DOCSLIB.ORG

WO 2017/112703 Al 29 June 2017 (29.06.2017) W P O P C T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2017/112703 Al 29 June 2017 (29.06.2017) W P O P C T (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/112703 Al 29 June 2017 (29.06.2017) W P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every A61P 35/00 (2006.01) A61K 9/00 (2006.01) kind of national protection available): AE, AG, AL, AM, A61K 31/337 (2006.01) G01N 33/574 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, (21) Number: International Application DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US20 16/067860 HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KH, KN, (22) International Filing Date: KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, 20 December 2016 (20. 12.2016) MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, (25) Filing Language: English RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, (26) Publication Language: English TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 62/387,359 24 December 201 5 (24. 12.2015) US (84) Designated States (unless otherwise indicated, for every 62/413,763 27 October 2016 (27. 10.2016) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (71) Applicant: CELGENE QUANTICEL RESEARCH, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, INC. [US/US]; 9393 Towne Centre Drive, Suite 110, San TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, Diego, California 92121 (US). DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, (72) Inventors: NIKOLOVA, Zariana; c/o Celgene Interna SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, tional Sari, Route de Perreaux 1, 2017 Boudry (CH). GW, KM, ML, MR, NE, SN, TD, TG). CHO, Robert; 1585 Riorden Terrace, Sunnyvale, Califor nia 94087 (US). STAFFORD, Jeffrey Alan; 12752 Sandy Published: Crest Court, San Diego, California 92130 (US). — with international search report (Art. 21(3)) (74) Agents: SUNG, Lawrence M. et al; Wiley Rein LLP, Pat ent Administration, 1776 K Street, NW, Washington, Dis trict of Columbia 20006 (US). (54) Title: BROMODOMAIN AND EXTRA-TERMINAL PROTEIN INHIBITOR COMBINATION THERAPY FIG. 8 2500 200 E £ 1500 o 1000 E . c 500 o 0 10 15 20 Days of Treatment (57) Abstract: The present disclosure relates generally to compositions and methods of treating cancers, such as glioblastoma and o non-Hodgkin's lymphomas, or other cancers in which the subject suffers from an advanced solid tumor, comprising the administra tion of a bromodomain and extra-terminal protein (BET) inhibitor and at least one chemotherapeutic agent, which does not inhibit BET directly. The BET inhibitor/chemo therapeutic agent combination therapy can yield synergistic effects, thereby increasing the effectiveness of the cancer treatment as compared to the administration of either the BET inhibitor or the chemotherapeutic agent alone. BROMODOMAIN AND EXTRA-TERMINAL PROTEIN INHIBITOR COMBINATION THERAPY RELATED APPLICATION [0001] This Application claims priority benefit of U.S. Provisional Patent Application No. 62/387,359, filed December 24, 2015, and U.S. Provisional Patent Application No. 62/413,763, filed October 27, 2016, both of which are incorporated fully herein by reference for all purposes. FIELD [0002] The embodiments described herein provide compositions, formulations, and methods for treating cancer and neoplastic disease; in which such treatments include combination therapies comprising administration of a bromodomain and extra-terminal (BET) protein inhibitor and a chemotherapeutic agent, such as temozolomide or paclitaxel. BACKGROUND [0003] There remains a need for compositions, formulations, and methods for treating subjects with cancers such as, for example, basal cell carcinoma, relapsed or refractory non- Hodgkin's lymphomas (NHL), glioblastoma multiforme, anaplastic astrocytoma, or other advanced solid tumors. [0004] For example, basal cell carcinoma (BCC) is a common cancer throughout the world, and its incidence is increasing. In the United States alone, more than 3.5 million new patients are diagnosed annually with non-melanoma skin cancer. Most BCCs can be cured by topical therapy, surgery, radiotherapy, or a combination thereof. Advanced BCC, however, often causes significant disfigurement and morbidity with associated physical and psychological sequelae, because BCC occurs commonly in sun-exposed areas such as the face. Further, a small proportion of these cancers are metastatic and not amenable to typical therapy. Near all BCCs are associated with aberrant hedgehog (Hh) signaling, which stimulates unregulated cell growth, and several therapeutic Hh inhibitors have proved useful in treating BCC. Unfortunately, about 20% of BCCs develop resistance to current Hh inhibitors, usually via Hh pathway reactivation by mutations that either interfere with the drug binding pocket, increase Hh signaling activity, or act through concurrent