU973741 KU973765 KU973804 KU973784 SYSb1551-1553/AMNH Available 3 C. p. confusa Laghep, Sikkim, India (S79598-S79600) —— from authors —— —— Calliope Lianhua Shan, Gansu, Zhuoni, China SYSb2545/SCIEA (S03542) 1 KU973753 KU973777 KU973815 1 calliope 4 KU973749 KU973773 KU973811 KU973792 Laoting, Hebei, China SYSb (1524-25,1527-28) —973752 —973776 —973814 —973795 Japan Sangster et al. (2010) 1 —— HM633316 HM633735 HM633598 Calliope Jiuding Shan, Deyang, Sichuan, China SYSb463/IOZ-PA20130516 1 KU973754 KU973778 KU973816 KU973796 pectardens Sichuan, China Sangster et al. (2010) 1 —— HM633320 HM633738 HM633602 Calliope 1 obscura Shaanxi, China Sangster et al. (2010) —— KC967092 KC967094 KC967096 Tarsiger 1 johnstoniae Taiwan, China Sangster et al. (2010) —— HM633391 HM633801 HM633672 Table A2. Amplification and sequencing primers and annealing temperature (Ta) of PCRs used to in this article. Genes Primers Sequences(5’-3’) Ta(°C) Length(bp) References BirdF1 TTCTCCAACCACAAAGACATTGGCAC COI 56 693 Hebert et al. 2004 BirdR1 ACGTGGGAGATAATTCCAAATCCTG L14995 CTCCCAGCCCCATCCAACATCTCAGCATGATGAAACTTCG 47-55 1018 Groth 1998 H16065 CTAAGAAGGGTGGAGTCTTCAGTTTTTGGTTTACAAGAC CylF285 TCGTAGGATACGTACTGCCC 236 CylR521 TGTTTGAGCCTGTTTCGTGT CylF499 CCTACACGAAACAGGCTCAA CYTB 220 CylR718 TCATTCGGGTTTGATGTGGG 50-55 This study CylF664 AAACTTCACACCAGCCAACC 163 CylR826 GTGTAATAGAGGGGCGAGGA CylF834 AACAGCGCTCACTAACCTTC 186 CylR1019 CTAATACGGCTGCAAGTGGG MYO2 GCCACCAAGCACAAGATCCC Myo 53-58 690 Kimball et al. 2009 MYO3F TTCAGCAAGGACCTTGATAATGACTT OD6 GACTCCAAAGCAGTTTGTCGTCTCAGTGT OD8R ATTGGTGGTGGCTTCCCTGGCTCTGAAGA ODC 53-61 663 Allen & Omland 2003 ODC2-F GGTGAGCTGACAGTACCAAA ODC2-R AGCCACCACCAATATCAAGC Table A3. Geographic information of sound recordings used in this study. Altitu Date Type Taxon Locality Latitude Longitude de（ (yyyy/mm/ Recordist Source m） dd) Song Call + -- This study Kalon, Sughd Region, Tajikistan 39°3'3.20" 68°58'54.23" 2918 2014/7/20 Chenxi Jia + -- This study + -- This study Geoff 43°3'31.92" 76°58'5.40" 2749 2009/5/11 + -- This study Carey + -- This study Ruud van 2400 2009/5/20 + -- XC43633 Beusekom Tian Shan Observatory, Ili-Alatau Arend National Park, Almaty, Kazakhstan 2700 2011/5/14 + + XC156598 Wassink Calliope. 43°4'25.64" 76°59'14.68" Jan Hein pectoralis 3000 2007/5/15 van + -- XC29566 ballioni Steenis 2200 2013/7/17 Thijs Fijen -- + XC145263 Nalati Grassland, Xinyuan County, 43°9'3.96" 84°22'25.43" 2570 2014/6/16 Chenxi Jia + -- This study Xinjiang, China Sayram Lake, Bole County, 44°40'20.53" 81°22'27.80" 2423 2014/6/19 Chenxi Jia + -- This study Xinjiang, China + -- This study Wusu County, Xinjiang, China 43°47'15.81" 84°27'42.80" 2640 2014/5/31 Chenxi Jia + -- This study C. p. Naltar valley, Gilgit, Gilgit– Per + -- This study 36°10'30.80" 74° 9'43.15" 2900 1998/6/3 pectoralis Baltistan, Pakistan Alström + -- This study + -- This study -- + XC117075 -- + XC117076 Kaziranga National Park (watch Mike -- + XC117077 26°38'4.20" 93°21'27.00" 70 2012/11/23 C. p. tower), Golaghat, Assam, India Nelson -- + XC117078 confusa -- + XC117081 -- + XC117116 +* -- XC117079 