In Transcriptional Regulation in Human Podocytes

THE ROLE OF ALPHA-ACTININ4 (ACTN4) IN TRANSCRIPTIONAL

REGULATION IN HUMAN PODOCYTES (HPC) AND IN NEPHROTIC

SYNDROME

XUAN ZHAO

Submitted in partial fulfillment of the requirements for the degree of Doctor of

Philosophy

Thesis advisor: Dr. Hung-Ying Kao

Department of Biochemistry

CASE WESTERN RESERVE UNIVERSITY

August, 2017

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the dissertation of

Xuan Zhao

Candidate for the Doctor of Philosophy degree*

(Signed) Dr. David Samols (Chair of the committee)

Dr. Hung-Ying Kao

Dr. William Merrick

Dr. Leslie Bruggeman

Dr. David Buchner

(date) June 21th, 2017

*We also certify that written approval has been obtained for any propriety

material contained therein

Table of contents

LIST OF TABLES ...... iii

LIST OF FIGURES ...... iv

ACKNOWLEDGEMENTS ...... vii

LIST OF ABBREVIATIONS ...... viii

ABSTRACT ...... 1

CHAPTER 1: INTRODUCTION ...... 3

Podocytes And Nephrotic Syndrome ...... 3

Alpha Actinin 4 (ACTN4) ...... 12

NF-κB Signaling ...... 18

Glucocorticoid And Glucocorticoid Receptors (GRs) ...... 25

The Effects Of Glucocorticoid Therapy On Nephrotic Syndrome ...... 33

The Role Of Glucocorticoids In Podocyte ...... 35

CHAPTER 2: ACTN4 POTENTIATES NF-κB ACTIVITY IN

PODOCYTES INDEPENDENT OF ITS CYTOPLASMIC ACTIN

BINDING FUNCION ...... 41

Abstract ...... 41

Introduction ...... 41

Materials And Methods ...... 44

Results ...... 48

Discussion ...... 74

CHAPTER3: ACTN4 REGULATES GLUCOCORTICOID RECEPTOR-

MEDIATED TRANSACTIVATION AND TRANSREPRESSION IN

PODOCYTES ...... 79

Abstract ...... 79

Introduction ...... 80

Results ...... 88

Discussion ...... 124

CHAPTER4: CHARACTERIZE THE NOVEL FAMILIAL FOCAL

SEGMENTAL GLOMERULOSCLEROSIS-LINKED ACTN4 PROTEIN

MUTATIONS ...... 128

Abstract ...... 128

Introduction ...... 131

Materials And Methods ...... 131

Results ...... 134

Discussion ...... 144

CHAPTER5: FUTURE DIRECTIONS ...... 146

References ...... 155

LIST OF TABLES

Table 1. Genes associated with nephrotic syndrome ...... 9

Table 2. A summary of biochemical properties of selectvie ACTN4 variants...... 144

iii

LIST OF FIGURES

Figure 1. A diagram showing the structure and components of renal glomerular

filtration system, from kidney to podocyte...... 10

Figure 2. A schematic diagram depicting components of The podocyte SD

and foot processes and slit diaphragm proteins...... 11

Figure 3. A Schematic representation of the domain architect of ACTN4 and

disease-associated mutations...... 16

Figure 4. Canonical and alternative pathway of NF-κB signaling...... 22

Figure 5. Domain structure of NF-κB and IκB family proteins...... 23

Figure 6. The GR family proteins ...... 29

Figure 7. Molecular mechanism of GR signaling pathways ...... 30

Figure 8. The mechanism of the Podocyte injury and the protective

effect of glucocorticoids...... 37

Figure 9. The effect of ACTN4 knockdown on NF-κB-mediated transcriptional

activation...... 51

Figure 10. The effect of ACTN4 knockdown on TNFα-induced p65 nuclear

translocation in HPCs...... 54

Figure 11. GRα-mediated transrepression of NF-κB target genes in podocytes...... 57

Figure 12. ACTN4 and p65 interact in glomeruli and in mammalian kidney cells...... 60

Figure 13. IκBα blocks ACTN4 from interacting with p65 in the cytosol...... 63

Figure 14. The association of ACTN4 variants with p65 and p50...... 66

Figure 15. The role of HDAC7 in ACTN4-mediated potentiation in NF-kB

transactivation activity...... 68

Figure 16. Association of p65 and ACTN4 with IL1-β and IL-8 promoters in HPCs. .... 72

Figure 17. A model in which ACTN4 binds and co-activates NF-κB transactivation

activity in the nucleus...... 73

Figure 18. The effect of Dex on nuclear translocation of GRα in podocytes...... 90

Figure 19. The effect of ACTN4 on GR-mediated transcriptional activation...... 94

Figure 20. Mapping of ACTN4 and GR interacting domains...... 98

Figure 21. The effect of ACTN4 LXXAA mutation on potentiating

GR-mediated transcriptional activity...... 101

Figure 22. The effect of FSGS-linked ACTN4 on GR-mediated transcriptional

activation...... 104

Figure 23. The effect of ACTN4 knockdown on Dex-induced GR nuclear

translocation in HPCs...... 107

Figure 24. The interaction between ACTN4 and GR only occurred in the nucleus

in HPCs...... 109

Figure 25. The effect of knocking down HSP90 on the association between

ACTN4 and GRα...... 110

Figure 26. The recruitment of ACTN4 and GR with GR transactivated promoters

in HPCs...... 116

Figure 27. The effects of Dex on the recruitment of GR, ACTN4, and p65

to NF-κB targeted promoters...... 122

Figure 28. A model depicting the mechanism by which ACTN4 regulates

Dex- and TNFα-mediated transcriptional regulation in HPCs...... 123

Figure 29. Characterization of wild-type and disease-associated ACTN4

protein stability ...... 136

Figure 30. The F-actin filaments binding affinity of disease-linked ACTN4

mutations...... 138

Figure 31. Subcellular distribution of the newly identified disease-associated

ACTN4 mutants...... 141

Figure 32. Associations of disease-linked ACTN4 mutants with p65 and GRα...... 143

ACKNOWLEDGEMENTS

First of all, I would like to thank my research advisor Dr. Hung-Ying Kao for his continuous encouragement, guidance and experience sharing both in scientific and real life world. I would not have the achievements today without his suggestion and support. Dr.

Kao is not only my mentor, but also a real model for me in America.

I would also like to thanks my committee members Dr. David Samols, Dr. Leslie

Bruggeman, Dr. William C. Merrick and Dr. David Buchner for their positive criticism and support of my research and my career development. Special thanks are go to my previous committee member Dr. Yu-Chung Yang.

The studies of my Ph.D. stage in collaboration with Dr. Minh Lam and Dr. Sichun Yang. I appreciate the support from my lab members and friends in the department. I want to specially thank Dr. Simran Khurana for her collaboration in this research.

Last but not the least, I would like to express my gratitude to my parents and family members back in China for keeping me motivated and focused throughout my efforts. I want to thank my parents, Lijian Zhao and Xiulian Hou and parents in law for their unconditional love, encourage and support. I would like to specifically thank my wife

Shuyu Hao, for standing beside me throughout my career.

Best wishes to my son who will be arriving this September.

vii

LIST OF ABBREVIATIONS

ABD, actin binding domain

ACTN1, Alpha-actinin1

ACTN2, Alpha-actinin2

ACTN3, Alpha-actinin3

ACTN4, Alpha-actinin4

ADR, adriamycin

AF-1, activation function-1

AIF, apoptosis-inducing factor

AngII, angiotensin II

ANGPTL4, Angiopoietin-Like Proteins 4

AP-1, Activator protein 1

APOL1, Apolipoprotein L1

AR, androgen receptor

Bcl-2, B-cell lymphoma 2 c-MIP, C-Maf-inducing protein

CaM, Calmodulin

CCL20, Chemokine (C-C motif) ligand 20

CD2AP, CD2-associated protein

CEBPs, CCAAT-enhancer-binding proteins

CH, calponin homology

ChIP, chromatin immunoprecipitation

COX-2, Cyclooxygenase 2

viii

CRBP1, Cellular Retinol-Binding Protein Type I

CRISPR, Clustered regularly interspaced short palindromic repeats

CXCL1, chemokine (C-X-C motif) ligand 1

DAMP, danger-associated molecular patterns

DBD, DNA-binding domain

DCN, Decorin

Dex, dexamethasone

DMEM, Dulbecco’s modified Eagle’s medium

ERK, extracellular signal-regulated kinases

ERα, Estrogen receptor alpha

F-actin, actin filaments

FAT, Protocadherin Fat

FP, foot process

FSGS, focal segmental glomerulosclerosis

GBM, glomerular basement member

GCs, glucocorticoids

GFB, glomerular filtration barrier

GR, glucocorticoid receptor

GRE, glucocorticoid response element

GST, glutathione S-transferase

HDAC7, histone deacetylase 7

HIVAN, HIV-associated nephropathy

HPC, human podocytes

HSP, heat shock chaperone protein

IKK, IκB kinase

IL-1β, Interleukin 1 beta

IL-6, Interleukin 6

IL-8, Interleukin 8

INF, Inverted formin-2

INS, idiopathic nephrotic syndrome

Iso, Isoform

ITS, insulin transferring selenite

IκB, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

KI, knockin

KO, knockout

LBD, ligand-binding domain

MAPK, Mitogen-Activated Protein Kinase

MCD, minimal change disease

MCP-1, Monocyte chemotactic protein 1

MEF, Mouse Embryonic Fibroblasts

MEF2, myocyte enhancer factor 2

MPGN, membranoproliferative glomerulonephritis

MR, mineroglucocorticoid receptor

NcoR, nuclear receptor co-repressor

NEPTUNE, Nephrotic syndrome study network

NF-κB, nuclear factor kappa-light-chain-enhancer of activated B cells

NPHS1, nephrin

NPHS2, podocin

NRs, nuclear hormone receptors

NS, nephrotic syndrome

NTD, N-terminal domain

PAI-1, Plasminogen activator inhibitor-1

PAMP, pathogen-associated molecular patterns

PAN, Puromycin aminonucleoside

PCAF, p300/CBP-associated factor

PECs, parietal epithelial cells

PHN, heymann nephritis

PIP2, phosphatidylinositol 4, 5-bisphosphate

PPARγ, Peroxisome proliferator-activated receptor gamma

PR, progesterone receptor

RAR, Retinoic acid receptor

RelB, Transcription factor RelB

RHD, Rel homology domain

RhoA, Ras homolog gene family, member A

ROS, reactive oxygen species

SAA1, Serum Amyloid A1

SD, slits diaphragms

SERPINE, Serpin family E member 1

SLR, spectrin-like repeats

SMRT, silencing mediated by retinoid and thyroid receptors

SP1, specificity protein 1

SR, spectrin repeats

STAT1, Signal transducer and activator of transcription 1

Synpo, synaptopodin

TGFβ, Transforming growth factor beta

TNFα, Tumor necrosis factor alpha

TRPC6, short transient receptor potential channel 6

VDR, vitamin D receptor

VEGF, vascular endothelial growth factor

WT-1, Wilms' tumour suppressor 1

WT, wild-type

ZO-1, α- and β-catenin, zonula occludens-1

xii

The Role Of Alpha-Actinin4 (ACTN4) In Transcriptional Regulation In Human

Podocytes (HPC) And In Nephrotic Syndrome

Abstract by

XUAN ZHAO

Glomerular podocytes are highly differentiated epithelial cells that play a pivotal role in kidney filtration. Alpha-actinin 4 (ACTN4) is a well-known actin-binding protein and a critical component of the podocyte cytoskeletal structure. Multiple mutations in ACTN4 have been linked to kidney diseases including focal segmental glomerulosclerosis (FSGS).

In addition to its cytoplasmic localization, ACTN4 is also present in the nucleus. Disruption of the NF-κB pathway in podocytes is implicated in glomerular diseases and drugs that suppress NF-κB, such as glucocorticoids, including dexamethasone (Dex), possess renoprotective activity. Dex-bound glucorcoticoid receptor alpha (GRα) activates glucocorticoid response element (GRE)-containing genes and interacts with NF-κB subunits to repress NF-κB target genes. These observations suggest that the intersection of the GR and NF-κB signaling in podocytes plays a critical role in glomerulopathies and therapeutic targets. The goal of my thesis is to investigate a role of ACTN4 in transcriptional regulation by NF-κB and GRα. We found that ACTN4 interacts with NF-

κB subunits in the nucleus of human podocytes (HPCs) and is recruited to NF-κB target gene promoters. Knockdown of ACTN4 significantly reduces TNFα-mediated NF-κB- driven reporter activities and NF-κB target genes expressions, such as IL-1β and IL-8.

Moreover, ACTN4 interacts with GRα in HPC nucleus in response to Dex and enhances

GRE-driven reporter activity in HPCs. Knockdown of ACTN4 significantly reduces Dex- induced GR target gene expression. Dex induces the recruitment of ACTN4 and GR to the promoters of GR-activated genes as well as Dex-repressed, NF-κB target genes. Taken together, our findings revealed a novel role of ACTN4 in transcriptional regulation of GR and NF-κB target genes to coordinate their expression in podocytes. These findings may have implications in the pathogenesis of ACTN4 mutation-associated kidney diseases and their treatments.

CHAPTER 1: INTRODUCTION

PODOCYTE AND NEPHROTIC SYNDROME

Podocyte function

One of the key functions of the kidney is to remove toxins and metabolic waste while preventing proteins larger than albumin from entering the urine. The glomerulus is the functional unit required for blood plasma filtration and primary urine production (1). There are four distinct cell types that assemble to form the glomerulus: glomerular endothelial cells, mesangial cells, podocytes, and parietal epithelial cells (2). The glomerular filtration barrier consists of three-layers: endothelial cells, glomerular basement member (GBM) and podocytes. Podocytes are highly differentiated epithelial cells covering the outer surface of the GBM that play an important role in maintaining the integrity of the glomerular filtration barrier (3). The podocyte consists of an arborized cell body, primary processes, and secondary foot processes (4, 5). The long interdigitated foot processes wrap around glomerular capillaries between adjacent podocytes and form the filtration slits, which are spanned by the slit diaphragms (SD), a highly specialized membrane-like cell-cell junctions. The cell body contains a nucleus and most of the cytoplasm, while the foot processes contain only a dense network of actin filaments connected with an array of transmembrane proteins that link the SD and the GBM anchor proteins (6, 7). The unique structure of the cell primary and secondary processes are maintained by the highly organized cytoskeleton (Figure 1).

Podocytes contribute to the formation of the glomerular filtration barrier (GFB), which is considered to be a sieve that selectively filters serum components and retains most of the circulating proteins larger than 60 kD. (3, 8). They make up the outer cell layer across the glomerular capillaries. The highly-specialized SD structure in charge of macromolecular filtering, connects the podocyte actin cytoskeleton to transmembrane proteins and receptors and regulates plasticity of the foot process. A growing number of molecular components of mature SD have been identified, many of which are components of tight and adherens junctions. Both nephrin and podocin are podocyte-specific proteins that are found in the SD (9–11). Several other proteins are also strongly associated with this unique structure, including CD2-associated protein (CD2AP), Transient receptor potential channel

6 (TRPC6), alpha-actinin 4 (ACTN4), P-cadherin, FAT, synaptopodin (Synpo), α- and β- catenin, zonula occludens-1 (ZO-1), nephrin homologue NEPH-1, and Wilms' tumour suppressor 1 (WT1) (12–19) (Table 1, Figure 2). These podocyte proteins are highly associated with the survival, differentiation, and unique cytoskeleton-dependent morphology of the podocytes.

In addition to being the major site of glomerular filtration, podocytes are crucial for the to the maintenance of the GBM and glomerular endothelial cells (20–22). The GBM is a critical determinant for the charge selectivity of the glomerular filtration barrier via it's strong negatively charged glycosaminoglycans. Podocytes are firmly attached to glomerular basement membrane through adhesion molecules, such as α3β1 integrins, and

α- and β-dystroglycan (23–25) (Figure 1). Meanwhile, The type IV collagen α3α4α5 trimers, which are essential for assembling the GBM collagen network (26), originates only

4 from podocyte. Podocytes are also the primary source of the GBM component laminin-521

(27) and communicate with glomerular endothelial cells mediated by proangiogenic secreted factors to ensure the proper development of the glomerular endothelium.

Podocytes secrete vascular endothelial growth factor (VEGF) and angiopoetin-1, which are required for the survival of endothelial cells (28–31). Cell–cell communication between podocytes and endothelial cells plays a prominent role in the formation of the glomerulus.