copy number changes in suppressor genes. Patients will benefit from the development of well-tolerated agents that overcome these resistance pathways by, for example, targeting proteins downstream in relevant signaling pathways. SUMMARY [0005] The aspects and embodiments of the present disclosure provide for methods and pharmaceutical compositions for treating subjects with cancer and neoplastic disease; such as those with advanced solid tumors, relapsed or refractory non-Hodgkin's lymphomas, glioblastoma multiforme, anaplastic astrocytoma, basal cell carcinoma, or other cancers. At least one embodiment provides a method for treating cancer and neoplastic disease comprising administering to a subject in need thereof a therapeutically effective amount of at least one BET inhibitor and a therapeutically effective amount of at least one chemotherapeutic agent. The chemotherapeutic agent may be an alkylating agent, such as temozolomide, or a mitotic inhibitor such as paclitaxel or paclitaxel protein-bound particles. An exemplary BET inhibitor is 4-[2- (cyclopropylmethylamino)-5-methylsulfonylphenyl]-2-methylisoquinolin- 1-one. According to the method, administration of a BET inhibitor and chemotherapeutic agent may be concurrent or sequential. [0006] In at least one embodiment, a BET inhibitor and chemotherapeutic agent of the combination therapy may be administered in a single pharmaceutical composition. Some embodiments provide a composition comprising a pharmaceutically effective amount of a BET inhibitor and temozolomide, formulated in a pharmaceutically acceptable carrier. Some embodiments provide a composition comprising a pharmaceutically effective amount of a BET inhibitor and protein-bound paclitaxel, formulated in a pharmaceutically acceptable carrier. In one embodiment, BET inhibitor and chemotherapeutic agent of the combination therapy may exist as separate pharmaceutical compositions administered either concurrently or sequentially. In another embodiment, BET inhibitor and chemotherapeutic agent are independent pharmaceutical compositions that are admixed before administration (i.e., admixed in a pharmaceutically acceptable solution for injection or infusion). In still another embodiment, BET inhibitor and chemotherapeutic agent are disposed as separate pharmaceutical compositions that are packaged together for administration (e.g., a blister-pack containing oral formulations, or packaging comprising an oral dosage form and an injectable dosage form). [0007] In at least one embodiment, administering the BET inhibitor and the chemotherapeutic agent results in a synergistic inhibition of cell proliferation or increased cell death (e.g., tumor cell death) compared with administration of either the BET inhibitor or the chemotherapeutic agent alone. The chemotherapeutic agent can be an anti-proliferative or pro- apoptotic compound, and can be selected so as to show a synergistic anti-proliferative or pro- apoptotic effect when co-administered with a BET inhibitor. Combinatorial treatment with a BET inhibitor and a chemotherapeutic agent can result in a synergistic anti-cancer effect or can overcome developed resistance. Synergistic effects or overcoming developed resistance can allow lower doses, significantly reducing therapy cost in a substantial patient population. DESCRIPTION OF THE DRAWINGS [0008] FIG. 1 is a graph showing dose-dependent tumor growth inhibition as measured by tumor volume in a TNBC PDX model, COH70, following dosing with Compound A (4- [2-(cyclopropylmethylamino)-5 -methylsulfonylphenyl] -2-methylisoquinolin- 1-one). Compound A dosing by mouth (PO) once daily for three consecutive days, followed by four days off (3x/week); Vehicle; Compound A 12.5 mg/kg PO 3x/week; Compound A 16 mg/kg PO 3x/week; Compound A 20 mg/kg PO 3x/week; SEM is the standard error of the mean. [0009] FIG. 2 is a graph showing dose-dependent tumor growth inhibition as measured by tumor volume in a GBM PDX model, GBM15, following dosing with Compound A. Vehicle; — Compound A 15 mg/kg PO once daily for 5 consecutive days, followed by 2 days off (5/2); Compound A 25 mg/kg PO once daily for 3 consecutive days, followed by 4 days off (3/4); Compound A 37.5 mg/kg PO once daily for 2 consecutive days, followed by 5 days off (2/5); SEM is the standard error of the mean. [0010] FIG. 3 s a graph showing tumor growth inhibition of GBM3 (GBM PDX) xenografts by administration of either Compound A, temozolomide (TMZ), or a combination of Compound A and TMZ. Vehicle; Compound A 12 mg/kg PO once daily; Compound A 6 mg/kg PO twice daily; Compound A 6 mg/kg PO twice daily combined with TMZ 50 mg/kg IP (intraperitoneal injection) given on days 7-9 and 22-24; TMZ 50 mg/kg IP given on days 7-9, 22-24; SEM is the standard error of the mean. [0011] FIG. 4 is a schematic outlining an overall study design useful for demonstrating safety or efficacy of pharmaceutical compositions.