Dibru-Saikhowa National Park, Desmond 27°40'7.42" 95°21'44.67" 120 1998/1/3 +* -- XC79436 Laika Gaon, Assam, India Allen 2008/6/8 + -- This study Baima Snow Mountain, Deqin Per 28°20'27.12" 99° 3'57.48" 4280 + -- This study County, Yunnan, China 2008/6/9 Alström + -- This study 4015 + -- This study 3970 + -- This study Per Road to Moxi, Kangding, Sichuan, 2013/5/30 29°54'00" 102°0'00" 4450 Alström + -- This study China 4060 + -- This study 4360 2013/5/31 + -- This study C. p. Per tschebaiewi 4280 2013/6/2 + -- This study Alström Frank 30°56'58.20" 102°52'58.44" 3800 2013/6/2 -- + XC110848 Balang Shan, Wenchuan County, Lambert Geoff Sichuan, China 4020 2012/6/8 + -- This study Carey 30°57'45.21" 102°52'38.66" 3600 2012/6/1 Frank + -- XC110845 30°53'15.76" 102°55'35.58" 3800 2012/6/2 Lambert + -- XC110849 Along Road 318, Yajiang, Sichuan, 30° 0'12.35" 100°51'44.75" 4408 2012/5/7 + + This study Chenxi Jia China 30°17'13.78" 99°30'48.35" 4217 2012/5/8 + -- This study Heimahe, Qinghai Lake, Gonghe Per 36°43'45.77" 99°47'17.33" 3203 1987/6/1 + -- This study County, Qinghai, China Alström Laoye Shan, Datong County, Frank 36°55'52.31" 101°41'42.16" 2800 2005/6/22 + -- XC68597 Qinghai, China Lambert Frank S of Gyegu, Yushu, Qinghai, China -- -- 4300 2005/6/10 + -- XC68598 Lambert Kanda Shan Pass, Yushu, Qinghai, Mike 32°20'26.16" 96°32'53.16" 4300 2014/7/7 -- + XC191607 China Nelson Mats Yushu, Qinghai, China -- -- -- 2010/6/27 -- + XC203410 Rellmar Xiadawuxiang, Maqen County, 34°57'27.14" 99°20'5.71" 4084 2012/5/25 Chenxi Jia + -- This study Golog, Qinghai, China Shergyla Mountain, Nyingchi, 29°36'51.30" 94°39'37.12" 4320 2014/5/28 + -- This study Tibet, China Chenxi Jia Tuolin Temple, Zanda County, 31°29'9.30" 79°47'55.31" 3606 2014/6/7 + -- This study Ngari, Tibet, China Tomas 2013/6/18 + -- XC176640 Beishan National Park, Huzhu Carlberg 36°49'23.88" 102°29'55.98" 2600 County, Qinghai, China Mike 2014/7/1 + -- XC191282 C. calliope Nelson Laoye Shan, Datong County, Ding Li beicki 36°55'52.31" 101°41'42.16" 2800 2013/6/12 + -- XC197759 Qinghai, China Yong Jiuzhaigou County, Aba, Sichuan, Frank 32°54'2.29" 103°31'4.81" 3200 2013/6/4 + -- XC161391 China Lambert C. c. Belaya Uba, Ridder, Oskemen, 50°32'38.42" 83°41'20.94" 750 2013/6/30 Thijs Fijen + -- XC145204 calliope Shyghys, Kazakhstan C. c. Prey Srorng Community Forest, Frank beicki/callio Krong Samraong, Oddar 13°59'9.60" 103°54'10.80" 90 2010/11/18 -- + XC88224 Lambert pe Meanchey, Cambodia Seima Biodiversity Conservation Frank Area, O Am, Mondulkiri, 12°8'45.24" 106°54'57.24" 140 2012/4/20 -- + XC97977 Lambert Cambodia Figure A1. Reconstruction of phylogenetic relationships of Calliope pectoralis and its congeners based on 600 bp of mitochondrial cytb using ML and BI approaches. Because ML and BI provided an identical topology, the shown tree topology is based on ML. The sequence of Collared Bush Robin Tarsiger johnstoniae was used as outgroup to root the phylogenetic tree. For all trees, bootstrap percentages for ML (performed by RaxML) > 60% and Bayesian posterior probabilities (using MrBayes) > 0.9 are indicated for each nodes. Figure A1. SYSb0861 Sichuan SYSb0776 Yunnan SYSb0775 Yunnan SYSb0770 Yunnan SYSb1086 Tibet SYSb0771 Yunnan C.