Journal of Avian Biology JAV-01015 Liu, Y., Chen, G., Huang, Q., Jia, C., Carey, G., Leader, P., Li, Y., Zou, F., Yang, X., Olsson, U

Journal of Avian Biology JAV-01015 Liu, Y., Chen, G., Huang, Q., Jia, C., Carey, G., Leader, P., Li, Y., Zou, F., Yang, X., Olsson, U

Journal of Avian Biology JAV-01015 Liu, Y., Chen, G., Huang, Q., Jia, C., Carey, G., Leader, P., Li, Y., Zou, F., Yang, X., Olsson, U. and Alström, P. 2016. Species delimitation of the white- tailed rubythroat Calliope pectoralis complex (Aves, Turdidae) using an integrative taxonomic approach. – J. Avian Biol. doi: 10.1111/jav.01015 Supplementary material Appendix 1 Table A1. Samples with vouchers and sequences with GenBank accession numbers used in this article (AMNH=American Museum of Natural History, SYSb=Sun Yat-sen University, SCIEA=South China Institute of Endangered Animals). GenBank accession numbers in bold indicate sequences yielded in this study. No. of Taxon Locality Sample ID/Voucher samples COI Cytb ODC Myo Aksu, Xinjiang, China SYSb024 1 KU973742 KU973766 KU973805 KU973785 Nalati Grassland, Xinyuan, Xinjiang, China SYSb1087/IOZ64459 1 KU973743 KU973767 —— KU973786 Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1088/IOZ63178 1 KU973745 KU973769 KU973807 KU973788 C. pectoralis Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1089/IOZ63189 1 KU973746 KU973770 KU973808 KU973789 ballioni Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1090/IOZ63190 1 KU973747 KU973771 KU973809 KU973790 Hogasangkhok Ravine,Varzob Region, Tajikistan SYSb1091/IOZ63198 1 KU973748 KU973772 KU973810 KU973791 Kazakhstan Sangster et al. (2010) 1 —— HM633321 HM633739 HM633603 The Tian Shan Observatory, Kazakhstan SYSb462 1 KU973744 KU973768 KU973806 KU973787 Xiadawuxiang, Maqen, Qinghai, China SYSb540/IOZ54456 1 KU973732 KU973755 KU973797 KU973779 Baima Snow Mountain, Deqin, Yunnan, China SYSb770 1 KU973733 KU973756 KU973798 —— Fugong, Nujiang, Yunnan, China SYSb771/KIZ-GLGS0218 1 KU973734 KU973757 KU973799 KU973780 Lushui, Nujiang, Yunnan, China SYSb772/KIZ-GLGS5006 1 KU973735 KU973758 KU973800 KU973781 Yulong Snow Mountain, Lijiang, Yunnan, China SYSb773/KIZ-YL07191 1 KU973736 KU973759 KU973801 KU973782 C. p. Meri Snow Mountain, Deqin, Yunnan, China SYSb774 1 KU973737 KU973760 KU973802 —— tschebaiewi Meri Snow Mountain, Deqin, Yunnan, China SYSb775 1 KU973738 KU973761 —— —— Meri Snow Mountain, Deqin, Yunnan, China SYSb776 1 KU973739 KU973762 —— —— Balang Shan, Wenchuan, Sichuan, China SYSb861 1 —— KU973763 —— —— Tuolin Temple, Zanda, Ngari, Tibet, China SYSb1085/IOZ64458 1 KU973740 KU973764 KU973803 KU973783 Shergyla Mountain, Nyingchi, Tibet, China SYSb1086/IOZ64457 1 KU973741 KU973765 KU973804 KU973784 SYSb1551-1553/AMNH Available 3 C. p. confusa Laghep, Sikkim, India (S79598-S79600) —— from authors —— —— Calliope Lianhua Shan, Gansu, Zhuoni, China SYSb2545/SCIEA (S03542) 1 KU973753 KU973777 KU973815 1 calliope 4 KU973749 KU973773 KU973811 KU973792 Laoting, Hebei, China SYSb (1524-25,1527-28) —973752 —973776 —973814 —973795 Japan Sangster et al. (2010) 1 —— HM633316 HM633735 HM633598 Calliope Jiuding Shan, Deyang, Sichuan, China SYSb463/IOZ-PA20130516 1 KU973754 KU973778 KU973816 KU973796 pectardens Sichuan, China Sangster et al. (2010) 1 —— HM633320 HM633738 HM633602 Calliope 1 obscura Shaanxi, China Sangster et al. (2010) —— KC967092 