Load more

Recommended publications
  • Investigator Initiated Study IRB-29839 an Open-Label Pilot Study To
    Investigator Initiated Study IRB-29839 An open-label pilot study to evaluate the efficacy and safety of a combination treatment of Sonidegib and BKM120 for the treatment of advanced basal cell carcinomas Version 05 September 2016 NCT02303041 DATE: 12Dec2018 1 Coordinating Center Stanford Cancer Center 875 Blake Wilbur Drive Stanford, CA 94305 And 450 Broadway, MC 5334 Redwood City, CA 94603 Protocol Director and Principal Investigator Anne Lynn S Chang, MD, Director of Dermatological Clinical Trials 450 Broadway St, MC 5334 Redwood City, CA 94603 [email protected] Co-Investigator Anthony Oro, MD PhD 450 Broadway St, MC 5334 Redwood City, CA 94603 [email protected] Biostatistician Shufeng Li, MS 450 Broadway St, MC 5334 Redwood City, CA 94603 [email protected] Study Coordinator Ann Moffat 450 Broadway St, MC 5334 Redwood City, CA 94603 [email protected] 2 Table of Contents 1 Background ................................................................. 7 1.1 Disease Background ..................................................... 7 1.2 Hedgehog Pathway and mechanism of action ............................... 7 1.3 PI3K Pathway and mechanism of action ................................... 9 1.4 Sonidegib Compound Information ............ Error! Bookmark not defined. 1.4.1 Preclinical Studies for Sonidegib ....................................................................11 1.4.2 Muscular system...............................................................................................13 1.4.3 Skeletal system ................................................................................................13
    [Show full text]
  • FDA-Approved Content Report Section 1
    SAMPLE REPORT New FDA-Approved Broad Companion Diagnostic for Solid Tumors FDA-Approved Content Report Section 1 1 FDA-Approved Therapies PATIENT TUMOR TYPE TRF# List of FDA-approved Jane Sample Lung adenocarcinoma TRFXXXXXX companion diagnostics to PATIENT PHYSICIAN SPECIMEN identify patients who may DISEASE Lung adenocarcinoma ORDERING PHYSICIAN Not Given SPECIMEN SITE Not Given NAME Not Given MEDICAL FACILITY Not Given SPECIMEN ID Not Given benefi t from associated DATE OF BIRTH Not Given ADDITIONAL RECIPIENT Not Given SPECIMEN TYPE Not Given SEX Female MEDICAL FACILITY ID Not Given DATE OF COLLECTION Not Given therapies MEDICAL RECORD # Not Given PATHOLOGIST Not Given SPECIMEN RECEIVED Not Given CDx Associated Findings 1 GENOMIC FINDINGS DETECTED FDA-APPROVED THERAPEUTIC OPTIONS 2 All Other Biomarkers EGFR L858R Gilotrif® (Afatinib) All other biomarkers, Iressa® (Gefitinib) including tumor mutational Tarceva® (Erlotinib) burden (TMB) and 2 microsatellite instability (MSI), without companion OTHER ALTERATIONS & BIOMARKERS IDENTIFIED Results reported in this section are not prescriptive or conclusive for labeled use of any specific therapeutic product. See diagnostic claims professional services section for additional information. Microsatellite Status MS-Stable PTCH1 T416S Tumor Mutation Burden 11 Muts/Mb RBM10 Q494* CDKN2A/B loss TP53 R267P EGFR amplification § Refer to appendix for limitation statements related to detection of any copy number alterations, gene rearrangements, MSI or TMB result in this section. Please refer to appendix
    [Show full text]
  • An Investigator-Initiated Open-Label Trial of Sonidegib in Advanced Basal Cell Carcinoma Patients Resistant to Vismodegib Christina Danial, Kavita Y