Podocyte injury

Podocytes are essential to maintain the integrity of the glomerular filtration barrier under normal conditions and are the target of many forms of physiological stress and pathological states. They respond to genetic, mechanical, reactive oxygen species (ROS) and immunological stresses, as well as toxins, viral infection and drugs (32, 33). Podocyte injury occurs when excessive stress disrupts homeostasis. The beginning of podocyte injury is often derangement of the actin cytoskeleton (34, 35), followed by the loss of SD proteins, and loss of structural integrity, leading to eventual foot process effacement and podocyte detachment from GBM or apoptosis (34, 36, 37). It is now widely accepted that podocyte injury leads to proteinuria and nephrotic syndrome (Figure 1 and 8).

Foot processes effacement is characterized by flattening of foot processes due to gradual simplification of the primary and secondary processes. The actin cytoskeleton network determines the shape of the podocyte, and consists of a dense bundle of actin filaments and a relatively short and branched cortical network (38). The bundle of actin filaments extend the length of FPs, while the branched actin network connects with the elements of the SD

(39). Therefore, any derangement in actin or actin-regulating proteins leads to a change in podocyte shape and consequently function (38, 40, 41). The initial response of podocytes to injuries is the disruption of the SD structure, actin dysregulation resulting in actin and actin-binding proteins accumulation. The role of the actin cytoskeleton in the podocyte foot process effacement is supported by scanning electron micrographs of several experimental models (42, 43). Although foot process effacement is a typical morphology associated with proteinuria, it may not be a sufficient cause of proteinuria (38, 44). For example, a low- dose injection of puromycin aminonucleoside (PAN) causes foot process effacement without proteinuria.

After the injury, podocytes can undergo apoptosis or fail to proliferate (45), which leads to a decrease in podocyte number. In the classic view, apoptosis has been considered to be the major cause of podocyte loss. Podocytes undergo apoptosis in glomerular disease, as well as in mice after PAN treatment (45–48). Recent studies have examined the molecular mechanism underlying podocytes apoptosis, which in part, can be mediated by TGFβ and the Smad signaling pathway (47). Other podocyte apoptosis inducers include reactive oxygen species and angiotensin II (AngII). Because podocytes are terminally differentiated cells with no proliferation potential (49, 50), lost podocytes cannot be replaced and is generally considered permanent. However, recently several sources of possible stem cells were identified that can supply podocyte progenitors, may be able to differentiate and replace lost podocytes (51).

Podocyte detachment from the GBM is a terminal event in podocyte injuries, which can promote further glomerular damage (52–54). The detachment of podocytes from the glomerular basement membrane occurs in regions of sclerotic lesions of the glomerulus and results in an increase in the appearance of podocytes and podocyte-associated molecules in urine. Indeed, cells obtained from the urine of proteinuria patients with various glomerular diseases stain positive for the podocyte markers (55, 56). Recent results demonstrated that podocytes detached from GBM in experimental membranous and diabetic nephropathy are viable in culture. Podocyte-GBM adhesion is mediated by cytoskeletal proteins and integrins. Disruption of the cytoskeleton-integrin system causes podocyte detachment. Together, these data indicate that a detachment of podocytes from

GBM represents another mechanism of reducing podocytes number.

Nephrotic syndrome

Nephrotic syndrome (NS) is not a single disease, but a term for a collection of conditions

(57). It is defined as a kidney disorder that causes the body to excrete too much protein in the urine (58) Based on kidney biopsies, NS patients can be diagnosed more specifically, including minimal change disease (MCD), focal segmental glomerulosclerosis (FSGS), membranous nephropathy, immunoglobulin A (IgA) nephropathy among other glomerular diseases (59–61). Normally, kidneys clear waste materials from the body and maintain a normal balance of fluids and electrolytes in the blood. When the filtering units of the kidney are damaged, proteins that are normally kept in the plasma leak into the urine in large

7 amounts. Various diseases, such as diabetes mellitus, hypertension, lupus erythematosus and viral infections, can damage glomeruli, which result in proteinuria and nephrotic syndromes, (62–66). Most NS in young children are idiopathic FSGS or frequently MCD considered a less severe form of FSGS (67). In adults, FSGS is the most common form of glomerular disease (58) and a leading cause of the primary nephrotic syndrome. FSGS account for 20% NS in children and 40% in adults. FSGS is also the leading cause of glomerulonephritis-associated end-stage renal disease (68, 69). The key features of NS are proteinuria, hypoalbuminemia, hypercholesterolemia and edema. In children, proteinuria is defined as more than 1 g of urine protein per square meter of body-surface area per day

(67). In adults, the proteinuria is defined as a urine protein level of more than 3.5 g per day

(70).

FSGS is viewed as a podocyte diseases or “podocytopathies” (71, 72). This is because mutations in several genes encoding components of the slit diaphragm, cell-membrane, actin-cytoskeleton and cytosol have been identified in familial and sporadic FSGS (Table.

1) (73–75). Among these genes, mutations in genes encoding nephrin and podocin commonly found in familial FSGS (76, 77).

Table 1. Genes associated with NS

Mutation Gene (examples) Disease association Reference nt534(delG), nt1275(delC), congenital Kestila, M 1998 (9); Lenkkeri, U NPHS1 W64S, nephrotic syndrome 1999 (78); C465Y, R229Q R138Q, Famillial idiopathic Boute, N. 2000 (10); Huber, T.B. NPHS2 V180M nephrotic syndrome 2003 (76) nephropathy heavy Neph1 Global KO Donoviel, D.B. 2001 (79) proteinuria K301M, CD2AP T374A, FSGS Gigante, M 2009 (80); delE525 P1032C, N286S, Steroid-resistant FAT Gee, H. Y. 2016 (81) A1003V, nephrotic syndrome R3087G K255E, Kaplan, J. M. 2000 (73); Bartram ACTN4 FSGS G195D MP, 2016 (82) R366H, early onset WT1 D396N, Schumacher,V 1998 (83); nephrotic syndrome R395H ITGA3 R463W nephrotic syndrome Yalcin, E. G. 2015 (84); C335A, TRPC6 FSGS Winn, M.P. 2005 (85) P112Q

Figure 1. A diagram showing the structure and components of renal glomerular filtration system, from kidney to podocyte.

The glomerular filtration barrier consists of fenestrated endothelial cells, glomerular base membrane and podocytes.

Figure 2. A schematic diagram depicting components of The podocyte SD and foot processes and slit diaphragm proteins.

This figure illustrates the proteins that make up SD between adjacent foot processes.

Nephrin, NEPH1, NEPH2, P-cadherin and FAT are membrane-spanning proteins that have large extracellular domains, which are important for signaling events that determine the structural integrity of podocyte foot processes. Many of the proteins that compose the slit diaphragm interact with intracellular adapter proteins, including CD2-AP, ZO-1,

Synaptopodin and ACTN4. The adapter proteins bind to the filamentous actin (F-actin).

The adhesion molecules dystroglycan and α3β1 integrin anchor the podocyte to the underlying GBM.

The goal of NS therapy is to preserve kidney function and achieve remission of proteinuria

(87, 88). Calcineurin inhibitor therapies, which suppress the immune system by preventing interleukin-2 (IL-2) production in T cells, and glucocorticoids (GCs) and are successful in approximately 50% of NS patients. GCs are more effective in MCD, but commonly require adjunctive therapy with additional agents for FSGS treatment. The calcineurin inhibitors, such as cyclosporine and tacrolimus, are widely used in the treatment of the GC-resistant

NS (89, 90). The major effects of calcineurin inhibitors are stabilization of the actin cytoskeleton in podocytes resulting in reduced proteinuria, independent of its effects on immune system. Other therapies available with beneficial effects in ameliorating proteinuria include alkylating agents and the anti-B-cell monoclonal antibody rituximab

(91–93).

ALPHA ACTININ 4 (ACTN4)

The architecture of ACTN4 functional domains

The actin cytoskeleton plays a central role in such things as cell shape, cell division, motility, contraction, adhesion, phagocytosis, protein sorting and signal transduction (94,

95). Alpha-actinins (ACTNs) are one of the major actin cross-linking proteins. Alpha actinin 4 (ACTN4) is a member of the alpha actinin family that consists of four family members including muscle-specific ACTN2 and ACTN3 and the ubiquitously expressed

ACTN1 and ACTN4 (96). Human ACTN1 and ACTN4 proteins show an overall 86% amino acid identity, but all four proteins share extensive sequence homology and a

12 conserved organization of functional domains. These include an N-terminal actin-binding domain (ABD) composed of 2 calponin homology (CH) domains, a central rod domain consisting of 4 spectrin repeats (SR), and a C-terminal calmodulin (CaM)-like domain (97,

98) (Figure 3). The CaM-like domain consists two EF-hand motifs, which bind Ca2+ in

ACTN1 and ACTN4. In contrast, muscle-specific ACTN2 and ACTN3 are missing exon19 that affects the binding of calcium at the EF-hand. Thus, ACTN2 and ACTN3 exhibit Ca2+- independent actin cross-linking (99). It has been postulated that ACTNs form anti-parallel dimers to coordinate cytoskeleton organization and signal transduction through association with adhesion molecules and cytoplasmic proteins (100).

ACTN4 and podocytes

Most of ACTN4 localizes in the cytoplasm. However, ACTN4 is also found in the nucleus in certain cell types, including human podocytes (73). Apart from its interactions with actin filaments (F-actin), ACTN4 functions as a platform protein where a number of protein- protein interactions between cytoskeleton and regulatory proteins occur (38, 101). At adhesion sites, ACTN4 interacts with several transmembrane receptors, including integrins, vinculin, and zyxin, to modulate focal adhesion, and anchor podocyte foot processes to the extracellular matrix (102–104). ACTN4 also functions to bridge F-actin to other cell junction proteins (105). It directly interacts with catenins, and associates with several proteins to form a nephrin multiprotein complex to maintain the structure of SD (106, 107).

Furthermore, ACTN4 interacts with cytoplasmic proteins to coordinate cell signal transduction. ACTN4 also interacts with the MAPK kinase MEKK1 at focal adhesions and regulates calpain activity (108). Another signaling molecule that interacts with ACTN4 is

13 phosphatidylinositol 4, 5-bisphosphate (PIP2) at the plasma membrane. This interaction decreases the binding between ACTNs and F-actin as well as integrins upon phosphatidylinositol 3-kinase (PI3K) activation (109, 110).

ACTN1 and ACTN4 display a high degree of similarity in their amino acid sequences, suggesting that they share common functions. However, kidney disease is only associated with ACTN4 mutations. This is possibly due to the fact that human glomeruli only express

ACTN4 and have no other compensating family member (111, 112). This observation also suggests that ACTN4 plays a critical role in kidney development and homeostasis.

Mutations in the ACTN4 gene are associated with an inherited form of FSGS. These mutations, K255E, T259I and S262P, present in the ABD of ACTN4 were identified from three unrelated families (73, 113). These disease-causing mutations are reported to acquire increased binding affinity for F-actin (114). Additionally, the actin filaments that associate with ACTN4 (K255E) form a smaller F-actin network. This mutation is also defective in cell spreading and motility (Figure 3). Recent data also provide supporting evidence that

G195D and Y265H are potential novel FSGS-causing mutations (82, 114). Several other

ACTN4 sequence variants outside of the ABD were identified in individuals with FSGS

(74). These mutations include W59R, R310Q, Q348R, V801M, R837Q and I149 deletion

(74, 115). Additionally, ACTN4 deficiency is found in multiple human primary glomerulopathies including sporadic FSGS, minimal change disease (MCD), and IgA nephropathy (19, 31, 116, 117). However, the detailed mechanism by which ACTN4 deficiency or mutations contribute to primary glomerulopathies is still not fully understood.

In mouse models, knockout (KO) of Actn4 results in lethality in 94% of the mice three weeks after birth, with the remaining 6% of surviving animals developing severe glomerular disease (118). This result suggests a critical role for ACTN4 in kidney development, although Actn4-/+ mice exhibit no obvious phenotype (118). In contrast to humans where FSGS-linked ACTN4 mutations are autosomal dominant, only one of nine knock-in (KI) mice heterozygous for Actn4+/K228E develope a mild proteinuria phenotype.

Homozygous Actn4K228E/K228E animals exhibite severe kidney disease but only 10% of the offspring from cross between heterozygous mice were homozygous (119). These data indicate that the phenotype of Actn4+/K228E mice does not fully recreate the phenotype of the human K255E mutation. This distinction between humans and mice has been proposed to be due to the relatively short life of the mouse compared to that of humans, suggesting that humans likely require a second mutation in order to develop FSGS (119). As an alternative but not exclusive explanation, it remains possible that because mice express

Actn1, Actn2, and Actn4 in the kidney, while humans only express ACTN4 (73, 118). Actn1 in the mouse kidney may compensate for heterozygous Actn4 (K228E) or loss of one copy of Acnt4, thereby accounting for the mild phenotype of the FSGS-linked mutants and the dosage effects observed in Actn+/K228E or Actn4-/+ mice. This explanation is supported by transgenic mouse studies demonstrating that higher expression of Actn4 (K228E) correlates with a more severe FSGS phenotype (113, 120). Furthermore, mice expressing higher levels of Actn4 (K228E) showed decreased mRNA and protein levels of SD components and increased affinity of ACTN4 for actin (120).

Figure 3. A Schematic representation of the domain architect of ACTN4 and disease- associated mutations.

The human ACTN4 is a 911 amino acid protein with several functional domains, including

2 calponin homology (CH) domains, 4 spectrin repeats (SR) and 2 EF-hand (calmodulin- like) domains. The known ACTN4 mutations are colored in gray. The 3 newly-identified disease-associated ACTN4 mutations are colored in orange. Bottom panel shows the schematic structure of ACTN4 isoform. Amino acids 89-478 are absent in ACTN4 (Iso)

ACTN4 and transcriptional regulation

In addition to the cytoplasm, ACTN4 is also found in the nucleus (103). While ACTN4 was originally isolated as a protein that binds filamentous actin (F-actin) to modulate cytoskeleton organization and cell motility (103), other reports suggested that ACTN4 participates in apoptosis (121) and associates with transcription factors such as RelA/NF-

κB, and MEF2s (122–125). Our laboratory has previously reported that ACTN4 plays an important role in transcriptional regulation, in addition to its function as a cytoskeletal protein. ACTN4 interacts with histone deacetylase 7 (HDAC7), and potentiates myocyte enhancer factor 2 (MEF2) transcriptional activity (126). Furthermore, ACTN4 interacts with several nuclear receptors, including estrogen receptor (ER), Vitamin D receptor (VDR) and retinoic acid receptor (RAR) in a hormone dependent manner stimulates NR-mediated gene expression (126–128). Transcriptional co-activators interact with nuclear receptors through sequences containing a short α-helical –LXXL- motif. ACTN4 contains a single -

LXXLL- motif and mutations in this motif abolish the ability of ACTN4 to interact with or enhance the transcriptional activation of NRs. When brought to a promoter, ACTN4 potentiates basal transcription activity. The ACTN4 isoform (Figure 3), ACTN4 (Iso), also potentiates transcriptional activation and interacts efficiently with transcriptional co- activators, such as p160 protein co-activators and PCAF, while full-length ACTN4 interacts weakly with these coactivators. Notably, FSGS-linked ACTN4 mutants lose the ability to bind NRs in a hormone-dependent manner. This observation suggests that disease-linked ACTN4 mutants lose their ability to potentiate transcription activity of transcription factors including NRs, in addition to acquiring increased actin-binding activity.

NF-κB SIGNALING

The NF-κB transcription factors control the expression of genes encoding pro- inflammatory cytokines, chemokines, and adhesion molecules that regulate immune responses, cell proliferation, apoptosis, and differentiation (129–131). NF-κB activation is required to protect organisms from environmental insults, and mis-regulation of NF-κB activation is associated with pathogenesis of various diseases including chronic inflammation and cancer (132, 133).

NF-κB signaling consists of either the canonical pathway (Figure 4A) that involves heterodimers of RelA/p65 and p105/p50 or the non-canonical pathway (Figure 4B) that includes heterodimers of RelB and p100/p52. All five members of NF-κB transcription factors share a highly-conserved DNA-binding domain called the Rel homology domain

(RHD) (Figure 5A). A transcriptional activation domain is only present in p65, c-Rel, and

RelB, and is necessary for the positive regulation of gene expression. p100 and p105 are distinguished by their long C-terminal domains which act to inhibit themselves. These proteins become active DNA-binding proteins by proteolysis, p105 to p50 and p100 to p52

(134–139). All NF-κB family proteins can form heterodimers. Dimeric NF-κB transcription factors bind to 9-10 base-pair DNA site (κB sites). The NF-κB subfamily proteins complex with members of the Rel subfamily proteins to form transcriptionally active dimers (140). The typical IκB family protein are characterized by the conserved six ankyrin repeats domains (A) (Figure 5B). Ankyrin domain mediates the association between IκB and the Rel homology domain of the NF-κB dimers.