KC967094 KC967096 Tarsiger 1 johnstoniae Taiwan, China Sangster et al. (2010) —— HM633391 HM633801 HM633672 Table A2. Amplification and sequencing primers and annealing temperature (Ta) of PCRs used to in this article. Genes Primers Sequences(5’-3’) Ta(°C) Length(bp) References BirdF1 TTCTCCAACCACAAAGACATTGGCAC COI 56 693 Hebert et al. 2004 BirdR1 ACGTGGGAGATAATTCCAAATCCTG L14995 CTCCCAGCCCCATCCAACATCTCAGCATGATGAAACTTCG 47-55 1018 Groth 1998 H16065 CTAAGAAGGGTGGAGTCTTCAGTTTTTGGTTTACAAGAC CylF285 TCGTAGGATACGTACTGCCC 236 CylR521 TGTTTGAGCCTGTTTCGTGT CylF499 CCTACACGAAACAGGCTCAA CYTB 220 CylR718 TCATTCGGGTTTGATGTGGG 50-55 This study CylF664 AAACTTCACACCAGCCAACC 163 CylR826 GTGTAATAGAGGGGCGAGGA CylF834 AACAGCGCTCACTAACCTTC 186 CylR1019 CTAATACGGCTGCAAGTGGG MYO2 GCCACCAAGCACAAGATCCC Myo 53-58 690 Kimball et al. 2009 MYO3F TTCAGCAAGGACCTTGATAATGACTT OD6 GACTCCAAAGCAGTTTGTCGTCTCAGTGT OD8R ATTGGTGGTGGCTTCCCTGGCTCTGAAGA ODC 53-61 663 Allen & Omland 2003 ODC2-F GGTGAGCTGACAGTACCAAA ODC2-R AGCCACCACCAATATCAAGC Table A3. Geographic information of sound recordings used in this study. Altitu Date Type Taxon Locality Latitude Longitude de( (yyyy/mm/ Recordist Source m) dd) Song Call + -- This study Kalon, Sughd Region, Tajikistan 39°3'3.20" 68°58'54.23" 2918 2014/7/20 Chenxi Jia + -- This study + -- This study Geoff 43°3'31.92" 76°58'5.40" 2749 2009/5/11 + -- This study Carey + -- This study Ruud van 2400 2009/5/20 + -- XC43633 Beusekom Tian Shan Observatory, Ili-Alatau Arend National Park, Almaty, Kazakhstan 2700 2011/5/14 + + XC156598 Wassink Calliope. 43°4'25.64" 76°59'14.68" Jan Hein pectoralis 3000 2007/5/15 van + -- XC29566 ballioni Steenis 2200 2013/7/17 Thijs Fijen -- + XC145263 Nalati Grassland, Xinyuan County, 43°9'3.96" 84°22'25.43" 2570 2014/6/16 Chenxi Jia + -- This study Xinjiang, China Sayram Lake, Bole County, 44°40'20.53" 81°22'27.80" 2423 2014/6/19 Chenxi Jia + -- This study Xinjiang, China + -- This study Wusu County, Xinjiang, China 43°47'15.81" 84°27'42.80" 2640 2014/5/31 Chenxi Jia + -- This study C. p. Naltar valley, Gilgit, Gilgit– Per + -- This study 36°10'30.80" 74° 9'43.15" 2900 1998/6/3 pectoralis Baltistan, Pakistan Alström + -- This study + -- This study -- + XC117075 -- + XC117076 Kaziranga National Park (watch Mike -- + XC117077 26°38'4.20" 93°21'27.00" 70 2012/11/23 C. p. tower), Golaghat, Assam, India Nelson -- + XC117078 confusa -- + XC117081 -- + XC117116 +* -- XC117079 Dibru-Saikhowa National Park, Desmond 27°40'7.42" 95°21'44.67" 120 1998/1/3 +* -- XC79436 Laika Gaon, Assam, India Allen 2008/6/8 + -- This study Baima Snow Mountain, Deqin Per 28°20'27.12" 99° 3'57.48" 4280 + -- This study County, Yunnan, China 2008/6/9 Alström + -- This study 4015 + -- This study 3970 + -- This study Per Road to Moxi, Kangding, Sichuan, 2013/5/30 29°54'00" 102°0'00" 4450 Alström + -- This study China 4060 + -- This study 4360 2013/5/31 + -- This study C. p. Per tschebaiewi 4280 2013/6/2 + -- This study Alström Frank 30°56'58.20" 102°52'58.44" 3800 2013/6/2 -- + XC110848 Balang Shan, Wenchuan County, Lambert Geoff Sichuan, China 4020 2012/6/8 + -- This study Carey 30°57'45.21" 102°52'38.66" 3600 2012/6/1 Frank + -- XC110845 30°53'15.76" 102°55'35.58" 3800 2012/6/2 Lambert + -- XC110849 Along Road 318, Yajiang, Sichuan, 30° 0'12.35" 100°51'44.75" 4408 2012/5/7 + + This study Chenxi Jia China 30°17'13.78" 