    Published OnlineFirst November 6, 2015; DOI: 10.1158/1078-0432.CCR-15-1588 Clinical Trial Brief Report Clinical Cancer Research An Investigator-Initiated Open-Label Trial of Sonidegib in Advanced Basal Cell Carcinoma Patients Resistant to Vismodegib Christina Danial, Kavita Y. Sarin, Anthony E. Oro, and Anne Lynn S. Chang Abstract Purpose: To assess the tumor response to the smoothened sive disease with sonidegib. Three patients experienced stable (SMO) inhibitor, sonidegib (LDE225), in patients with an disease and discontinued sonidegib either due to adverse events advanced basal cell carcinoma (BCC) resistant to treatment with (n ¼ 1) or due to election for surgery (n ¼ 2). The response of one vismodegib (GDC0449). patient was not evaluable. SMO mutations with in vitro data Experimental Design: Nine patients with an advanced suggesting resistance to Hh pathway inhibition were identified BCC that was previously resistant to treatment with vismode- in 5 patients, and none of these patients experienced responses gib were given sonidegib in this investigational, open- while on sonidegib. label study. Tumor response was determined using the Conclusion: Patients with advanced BCCs that were response evaluation criteria in solid tumors. SMO mutations previously resistant to treatment with vismodegib similarly were identified using biopsy samples from the target BCC demonstrated treatment resistance with sonidegib. Patients location. who have developed treatment resistance to an SMO inhibitor Results: The median duration of treatment with sonidegib was may continue to experience tumor progression in response to 6 weeks (range, 3–58 weeks). Five patients experienced progres- other SMO inhibitors. Clin Cancer Res; 1–5. Ó2015 AACR. Introduction Sonidegib (LDE225) is a new SMO inhibitor approved in 2015 by the FDA for locally advanced BCCs.
    [Show full text]
  • Imatinib (Gleevec™)
    Biologicals What Are They? When Did All of this Happen? There are Clear Benefits. Are there also Risks? Brian J Ward Research Institute of the McGill University Health Centre Global Health, Immunity & Infectious Diseases Grand Rounds – March 2016 Biologicals Biological therapy involves the use of living organisms, substances derived from living organisms, or laboratory-produced versions of such substances to treat disease. National Cancer Institute (USA) What Effects Do Steroids Have on Immune Responses? This is your immune system on high dose steroids projects.accessatlanta.com • Suppress innate and adaptive responses • Shut down inflammatory responses in progress • Effects on neutrophils, macrophages & lymphocytes • Few problems because use typically short-term Virtually Every Cell and Pathway in Immune System ‘Target-able’ (Influenza Vaccination) Reed SG et al. Nature Medicine 2013 Nakaya HI et al. Nature Immunology 2011 Landscape - 2013 Antisense (30) Cell therapy (69) Gene Therapy (46) Monoclonal Antibodies (308) Recombinant Proteins (93) Vaccines (250) Other (81) http://www.phrma.org/sites/default/files/pdf/biologicsoverview2013.pdf Therapeutic Category Drugs versus Biologics Patented Ibuprofen (Advil™) Generic Ibuprofen BioSimilars/BioSuperiors ? www.drugbank.ca Patented Etanercept (Enbrel™) BioSimilar Etanercept Etacept™ (India) Biologics in Cancer Therapy Therapeutic Categories • Hormonal Therapy • Monoclonal antibodies • Cytokine therapy • Classical vaccine strategies • Adoptive T-cell or dendritic cells transfer • Oncolytic
    [Show full text]