#p.#tschebaiewi# 97/1.0 SYSb0774 Yunnan SYSb0772 Yunnan SYSb0540 Qinghai SYSb1085 Tibet SYSb0773 Yunnan 92/1.0 SYSb0024 Xinjiang SYSb1090 Tajikistan SYSb1091 Tajikistan SYSb1087 Xinjiang SYSb1089 Tajikistan C.#p.#ballioni# 100/1.0 SYSb0462 Kazakhstan SYSb1088 Tajikistan DZUG-U30 Kazakhstan SYSb1522 Sikkim SYSb1521 Sikkim C.#p.#confusa# 67/0.94 SYSb1523 Sikkim 79/0.94 DZUG-U660 Japan SYSb2545 Gansu 100/1.0 SYSb1525 Hebei SYSb1524 Hebei C.#calliope# SYSb1527 Hebei SYSb1528 Hebei 100/1.0 SYSb0463 Sichuan 100/1.0 DZUG-U40 Sichuan C.#pectardens# Shaanxi C.#obscura# Tarsiger johnstoniae 0.02 Figure A2. Multilocus species trees for the Calliope pectoralis – C. calliope complex inferred by *BEAST. Bayesian posterior probabilities are indicated for each node. Figure A3. Shows of breath-band width difference between Calliope pectoralis ballioni (Left 1-2) and C. p. tschebaiewi (Left 3-5). Photoed by Yang Liu from IOZ, CAS, China. .
Load more

Recommended publications
  • The 2008 Wenchuan Earthquake: Risk Management Lessons and Implications Ic Acknowledgements
    The 2008 Wenchuan Earthquake: Risk Management Lessons and Implications Ic ACKNOWLEDGEMENTS Authors Emily Paterson Domenico del Re Zifa Wang Editor Shelly Ericksen Graphic Designer Yaping Xie Contributors Joseph Sun, Pacific Gas and Electric Company Navin Peiris Robert Muir-Wood Image Sources Earthquake Engineering Field Investigation Team (EEFIT) Institute of Engineering Mechanics (IEM) Massachusetts Institute of Technology (MIT) National Aeronautics and Space Administration (NASA) National Space Organization (NSO) References Burchfiel, B.C., Chen, Z., Liu, Y. Royden, L.H., “Tectonics of the Longmen Shan and Adjacent Regoins, Central China,” International Geological Review, 37(8), edited by W.G. Ernst, B.J. Skinner, L.A. Taylor (1995). BusinessWeek,”China Quake Batters Energy Industry,” http://www.businessweek.com/globalbiz/content/may2008/ gb20080519_901796.htm, accessed September 2008. Densmore A.L., Ellis, M.A., Li, Y., Zhou, R., Hancock, G.S., and Richardson, N., “Active Tectonics of the Beichuan and Pengguan Faults at the Eastern Margin of the Tibetan Plateau,” Tectonics, 26, TC4005, doi:10.1029/2006TC001987 (2007). Embassy of the People’s Republic of China in the United States of America, “Quake Lakes Under Control, Situation Grim,” http://www.china-embassy.org/eng/gyzg/t458627.htm, accessed September 2008. Energy Bulletin, “China’s Renewable Energy Plans: Shaken, Not Stirred,” http://www.energybulletin.net/node/45778, accessed September 2008. Global Terrorism Analysis, “Energy Implications of the 2008 Sichuan Earthquake,” http://www.jamestown.org/terrorism/news/ article.php?articleid=2374284, accessed September 2008. World Energy Outlook: http://www.worldenergyoutlook.org/, accessed September 2008. World Health Organization, “China, Sichuan Earthquake.” http://www.wpro.who.int/sites/eha/disasters/emergency_reports/ chn_earthquake_latest.htm, accessed September 2008.