The canonical pathway (Figure 4A) participates in the inflammatory response, and the non- canonical pathway is involved in immune cell differentiation and maturation. The canonical pathway is induced by several diverse NF-κB stimuli, such as cytokines, pathogen-associated molecular patterns (PAMPs), and danger-associated molecular patterns (DAMPs) (141, 142). Under the resting condition, NF-κB dimers are bound to inhibitory IκB proteins, which sequester NF-κB complexes in the cytoplasm. Upon exposure to inflammatory stimuli, activation of the β subunit of the trimeric IκB kinase

(IKK) complex occurs. The activated β subunit of the IκB kinase (IKK) complex phosphorylates IκB proteins. Phosphorylated IκBs are recognized by the ubiquitin ligase machinery, leading to poly-ubiquitination and subsequent degradation, followed by the release of the NF-κB (143–145). The freed NF-κB translocates to the nucleus, where it binds to the cognate sequences found in the promoter or enhancer regions of target genes, including IκB. The activation of NF-κB is controlled by the stimulus-induced degradation and re-synthesis of IκB proteins. The abundance of activated nuclear NF-κB is negatively regulated through a feedback pathway in which newly synthesized IκB protein translocates to the nucleus and promotes nuclear exports of NF-kB to the cytosol (146).

In the non-canonical pathway (Figure 4B), activation of NF-κB is mediated by NIK and

IKKα, but not when part of the trimeric IKK complex. This results in phosphorylation and activation of the IKKα complex that in turn phosphorylates the IκB domain of p100, generating p52 by protease digestion. This is followed by the liberation of p52 and RelB.

This heterodimer subsequently translocates to the nucleus to activate its target genes (147,

148). The alternative pathway is activated in response to a subset of NF-κB inducers including lymphotoxin β and B-cell activating factors.

Upon translocation to the nucleus, NF-κB transcription factors are subjected to several post-translational modifications, including phosphorylation, acetylation, ubiquitination and methylation (149–153). Acetylation of p65 at lysine residues occurs in the nucleus

(150, 151, 154) and regulates its DNA-binding activity, its ability to associate with IκB and its transcription activity (150, 151, 155). In addition to direct modification of NF-κB subunits, histones flanking the promoters of various NF-κB target genes are subjected to acetylation, phosphorylation, and methylation through NF-κB-mediated recruitment of various histone modifying enzymes (156–158). Modification of NF-κB subunits and histones are known to recruit other transcription factors that include the constitutively active transcription factor SP-1 and the inducible factors STATs, CEBPs, CRBP, and AP-

1 (48, 159–167). Many of these sequence-specific transcription factors directly interact with NF-κB. Transcriptional co-activators usually form a functional complex to potentiate

NF-κB transcription activity. In contrast, hormone bound glucocorticoid receptor monomer directly or indirectly interacts with RelA-containing dimers and disrupts the interactions of

NF-κB subunits with coactivators. In this way, glucocorticoids inhibit the activity of pro- inflammatory transcription factors including NF-κB and AP-1 (168–170).

Figure 4. Canonical and alternative pathway of NF-κB signaling.

A, Activation of the canonical NF-κB pathway. Various stimuli activate the canonical pathway of NF-κB activation. In resting cells, NF-κB is sequestered by IκB in the cytoplasm. Activated IKK phosphorylates IκB proteins and induces IκB polyubiquitinylation. Unbiquitinated IκB is then recognized by the proteasome and undergoes proteolytic degradation. Following IκB degradation, the cytoplasmic NF-κB dimers are released and translocate into the nucleus, where they bind to their targeted promoters and activate transcription. B, Activation of the alternative NF-κB pathway.

Following activation of by cell-surface TNF receptor superfamily, NIK phosphorylates

IKKα, which in turns phosphorylates p100. Phosphorylated p100 is cleaved, generating p52, which forms heterodimers with RELB followed by nuclear translocation.

Figure 5. Domain structure of NF-κB and IκB family proteins.

A, The NF-κB subunits are comprised of five family members: RELA (p65), RELB, c-

REL, p100/p52, and p105/p50, all of which share the Rel homology domain (RHD). RELA

(p65), RELB and c-REL have transcription activation domain (TAD), while p100/p52, and p105/p50 contain ankyrin repeat domains (A) which mediate interaction with IκB family proteins B, IκB proteins. The IκB family members are IκBα, IκBβ, IκBγ, IκBε and BCL-

3. The IκB proteins are characterized by the presence of 6 or 7 ankyrin repeats. The ankyrin repeat motif in IκB proteins binds to the nuclear localization sequence (NLS) of NF-κB protein.

NF-κB and nephrotic syndrome

A key function of the NF-κB transcription factors is regulation of the induction and resolution of inflammation. Accumulated evidence suggests the involvement of NF-κB in the pathogenesis of renal inflammatory diseases (171, 172). NF-κB activation by multiple pathological agents in renal cells has been associated with experimental and human kidney diseases. Uncontrolled NF-κB activation in kidney podocytes appears to contribute to the glomerular injury (173–175). NF-κB regulates the expression of numerous genes that play key roles in the inflammatory response during kidney injury (176, 177). NF-κB activation has been demonstrated in glomerular cells such as podocytes, mesangial cells, tubular and endothelial cells upon renal injury or after exposure to inflammatory stimuli both in vivo and in vitro (178–180). Several NF-κB inducible genes and their encoded proteins including angiotensin II and cytokines, such as IL-1, IL-8, E-selection and MCP-1 are associated with the progression of glomerulonephritis, tissue injury in nephrotoxicity and other renal diseases, including glycosylated IgA, (181–189). In human renal disease, there is histologic evidence of NF-κB activation in nephrotic syndrome (190, 191). Functional evidence of NF-κB activation in progressive diabetic nephropathy glomeruli was observed through the mapping of the whole-genome expression profiles (176, 192).

Several reports suggest that dysregulation of the activity of canonical NF-κB, p50/p65

(RelA), in podocytes has a pathogenic role in glomerular diseases(193). For example, our collabotator demonstrated that induced activation of NF-κB contributes to HIV-associated nephropathy (HIVAN) pathogenesis (194, 195). This aberrant NF-κB activation

24 specifically has a role enhancing the effects of the TNF family of receptors on podocytes including the activities of Fas/FasL and TNFR2 (195, 196). Others reported that activation of the ERK pathway and subsequent nuclear translocation of NF-κB are necessary for Ang

II-induced TRPC6 accumulation and podocyte apoptosis(197), and that NF-κB activity mediates puromycin aminonucleoside (PAN)-induced glomerular injury and proteinuria

(198). Collectively, these observations indicate that NF-κB is an important mediator of pathogenic processes in podocytes and that balanced NF-κB activity is critical to maintain podocyte integrity and function.

During resolution of inflammation, NF-κB inhibitors have shown to be beneficial in experimental models. The conventional therapies of NF-κB inhibitors in clinical use include steroids and multiple immunosuppressive drugs, such as, alkylating agents and calcineurin inhibitors (91, 199). It is clear that targeting the NF-κB pathway is a major therapeutic approach in the management of nephrotic syndrome.

GLUCOCORTICOID AND GLUCOCORTICOID RECEPTORS (GRs)

GR signaling

Nuclear hormone receptors (NRs) are hormone-activated transcription factors that control homeostasis, differentiation, proliferation and animal development (200, 201). Among a total of 48 nuclear receptors expressed in humans, the best characterized subfamily of NRs is the class I steroid hormone receptors, which includes glucocorticoid receptor (GR), mineroglucocorticoid (MR), progesterone receptor (PR), androgen receptor (AR) and

25 estrogen receptor (ER). These receptors bind their cognate hormones and regulate the expression of a network of target genes. Class II NRs are the ‘orphan’ receptors, physiological ligands of several of which have not been identified (202, 203). Class III

NRs are the ‘adopted’ orphan receptors, of which ligands have recently been identified

(204). A key function of NRs is to mediate transcriptional regulation in response to hormones and other metabolic ligands through the recruitment of a range of positive and negative regulatory proteins, referred to as co-activators or co-repressors. The NR target genes comprise a complex genetic network, in which their coordinated activity defines the physiological hormonal responses.

The human GR gene is composed of 9 exons. Alternative splicing of exon 9 generates 2 isoforms, termed GRα and GRβ (205). GRα is the classic GR protein that mediates the actions of glucocorticoids (GCs) (206). GRβ contains a unique carboxyl-terminal sequence and does not bind GCs agonists (207, 208). When coexpressed with GRα, GRβ functions as a dominant-negative inhibitor. In addition to GRβ, alternative splicing of the GR gene gives rise to other isoforms, including GRγ, GR-A, and GR-P (205) (Figure 6). GRγ exhibits a distinct transcriptional profile from GRα (209). GRα is composed of four functional domains, the N-terminal ligand-independent transactivation domain or activation function 1 (AF-1), the DNA-binding domain (DBD), the flexible hinge region and the ligand-binding domain (LBD), which contains 12 helices including the ligand- binding pocket (helices 3,4,5 and 12) and the AF2 domain (Figure 6). The DBD and LBD each contain a NLS that directs translocation of NRs to the nucleus (210–212).

Glucocorticoid binding to the hydrophobic pocket of the LBD triggers a conformational

26 change, thereby unmasking LBD from AF2 domain (213, 214). The AF1 and AF2 domains have been shown to activate transcription through its interaction with basal transcriptional machinery and transcriptional co-activators (215). Most of the co-activators interact with

GR LBD through the LXXLL nuclear receptor interacting motif and stimulate GR- mediated transcription by altering chromatin structure or interacting with basal transcription machinery (216–219). Antagonist-bound GR repress transcription by generating a closed chromatin structure through the recruitment of corepressors including nuclear receptor co-repressor (NcoR) and silencing mediated by retinoid and thyroid receptors (SMRT) (220–222).

Glucocorticoid signaling is primarily dependent on GR-mediated transcription and protein synthesis. In the absence of hormone, the GR resides in the cytoplasm as part of a large multiprotein complex that includes chaperone proteins, such as HSP90 (223–225). Upon ligand binding, GR dissociates from chaperone proteins and translocates into the nucleus, where it regulates transcription through multiple distinct modes of action (Figure 7). As a homodimer, it can bind a cognate DNA sequence present in enhancers containing glucocorticoid response elements (GREs) to activate gene expression (226, 227). In addition to homodimer formation, GR also direct interacts with MR or AR to form a heterodimer. The subsequent recruitment of several coactivators, including histone modifying enzymes and chromatin modulators promotes chromatin remodeling and subsequent transcriptional initiation (228–232). The GR has also been proposed to bind to specific sequences called negative GREs (nGREs) in the promoter region of some target genes (220, 233, 234). Recently, it was shown that GR binds to a set of genes that contain

27 nGREs mediating downregulation of these genes (235). In contrast to the homodimer, ligand-bound monomeric GR regulates transcription is through its interactions with other transcriptional regulators, such as nuclear factor kappa B (NF-κB) and activating protein-

1 (AP-1). These interactions block co-activator recruitment and promote co-repressor recruitment, thereby altering chromatin structure and transrepressing target gene expression (236–238). Lastly, ligand-bound monomeric GR is capable of binding composite GR-responsive regions, where additional transcription factors bind and efficiently induce glucocorticoid-mediated gene expression (239, 240).

Figure 6. The GR family proteins.

Human GR has 3 major domains: the N-terminal domain (NTD), middle DNA-binding domain (DBD) and the C-terminal ligand-binding domain (LBD). DBD and LBD are linked by the hinge region (HR). Alternative splicing of the GR in exon 9 generates the isoforms GRα, GRβ, GRγ, GR-A, and GR-P, which differ in size and sequence of HR and/or LBD.

Figure 7. Molecular mechanism of GR signaling pathways

Glucocorticoids diffuse across the cell membrane to the cytosol, where they bind GR.

Glucocorticoid binding promotes dissociation of GR from chaperone proteins (HSPs) and subsequent nuclear translocation. Once in the nucleus, GR form hetero- or homodimers and interact with DNA to control gene transcription. Ligand-bound GR can lead to either activation or repression of gene transcription. TF: transcription factor; GRE, glucocorticoid response element; nGRE, negative glucocorticoid response element; TFRE: transcription factor response element.

Glucocorticoids

As a ligand-activated transcription factor, the physiologic and pharmacologic action of GR is primarily mediated by the glucocorticoids (GC). Physiological GCs, such as Cortisol or hydrocortisone, are cholesterol-derived hormones secreted by the adrenal glands (241).

The synthesis and release of GCs are under dynamic circadian regulation by the hypothalamic-pituitary-adrenal axis (242, 243). The availability of natural GCs in tissues is regulated by corticosteroid-binding globulin in serum and by the expression of 11β- hydroxysteroid dehydrogenase enzymes (244).

Synthetic GCs are drugs that mimic the action of natural GCs. Dexamethasone (Dex), prednisone/prednisolone, hydrocortisone, and budesonide are the most commonly prescribed GCs (245, 246). Importantly, synthetic GCs do not bind corticosteroid-binding globulin and are not metabolized by 11β-hydroxysteroid dehydrogenase enzymes. As such, synthetic GCs have increased local availability (247). Synthetic GCs are being prescribed for chronic inflammatory diseases, including autoimmune disorders, allergies, asthma and skin infections (248). In addition to their anti-inflammatory properties, GCs have been used in cancer therapy to reduce some side effects of chemotherapy (249). Additionally, they may be used to kill cancer cells by their anti-proliferative and anti-angiogenic properties

(250–253). Synthetic GCs, such as Dex and prednisone/prednisolone, are also therapeutically effective in nephrotic syndrome (254, 255). It has been proposed that the therapeutic effects of Dex can directly act on the glomerular podocytes (256).

GR target genes

Genome-wide analysis of GR-regulated genes and GR-binding sites in different cells and tissues have recently been reported (257–259). These experiments report the characteristics of genome-wide profiling of GR and genome-wide inventory of GR-binding sites. These results provide an exciting global view of the GR targets genes, and the tissue-specific modes of GR action, and potentially contributes to our understanding of glucocorticoid action. Notably, GR binding sites in the genome are not present in isolation but are usually surrounded by other transcriptional factor binding motifs. It was proposed that these transcription factors cooperate with GR to maintain accessibility of these sites (260).

Another finding is that some of the GR binding sites are distal to the nearest transcriptional start site (261, 262).

It is striking that GR selectively regulates transcription in a cell-specific manner, and there is only modest overlap in glucocorticoid-regulated gene sets between human osteosarcoma cells and A549 alveolar epithelial cell line (260, 263). The chromatin accessibility is a major contributor is the determination of the tissue-specific GR binding profiles, while the major determinant for tissue-specific chromatin accessibility is cell-type-specific expression of other transcription factors. GR target genes are involved in metabolism, signal transduction, inflammation and the immune response (168, 264–266). These GR target genes span the known range of GCs functions, contains both induced and repressed genes. Notably, GCs are widely used in medical therapy for immunosuppression and anti- inflammatory agents. However, GCs’ broad effects on different organ systems lead to

32 unwanted side effects such as bone loss and glucose dysregulation. Recent advances in next-generation DNA sequencing, have enabled new techniques to measure protein:DNA binding (ChIP) and gene expression (RNA-seq) to produce a comprehensive genomic map of GR:DNA binding and GR gene regulation in different tissues.

THE EFFECTS OF GLUCOCORTICOID THERAPY ON NEPHROTIC

SYNDROME

Glucocorticoids regulate many physiological processes and have an essential role in podocyte development and treatments for nephrotic syndrome (175). The physiologic and pharmacologic actions of GCs are mediated by GRα (267–269). Ligand-bound GR induces or represses the transcription of target genes through direct binding to DNA or association with other transcription factors. Glucocorticoids are used as immunosuppressive drugs for many diseases by reducing inflammation (241). It has been a longstanding clinical practice to use GCs to treat kidney disease. Recent studies in multiple experimental models have begun to explore the direct and indirect effects of GCs in podocytes to better understand its renoprotective activity (269). Podocyte loss or injury is associated with the pathobiology of proteinuria and nephrotic syndrome (270, 271). Glucocorticoids are the mainstay of treatment of nephrotic syndrome (254), however, their mechanism of action remains poorly understood.