  • Manufacturer Patient Assistance Programs
    Manufacturer Patient Assistance Programs * Provisional Bridging Programs August 2021 highlighted below in blue For medications currently not funded per the BC Cancer Benefit Drug List - http://www.bccancer.bc.ca/systemic-therapy-site/documents/policy%20and%20forms/benefit%20drug%20list.pdf Disclaimer: BC Cancer intends to keep the information on this document as up to date as possible but cannot guarantee that the programs are all available as listed. Contact your local Drug Access Navigator (DAN) for more information UPDATES: New MPAP/Compassionate Access Open: Abiraterone-JAMP, Abiraterone-Sandoz, Everolimus-Sandoz, Gefitinib-JAMP, Gefinitib-Sandoz, Imatinib-JAMP, Encorafenib (Braftovi), Binimetinib (Mektovi), Pralsetinib (Gavreto), Trastuzumab Deruxtecan (Enhertu) Provisional Bridging/Compassionate Access Closed: MPAP Closed: Additional Updates: Drug Manufacturer / PAP Name Contact Information Support Offered Route Strength DIN Abemaciclib (Verzenio) Lilly Phone 1.855.545.5922 Compassionate supply may be available PO 50mg 02487098 * Provisional Bridging Program Lilly Patient Support Program Fax 1.844.503.7749 Financial assistance for patients with or without private insurance may be available PO 100mg 02487101 Email [email protected] PO 150mg 02487128 Web PO 200mg 02487136 Abiraterone (Zytiga) Janssen Phone 1.844.511.2616 Compassionate supply may be available PO 250mg 02371065 * Provisional Bridging Program Janssen BioAdvance Patient Assistance Program Fax 1.855.629.7100 Financial assistance for patients with or without private
    [Show full text]
  • Cyclin-Dependent Kinase Inhibitors in Brain Cancer: Current State and Future Directions
    Juric et al. Cancer Drug Resist 2020;3:48-62 Cancer DOI: 10.20517/cdr.2019.105 Drug Resistance Review Open Access Cyclin-dependent kinase inhibitors in brain cancer: current state and future directions Viktorija Juric, Brona Murphy Department of Physiology and Medical Physics, Royal College of Surgeons in Ireland, Dublin D02, Ireland. Correspondence to: Dr. Brona Murphy, Department of Physiology and Medical Physics, Royal College of Surgeons in Ireland, 39A York Street, Dublin D02, Ireland. E-mail: [email protected] How to cite this article: Juric V, Murphy B. Cyclin-dependent kinase inhibitors in brain cancer: current state and future directions. Cancer Drug Resist 2020;3:48-62. http://dx.doi.org/10.20517/cdr.2019.105 Received: 5 Nov 2019 First Decision: 4 Dec 2019 Revised: 11 Dec 2019 Accepted: 20 Dec 2019 Published: 19 Mar 2020 Science Editor: Lee M. Graves Copy Editor: Jing-Wen Zhang Production Editor: Jing Yu Abstract Cyclin-dependent kinases (CDKs) are important regulatory enzymes in the normal physiological processes that drive cell-cycle transitions and regulate transcription. Virtually all cancers harbour genomic alterations that lead to the constitutive activation of CDKs, resulting in the proliferation of cancer cells. CDK inhibitors (CKIs) are currently in clinical use for the treatment of breast cancer, combined with endocrine therapy. In this review, we describe the potential of CKIs for the treatment of cancer with specific focus on glioblastoma (GBM), the most common and aggressive primary brain tumour in adults. Despite intense effort to combat GBM with surgery, radiation and temozolomide chemotherapy, the median survival for patients is 15 months and the majority of patients experience disease recurrence within 6-8 months of treatment onset.