    [Show full text]
  • Respective Influence of Vertical Mountain Differentiation on Debris Flow Occurrence in the Upper Min River, China
    www.nature.com/scientificreports OPEN Respective infuence of vertical mountain diferentiation on debris fow occurrence in the Upper Min River, China Mingtao Ding*, Tao Huang , Hao Zheng & Guohui Yang The generation, formation, and development of debris fow are closely related to the vertical climate, vegetation, soil, lithology and topography of the mountain area. Taking in the upper reaches of Min River (the Upper Min River) as the study area, combined with GIS and RS technology, the Geo-detector (GEO) method was used to quantitatively analyze the respective infuence of 9 factors on debris fow occurrence. We identify from a list of 5 variables that explain 53.92%% of the total variance. Maximum daily rainfall and slope are recognized as the primary driver (39.56%) of the spatiotemporal variability of debris fow activity. Interaction detector indicates that the interaction between the vertical diferentiation factors of the mountainous areas in the study area is nonlinear enhancement. Risk detector shows that the debris fow accumulation area and propagation area in the Upper Min River are mainly distributed in the arid valleys of subtropical and warm temperate zones. The study results of this paper will enrich the scientifc basis of prevention and reduction of debris fow hazards. Debris fows are a common type of geological disaster in mountainous areas1,2, which ofen causes huge casual- ties and property losses3,4. To scientifcally deal with debris fow disasters, a lot of research has been carried out from the aspects of debris fow physics5–9, risk assessment10–12, social vulnerability/resilience13–15, etc. Jointly infuenced by unfavorable conditions and factors for social and economic development, the Upper Min River is a geographically uplifed but economically depressed region in Southwest Sichuan.
    [Show full text]
  • Report on Domestic Animal Genetic Resources in China
    Country Report for the Preparation of the First Report on the State of the World’s Animal Genetic Resources Report on Domestic Animal Genetic Resources in China June 2003 Beijing CONTENTS Executive Summary Biological diversity is the basis for the existence and development of human society and has aroused the increasing great attention of international society. In June 1992, more than 150 countries including China had jointly signed the "Pact of Biological Diversity". Domestic animal genetic resources are an important component of biological diversity, precious resources formed through long-term evolution, and also the closest and most direct part of relation with human beings. Therefore, in order to realize a sustainable, stable and high-efficient animal production, it is of great significance to meet even higher demand for animal and poultry product varieties and quality by human society, strengthen conservation, and effective, rational and sustainable utilization of animal and poultry genetic resources. The "Report on Domestic Animal Genetic Resources in China" (hereinafter referred to as the "Report") was compiled in accordance with the requirements of the "World Status of Animal Genetic Resource " compiled by the FAO. The Ministry of Agriculture" (MOA) has attached great importance to the compilation of the Report, organized nearly 20 experts from administrative, technical extension, research institutes and universities to participate in the compilation team. In 1999, the first meeting of the compilation staff members had been held in the National Animal Husbandry and Veterinary Service, discussed on the compilation outline and division of labor in the Report compilation, and smoothly fulfilled the tasks to each of the compilers.