The remission rates of GC therapy vary between patients, depending on initial renal function, and the pathological features of nephrotic syndrome (60, 272). Based on their

33 steroid responsiveness, patients are classified as steroid-sensitive and steroid-resistant.

Genetic mutations that affect glomerular podocyte function, such as NPHS1, NPHS2, and

WT1 (10, 273, 274), account for most steroid-resistant cases and patients with genetic forms of steroid-resistance are less response to immunotherapeutic drugs. A circulating factor has been considered to be another cause of development of the steroid-resistance nephrotic syndrome (275, 276). Steroid-resistant nephrotic syndrome in adults has been defined as the persistence of symptoms after a 4 month trial of therapy. Steroid-resistant nephrotic syndromes will inevitably progress to end-stage renal disease (277). Alternative therapeutic strategies, including calcineurin inhibitor therapy, alkylating agents and angiotensin-converting enzyme inhibitors, have been used to reduce proteinuria in steroid- resistant patients with FSGS (278).

Corticosteroid therapy has been used in childhood nephrotic syndrome since the 1950s.

GCs therapy is more effective alone for children with minimal change disease (MCD), but commonly requires a combination of additional agents in adult NS (70, 88, 279). Children with the nephrotic syndrome are treated with oral prednisone for 2 to 3 months (68). Both higher doses and increased duration of prednisone therapy leads to enduring remission. 80% of children with MCD, respond to steroid therapy (279). Thus, therapeutic decisions in children with steroid-resistance are based on the underlying etiology (67, 280). In contrast, adults with the nephrotic syndrome usually undergo renal biopsy prior to the initiation of therapy. The renal biopsy is essential to distinguish the nature and severity of the glomerular processes and clarify the types and causes of glomerular nephropathy (281).

Patients whose biopsies demonstrated more cellular lesion generally have been associated

34 with a poor therapeutic response. (282, 283). Approximately 35% percent of adult patients fail to respond to initial steroid treatment and do not attain remission (70, 88). The treatment for adults with FSGS is high dose glucocorticoid therapy for a significantly longer duration (284). For patients who have a well-preserved renal function, initial high- dose prednisone is given for 3 to 4 months. However, complete remission rates for glucocorticoid therapy in adults with primary FSGS was quite disappointing (70, 284).

Consequently, there is less evidence to support steroid therapy for adaptive or genetic forms of adult FSGS patients. Thus, understanding the mechanism underlying steroid- resistance is an urgent matter for NS therapy.

THE ROLE OF GLUCOCORTICOIDS IN PODOCYTES

Glucocorticoids direct effect on podocytes

The glucocorticoid receptor, as well as the major components of GR transcriptional cofactors, are expressed in human podocytes (175, 234, 269). In order to determine whether podocytes are the key cell type affected by glucocorticoid therapy, recent studies in murine and human podocytes showed that Dex directly regulates podocyte morphology and function (Figure 8). Mathieson et al. first evaluated the direct effect of Dex on an immortalized human podocyte cell line (HPCs) (269). They found that Dex has potent direct effects on human podocytes in vitro. Dex treatment up-regulated expression of nephrin (NPHS1), and down-regulated vascular endothelial growth factor (VEGF), as well as cyclin kinase inhibitor p21 and inflammation-associated cytokines, such as IL-1α, IL-

1β, TNFα, IL-6 and MCP-1. A proteomic analysis also identified proteins with known roles

35 in protecting podocytes from injury and found them to be up-regulated by Dex in cultured murine podocytes (285). These up-regulated proteins are particularly rich in actin cytoskeleton and proteins involved in responses to cellular stress. Microarray analysis of glucocorticoid target genes in cultured human podocytes has been previously reported

(286). Using microarray analyses, it was shown that Dex induces expression of PAI-1

(Plasminogen Activator Inhibitor Type 1) and CCL20 mRNAs. PAI-1 is present in trace amounts in healthy kidneys but increases in a wide variety of both acute and chronic diseased kidneys. Furthermore, reduced PAI-1 activity has been shown to be protective of albuminuria and glomerulosclerosis in experimental diabetes (287), while CCL20 is up- regulated in patients with progressive IgA nephropathy (288). Thus, Dex potentially exhibits unwanted effects which may cause further damage to podocytes or glomeruli. Our previous microarray studies also uncovered that GR crosstalks with a broad range of signaling pathways, including the inflammatory response, cell migration, angiogenesis, and predominantly altered NF-κB and TGFβ pathways (286). GCs considered to have immunosuppressive and anti-inflammatory effects. It exerts the anti-proteinuria effect not only by immune-suppression but also through protecting podocyte integrity. Recently,

RNA-seq analysis revealed that Dex-regulated genes are linked to cytoskeleton-related processes, podocyte differentiation, pro-inflammatory cytokines and growth factors (289).

Collectively, these results advance our knowledge of the molecular mechanisms by which

GCs exert their therapeutic effects on podocytes.

Figure 8. The mechanism of the Podocyte injury and the protective effect of glucocorticoids.

Several causes are known to contribute to podocyte injury. After injury, podocytes can undergo cytoskeleton derangment, effacement, detachment or apoptosis. The mechanisms by which glucocorticoids exerts its renoprotective effect involve several modes that protect podocyte from injury.

GCs and podocyte injury

Podocyte injury due to genetic mutations or environmental stress is a major cause of NS.

Therefore, podocytes are an important therapeutic target for the treatment of NS. Current evidence suggests that GCs treatment protects podocytes from experimental injuries induced by puromycin aminonucleoside (PAN), Adriamycin (ADR), or protein-overload

(290, 291). In an experimental podocyte injury model, upregulation of TRPC6 was shown to contributes to Angiotensin II (Ang II)-induced podocyte injury (197, 292). Notably, Dex treatment significantly reduced PAN-induced TRPC6 expression in rat and cultured murine podocytes (294). Serum albumin overload in rats has also reported to not only induc structural and pathological changes in podocytes (296, 297), but also increase pro- inflammatory genes COX-2, MCP-1, CXCL1, and the stress protein HSP25 expression in both rat glomeruli and cultured podocytes(298). Similarly, GCs inhibit serum albumin- induced COX-2 expression via its transrepression of NF-kB activity. GCs are also implicated in activating glomerular antioxidant enzymes and protecting glomeruli from reactive oxygen species (ROS)-mediated injuries in PAN-induced nephrosis rats (299).

Using zebrafish and cultured HPCs, a recent study demonstrated that GCs ameliorate PAN- induced podocyte injury by downregulating caveolim-1 expression (300) and overexpression of caveolim-1 impair normal podocyte function (300). In summary, podocyte injury was relieved by GCs treatment in animal model and cultured human podocytes. The mechanism by which GCs protect podocytes from injury is mediated by regulating its target gene expression.

GCs and actin-filament stabilization

The podocyte actin cytoskeleton is a key component of the complex architecture of the slit diaphragm (1, 4). Glucocorticoids have been demonstrated to protect and enhance recovery of cultured murine podocytes due to its ability to stabilize actin filaments (267).

Dexamethasone (Dex) treatment induced a significant increase in the activity of the actin- regulating GTPase RhoA, and thereby increased total cellular polymerized actin and stabilized actin filaments, thereby blocking PAN-induced disruption of actin filements

(267, 289, 301). Additionally, a recent study in cultured podocytes indicated that Dex could protect podocytes from adriamycin-induced actin rearrangements (302). These reports imply that the beneficial effects of GCs in renal disease, at least in part, result from enhancing podocyte actin filament stability.

GCs and podocyte apoptosis

One of the beneficial features of glucocorticoid action is prevention of podocyte apoptosis

(290). GCs inhibit apoptosis by restoring Bcl-2 expression, reducing p53 levels and inhibiting nuclear translocation of apoptosis-inducing factor (AIF) in PAN-treated cultured podocytes (290). These activities are due to, in part, Dex-mediated reduction of extracellular signal-regulated kinase (ERK) phosphorylation induced by PAN treatment

(303). PAN also reduces PI3K/Akt signaling and promotes podocyte apoptosis. Dex treatment restores the PI3K/Akt signaling, which promotes the activity of antiapoptotic proteins (304). In another study, prednisone treatment has been shown to reduce podocyte

39 apoptosis. It also increased podocyte progenitors by activating ERK signaling in an FSGS mouse model initiated with a cytotoxic anti-podocyte antibody (305). In order to limit podocyte loss, GCs not only inhibit podocytes apoptosis, but also increase the number of podocyte progenitors.

In this introduction, I begin with a brief introduction to the major players in this thesis: podocyte, nephrotic syndrome, alpha-actinin 4, NF-κB signaling and GR signaling. In summary, I introduce the importance of human podocytes, followed by the occurrencec of podocyte injury and the pathology of nephrotic syndrome. ACTN4 plays a key role in maintaining podocyte function, and ACTN4 mutations are linked to nephrotic syndromes.

Furthermore, in order to demonstrate the importance of ACTN4 in transcriptional regulation of both NF-κB and GR signaling, I present a series of the recent developments in dissecting the mechanism by which aberrant NF-κB activity induces human renal disease and the mechanism by which glucocorticoids and GR treats nephrotic syndrome and protects podocyte injury.

Following this introduction, the observations regarding the role of ACTN4 in regulating

NF-κB and GR transcriptional activities in human podocytes will be presented and discussed in chapter 2 and chapter 3. Studies of the properties of the novel disease- associated ACTN4 mutations will be described in Chapter 4.

CHAPTER 2: ACTN4 POTENTIATES NF-κB ACTIVITY IN PODOCYTES

INDEPENDENT OF ITS CYTOPLASMIC ACTIN BINDING FUNCION

ABSTRACT

Glomerular podocytes are highly specialized terminally differentiated cells that act as a filtration barrier in the kidney. Mutations in the actin-binding protein, α-actinin 4 (ACTN4), are linked to focal segmental glomerulosclerosis (FSGS), a chronic kidney disease characterized by proteinuria. Aberrant activation of the NF-κB pathway in podocytes is implicated in glomerular diseases including proteinuria. We demonstrate here that stable knockdown of ACTN4 in podocytes significantly reduces TNFα-mediated induction of

NF-κB target genes, including IL-1β and NPHS1, and activation of an NF-κB-driven reporter without interfering with p65 nuclear translocation. Overexpression of ACTN4 and an actin binding-defective variant increases the reporter activity. In contrast, an FSGS- linked ACTN4 mutant, K255E, which has increased actin binding activity and is predominantly cytoplasmic, fails to potentiate NF-κB activity. Mechanistically, IκBα blocks the association of ACTN4 and p65 in the cytosol. In response to TNFα, both NF-

κB subunits p65 and p50 translocate to the nucleus, where they bind and recruit ACTN4 to their targeted promoters, IL-1β and IL-8. Taken together, our data identify ACTN4 as a novel coactivator for NF-κB transcription factors in podocytes. Importantly, this nuclear function of ACTN4 is independent of its actin binding activity in the cytoplasm.

INTRODUCTION

The kidney glomerular podocytes are highly specialized epithelial cells that extend numerous lamellipodia that branch into primary and secondary processes, which further ramify into smaller processes known as foot processes (306). These foot processes are spanned by slit diaphragms containing Nephrin which prevent the filtration of larger plasma proteins into the urine. The maintenance of the slit diaphragm is critical for proper glomerular filtration and kidney function.

Mutations in several genes encoding components of the slit diaphragm or the foot processes have been linked to familial forms of FSGS including alpha actinin-4 (ACTN4) (73, 75,

307, 308). ACTN4 was originally isolated as a protein that binds filamentous actin (F-actin) to modulate cytoskeletal organization and cell motility (103), and initial theories of its function in FSGS have centered on this role, postulating that increased actin binding activity contributes to pathogenesis. However, the mechanisms by which FSGS-linked

ACTN4 mutations cause glomerular diseases remain elusive.

While investigating histone deacetylase 7 (HDAC7) interacting proteins, we identified

ACTN4 as a transcriptional co-activator for MEF2 transcription factors (124). This finding was recently confirmed by An et al. (309), We also established that ACTN4 has a regulatory function on transcription mediated by nuclear hormone receptors such as estrogen receptor, retinoic acid receptor, peroxisome proliferator-activated receptor and vitamin D receptor via its amino-terminal nuclear receptor interacting motif, LXXLL (126,

127). Notably, FSGS-linked ACTN4 mutants, which are predominantly cytoplasmic, loose their ability to potentiate hormone-dependent transcriptional activation (310). Based on

42 these observations, we conclude that ACTN4 plays a role in both cytoskeletal dynamics and transcription through nuclear hormone receptor signaling.

NF-κB transcription factors regulate immune responses, cell proliferation, apoptosis and differentiation through controlling the expression of genes encoding pro-inflammatory cytokines, chemokines, and adhesion molecules (129, 130). NF-κB signaling comprises the canonical pathway that involves heterodimers of RelA/p65 and p105/p50 and the non- canonical pathway that includes heterodimers of RelB and p100/p52. The canonical pathways are activated by pattern recognition receptors and the tumor necrosis family receptors in response to a variety of pro-inflammatory signals including cytokines such as

TNFα. Upon stimulation, the IκB kinase complex phosphorylates IκB (the cytoplasmic repressor for the NF-κB p50/p65 heterodimer), which promotes IκB degradation and subsequent p65/p50 heterodimers release and translocation to the nucleus. Upon nuclear translocation, NF-κB transcription factors bind their target genes and recruit chromatin modification enzymes and transcriptional cofactors to regulate specific target gene expression.

Several studies have linked dysregulated activation of NF-κB with human chronic kidney diseases, podocyte function, and Nephrin expression levels (174, 194–196, 311–313).

Because of the known interactions between the nuclear hormone Glucocorticoid Receptor

(GR) and NF-κB signaling, and also the importance of glucocorticoids in the treatment of proteinuric kidney diseases, we wished to determine if ACTN4 participates in transcriptional responses mediated by NF-κB and GR. In this study, we describe a novel

43 role for ACTN4 as a transcriptional coactivator of NF-κB in podocytes. In addition, the previously described FSGS-linked ACTN4 mutant, K255E, fails to potentiate NF-κB activity (310). These transcriptional regulatory functions appear to be independent of cytoskeletal functions associated with actin binding defects of the K255E ACTN4 mutation.

Taken together, our findings highlight a previously underappreciated function of ACTN4 in transcriptional activation in glomerular physiology and a novel pathological consequence of the mutations in ACTN4 associated with FSGS.

MATERIALS AND METHODS

Cell culture and differentiation - HEK293T, HeLa cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS and penicillin- streptomycin (50 units/ml) at 37 °C in 5% CO2. Human immortalized podocytes (HPCs) were cultured in RPMI 1640 (Life Technologies) supplemented with 10% fetal bovine serum, penicillin-streptomycin (50 units/ml) and insulin transferring selenite (ITS) (sigma chemicals). HPCs were grown at the permissive temperature of 33 °C and transferred to

37 °C to induce differentiation for 3 days prior to treatments. Cells were starved in RPMI

1640 supplemented with 2% fetal bovine serum, penicillin-streptomycin (50 units/ml) and insulin transferrin selenite (ITS).

Plasmid construction - CMX-HA-ACTN4, GST-ACTN4 (WT) different ACTN4 mutations expression plasmids as well as GST-ACTN4 deletion constructs were described previously (126, 127, 310). The expression plasmids CMX-HA-p65 were generated by

PCR and subcloned into a CMX-1H vector (314). For MCP1-Luc reporter plasmid, 3 kb upstream of MCP-1 transcription start site was subcloned into CMX-Luc reporter vector.

Antibodies and chemicals - The anti-ACTN4 antibodies have been described previously

(6). For immunoprecipitation assays, anti-HA antibodies (Santa Cruz Sc-805), anti-p65 antibodies (Santa Cruz Sc-372) were used. For immunostaining, anti-HA (Santa Cruz Sc-

805), anti- p65 antibodies (Santa Cruz Sc-372), anti-ACTN4 (Santa Cruz Sc-134236), anti-

Lamin B (Sc-6216) and anti-α-tubulin (T-5168, Sigma-Aldrich) were used. The secondary antibodies for immunofluorescence were from Life technologies (anti-mouse or anti-rabbit

Alexa Fluor 488, or Alexa Fluor 594). Tumor necrosis factor alpha (TNFα) was purchased from Promega (G5241), Dexamethasone (D4902), was purchased from Sigma-Aldrich.