99°30'48.35" 4217 2012/5/8 + -- This study Heimahe, Qinghai Lake, Gonghe Per 36°43'45.77" 99°47'17.33" 3203 1987/6/1 + -- This study County, Qinghai, China Alström Laoye Shan, Datong County, Frank 36°55'52.31" 101°41'42.16" 2800 2005/6/22 + -- XC68597 Qinghai, China Lambert Frank S of Gyegu, Yushu, Qinghai, China -- -- 4300 2005/6/10 + -- XC68598 Lambert Kanda Shan Pass, Yushu, Qinghai, Mike 32°20'26.16" 96°32'53.16" 4300 2014/7/7 -- + XC191607 China Nelson Mats Yushu, Qinghai, China -- -- -- 2010/6/27 -- + XC203410 Rellmar Xiadawuxiang, Maqen County, 34°57'27.14" 99°20'5.71" 4084 2012/5/25 Chenxi Jia + -- This study Golog, Qinghai, China Shergyla Mountain, Nyingchi, 29°36'51.30" 94°39'37.12" 4320 2014/5/28 + -- This study Tibet, China Chenxi Jia Tuolin Temple, Zanda County, 31°29'9.30" 79°47'55.31" 3606 2014/6/7 + -- This study Ngari, Tibet, China Tomas 2013/6/18 + -- XC176640 Beishan National Park, Huzhu Carlberg 36°49'23.88" 102°29'55.98" 2600 County, Qinghai, China Mike 2014/7/1 + -- XC191282 C. calliope Nelson Laoye Shan, Datong County, Ding Li beicki 36°55'52.31" 101°41'42.16" 2800 2013/6/12 + -- XC197759 Qinghai, China Yong Jiuzhaigou County, Aba, Sichuan, Frank 32°54'2.29" 103°31'4.81" 3200 2013/6/4 + -- XC161391 China Lambert C. c. Belaya Uba, Ridder, Oskemen, 50°32'38.42" 83°41'20.94" 750 2013/6/30 Thijs Fijen + -- XC145204 calliope Shyghys, Kazakhstan C. c. Prey Srorng Community Forest, Frank beicki/callio Krong Samraong, Oddar 13°59'9.60" 103°54'10.80" 90 2010/11/18 -- + XC88224 Lambert pe Meanchey, Cambodia Seima Biodiversity Conservation Frank Area, O Am, Mondulkiri, 12°8'45.24" 106°54'57.24" 140 2012/4/20 -- + XC97977 Lambert Cambodia Figure A1. Reconstruction of phylogenetic relationships of Calliope pectoralis and its congeners based on 600 bp of mitochondrial cytb using ML and BI approaches. Because ML and BI provided an identical topology, the shown tree topology is based on ML. The sequence of Collared Bush Robin Tarsiger johnstoniae was used as outgroup to root the phylogenetic tree. For all trees, bootstrap percentages for ML (performed by RaxML) > 60% and Bayesian posterior probabilities (using MrBayes) > 0.9 are indicated for each nodes. Figure A1. SYSb0861 Sichuan SYSb0776 Yunnan SYSb0775 Yunnan SYSb0770 Yunnan SYSb1086 Tibet SYSb0771 Yunnan C.#p.#tschebaiewi# 97/1.0 SYSb0774 Yunnan SYSb0772 Yunnan SYSb0540 Qinghai SYSb1085 Tibet SYSb0773 Yunnan 92/1.0 SYSb0024 Xinjiang SYSb1090 Tajikistan SYSb1091 Tajikistan SYSb1087 Xinjiang SYSb1089 Tajikistan C.#p.#ballioni# 100/1.0 SYSb0462 Kazakhstan SYSb1088 Tajikistan DZUG-U30 Kazakhstan SYSb1522 Sikkim SYSb1521 Sikkim C.#p.#confusa# 67/0.94 SYSb1523 Sikkim 79/0.94 DZUG-U660 Japan SYSb2545 Gansu 100/1.0 SYSb1525 Hebei SYSb1524 Hebei C.#calliope# SYSb1527 Hebei SYSb1528 Hebei 100/1.0 SYSb0463 Sichuan 100/1.0 DZUG-U40 Sichuan C.#pectardens# Shaanxi C.#obscura# Tarsiger johnstoniae 0.02 Figure A2. Multilocus species trees for the Calliope pectoralis – C. calliope complex inferred by *BEAST. Bayesian posterior probabilities are indicated for each node. Figure A3. Shows of breath-band width difference between Calliope pectoralis ballioni (Left 1-2) and C. p. tschebaiewi (Left 3-5). Photoed by Yang Liu from IOZ, CAS, China. .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    11 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us