    [Show full text]
  • Standard Oncology Criteria C16154-A
    Prior Authorization Criteria Standard Oncology Criteria Policy Number: C16154-A CRITERIA EFFECTIVE DATES: ORIGINAL EFFECTIVE DATE LAST REVIEWED DATE NEXT REVIEW DATE DUE BEFORE 03/2016 12/2/2020 1/26/2022 HCPCS CODING TYPE OF CRITERIA LAST P&T APPROVAL/VERSION N/A RxPA Q1 2021 20210127C16154-A PRODUCTS AFFECTED: See dosage forms DRUG CLASS: Antineoplastic ROUTE OF ADMINISTRATION: Variable per drug PLACE OF SERVICE: Retail Pharmacy, Specialty Pharmacy, Buy and Bill- please refer to specialty pharmacy list by drug AVAILABLE DOSAGE FORMS: Abraxane (paclitaxel protein-bound) Cabometyx (cabozantinib) Erwinaze (asparaginase) Actimmune (interferon gamma-1b) Calquence (acalbrutinib) Erwinia (chrysantemi) Adriamycin (doxorubicin) Campath (alemtuzumab) Ethyol (amifostine) Adrucil (fluorouracil) Camptosar (irinotecan) Etopophos (etoposide phosphate) Afinitor (everolimus) Caprelsa (vandetanib) Evomela (melphalan) Alecensa (alectinib) Casodex (bicalutamide) Fareston (toremifene) Alimta (pemetrexed disodium) Cerubidine (danorubicin) Farydak (panbinostat) Aliqopa (copanlisib) Clolar (clofarabine) Faslodex (fulvestrant) Alkeran (melphalan) Cometriq (cabozantinib) Femara (letrozole) Alunbrig (brigatinib) Copiktra (duvelisib) Firmagon (degarelix) Arimidex (anastrozole) Cosmegen (dactinomycin) Floxuridine Aromasin (exemestane) Cotellic (cobimetinib) Fludara (fludarbine) Arranon (nelarabine) Cyramza (ramucirumab) Folotyn (pralatrexate) Arzerra (ofatumumab) Cytosar-U (cytarabine) Fusilev (levoleucovorin) Asparlas (calaspargase pegol-mknl Cytoxan (cyclophosphamide)
    [Show full text]
  • WO 2018/218208 Al 29 November 2018 (29.11.2018) W !P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/218208 Al 29 November 2018 (29.11.2018) W !P O PCT (51) International Patent Classification: Fabio; c/o Bruin Biosciences, Inc., 10225 Barnes Canyon A61K 31/00 (2006.01) A61K 47/00 (2006.01) Road, Suite A104, San Diego, California 92121-2734 (US). BEATON, Graham; c/o Bruin Biosciences, Inc., 10225 (21) International Application Number: Barnes Canyon Road, Suite A104, San Diego, California PCT/US20 18/034744 92121-2734 (US). RAVULA, Satheesh; c/o Bruin Bio (22) International Filing Date: sciences, Inc., 10225 Barnes Canyon Road, Suite A l 04, San 25 May 2018 (25.05.2018) Diego, Kansas 92121-2734 (US). (25) Filing Language: English (74) Agent: MALLON, Joseph J.; 2040 Main Street, Four teenth Floor, Irvine, California 92614 (US). (26) Publication Langi English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/5 11,895 26 May 2017 (26.05.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/5 11,898 26 May 2017 (26.05.2017) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicants: BRUIN BIOSCIENCES, INC. [US/US]; DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, 10225 Barnes Canyon Road, Suite A104, San Diego, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, California 92121-2734 (US).