Generation of stable knockdown cells - shRNAs against human ACTN4

(TRCN0000055783, TRCN0000055784, TRCN0000055785, TRCN0000055786,

TRCN0000055787), shRNA against human IκBα (TRCN0000004539, TRCN0000004540,

TRCN0000004541, TRCN0000004542) and shRNA against human HDAC7

(TRCN0000195442) were purchased from Sigma-Aldrich. The packaging plasmids used were pMD2.G and psPAX2 that were kindly provided by Dr. Barbara Bedogni. After cotransfection into the HEK293T packaging cell line with shRNA and packaging plasmid, the supernatants containing the lentivirus were collected and used to infect HEK293T and

HPCs cell lines. Cells were stably infected with lentivirus and selected in puromycin- containing medium (1.5 μg/ml) for 2 days. Knockdown of ACTN4 was confirmed by

Western blots.

Subcellular fractionation - Isolation of nuclei and cytoplasm from HPCs and extraction of nuclear and cytosolic proteins was performed according to a published protocol (310).

Nuclear and cytoplasmic fractions were resolved on SDS-polyacrylamide gels and followed by Western blotting with the indicated antibodies.

In vitro protein-protein interaction assays - Glutathione S-transferase (GST) fusion proteins were expressed in E. coli DH5α strain, affinity purified and immobilized on glutathione- sepharose 4B beads. Immobilized, purified GST, GST-ACTN4 or GST-p65 fusion proteins were incubated with whole cell extracts expressing HA-p65, HA-ACTN4 or HA-p50 followed by extensive washes as described (315). The pulldown fractions were subjected to Western blottings with the HA-antibodies. The immobilized GST and GST fusion proteins were visualized by Coomassie Brilliant Blue staining.

Co-immunoprecipitation - HPCs were treated with vehicle or TNFα (20 ng/ml), harvested, and whole cell lysates prepared (310). Immunoprecipitation and Western blotting assays were carried out following our published protocol (124).

Glomerular isolation - Glomerular extracts were prepared following an established protocol (316). Twenty-week-old male C57BL/6 mice (n=5) were anesthetized. Kidneys were harvested, decapsulated, minced, and digested and the glomeruli containing. RNA prepared using RNA spin kit (USB).

Transient transfection reporter assays - HEK 293 stably expressing shRNA against human

ACTN4 or HDAC7, or overexpressing wild-type or mutant HA-ACTN4 were cultured in

24-well plates. Cells were co-transfected with an NF-κB luciferase reporter (a generous gift from Dr. Bedogni) or MCP-1-Luc reporter and pCMX-β-galactosidase construct using

Lipofectamine 2000. The cells were lysed in reporter lysis buffer 8 h after TNFα or 12 h after Dexamethasone treatment and 48 h after transfection (Promega). Luciferase and β- gal activities were measured according to the manufacturer’s protocol using a luciferase assay system (Progema). Luciferase activity was normalized to β-gal activity. Each reaction was performed in triplicates.

RNA isolation and qPCR - Total RNA was extracted using the RNeasy isolation kit

(Qiagen) and reverse transcribed using reverse transcription kit (Bio-Rad) according to the manufacturer’s instructions. The PCR primers used in this study and their sequences are listed in supplemental Table 1 and previously described. The iQ SYBR green PCR supermix (Bio-Rad and Qiagen) and the CFX96 Real-time PCR detection system (Bio-Rad) were used to quantify cDNAs according to the manufacturer’s instructions. The 18S rRNA was used for normalization. The relative mRNA expression was calculated by the 2-

(△△Ct) method.

Chromatin Immunoprecipitation (ChIP) assay - ChIP assays were carried out as described with modifications (15). Chromatin was sheared by sonication and the extracts were precleared by protein-A-coupled beads (Repligen). Immunoprecipitation was performed using anti-ACTN4 and anti-p65 antibodies.

Immunofluorescence microscopy - HPCs were grown on a sterile coverslip in 12-well plates, treated with or without TNFα, fixed with 3.7% paraformaldehyde for 30 min at room temperature and incubated with anti-p65, anti-ACTN4 (Santa Cruz Sc-134236) or rhodamine-labeled phalloidin (Santa Cruz, Cytoskeleton). The secondary antibodies used were Alexa Fluor 488 and Alexa Flour 594 (Invitrogen). DAPI (4', 6-diamidino-2- phenylindole) was applied to the samples after the final wash to visualize cell nuclei.

Images were visualized using a Leica epi-fluorescence microscope.

Statical analysis - Data were expressed as the mean±S.D. analyses were performed with student's t test using Graphpad Prism6 software. A value of p<0.05 was considered to be significant. p<0.05 and p<0.001 are designated by * and **, respectively.

RESULTS

ACTN4 is required for NF-κB transcriptional activity

Our previous work has indicated ACTN4 plays a role in transcriptional regulation by MEF2 transcription factors and nuclear hormone receptors. Because of the intersection of the nuclear hormone receptors and NF-κB signaling, we wished to investigate whether ACTN4 is also involved in NF-κB transcriptional regulation, we established several independent

HEK293T and HPC cell lines stably expressing a control shRNA (shCtrl) or ACTN4 shRNA (shACTN4) expressing different levels of endogenous ACTN4 protein. We found that knockdown of ACTN4 decreased IL-1β mRNA expression, a known NF-κB target gene

(Fig. 9A). These results indicated that ACTN4 positively regulated IL-1β expression in

48 both cell lines and raised the possibility that ACTN4 played an important role in promoting

NF-κB signaling. To test whether ACTN4 regulates p65-mediated transcriptional activity, we examined the effect of ACTN4 knockdown on a NF-κB-driven reporter activity and found that knockdown of ACTN4 significantly decreased basal and TNFα-induced NF-κB reporter activity (Figure 9B). Consistently, overexpression of HA-ACTN4 increased

TNFα-induced NF-κB reporter activity (Fig. 9C). We further generated a reporter construct with the native MCP-1 promoter, a classical NF-κB target gene and determined the effect of ACTN4 knockdown on the promoter activity. We found that knockdown of ACTN4 significantly blocked the ability of TNFα to induce MCP-1 promoter activity (Fig. 9D).

Taken together, these data indicate that ACTN4 is important for TNFα-mediated transactivation activity of NF-κB.

Figure 9. The effect of ACTN4 knockdown on NF-κB-mediated transcriptional activation.

A, ACTN4 was stably knocked down by several short hairpin (sh) RNAs (shA1-4) targeting different regions of ACTN4 mRNA in HEK293T cells (lanes 1-5) or HPCs (lanes

6-8). A control shRNA (shCtrl) was used for comparison. The mRNA expression levels of

IL-1β of corresponding cells are shown. B, Control, and ACTN4 stably knockdown

HEK293T cells were transiently transfected with a plasmid constitutively expressing β- galactosidase and an NF-κB luciferase reporter plasmid. NF-κB BS: NF-κB binding site.

Following transfection, cells were treated with TNFα (20 ng/ml) for 12 h and luciferase activity measured. A schematic representation of the reporter construct (top) and the expression of ACTN4 (bottom) are shown. C, HEK293T cells were co-transfected with an

NF-κB luciferase reporter plasmid and increasing amounts of HA-ACTN4 expression plasmid followed by treatment with vehicle or TNFα (20 ng/ml) for 12 h and luciferase activity measured. B-C, The relative luciferase activity was normalized to β-galactosidase activity. D, The MCP-1 promoter reporter construct and CMX-β-gal expression plasmid were transiently transfected into shCtrl or shA4-1 HEK293T cells, treated with or without

TNFα and the reporter activity assayed.

Knockdown of ACNT4 does not disrupt TNFα-induced p65 nuclear translocation

To dissect the mechanism underlying ACTN4-mediated transcriptional activation of NF-

κB target genes in HPCs, control and ACTN4 knockdown HPCs were treated with or without TNFα and NF-κB target gene expression was analyzed by RT-qPCR. We found that knocking down ACTN4 significantly decreased mRNA levels of NF-κB target genes,

IL-1β, IL8 and MCP-1 (Fig. 10A). The nephrin gene NPHS1 has been shown to be a NF-

κB target gene(317). Indeed, NPHS1 mRNA expression was induced by TNFα, and knockdown of ACTN4 abolished TNFα-mediated induction of NPHS1 mRNA. Nuclear translocation of the NF-κB family of transcription factors is an essential step to regulate the expression of their target genes. A previous report has suggested that overexpression of ACTN4 promoted nuclear translocation of p65(125). To further dissect the mechanism by which loss of ACTN4 decreased NF-κB reporter activity and its target gene expression, we determined whether knockdown of ACTN4 affects TNFα-induced nuclear translocation of p65. Control and ACTN4 knockdown HPCs were treated with or without TNFα followed by subcellular fractionation and indirect immunofluorescence microscopy. Subcellular fractionation of HPCs indicated that knockdown of ACTN4 had little or no effect on TNFα- induced nuclear translocation of p65 (Fig. 10B). Immunofluorescence microscopy further demonstrated that p65 was capable of translocating to the nucleus in ACTN4 knockdown

HPCs (Fig. 10C). Taken together, our data demonstrated that knockdown of ACTN4 significantly inhibited the expression of basal and TNFα-induced NF-κB target genes, but has little or no effect on TNFα-induced nuclear translocation of p65.

Figure 10. The effect of ACTN4 knockdown on TNFα-induced p65 nuclear translocation in HPCs.

A, ACTN4 was stably knocked down by shRNAs in HPCs. HPCs were starved overnight and treated with TNFα (20 ng/ml) for 6 h prior to harvest. Total RNA was extracted and qRT-PCR analysis was conducted using gene-specific primers as indicated. B-C,

Subcellular localization of p65 in ACTN4 KD HPCs was analyzed by Western blotting analyses (B) or immunofluorescence microscopy (C). B, Control, and ACTN4 KD HPCs were treated with 20 ng/ml TNFα for 1 h, harvested and subcellular fractions prepared followed by Western blotting using anti-ACTN4, anti-p65 and anti-lamin B or anti-α- tubulin as loading controls. The ratio of p65 to Lamin B or α-tubulin at DMSO-treated

HPCs were set at 1. The relative p65 intensity is shown. The quantitation data were an average of 2 Western blots. C, Control, and ACTN4 KD HPCs were treated with TNFα

(20 ng/ml) for 30 min followed by immunostaining with ACTN4 and p65 antibodies and fluorescence microscopy.

Glucocorticoid-mediated transrepression in podocytes

Liganded glucocorticoid receptors (GRs) can have diverse effects on both glucocorticoid response element (GRE)-and NF-κB-mediated transcriptional activation, depending on the nature of the ligands. For example, the glucocorticoid dexamethasone (Dex) activates

GRE-containing reporter activity while repressing NF-κB reporter activity. Fig. 11A shows that Dex treatment markedly repressed basal and TNFα-mediated induction of IL-1β, IL-8, and MCP-1 mRNAs. We also observed Dex-mediated transrepression of NF-κB activity using a reporter that contains a native promoter derived from MCP-1 in HPCs (Fig. 11B)

Using HPCs in which ACTN4 was stably knocked down, we further demonstrated that Dex effectively repressed IL-1β and MCP-1 gene expression in ACTN4 knockdown HPCs, but had no effect on IL-8 mRNA expression (Fig. 11C). Taken together, these data indicated that Dex represses NF-κB transcription activity in HPCs and that ACTN4 plays a role in

Dex-mediated transrepression of NF-κB activity in a gene-specific manner.

Figure 11. GRα-mediated transrepression of NF-κB target genes in podocytes.

A, The mRNA expression levels of NF-κB target genes in TNFα or Dex-treated HPCs.

HPCs were starved overnight, treated with Dex (100 ng/ml) or TNFα (20 ng/ml) for 6 h.

Total RNA was extracted and qRT-PCR analysis was conducted using gene-specific primers as indicated. B, Dex-mediated transrepression of TNFα activity in a reporter construct that contains a native MCP-1 promoter. The MCP-1 promoter reporter construct was transiently transfected into HPCs, treated with vehicle, TNFα, Dex or both and the reporter activity assayed. C, The expression of NF-κB target genes in control and ACTN4 knockdown HPCs treated with vehicle or Dex. Control and ACTN4 stable knockdown

HPCs were treated with Dex (100 ng/ml) for 4 h. Total RNA was extracted and RT-qPCR analysis was conducted using gene-specific primers as indicated.

ACTN4 physically interacts with p65 in HPCs

We further dissected the mechanism by which ACTN4 potentiates NF-κB transcription activity by examining whether ACTN4 and p65 interact. First, we demonstrated that endogenous ACTN4 was co-precipitated with exogenously expressed HA-p65 in HEK293 cells (Fig. 12A). We further confirmed this interaction occurs for endogenous ACTN4 and p65 (Fig. 12B). In the absence of TNFα, ACTN4 is distributed throughout the cells, whereas p65 is primarily in the cytoplasm (Fig. 10). In response to TNFα, a significant fraction of p65 translocates into the nucleus, while subcellular localization of ACTN4 remains relatively unchanged. These observations raise an intriguing question: do ACTN4 and p65 interact in the cytoplasm or in the nucleus? Indeed, we observed that ACTN4 and p65 co-immunoprecitated in the nuclear extracts prepared from TNFα-treated HEK293T cells (Fig. 12C). Similarly, we observed that p65 only interacts nuclear, but not cytoplasmic

ACTN4 in TNFα-treated HPCs (Fig. 12D). Lastly, we isolated glomeruli from mice and prepared total cellular extracts. Immunoprecipitation with anti-p65 antibodies indicated that ACTN4 and p65 interact in mouse glomeruli (Fig. 12E). To further confirm this association, we examined whether endogenous ACTN4 interacts with exogenously transfected HA-p65. In summary, these data indicate that p65 and ACTN4 interact in glomeruli, HPCs, and HEK293 cells.

Figure 12. ACTN4 and p65 interact in glomeruli and in mammalian kidney cells.

A, Exogenous p65 and endogenous ACTN4 interact in in TNFα-treated HEK293s.

HEK293 cells were transiently transfected with a control or an HA-p65 expression plasmid, treated with TNFa and immunoprecipitation performed with anti-HA antibodies and followed by immunoblotting with anti-HA and anti-ACTN4 antibodies. B, HEK293T cells were treated with or without TNFα (20 ng/ml) for 1 h, whole cell extracts were prepared and immunoprecipitated with anti-p65 antibodies and anti-HA antibodies as a control.

Proteins were detected by Western blotting (WB) using anti-ACTN4 and anti-p65 antibodies as indicated. The asterisks mark non-specific signals. C, HEK293T cells were treated with TNFα (20 ng/ml) for 1 h, nuclear extracts prepared and immunoprecipitated with anti-HA (control), anti-p65 or anti-ACTN4 antibodies. The immunopellets were subjected to Western blotting with anti-p65 and anti-ACTN4 antibodies. D, nuclear

ACTN4, and p65 interact in HPCs. HPCs were treated with TNFα and nuclear and cytoplasmic fractions prepared. Coimmunoprecipitation was carried out using anti-p65 antibodies followed by Western blotting with the indicated antibodies. E, Mouse glomerular extracts were prepared and immunoprecipitated with anti-p65 antibodies or anti-HA antibodies followed by Western blotting with anti-ACTN4 and p65 antibodies.

The asterisks shown in B and E represent non-specific background signals.

The role of cytoplasmic IκBα in ACTN4-p65 interaction

Because cytoplasmic NF-κB is bound by IκB, the inability of ACTN4 to bind NF-κB in the cytoplasm could be due to the masking of the ACTN4 interacting surface in p65 by cytoplasmic IκBα. Alternatively, it is possible that nuclear and cytoplasmic p65 and p50 have distinct biochemical properties such as differential posttranslational modification. p65 and p50 are subjected to intensive posttranslational modification such as phosphorylation, acetylation, methylation, glycosylation and ubiquitination. To distinguish these two possibilities, we first tested whether bacterially expressed GST-p65 is capable of pulling down HA-ACTN4 expressed in mammalian cells. Indeed, GST-p65 was capable of pulling down HA-ACTN4, suggesting that posttranslational modification of p65 is not required for interacting with ACTN4 (Fig. 13A). We further mapped ACTN4 interaction domain in p65 to the first 313 amino acids (Fig. 13B), the same region where IκBα binds. Lastly, we demonstrated that depletion of IκBα in HPCs significantly enhances the interaction between ACTN4 and p65 in the cytoplasm (Fig. 13C). In summary, these data support a model in which cytoplasmic IκBα masks ACTN4 interaction domain, thus blocking

ACTN4 from binding p65.

Figure 13. IκBα blocks ACTN4 from interacting with p65 in the cytosol.

A, Purified, imobilized GST-p65 was incubated with cell extracts expressing HA-ACTN4 or HA-p50. Pulldown fractions were subject to Western blotting with anti-HA antibodies.