    [Show full text]
  • Section II: Summary of the Periodic
    II State of Conservation of the World Heritage Properties in the Asia-Pacific Region CHINA (PEOPLE'S REPUBLIC OF) Jiuzhaigou Valley UNESCO UNESCO II.1 Introduction Year of Inscription 1992 • The responsibilities of the Administration Bureau (under the Aba Prefecture People’s Government) are Organisation Responsible for the Report to: (i) publicize laws & regulations; (ii) protect scenic area resources; (iii) coordinate in overall planning; • The Administrative Bureau of Jiuzhaigou Scenic & (iv) control the construction of service facilities; and Historic Interest Area, (v) work out rules for tourist security, environmental Aba Tibet & Qiang Autonomous Prefecture, sanitation, and public security. Jiuzhaigou County 623 402 Sichuan Province • In 1997, Jiuzhaigou was also designated a World PRC Biosphere Reserve. II.2 Statement of Significance Present State of Conservation • In 2002, 47 kilometres of plank trails (40cm above Inscription Criteria N iii the ground) were laid around the site. • Since 1999, all land currently under cultivation in the Statement of Significance buffer zone has been reforested. “Residents have • Proposed as follows: received a subsidy to compensate for their loss of income from farming.” The remaining inhabitants use “Jiuzhaigou was inscribed on the WH List for its electricity and gas instead of firewood and coal. natural beauty, and is located in the south part of the Min Shan mountain range of Aba Tibetan & Qiang Staffing and Training Needs Autonomous Prefecture, Sichuan province”. 379 staff are employed in the administration (one • It covers 720 km2 area with 63.5% forest cover, 114 • lakes, 17 groups of waterfalls, 11 torrents and 5 has a masters degree and 30 are university “calcareous ‘tufa’ shoals, in strings and clusters, graduates) belonging to Han (252), Tibetan (100), Qiang (13), and Hui (9) ethnic groups.
    [Show full text]
  • Sichuan Province
    Directory of Important Bird Areas in China (Mainland): Key Sites for Conservation Editors SIMBA CHAN (Editor-in-chief) MIKE CROSBY , SAMSON SO, WANG DEZHI , FION CHEUNG and HUA FANGYUAN Principal compilers and data contributors Prof. Zhang Zhengwang (Beijing Normal University), Prof. Chang Jiachuan (Northeast Forestry University), the late Prof. Zhao Zhengjie (Forestry Institute of Jilin Province), Prof. Xing Lianlian (University of Nei Menggu), Prof. Ma Ming (Ecological and Geographical Institute, Chinese Academy of Sciences, Xinjiang), Prof. Lu Xin (Wuhan University), Prof. Liu Naifa (Lanzhou University), Prof. Yu Zhiwei (China West Normal University), Prof. Yang Lan (Kunming Institute for Zoology), Prof. Wang Qishan (Anhui University), Prof. Ding Changqing (Beijing Forestry University), Prof. Ding Ping (Zhejiang University), the late Prof. Gao Yuren (South China Institute for Endangered Animals), Prof. Zhou Fang (Guangxi University), Prof. Hu Hongxing (Wuhan University), Prof. Chen Shuihua (Zhejiang Natural History Museum), Tsering (Tibet University), Prof. Ma Zhijun (Fudan University), Prof. Guo Yumin (Capital Normal University), Dai Nianhua (Institute of Sciences, Jiangxi), Prof. Han Lianxian (Southwest Forestry University), Yang Xiaojun (Kunming Institute for Zoology), Prof. Wang Zijiang (Kunming Ornithological Association), Prof. Li Zhumei (Institute of Biology, Guizhou), Ma Chaohong (Management Office of Yellow River Wetland National Nature Reserve, Henan), Shen You (Chengdu Bird Watching Society), Wei Qian (Chengdu Bird Watching Society), Zhang Yu (Wild Bird Society of Jiangsu), Kang Hongli (Wild Bird Society of Shanghai). Information on Important Bird Areas in China was compiled with the support of the World Bank using consultant trust funds from the Government of Japan. Surveys of IBAs in western China were funded by Keidanren Nature Conservation Fund (Japan) and the Sekisui Chemical Co.