    [Show full text]
  • Comparator Report on Patient Access to Cancer Medicines in Europe Revisited
    COMPARATOR REPORT ON PATIENT ACCESS TO CANCER MEDICINES IN EUROPE REVISITED BENGT JÖNSSON THOMAS HOFMARCHER PETER LINDGREN IHE REPORT NILS WILKING 2016:4 COMPARATOR REPORT ON PATIENT ACCESS TO CANCER MEDICINES IN EUROPE REVISITED Authors: Bengt Jönsson, PhD, professor emeritus Stockholm School of Economics, Stockholm, Sweden Thomas Hofmarcher, MSc The Swedish Institute for Health Economics, Lund Sweden Lund University, Lund, Sweden Peter Lindgren, PhD, associate professor The Swedish Institute for Health Economics, Lund, Sweden Karolinska Institutet, Stockholm, Sweden Nils Wilking, MD, PhD, associate professor Senior strategic advisor cancer, Skåne University Hospital Lund/Malmö, Sweden Karolinska Institutet, Stockholm, Sweden IHE Report 2016:4 e-ISSN 1651-8187 The report can be downloaded from IHE’s website www.ihe.se Please cite this report as: Jönsson, B., Hofmarcher, T., Lindgren, P., Wilking, N. Comparator report on patient access to cancer medicines in Europe revisited. IHE Report 2016:4, IHE: Lund. ACCESS TO CANCER MEDICINES IN EUROPE Content Content 2 Foreword 5 List of Abbreviations 7 Executive summary 9 1 The burden and cost of cancer in Europe 1995–2014 12 1.1 Health burden of cancer 13 1.1.1 Incidence 15 1.1.2 Mortality 19 1.1.3 Survival 25 1.1.4 Burden of disease 27 Economic burden of cancer 31 Direct cost of cancer 35 1.3.1 Comparison with previous results 40 1.3.2 Development of the direct cost over time 41 1.3.3 Spending on cancer and patient outcomes 46 Cost of cancer drugs 48 1.4.1 Development of the cost of cancer drugs
    [Show full text]
  • Australian Public Assessment Report for Odomzo
    Australian Public Assessment Report for Odomzo Proprietary Product Name: Sonidegib Sponsor: Novartis Pharmaceuticals Australia Pty Ltd November 2019 Therapeutic Goods Administration About the Therapeutic Goods Administration (TGA) • The Therapeutic Goods Administration (TGA) is part of the Australian Government Department of Health and is responsible for regulating medicines and medical devices. • The TGA administers the Therapeutic Goods Act 1989 (the Act), applying a risk management approach designed to ensure therapeutic goods supplied in Australia meet acceptable standards of quality, safety and efficacy (performance) when necessary. • The work of the TGA is based on applying scientific and clinical expertise to decision- making, to ensure that the benefits to consumers outweigh any risks associated with the use of medicines and medical devices. • The TGA relies on the public, healthcare professionals and industry to report problems with medicines or medical devices. TGA investigates reports received by it to determine any necessary regulatory action. • To report a problem with a medicine or medical device, please see the information on the TGA website <https://www.tga.gov.au>. About AusPARs • An Australian Public Assessment Report (AusPAR) provides information about the evaluation of a prescription medicine and the considerations that led the TGA to approve or not approve a prescription medicine submission. • AusPARs are prepared and published by the TGA. • An AusPAR is prepared for submissions that relate to new chemical entities, generic medicines, major variations and extensions of indications. • An AusPAR is a static document; it provides information that relates to a submission at a particular point in time. • A new AusPAR will be developed to reflect changes to indications and/or major variations to a prescription medicine subject to evaluation by the TGA.