B, Purified, imobilized GST-ACTN4 was incubated with cell extracts expressing HA-p65

(full-length), HA-p65 (1-313) or HA-p65 (314-551) followed by Western blotting with anti-HA antibodies. C, Knockdown of IκBα results in an association between ACTN4 and p65. HPCs were transiently transfected with a control or IκBα shRNA, nuclear and cytoplasmic fractions prepared, immunoprecipitated with anti-p65 antibodies and Western blotted with indicated antibodies.

Association of ACTN4 (WT) and its variant with NF-κB subunits

We have previously described a spliced variant of ACTN4 (Fig. 14A), ACTN4 (Iso), which binds and potentiates transcriptional activity by nuclear receptors and MEF2C. We also demonstrated that the LXXLL nuclear interacting motif is essential for nuclear receptor binding and transcriptional activation. We next addressed whether p65 binds ACTN4 variants by GST pulldown assays and whether the LXXLL motif is critical for the interaction between ACTN4 and p65. We found that mutation of the LXXLL motif,

LXXAA (AA), had little effect on p65 binding activity (Fig. 14B, lanes 3 & 4) and that

GST-ACTN4 (Iso) also binds p65, but less robust than the full-length protein (lanes 3 &

5). We have previously shown that the FSGS-linked ACTN4 mutant, K255E, is defective in interacting with nuclear receptors. However, ACTN4 (K255E) interacts with p65 similarly to the wild-type protein. Interestingly, the p65 heterodimeric partner, p50, also binds ACTN4 and its variants (Fig. 14C), although p50 binds ACTN4 (Iso) better than the full-length protein (lanes 3 & 5). Furthermore, ACTN4 (K255E) exhibited a weaker binding to p50. We further determined the ability of these ACTN4 variants to potentiate

NF-κB reporter activity (Fig. 14D). We observed a higher reporter activity in ACTN4 (Iso) and ACTN4 (Iso, AA) transfected cells, even though their expression levels were significantly lower than the full-length ACTN4 (right panel). In contrast, the FSGS-linked mutant, K255E, significantly lost its ability to activate NF-κB reporter activity. Taking together, these data indicate that p65 and p50 binding surface in ACTN4 do not overlap with that of nuclear receptors and that ACTN4 (Iso) possess intrinsically more potent coactivation activity.

Figure 14. The association of ACTN4 variants with p65 and p50.

A, Schematic representations of ACTN4 and its spliced variant, Iso. CH, Calponin

Homology domain; SR, Spectrin Repeat, CaM, Calmodulin. The nuclear receptor interacting motif, LXXLL (amino acids 84-88) is N-terminal to the splicing junction such that both full-length and the isoform share the LXXLL motif with distinct C-terminal sequences to the motif. The FSGS-linked K255E mutant is indicated. The C-terminal tandem solid black boxes are EF-hand calcium-binding domains. B, HeLa cells were transiently transfected with an HA-p65 expression plasmid. Whole cell lysates were incubated with immobilized GST or GST-ACTN4 (WT) or its variants. The pulldown fractions were analyzed by Western blotting with anti-HA antibodies. The expressions of

GST or GST-ACTN4 were visualized by coomassie blue staining. C, The experiments were similar to that in B except HA-p50 expressed HeLa extracts were used for pulldown.

D, HEK293T cells were co-transfected with an NF-κB luciferase reporter construct and

HA-ACTN4 (WT) or the variants Iso, Iso with alanine sabstitutions mutation in the

LXXLL motif (Iso-AA), or the K255E FSGS mutant (K-E), treated with TNFα (20 ng/ml) for 12 h and luciferase activity measured. The luciferase activity was normalized to β- galactosidase activity. The expression of ACTN4 and variants are shown by Western blot on the right panel. The lower bands in lanes 1 and 4 represent degraded ACTN4 protein.

The HDAC7-interacting domain is important for ACTN4-mediated transcriptional activation

We have previously demonstrated that the ability of ACTN4 to potentiate MEF2- and ERα- mediated transaction requires its HDAC7-interacting domain. We therefore determined whether HDAC7 plays a role in ACTN4-mediated potentiation of NF-κB activity. Indeed, the ACTN4 mutants defective in interacting with HDAC7 significantly lost their ability to potentiate NF-κB-driven reporter activity (Fig. 15A, right panel). Furthermore, knockdown of HDAC7 potentiates NF-κB-driven reporter activity (Fig. 15B) and endogenous IL-1β mRNA expression (Fig. 15C). Based on these data, we conclude that HDAC7 plays a role in ACTN4-mediated potentiation of NF-κB transactivation activity.

Figure 15. The role of HDAC7 in ACTN4-mediated potentiation in NF-kB transactivation activity.

A, HEK293 cells were transiently transfected with ACTN4 (FL), ACTN4 (FL, Δ 831-869),

ACTN4 (Iso) or ACTN4 (Iso, Δ 441-479) and a NF-κB reporter, treated with or without

TNFα and reporter activity measured. B, HEK293 cells were infected with a shCtrl or shHDAC7 expression viral vector and a NF-κB reporter, treated with or without TNFα and reporter activity determined. C, HPCs were transiently infected with a shCtrl or shHDAC7 expression viral vector, treated with or without TNFα, total RNA isolated and RT-qPCR performed with gene-specific primers.

ACTN4 is recruited to NF-κB target gene promoters

We further determined p65 interaction domain in ACTN4. Immobilized, purified GST-

ACTN4 (WT) was incubated with nuclear and cytoplasm extracts expressing HA-p65 (Fig.

16A) or HA-p50 (Fig. 16B) followed by Western blotting with anti-HA antibodies. In agreement with coimmunoprecipitation experiments, GST-ACTN4 was capable of pulling down nuclear p65 (Fig. 15A, lane 5) and p50 (Fig. 16B, lane 5) in vitro. In contrast, no interaction was observed when cytoplasmic extracts were used for pulldown assays. To map the domain in ACTN4 that is required for interacting with nuclear p65, we used GST fusion proteins with full-length ACTN4 (full-length), isoform ACTN4 (Iso) and truncated

ACTN4 (Iso) at amino acids 2-102 and 95-521 for pulldown assays. The C-terminal deletion mutant, ACTN4 (2-102), contains part of a CH1 domain, whereas ACTN4 (95-

521) contains the remaining C-terminus of ACTN4 (Iso) that includes part of Spectrin repeat 2 (SR2), SR3, SR4 and the calmodulin-like domain (Fig. 13A). Fig. 16 A-B show that amino acids 2-102 are sufficient to bind both HA-p65 and HA-p50 (lane 10). However, the C-terminus did not interact with HA-p65 (Fig. 16A, lane 12) and interacted poorly with p50 (Fig. 16B, lane 12).

We next performed chromatin immunoprecipitation assays (ChIPs) to determine whether

ACTN4 is recruited to the promoters of NF-κB targeted promoters. Indeed, TNFα increased the recruitment of p65 and ACTN4 to IL-1β (Fig. 16C) and IL-8 promoters (Fig.

16D). As a control, knockdown of ACTN4 markedly reduced the association of ACTN4 with the IL-1β promoter regardless the presence of TNFα (Fig. 16E). Interestingly,

69 knockdown of ACTN4 slightly reduced the binding of p65 to the IL-1β promoter. Taken together, we conclude that ACTN4 and p65 are recruited to IL-1β and IL-8 promoters in response to TNFα in HPCs.

Figure 16. Association of p65 and ACTN4 with IL1-β and IL-8 promoters in HPCs.

A, HeLa cells were transiently transfected with an HA-p65 expression plasmid. Nuclear and cytoplasmic lysates were incubated with immobilized GST or GST-ACTN4 (WT)

(lanes 1-6). Lanes 7-12, pulldown assays were performed with nuclear extracts expressing

HA-P65 and immobilized GST, GST-ACTN4 and its variants. Pulldown fractions were analyzed by Western blotting with anti-HA antibodies. The expressions of GST fusion proteins were visualized by coomassie blue staining. The asterisk marks contaminated bacterial proteins co-purified with GST proteins. B, The experiments were similar to that in A except HA-p50 expressed HeLa nuclear extracts were used for pulldown assays. C-E,

HPCs were treated with vehicle or TNFα for 1 h followed by ChIP assays with anti-p65 and anti-ACTN4 antibodies. Immunoprecipitated chromatin was analyzed by qPCR using the primers flanking p65-binding sites on IL-1β (C) and IL-8 (D) promoters. TNFα-induced association of p65 and ACTN4 with the promoters is shown as relative promoter occupancy.

E, HPCs stably expressing shCtrl or shACTN4 were used for ChIP assays as described in

C and D. The relative recruitment of ACTN4 to the IL-1β promoter was determined by normalizing the PCR products from shACTN4 cells to that of the shCtrl cells. Error bars indicate mean±S.D.

Figure 17. A model in which ACTN4 binds and co-activates NF-κB transactivation activity in the nucleus.

We propose that in the absence of TNFα, NF-κB transcription factor is sequestered by IκBα in the cytosol, thereby blocking ACTN4 from binding to NF-κB (left panel). However, knockdown of IκBα induces the association between ACTN4 and NF-κB in the cytosol

(center panel). In response to TNFα, NF-κB translocates into the nucleus, where it binds and recruits ACTN4 to its targeted promoters (right panel).

DISCUSSION

We and others have previously demonstrated that in addition to its role in the cytoplasm,

ACTN4 is capable of potentiating the activity of several transcription factors that include nuclear receptors such as the estrogen receptor, peroxisome proliferator-activated receptors, retinoic acid receptor and vitamin D receptor (126, 127, 310) and MEF2 (124, 309). These observations raise a mechanistically important question regarding ACTN4’s role in podocyte function and kidney disease: Is ACTN4’s known cytoplasmic actin-binding activity required for its ability to coactivate transcription factors?

We previously reported that ACTN4 is recruited to the promoter of estrogen receptor target gene, pS2 (126). When tethered to Gal4 DNA binding domain (DBD), Gal DBD-ACTN4 potently activates Gal4 reporter activity, likely through its interaction with transcriptional coactivators such as p160 coactivators and the histone acetyltransferases activity PCAF

(127). Our current study provides strong evidence demonstrating that 1) ACTN4 is essential for NF-κB-mediated transcriptional activation, 2) ACTN4 interacts wth p65 and p50 in the nucleus and is recruited to the promoters of NF-κB target genes, IL-1β and IL-

8, 3) loss of ACTN4 does not affect TNFα-induced nuclear translocation of p65, and 4) the spliced variant, ACTN4 (Iso), does not contain an intact actin-binding domain and is a more potent transcriptional coactivator than the full-length ACTN4. Moreover, although the FSGS-linked mutant K255E is capable of interacting with p65, it has significantly lost its ability to potentiate NF-κB reporter activity. We reason that because K255E is predominantly cytoplasmic (310), it is unable to potentiate the activity of transcription

74 factors in the nucleus. This is consistent with recent studies indicating that in response to myoblast differentiation signal, ACTN4 translocates into the nucleus and coactivates

MEF2 transcription activity and myogenic gene expression (309). In contrast to the hormone-dependent interaction between ACTN4 and nuclear receptors, this finding provides an alternative mechanism by which ACTN4 potentiates transcriptional activity.

A previous study has suggested a role of ACTN4 in activating NF-κB activity (318).

However, it was concluded that ACTN4 and NF-κB interact in the cytoplasm and it is unclear how cytoplasmic ACTN4 potentiates NF-κB activity. However, the current study and previous reports support the notion that although ACTN4 is found in the nucleus and cytoplasm, nuclear ACTN4 binds and potentiates transcription factor activity in the nucleus, independently of its cytoplasmic actin-binding activity.

We noted that while ACTN4 (Iso) binds p65 similarly to the wild-type protein, ACTN4

(Iso) has a more potent transactivation activity than the wild-type protein (Fig. 14D). This is consistent with our previous report that Gal-ACTN4 (Iso) has a higher transactivation activity than the wild-type protein, likely due to a better binding activity of ACTN4 (Iso) to p160 coactivators and the histone acetyltransferases activity PCAF than the ACTN4 (FL)

(127).

Several lines of evidence suggest that cytoplasmic IκBα masks and prevents ACTN4 from binding p65: 1) GST-ACTN4 pulls down nuclear, but not cytoplasmic p65 or p50, 2)

Endogenous ACTN4 only associates with p65 when IκBα was knocked down and 3) the interaction domain between ACTN4 and p65 overlapped the interaction domain between

IκBα and p65. In sum, these data indicate that a compartment-dependent interaction between ACTN4 and p65 regulated by signal-dependent nuclear translocation of p65 and p50 is indispensable for the activation of NF-κB activity (Fig. 17).

The glucocorticoid receptor is a member of the nuclear receptor family that regulates target gene expression through one of the several mechanisms that involve activation, repression, and transrepression (319). Glucocorticoid-mediated transrepression of NF-κB activity is a critical mechanism underlying its anti-inflammatory activity (320). In proteinuric kidney diseases, the glucocorticoids are a longstanding treatment strategy, although their exact mechanism of action is not fully understood. Although anti-inflammatory effects are likely involved, in vitro studies have suggested a direct beneficial effect on podocyte function

(269) including stabilizing podocyte actin filaments (267). Our data indicated that ACTN4 may play a role in Dex-mediated transrepression of NF-κB activity in a gene-specific manner. Further investigation is necessary to dissect the mechanism by which ACTN4 regulates GR-mediated transrepression of NF-κB target genes.

As an actin-binding protein that coordinates cytoskeletal dynamics of the foot processes in podocytes, ACTN4 mutations that alter its actin-binding activity are likely disrupting slit diaphragm and causing podocytes injury. However, while some FSGS-associated ACTN4 mutants acquire increased actin binding activity, other FSGS-associated ACTN4 mutants bind actin similarly to the wild-type protein (74). Importantly, the FSGS-linked ACTN4 mutant, K255E, not only acquires increased actin-biding activity but also exhibits predominantly cytoplasmic distribution (310) and accelerated turnover rate (119).

Furthermore, FSGS-linked ACTN4 mutants are defective in ligand-dependent interaction with nuclear receptors and decrease ligand-dependent activation of nuclear reporter activity.

In this study, we found that although K255E binds NF-κB in vitro, it fails to potentiate NF-

κB reporter activity, likely due to the nuclear exclusion of this mutant. Based on these observations, we hypothesize that ACTN4 (K255E) is both gain-of-function in acquiring increased actin-binding activity and loss-of-function in losing nuclear localization, reducing protein abundance and therefore is defective in transcriptional coactivation.

Interestingly, ACTN4 deficiency is also found in multiple human primary glomerulopathy including sporadic FSGS, minimal change disease, and IgA nephropathy (31, 116, 117,

321). Recent studies further indicated that the abundance of ACTN4 protein is significantly reduced in experimental glomerular diseases (322, 323). Indeed, Actn4 knockout mice do not survive the perinatal period and for the remaining mice that survive exhibit severe glomerular defects, podocyte injury, and proteinuria (118). Collectively, these observations suggest that expression levels of normal, not just mutant ACTN4, play an important role in many forms of glomerular diseases independent of a genetic alteration in F-actin binding.

Perturbed activation of NF-κB is implicated in various nephrotic diseases. Constitutive activation of NF-κB is associated with FSGS in HIVAN as well as Heymann nephritis

(PHN) and contributes to proteinuria (173). However, inhibition of NF-κB is thought to contribute to TGFβ-mediated apoptosis of murine podocytes (47) and down-regulation of

NF-κB is found in podocytes in c-MIP elevated idiopathic nephrotic syndrome (INS) (324).

A better elucidation of the role of the NF-κB, its target genes and regulation in podocytes will help understand the pathogenesis of podocytopathies. Our finding that ACTN4 is

77 essential for NF-κB-mediated transcriptional activation opens a new avenue for a future study involving anti-inflammatory treatment effects and podocyte function in FSGS.