    [Show full text]
  • Analysis of Disaster Characteristics and Emergency Response of The
    Nat. Hazards Earth Syst. Sci. Discuss., https://doi.org/10.5194/nhess-2017-418 Manuscript under review for journal Nat. Hazards Earth Syst. Sci. Discussion started: 11 December 2017 c Author(s) 2017. CC BY 4.0 License. Analysis of disaster characteristics and emergency response of the Jiuzhaigou earthquake WANG Wei1, CHEN Hong2**, XU Aihui2, QU Minhao3 1Institute of Engineering Mechanics, China Earthquake Administration, Harbin 150080, China 5 2Institute of Crustal Dynamics, China Earthquake Administration, Beijing 100085, China 3National Earthquake Response Support Service, Beijing 100049, China Correspondence to: Chen Hong ([email protected]) Abstract. This paper provides a detailed introduction to the disaster situation of the August 8, 2017, Ms 7.0 earthquake that occurred in Jiuzhaigou County, Sichuan Province, China, and specifically describes the emergency response activities of all 10 levels of the government, various departments, rescue teams, enterprises and public institutions as well as social organizations. The characteristics of the earthquake disaster and the emergency responses are analysed and summarized. The emergency response activities during the Jiuzhaigou earthquake exhibited three distinct characteristics relative to those during similar earthquakes. The response level and resource mobilization were appropriately and sensibly adjusted according to the development of the disaster, and various departments worked closely together to conduct multi-sector joint rescue efforts. 15 Moreover, professional rescue forces and participating social organizations were more rationally mobilized. A set of effective disaster relief command and coordination mechanisms were established for cooperation between multiple departments and the participation of many social organizations under the leadership of the local government. Finally, newer and more effective technologies played an important role in the emergency response and rescue efforts following this earthquake.
    [Show full text]
  • 8 Days in Chengdu and Around
    8 days in Chengdu and around Contact us | turipo.com | [email protected] 8 days in Chengdu and around 3 days in Chengdu and around: Leshan, Eemeishan, Qingcheng Mountain and Jiuzhaigou Nature Reserve. Contact us | turipo.com | [email protected] Day 1 - Changdu Contact us | turipo.com | [email protected] Day 1 - Changdu WIKIPEDIA 1. Chengdu Panda Breeding Research Center People's Park may refer to: Chengdu Panda Breeding Research Center, Chengdu, China Rating: 4.7 4. Jinli Road This place is awesome. lots off to people working there who keep this park so well maintained and friendly for the Jin Li Lu, Wuhou Qu, Chengdu Shi, Sichuan Sheng, China animals there as well as for the visitors. They are doing a great job in conservaon of these cuddly cute bears. Very Jinli Ancient Street is “The First Street of Shu Kingdom”, beautiful. A must visit place. and it’s a famous snack street in Chengdu. The ambiance was like stepping back into the past, well presented and historically brilliant. Evening stroll is extreme beauful, and 2. Luodai Ancient Town picturesque with the lanterns lit up and the street performances are also wonderful. China, Sichuan Sheng, Chengdu Shi, Longquanyi Qu, Bajiaojing St, 东郊龙泉驿区 Telephone: +86 28 8489 3693 Rating: 4.2 This is a nice ancient town with local snacks and shopping. It's very convenient to get here from Chengdu and a nice half day trip. 3. People's Park People's Park, Chengdu, Sichuan, China This place is very good naonal park for walking and breath some air with a tea house and great environment.