    [Show full text]
  • In Chronic Phase Chronic Published: 09 May 2016 Myeloid Leukaemia David A
    www.nature.com/scientificreports OPEN Deregulated hedgehog pathway signaling is inhibited by the smoothened antagonist LDE225 Received: 24 September 2015 Accepted: 18 April 2016 (Sonidegib) in chronic phase chronic Published: 09 May 2016 myeloid leukaemia David A. Irvine1,*, Bin Zhang2,*, Ross Kinstrie1, Anuradha Tarafdar1, Heather Morrison1, Victoria L. Campbell1, Hothri A. Moka1, Yinwei Ho2, Colin Nixon4, Paul W. Manley3, Helen Wheadon1, John R. Goodlad5, Tessa L. Holyoake1, Ravi Bhatia6 & Mhairi Copland1 Targeting the Hedgehog (Hh) pathway represents a potential leukaemia stem cell (LSC)-directed therapy which may compliment tyrosine kinase inhibitors (TKIs) to eradicate LSC in chronic phase (CP) chronic myeloid leukaemia (CML). We set out to elucidate the role of Hh signaling in CP-CML and determine if inhibition of Hh signaling, through inhibition of smoothened (SMO), was an effective strategy to target CP-CML LSC. Assessment of Hh pathway gene and protein expression demonstrated that the Hh pathway is activated in CD34+ CP-CML stem/progenitor cells. LDE225 (Sonidegib), a small molecule, clinically investigated SMO inhibitor, used alone and in combination with nilotinib, inhibited the Hh pathway in CD34+ CP-CML cells, reducing the number and self-renewal capacity of CML LSC in vitro. The combination had no effect on normal haemopoietic stem cells. When combined, LDE225 + nilotinib reduced CD34+ CP-CML cell engraftment in NSG mice and, upon administration to EGFP+ /SCLtTA/TRE-BCR-ABL mice, the combination enhanced survival with reduced leukaemia development in secondary transplant recipients. In conclusion, the Hh pathway is deregulated in CML stem and progenitor cells. We identify Hh pathway inhibition, in combination with nilotinib, as a potentially effective therapeutic strategy to improve responses in CP-CML by targeting both stem and progenitor cells.
    [Show full text]
  • Supplementary Tables
    SUPPLEMENTARY TABLES Supplementary Table 3. The primer sequences of the five prognostic genes. Primers for detection prognostic genes Gene Forward Primer Reverse Primer FYN CCCAACTACAACAACTTCCACG GCTGGGAATGTAACCTGTCTCTC PPP1CB GTCGTCCAGGAAAGATTGTGC AAGATAGTTGGCTTCTGGTGGG PPP1CC AACGGCTGCTGGAAGTGAGA CACATAGTCCCCAAGAAACAGGTA RAC1 AGGCCATCAAGTGTGTGGTG AAGAACACATCTGTTTGCGGA SPP1 CGAAGTTTTCACTCCAGTTGTCC AGGTGATGTCCTCGTCTGTAGC beta-actin CACCCAGCACAATGAAGATCAAGAT CCAGTTTTTAAATCCTGAGTCAAGC www.aging-us.com 1 AGING Supplementary Table 4. The results of correlation analysis of the prognosis gene expression and chemotherapy drug sensitivity. Gene Drug cor P value PPP1CC Chelerythrine 0.441276 0.000417 PPP1CC AT-13387 0.387333 0.002232 FYN 8-Chloro-adenosine -0.37588 0.00308 SPP1 Gefitinib 0.375562 0.003107 FYN PX-316 0.365799 0.00405 PPP1CC Amonafide 0.36321 0.00434 FYN Afatinib -0.35729 0.00507 SPP1 Erlotinib 0.354486 0.005454 SPP1 Lapatinib 0.349174 0.006249 FYN AFP464 -0.34638 0.006706 FYN AP-26113 -0.3443 0.007065 FYN Erlotinib -0.34236 0.007416 FYN Nitrogen mustard -0.34175 0.007529 PPP1CC Fenretinide 0.340414 0.007782 PPP1CC Everolimus -0.33663 0.00854 RAC1 Fluorouracil -0.33528 0.008826 PPP1CC Parthenolide 0.334771 0.008936 FYN Dasatinib -0.32779 0.010567 FYN SR16157 -0.3271 0.010741 SPP1 bisacodyl, active ingredient of viraplex -0.32687 0.010801 SPP1 Vandetanib 0.325235 0.011225 FYN Bosutinib -0.32482 0.011335 PPP1CC Hydroxyurea 0.323699 0.011638 FYN Ifosfamide 0.321856 0.01215 FYN AZD-9291 -0.32021 0.012624 FYN Fluorouracil -0.31794 0.013304
    [Show full text]