CHAPTER 3: ACTN4 REGULATES GLUCOCORTICOID RECEPTOR-

MEDIATED TRANSACTIVATION AND TRANSREPRESSION IN PODOCYTES

ABSTRACT

Glucocorticoids (GCs) are a general class of steroids that possess renoprotective activity in glomeruli through their interaction with the glucocorticoid receptor. However, the mechanisms by which the GCs ameliorate proteinuria and glomerular disease are not well understood. In this study, we demonstrated that alpha actinin 4 (ACTN4), an actin- crosslinking protein known to coordinate cytoskeletal organization, interacts with the glucocorticoid receptor (GR) in the nucleus of human podocytes (HPCs), a key cell type in the glomerulus critical for kidney filtration function. The GR-ACTN4 complex enhances glucocorticoid response element (GRE)-driven reporter activity. Stable knockdown of

ACTN4 by shRNA in HPCs significantly reduces dexamethasone (Dex)-mediated induction of GR target genes and GRE-driven reporter activity without disrupting Dex- induced nuclear translocation of GR. Synonymous mutations or protein expression losses in ACTN4 are associated with kidney diseases including focal segmental glomerulosclerosis (FSGS) characterized by proteinuria and podocyte injury. We found that FSGS-linked ACTN4 mutants lose their ability to bind liganded GR and support GRE- mediated transcriptional activity. Mechanistically, GR and ACTN4 interact in the nucleus of HPCs. Furthermore, disruption of the LXXLL nuclear receptor interacting motif present in ACTN4 results in reduced GR interaction and Dex-mediated transactivation of a GRE reporter, while still maintaining its actin-binding activity. In contrast, an ACTN4 isoform,

ACTN4 (Iso), which losses its actin-binding domain, is still capable of potentiating a GRE

79 reporter. Dex induces the recruitment of ACTN4 and GR to putative GREs in Dex- transactivated promoters, SERPINE1, ANGPLT4, CCL20, and SAA1 as well as the NF-κB

(p65) binding sites on GR transrepressed promoters, such as IL-1β, IL-6 and IL-8. Taken together, our data establish ACTN4 as a transcriptional co-regulator that modulates both

Dex transactivated and transrepressed genes in podocytes.

INTRODUCTION

It has been a longstanding clinical practice to use ligands for nuclear hormone receptors

(NRs), including steroids, to treat kidney diseases, despite the lack of a clear understanding of their mechanisms of action in this tissue. Recent studies in multiple experimental models have begun to explore the direct and indirect effects of NRs in renal cells to better utilize

NR ligands as therapeutic agents for glomerular diseases such as minimal change disease

(MCD) and focal segmental glomerulosclerosis (FSGS) (325)(326). Glucocorticoids (GCs) as a general class of steroids possess renoprotective activity in glomeruli (284, 327–330), however, steroid-resistance and systemic toxicity remain major issues for their long-term use (328). This is, in part, due to a lack of understanding of the mechanism underlying transcriptional regulation by the glucocorticoid receptor (GRα) in podocytes, a key cell type in the glomerulus that forms the filtration barrier.

Glucocorticoids regulate a wide variety of physiological processes (200, 331). Both natural and synthetic GCs have shown to exert anti-inflammatory actions mediated by glucocorticoid receptor, a member of NR superfamily that function as transcription factors

80 and regulate gene expression in a cell type-specific and context-dependent manner (238,

332). In the absence of GCs, GR is sequestered by heat shock protein chaperons in the cytoplasm (333). When GCs are present, they bind to GR, allowing GR to dissociate from its chaperone proteins and translocate to the nucleus. Ligand-bound GR binds glucocorticoid response elements (GRE) or negative GREs and positively or negatively regulate target gene expression (334). Additionally, ligand-bound GR can repress transcription through interactions with other transcriptional regulators, such as NF-B, a mechanism termed transrepression. The synthetic GC, Dexamethasone (Dex), binds to GR and regulates its target gene expression in human podocytes (HPCs). Recent evidence showed that Dex target genes affect the morphological and cytoskeletal response of podocytes (269, 286, 335). Dex can also relieve the podocyte apoptosis induced by puromycin aminonucleoside-treatment (290) and down-regulate cytokines and vascular endothelial growth factor (VEGF) expression in podocytes (269). These transrepressive effects have been proposed to explain why GCs are effective for the treatment of nephrotic syndrome. However, more research needs to be done in order to elucidate the mechanism mediated by Dex, especially the potential side effects of Dex on podocytes.

The actinin (ACTN) family proteins contain four members that bind filamentous actin and maintain cytoskeletal architecture (101). Multiple mutations in ACTN4 have been linked to FSGS (73, 119). Additionally, ACTN4 deficiency is also found in multiple human primary glomerulopathies including sporadic FSGS, MCD and IgA nephropathy (111, 321).

However, the molecular mechanisms by which ACTN4 maintains podocytes homeostasis and its biochemical activities remain largely unknown.

Previously, we have shown that ACTN4 potentiates transcriptional activation by MEF2

(124, 309), NF-κB (336, 337), and NRs (126–128). The newly identified nuclear function of ACTN4, its link to FSGS and MCD and the beneficial effects of GCs on FSGS and

MCD prompted us to investigate the role of ACTN4 in GC-mediated transcriptional regulation in podocytes and the effects of FSGS-linked ACTN4 mutations on GR transactivation activity. Our data define the novel function of ACTN4 as a co-activator that regulates GR-mediated transactivation in human podocytes. Furthermore, our study reveals a unique feature of ACTN4 in GR-mediated transrepression.

MATERIALS AND METHODS

Plasmid construction: CMX-HA-ACTN4, GST-ACTN4 (WT), different ACTN4 mutations expression plasmids, as well as GST-ACTN4 deletion constructs were described previously. The expression plasmids CMX-HA-GR (Full length, 1-419 and 488-C terminus) were generated by PCR and subcloned into the CMX-1H vector (336). The GRE-Luc reporter plasmid was a gift from Dr. Ron Evans (The Salk Institute).

Antibodies and chemicals: The anti-ACTN4 and anti-HDAC7 antibodies have been described previously (336). For immunoprecipitation assays, anti-HA antibodies (Santa

Cruz Biotechnology Sc-805), anti-GR antibodies (sc-8992), anti-p65 antibodies (sc-372), anti-HSP90 (sc-69703), anti-Lamin B (sc-6216), and anti-α-tubulin (T-5168, Sigma-

Aldrich) were used. For immunostaining, anti-GR antibodies, anti-synaptopodin antibodies

82 were used and rhodamine phalloidin (Cytoskeleton, Inc #PHDR1) was used to detect actin.

The secondary antibodies for immunofluorescence were from Life Technologies (anti- mouse or anti-rabbit Alexa Fluor 488 or Alexa Fluor 594). Dexamethasone (D4902) was purchased from Sigma-Aldrich.

siRNA transfection: Human podocytes were subjected to siRNA transfection with either a non-targeting siRNA (siCtrl) or with siRNA against GR (GR-1(J003424-07)) or (GR-

1(J003424-09)) according to the manufacturer’s protocol (Dharmacon). Twenty-four hours after transfection, the medium was replaced with RPMI-1640 supplemented with

10%charcoal stripped fetal bovine serum, 50 units/ml penicillin G and 50 ug/ml streptomycin sulfate and ITS (Sigma). The next day, the cells were treated with or without

100 nM of dexamethasone.

Cell culture and differentiation: HEK293T and HeLa cells were grown in DMEM supplemented with 10% FBS and penicillin-streptomycin (50 units/ml) at 37 °C in 5% CO2.

Human immortalized podocytes (HPCs) were cultured in RPMI 1640 (Life Technologies) supplemented with 10% fetal bovine serum, penicillin-streptomycin (50 units/ml) and insulin-transferrin-selenite (Sigma). HPCs were grown at the permissive temperature of

33 °C and transferred to 37 °C to induce differentiation for 3 days prior to treatment. Cells were serum starved in RPMI 1640 supplemented with 2% fetal bovine serum, penicillin- streptomycin (50 units/ml), and insulin-transferrin-selenite.

Immunofluorescence microscopy: HPCs were fixed in 3.7% paraformaldehyde (PFA) in

PBS for 30 min at room temperature and permeabilized in PBS with the addition of 0.1%

Triton X-100 and 10% goat serum for 10 min. The cells were washed three times with PBS and incubated in a PBS-goat serum (10%) plus 0.1% Tween-20 solution (ABB) for 60 min.

Incubation with primary antibodies was carried out for 120 min in ABB. The cells were washed three times in 1x PBS, and the secondary antibodies were added for another hour in the dark at room temperature in ABB. DAPI was applied to the samples after the final wash to visualize cell nuclei. Images were visualized using a Leica epifluorescence microscope.

Generation of stable knockdown cells: The shACTN4 and shHDAC7 stable cells were previously described (336). Lentiviral vectors harboring shRNAs against human HSP90α

(TRCN0000008490, TRCN0000008493, and TRCN0000008494), were purchased from

Sigma-Aldrich. The packaging plasmids used were pMD2.G and psPAX2, which were kindly provided by Dr. Barbara Bedogni. The establishment of stable ACTN4 and HSP90α knockdown cells was performed as described previously (111). After cotransfection into the HEK293T packaging cell line with shRNA and packaging plasmids, the supernatants containing lentiviral particles were collected and used to infect HEK293T and HPC cell lines. Cells were stably infected with lentivirus and selected in puromycin-containing medium (1.5 μg/ml) for 2 days. Knockdown of ACTN4 and HSP90α was confirmed by

Western blots.

Preparation of mouse glomeruli: Glomeruli were isolated using the standard sieving protocol and protein extracts were prepared as previously described (336). Glomeruli from

20-week-old male C57BL/6 mice (n = 5) were pooled.

Subcellular Fractionation of HPCs: Isolation of nuclei and cytoplasm from HPCs and extraction of nuclear and cytosolic proteins were performed according to a published protocol (128). Nuclear and cytoplasmic fractions were separated on SDS-polyacrylamide gels and followed by Western blotting with the indicated antibodies. Lamin B and α-tubulin served as nuclear and cytoplasmic markers respectively.

In vitro protein-protein interaction assays: GST fusion proteins were expressed in E. coli

DH5α strain, affinity-purified, and immobilized on glutathione-Sepharose 4B beads.

Immobilized, purified GST and GST-ACTN4 fusion proteins were incubated with whole cell extracts expressing HA-GR followed by extensive washes as described (126). The pulldown fractions were subjected to Western blotting with HA antibodies. The immobilized

GST and GST fusion proteins were visualized by Coomassie Brilliant Blue staining.

Coimmunoprecipitation: HPCs were treated with DMSO or Dex (100 nM), harvested and whole cell lysates or nuclear extracts were prepared. Glomerular extracts were precleared with Protein-A beads (RepliGen). Immunoprecipitation and Western blotting assays were carried out following our published protocol (126).

Transient transfection reporter assays: HEK293T or HPCs cells stably expressing shRNA against human ACTN4 (shACTN4) or control shRNA (shCtrl) were cultured in 24-well plates. Cells were cotransfected with a GRE-driven luciferase reporter and a Renilla

Luciferase control reporter constructs using Lipofectamine 2000. To determine the effects of wild-type or mutant ACTN4 on GRE reporter activity, HEK293 cells were transiently transfected with the indicated ACTN4 expression plasmids. The cells were lysed in

Reporter Lysis 5X Buffer 12 h after dexamethasone treatment and 48 h after transfection

(Promega). The luciferases activity was determined using Dual-Luciferase AssayKit

(Promega). Luciferase activity was normalized with that of Renilla luciferase. Each transfection was performed in triplicate.

RNA isolation and qPCR: Total RNA was extracted using the RNeasy isolation kit (Qiagen) and reverse-transcribed using a reverse transcription kit (Bio-Rad) according to the manufacturer's instructions. iQ SYBR Green PCR supermix (Bio-Rad and Qiagen) and the

CFX96 real-time PCR detection system (Bio-Rad) were used to quantify cDNAs according to the manufacturer's instructions and 18S rRNA was used for normalization. The relative mRNA expression was calculated by the 2−(ΔΔCt) method. The PCR primers used in this study and their sequences were previously described (336).

Actin-binding assays: Actin Binding Protein spin-down assay Biochem Kits were obtained from Cytoskeleton and used following the manufacturer's instructions. Both wild-type and

LXXAA mutants GST-ACTN4 proteins were purified from E. coli. F-actin was polymerized and incubated with GST-ACTN4 proteins at room temperature. The mixture

86 was incubated on ice, then centrifuged at 150,000 × g for 1.5 h at 24 °C. Both the supernatants and the pellets were subjected to 8% SDS-PAGE followed by transfer to

PVDF membranes. Proteins were visualized by Coomassie Blue staining or Western blotting.

ChIP assays: ChIP assays were carried out as described (336). Immunoprecipitation was performed using anti-ACTN4 and anti-p65 antibodies. The primer sequences for ChIP assays for GRE are: SERPIN1, forward: CTAGGCTTTTTGGGTCACCCGGCATGG, reverse: CTAGGCTTTTTGGGTCACCCGGCATGG, CCL20, forward:

GTATGCTCAACATCCTGT, reverse: AGAGCTGCTTTACTCATT, ANGPTL4, forward: AGCTGTCTGCCCTGCAATGTACAAGTT, reverse:

AGGATTCCTGGAGCAGGGGTCCTAAGA, SAA1, forward:

ACTTCACACCTTCCAGCAGCCCAGGTG, reverse:

CTGCTGGTTTCTTGGGAGCGAAGAAAA. The primer sequences for ChIP assays for p65 and GR are: IL-1β (-6069 -> -5680): forward, GTGCTGTGTGAATTT, reverse,

TCCAGCAACAAAGCT, IL-1β (-351 -> -235): forward,

CTGTGTGTCTTCCACTTTGTCCC, reverse, TGCATTGTTTTCCTGACAATCG, IL-8

(-32 -> 277): forward, CTTGTTTACCACAAG, reverse: ACATGTTACTAGTAT, IL-8 (-

1381 -> -1200): forward, CTTGTTTACCACAAG, reverse, ACATGTTACTAGTAT, IL-

6 (-765 -> -410): forward: ATGGAGATGAATCAC, reverse, GTTTACTCTTAACTG,

IL-6 (-263 -> -107): forward, ATGGAGATGAATCAC, reverse, GTTTACTCTTAACTG.

Statistical Analysis: Data are expressed as the mean ±S.D. Analyses were performed with

Student’s t test using the GraphPad Prism6 software. A value of p < 0.05 was considered to be significant. p < 0.05, p < 0.01 and p < 0.001 are designated by *, ** and ***, respectively.

RESULTS

Expression of GRα in immortalized HPCs and primary mouse podocytes

We have previously demonstrated that ACTN4 can reside in both the nucleus and the cytoplasm (126). To begin to investigate the role of ACTN4 in GR-mediated transcriptional regulation in HPCs, we first examined the expression and subcellular distribution of GRα in immortalized human podocytes (HPCs) by immunofluorescence microscopy. In untreated HPCs, a large fraction of GRα is primarily localized in the cytoplasm. However, dexamethasone (Dex), a potent GRα agonist, induced nuclear translocation of GRα (Fig.

18).

Figure 18. The effect of Dex on nuclear translocation of GRα in podocytes.

HPCs were transfected with either siCtrl or siGRα. Forty-eight hours post-transfection, cells were treated with or without 100 nM of Dex for 2 days. The cells were cultured for a total of 5 days followed by immunostaining with anti-GRα or anti-synaptopodin antibodies and indirect fluorescence microscopy. This microscope was carried out by Dr. Simran

Khurana

ACTN4 potentiates and interacts with GRα in a ligand-dependent manner

We have previously demonstrated that ACTN4 is a transcriptional coactivator for several transcription factors including NRs (127). To test whether GR and ACTN4 interact in kidney cells, we carried out immunoprecipitation to examine whether endogenous GR and

ACTN4 interact in HEK293T cells. In the absence of a GR agonist, α-ACTN4 and GRα did not interact, however, with the addition of Dex, α-ACNT4 and GR co- immunoprecipitated (Fig. 19A). We also verified the association between ACTN4 and GR by GST pull-down assay (Fig. 19B). We then asked whether ACTN4 is also involved in

GR-mediated transcriptional regulation. Overexpression of ACTN4 potentiates GRE reporter activity in a dose-dependent manner (Fig. 19C). In cultured human podocytes (Fig.

19D) and isolated mouse glomeruli (Fig. 18E), we similarly demonstrated that endogenous

ACTN4 co-immunoprecipitated with GR. To further determine the role of ACTN4 in GR- mediated transcriptional activity, we carried out transient transfection reporter assay in

HPCs using a reporter construct harboring a glucocorticoid response element (GRE). We examined the role of ACTN4 in GR-mediated transcriptional regulation in a control HPC line and a previously established ACTN4 knockdown HPC cell line (shACTN4). We found that both the addition of Dex and exogenously expressed GR increased reporter activity and that knockdown of ACTN4 significantly reduced GR- and Dex-induced GRE activity

(Fig. 19F). Based on these results, we conclude that ACTN4 potentiates Dex-mediated

GRE-driven reporter activity through its interaction with GR.