    [Show full text]
  • Analysis of the Disaster Characteristics and Emergency Response of the Jiuzhaigou Earthquake
    Nat. Hazards Earth Syst. Sci., 18, 1771–1783, 2018 https://doi.org/10.5194/nhess-18-1771-2018 © Author(s) 2018. This work is distributed under the Creative Commons Attribution 4.0 License. Analysis of the disaster characteristics and emergency response of the Jiuzhaigou earthquake Wei Wang1, Hong Chen2, Aihui Xu2, and Minhao Qu3 1Institute of Engineering Mechanics, China Earthquake Administration, Harbin 150080, China 2Institute of Crustal Dynamics, China Earthquake Administration, Beijing 100085, China 3National Earthquake Response Support Service, Beijing 100049, China Correspondence: Hong Chen ([email protected]) Received: 24 November 2017 – Discussion started: 11 December 2017 Revised: 30 March 2018 – Accepted: 15 June 2018 – Published: 27 June 2018 Abstract. China’s earthquake emergency response system garding earthquakes, meteorological and flood disasters, wa- has been improved by lessons learned from multiple earth- ter pollution, soil desertification, forest fires and environment quakes. This paper focuses on the Ms 7.0 earthquake that oc- protection. However, China’s modern emergency manage- curred in Jiuzhaigou County, Sichuan Province, China, on ment was preliminary formed during the SARS (severe acute 8 August 2017 and assesses the emergency response activ- respiratory syndrome) event in 2003, which affected as many ities of all levels of government as well as various depart- as 26 provinces and 5327 persons with a death rate of 6.53 % ments, rescue teams, enterprises and public institutions and (Li et al., 2004), highlighting the importance of emergency social organizations. The emergency response is compared response. China used advanced emergency management con- to other large earthquakes that occurred in China in recent cepts of all-hazards approach, integrated emergency manage- years.
    [Show full text]
  • Bon the Everlasting Religion of Tibet
    BON THE EVERLASTING RELIGION OF TIBET TIBETAN STUDIES IN HONOUR OF PROFESSOR DAVID L. SNELLGROVE Papers Presented at the International Conference on Bon 22-27 June 2008, Shenten Dargye Ling, Château de la Modetais, Blou, France New Horizons of Bon Studies, 2 Samten G. Karmay and Donatella Rossi, Editors Founded by Giuseppe Tucci A QUARTERLY PUBLISHED BY THE ISTITUTO ITALIANO PER L’AFRICA E L’ORIENTE I s I A O Vol. 59 - Nos. 1-4 (December 2009) EDITORIAL BOARD † Domenico Faccenna Gherardo Gnoli, Chairman Lionello Lanciotti Luciano Petech Art Director: Beniamino Melasecchi Editorial staff: Matteo De Chiara, Elisabetta Valento ISSN 0012-8376 Yearly subscription: € 200,00 (mail expenses not included) Subscription orders must be sent direct to: www.mediastore.isiao.it Manuscripts should be sent to the Editorial Board of East and West Administrative and Editorial Offices: Istituto Italiano per l’Africa e l’Oriente Direttore scientifico: Gherardo Gnoli; Direttore editoriale: Francesco D’Arelli Art director: Beniamino Melasecchi; Coord. redazionale: Elisabetta Valento Redazione: Paola Bacchetti, Matteo De Chiara Via Ulisse Aldrovandi 16, 00197 Rome C O N T E N T S Preface by Gherardo Gnoli................................................................................................ 11 Introduction by Samten G. Karmay................................................................................... 13 Part I. Myths and History Per Kværne, Bon and Shamanism.....................................................................................
    [Show full text]
  • Pdf | 35.16 Kb
    INTEGRATED SAFEGUARDS DATASHEET APPRAISAL STAGE I. Basic Information Date prepared/updated: 11/10/2008 Report No.: AC4016 Public Disclosure Authorized 1. Basic Project Data Country: China Project ID: P114107 Project Name: Wenchuan Earthquake Recovery Task Team Leader: Mara K. Warwick Estimated Appraisal Date: November 13, Estimated Board Date: December 16, 2008 2008 Managing Unit: EASCS Lending Instrument: Emergency Recovery Loan Sector: General water, sanitation and flood protection sector (44%);Roads and highways (39%);Health (13%);General education sector (4%) Theme: Natural disaster management (P);Pollution management and environmental health (S);Access to urban services and housing (S) Public Disclosure Authorized IBRD Amount (US$m.): 710.00 IDA Amount (US$m.): 0.00 GEF Amount (US$m.): 0.00 PCF Amount (US$m.): 0.00 Other financing amounts by source: Borrower 30.00 30.00 Environmental Category: A - Full Assessment Simplified Processing Simple [] Repeater [] Is this project processed under OP 8.50 (Emergency Recovery) Yes [X] No [ ] or OP 8.00 (Rapid Response to Crises and Emergencies) Public Disclosure Authorized 2. Project Objectives To restore essential infrastructure, health, and education services to at least levels existing prior to the Wenchuan Earthquake, and where appropriate, to provide for expansion of services while reducing the vulnerability to seismic and flood hazards. 3. Project Description The project is divided into two provincial parts: one for Sichuan and one for Gansu. The first part, the Sichuan Recovery Program, will finance reconstruction and appropriate expansion of infrastructure and health sub-projects in about 16 counties in the five municipalities of Mianyang, Guangyuan, Bazhong, Nanchong and Ya’an.
    [Show full text]
  • Studies on Ethnic Groups in China
    Kolas&Thowsen, Margins 1/4/05 4:10 PM Page i studies on ethnic groups in china Stevan Harrell, Editor Kolas&Thowsen, Margins 1/4/05 4:10 PM Page ii studies on ethnic groups in china Cultural Encounters on China’s Ethnic Frontiers Edited by Stevan Harrell Guest People: Hakka Identity in China and Abroad Edited by Nicole Constable Familiar Strangers: A History of Muslims in Northwest China Jonathan N. Lipman Lessons in Being Chinese: Minority Education and Ethnic Identity in Southwest China Mette Halskov Hansen Manchus and Han: Ethnic Relations and Political Power in Late Qing and Early Republican China, 1861–1928 Edward J. M. Rhoads Ways of Being Ethnic in Southwest China Stevan Harrell Governing China’s Multiethnic Frontiers Edited by Morris Rossabi On the Margins of Tibet: Cultural Survival on the Sino-Tibetan Frontier Åshild Kolås and Monika P. Thowsen Kolas&Thowsen, Margins 1/4/05 4:10 PM Page iii ON THE MARGINS OF TIBET Cultural Survival on the Sino-Tibetan Frontier Åshild Kolås and Monika P. Thowsen UNIVERSITY OF WASHINGTON PRESS Seattle and London Kolas&Thowsen, Margins 1/7/05 12:47 PM Page iv this publication was supported in part by the donald r. ellegood international publications endowment. Copyright © 2005 by the University of Washington Press Printed in United States of America Designed by Pamela Canell 12 11 10 09 08 07 06 05 5 4 3 2 1 All rights reserved. No part of this publication may be repro- duced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any infor- mation storage or retrieval system, without permission in writ- ing from the publisher.
    [Show full text]
  • Internal Ex-Post Evaluation for Technical Cooperation Project
    Internal Ex-Post Evaluation for Technical Cooperation Project conducted by China Office: November, 2018 Country Name People's Republic of Project on Forest Restoration after the Earthquake in Sichuan Province China I. Project Outline The Sichuan Earthquake, which occurred in Wenchuan County in Sichuan Province in China on May 12, 2008, caused a great deal of damages to forest vegetation. As measures to restore the disaster-affected forests, the Government of China launched a policy to restore multiple functions of forests in stages through combining natural regeneration and artificial restoration. Through JICA’s technical cooperation project “The Background Model Afforestation Project in Sichuan” (2000-2007), technologies such as “Chisan” technologies using simple work methods had been developed in Sichuan Province. However, because of diverse geographical conditions of the areas affected by the Sichuan Earthquake, it was difficult to determine the precise measures for each condition. In addition, technical and management capacity of the related agencies was not sufficient for restoration of forest vegetation which had been destroyed in an unprecedented scale in China. The project aims at improving technical capacity of the related agencies of Sichuan Province, engaged in restoration projects for typical disaster-affected forests in the project areas1 in the earthquake-stricken areas in Sichuan Province in China, through development of restoration plans for the typical disaster-affected forests, establishment of technological system concerning major forest restoration work methods, and enhancement of contents and system of technical training necessary for implementation of restoration works Objectives of the Project for the disaster-affected forests, thereby enabling sustainable and self-reliant implementation of restoration projects for the disaster-affected forests.
    [Show full text]