ACTN4 was originally identified as an HDAC7-interacting protein (124). We therefore determined whether HDAC7 is required for ACTN4-meidated GR activity. Indeed, knockdown of HDAC7 decreased GRE-driven reporter activity, with or without Dex treatment (Fig. 19G). Furthermore, an ACTN4 mutant defective in interacting with

HDAC7 (124) also lost its ability to potentiate GRE-reporter activity (Fig. 19H). Based on these data, we conclude that HDAC7 regulates GR transactivation activity.

Figure 19. The effect of ACTN4 on GR-mediated transcriptional activation.

A, HEK293T cells were treated with (+) or without (-) Dexamethasone (Dex, 100nM) for

8 hr. Whole cell extracts were prepared and immunoprecipitated with anti-GR antibodies.

Proteins were detected by Western blotting (WB) using anti-ACTN4 and anti-GRα antibodies as indicated. B, HeLa cells were transfected with an HA-GRα expression

94 plasmid, lysates were prepared and incubated with immobilized, bacterially expressed

GST-ACTN4 fusion protein in the presence of Dex. Pull-down fractions were subjected to

Western blotting with HA-antibodies. C, HEK293T cells were cotransfected with a GRE- luciferase reporter plasmid and HA-ACTN4 expression plasmid. The cells were then treated with Dex for 12 h and luciferase activity was measured. D, HPC whole cell extracts were prepared and immunoprecipitated with anti-ACTN4 antibodies and anti-HA antibodies as a control. Proteins were detected by Western blotting using anti-ACTN4 and anti-GR (arrowhead) antibodies as indicated. E, Mouse glomerular extracts were prepared and immunoprecipitated with anti-GR or anti-HA antibodies followed by Western blotting with anti-ACTN4 or GR antibodies. F, ACTN4 was stably knocked down by short hairpin shRNAs in human podocytes (HPCs). A control shRNA (shCtrl) was used for comparison.

A GRE-luciferase reporter plasmid and an HA-GR expression plasmid were transfected into shCtrl and shACTN4 HPCs, treated with Veh or Dex for 12 h, and the reporter activity was analyzed. G, HDAC7 was stably knocked down by short hairpin shRNAs in human podocytes (HPCs). A control shRNA (shCtrl) was used for comparison. A GRE-luciferase reporter plasmid and an HA-GR expression plasmid were transfected into shCtrl and shHDAC7 HPCs, treated with Veh or Dex for 12 h, and the reporter activity was analyzed.

H, HPCs were transiently transfected with ACTN4 ACTN4 (FL, Δ831-869), ACTN4 (iso), or ACTN4 (iso, Δ441-479) and a GRE-Luciferase reporter plasmid, and treated with or without Dex, and reporter activity was measured. ***, P˂ 0.001; n.s., not significant.

Penal B was carried out by Dr. Simran Khurana.

Mapping of the interaction domains between ACTN4 and GR

To understand the molecular basis of the interaction between ACTN4 and GR, we mapped the interaction domains by GST pulldown assays with several ACTN4 constructs. ACTN4

(Iso) is a spliced isoform that is missing amino acids 89-478 of the full-length protein (124).

The C-terminal truncation mutant ACTN4 (Iso, 2-102), contains an intact LXXLL nuclear receptor interacting domain and part of CH1 (calponin homology 1) domain, whereas

ACTN4 (95-521) contains the remaining C-terminus of ACTN4 isoform that includes part of SR2 (Spectrin repeat), SR3, SR4, and the calmodulin-like domain (Fig 20A).

Immobilized, purified GST-ACTN4 full-length (288), ACTN4 (Iso), and truncated

ACTN4 (Iso) mutants were incubated with whole cell lysate expressing HA-GR followed by Western blotting with anti-HA antibodies. We found that the amino acids 2-102 are sufficient to bind GR. However, the C-terminus did not interact with GR. We further mapped ACTN4 interaction domain in GR (Fig 20B). The N-terminus (1-419) of GR contains the AF1 (transcription activation function-1) domain and interacts with ACTN4 in a Dex-independent manner. The C-terminus (488-777) contains the LBD and interacts poorly with ACTN4. However, this interaction is enhanced by Dex.

Figure 20. Mapping of ACTN4 and GR interacting domains.

A, Top panel: A schematic representation of ACTN4 functional domains, CH, calponin homology domain; SR, spectrin repeat, CaM, calmodulin; the nuclear receptor-interacting motif, LXXLL (amino acids 84-88); the C-terminal EF-hand calcium binding domains.

The FSGS-linked K255E, T259I, and S262P mutants are indicated. Bottom panel: HeLa cells were transfected with an HA-GR expression plasmid. Whole cell lysates were incubated with immobilized GST, GST-ACTN4, and its variants. GST-pulldown assays were performed as described for Fig.20B. Pulldown fractions were analyzed by Western blotting with anti-HA antibodies. The expressions of GST fusion proteins were visualized by commassie blue staining. B, Top panel: A schematic representation of GRα functional domains, NTD, N-terminal domain; DBD, DNA-binding domain; H, hinge domain; LBD, ligand-binding domain. Bottom panel: HeLa cells were transfected with HA-GR truncated mutants. Whole cell lysates were incubated with immobilized GST, GST-ACTN4. GST- pulldown assays were preformed as described.

The role of actin-binding in ACTN4-mediated transcriptional regulation of GRE reporter

We have previously identified an ACTN4 spliced isoform (called “Iso”), which is missing most of the actin-binding domain (127). We found that this isoform is still capable of potentiating GRE reporter activity (Fig. 21A) and capable of binding GR in vitro (Fig.

19A). The ability of NR co-activators to potentiate NR transcriptional activity depends on the NR interacting motif, LXXLL, which is commonly present in NR co-activators that include ACTN4, the histone acetyltransferases CBP/p300, PCAF and the p160 family coactivator members (126). An ACTN4 mutant (LXXAA) failed to potentiate GRα reporter activity (Fig. 21B) and was unable to interact with GR (Fig. 21C). However, this mutant was still capable of interacting and potentiating NF-κB transcriptional activity

(336). Furthermore, this mutant binds F-actin filaments, comparably to the wild-type protein (Fig. 21D). Collectively, these data indicate that the inability of ACTN4 (LXXAA) to potentiate NR transcriptional activity is independent of its actin binding activity and that the actin-binding domain is dispensable for potentiating GRE reporter activity.

100

Figure 21. The effect of ACTN4 LXXAA mutation on potentiating GR-mediated transcriptional activity.

A-B, Expression plasmids for ACTN4 (WT), ACTN4 (Iso) (A) or an ACTN4 mutant

(LXXAA) (B) were co-transfected with a GR expression plasmid and GRE-luciferase reporter plasmid in HEK293T cells, followed by treatment with Veh, Dex for 12 h, and the reporter activity was analyzed. C, HeLa cells were transfected with an HA-GR expression plasmid, lysates were prepared and incubated with bacterially expressed GST-ACTN4

(WT) or with GST-ACTN4 (LXXAA) fusion proteins in the absence or presence of Dex

(100 nM). Pull-down fractions were subjected to Western blotting with HA antibodies. D,

The LXXAA mutation does not affect ACTN4 F-actin filament binding activity.

Recombinant GST, GST-ACTN4 (WT) and GST-ACTN4 (LXXAA) were purified and subjected to F-actin co-sedimentation assays. S: soluble fraction, P: pellet fraction. Note the differences of GST-ACTN4 in the pellet fractions between lanes 2 and 4 and lanes 6 and 8 are similar. Panel A was carried out by Dr. Sharmistha Chakraborty

101

FSGS-linked ACTN4 mutants failed to activate transcription mediated by GR

We next determined whether the known FSGS-linked ACTN4 mutations, K255E, S258P, and T262I, affect the ability of ACTN4 to potentiate GR-mediated transactivation (Fig.

22A). We found that FSGS-linked ACTN4 mutants significantly reduced GRE reporter activity (lanes 3-5) and the reduction of GRE activities was also observed in GR overexpressing cells (lanes 8-10) (Fig. 22B). This would suggest the FSGS-linked mutations are functional. Additionally, FSGS-linked ACTN4 failed to bind GR as demonstrated by GST pull-down assays (lanes 3-5) (Fig. 22C). In sum, the above data would suggest that FSGS-linked ACTN4 mutants have functionally lost their ability to potentiate Dex-mediated transcriptional activation.

102

103

Figure 22. The effect of FSGS-linked ACTN4 on GR-mediated transcriptional activation.

A, A GRE-containing reporter construct was co-transfected with or without plasmids expressing GR and ACTN4 (WT) or FSGS-linked ACTN4 mutants along with β-gal as indicated. The cells were treated with or without 100 nM Dex overnight. Luciferase activity was measured and normalized to β-gal activity. The expression of GR, HA-ACTN4 wild- type and variants are shown. B, Lysates were incubated with immobilized bacterially expressed GST-ACTN4 (WT), GST-ACTN4 (FSGS-linked mutants) fusion proteins in the presence of the 100 nM Dex. Pull-down fractions were subjects to immunoblotting with anti-HA antibodies. **, P˂ 0.01; ***, P˂ 0.001. Penal B was carried out by Dr. Simran

Khurana.

104

Knockdown of ACTN4 has little or no effects on dexamethasone-mediated nuclear translocation of GR

Because both ACTN4 and GR localize in the nucleus and cytoplasm, our observation that loss of ACTN4 reduces GRE-mediated reporter activity raises the possibility that ACTN4 plays a role in Dex-induced nuclear translocation of GR. To test this possibility, we determined whether knockdown of ACTN4 affects Dex-induced nuclear translocation of

GR. Control and ACTN4 knockdown HPCs were treated with or without Dex followed by immunofluorescence microscopy and subcellular fractionation. Dex-induced endogenous

GR nuclear translocation in HPCs, which was confirmed by cell fractionation (Fig. 23A).

Subcellular fractionation of HPCs further indicated that knockdown of ACTN4 had little or no effect on Dex-induced nuclear translocation of GR (Fig. 23B). Additionally, immunofluorescence microscopy demonstrated that GR was capable of translocating to the nucleus in ACTN4 knockdown HPCs (Fig. 23C). Taken together, our data suggest that the loss of ACTN4 impairs Dex-mediated transactivation by GR, without affecting Dex- induced GR nuclear translocation.

105

106

Figure 23. The effect of ACTN4 knockdown on Dex-induced GR nuclear translocation in HPCs.

A, HPCs were treated with DMSO or Dex (100 nM) for 4 h followed by subcellular fractionation and Western blotting with the indicated antibodies. B, Control (shCtrl) and

ACTN4 knockdown HPCs (shACTN4) were treated and analyzed as in A. Only the nuclear fraction is shown. C, Control (shCtrl) and ACTN4 knockdown (shACTN4) HPCs were treated with or without Dex (100 nM) for 1 h followed by immunostaining with the indicated antibodies and visualized by fluorescence microscopy.

107

ACTN4 and GR interact exclusively in the nucleus of HPCs

To further investigate the mechanism underlying ACTN4-mediated activation of GR, we determined in which cellular compartment the GR: ACTN4 interaction takes place. We addressed this issue by performing coimmunoprecipitation with nuclear or cytoplasmic extracts prepared from HPCs (Fig. 24A). We demonstrated that endogenous ACTN4 and

GR interact in the nucleus, but not the cytoplasm. We further demonstrated that immobilized, purified GST-ACTN4 was capable of pulling down nuclear HA-GR in vitro

(Fig. 24B). In contrast, no interaction was observed when cytoplasmic extracts were used for pull-down assay. Thus, we conclude that endogenous ACTN4 and GR interact in the nucleus, but not in the cytoplasm. The current model for the mechanism of GR activation proposes that cytoplasmic GR is sequestered by HSP70/HSP90 (338). To investigate the role of HSP90 on GR translocation in HPCs, we carried out cell fractionation to examine the endogenous GR localization following knockdown of HSP90. Interestingly, the abundance of cytoplasmic GR in HSP90 knockdown HPCs was also reduced (Fig. 25A).

We also carried out endogenous immunoprecipitation to examine the interaction between

GR and ACTN4. We found that knockdown of HSP90 enhanced the association between cytoplasmic GR and ACTN4 (Fig. 25B).

108

Figure 24. The interaction between ACTN4 and GR only occurred in the nucleus in

HPCs.

A, HPCs were treated with 100nM Dex for 4 h, and nuclear and cytoplasmic fractions were prepared. Coimmunoprecipitation was carried out using anti-GR antibodies followed by

Western blotting with indicated antibodies. B, HeLa cells were transiently transfected with an HA-GR expression plasmid. Nuclear (N) and Cytoplasmic (C) lysates were incubated with immobilized GST or GST-ACTN4. Lanes 1-3, pull-down assays were performed with nuclear extracts expressing HA-GR and lanes 4-6 with cytoplasmic extracts. Pull-down fractions were analyzed by Western blotting with anti-HA antibodies. The expressions of

GST fusion proteins were visualized by commassie blue staining.

109

Figure 25. The effect of knocking down HSP90 on the association between ACTN4 and GRα.

Knockdown of HSP90 enhances the association of cytoplasmic GR and ACTN4. A, HSP90 was stably knocked down by shRNAs in HPCs. Nuclear and cytoplasmic GR and HSP90 were detected by Western blotting with the indicated antibodies. S.E., shorter exposure;

L.S., longer exposure. B, Control (shCtrl) and HSP90 knockdown (shHSP90) HPCs were grown, harvested and nuclear and cytoplasmic extracts prepared. Cytoplasmic extracts were used for immunoprecipitation with anti-GR antibodies and the immunoprecipitates were subjected to Western blotting with the indicated antibodies, arrowhead indicates

ACTN4 band.

110

ACTN4 is recruited to the promoters of GR-transactivated genes

We have previously carried out microarray gene expression studies in HPCs and identified several Dex target genes (286). We further validated several Dex target genes by qRT-PCR.

Taking advantage of the ENCODE database, we found that the Dex inducible genes,

SERPINE1 (Serpin Family E Member 1), ANGPTL4 (Angiopoietin-like 4), CCL20

((chemokine (C-C motif) ligand 20) and SAA1 (Serum Amyloid A1) promoters contain one putative GR binding site (Fig. 26A). These GR binding sites are next to a histone

H3K27acetyl mark, which is often found in active regulatory elements. We next asked whether Dex promotes the recruitment of GR to these putative GR target sites using chromatin immunoprecipitation (ChIP) assays. Our data indicated that in response to Dex, both GR and ACTN4 recruitment was increased on the putative GR binding sites in the promoters of SERPINE1 (Fig. 26B), ANGPTL4 (Fig. 26C), CCL20 (Fig. 25D) and SAA1

(Fig. 26E).

To determine the role of ACTN4 in mediating transactivation of these GR target genes, control and ACTN4 knockdown HPCs were treated with or without Dex and their mRNA expression was assessed by RT-PCR. We found that knocking down ACTN4 significantly decreased mRNA levels of SERPINE1, ANGPTL4 and DCN (Fig. 26F). However, SAA1 and CCL20 expression were slightly increased in ACTN4 knockdown HPCs. These results indicated that GR transactivated genes are not all co-activated by ACTN4. In the absence of Dex, loss of ACTN4 reduced the association of ACTN4 with the promoters of SERPINE1,

ANGPTL4, SAA1 and CCL20 without significantly affecting GR occupancy on these

111 promoters (Fig. 26G-J). Interestingly, in the presence of Dex, however, loss of ACTN4 reduced both the recruitment of ACTN4 and GR to GR binding sites. This observation suggests that GR binding to these promoters may partly depend on ACTN4 in Dex-treated

HPCs.

112

113

114

115

Figure 26. The recruitment of ACTN4 and GR with GR transactivated promoters in

HPCs.

A, Diagrams of mapped GREs and PCR primer sets in GR transactivated genes. B-E, HPCs were treated with vehicle or Dex for 4 hr followed by ChIP assays with anti-ACTN4 and anti-GR antibodies. Immunoprecipitated chromatin was analyzed by qPCR using the primers flanking the mapped putative GR-binding sites (ENCODE) on the indicated promoters. F, Control, and ACTN4 knockdown HPCs were treated with vehicle or Dex for

8 hr prior to harvest. Total RNA was prepared and quantitative RT-PCR analysis was conducted using gene-specific primers. G-J, HPCs stably expressing shCtrl or shACTN4 were treated with vehicle or Dex for 4 hr prior to harvest. The relative recruitment of

ACTN4 and GR to SERPINE1 (G), ANGPTL4 (H), CCL20 (I) and SAA1 (J) promoters were determined by normalizing the PCR products from shACTN4 cells to that of shCtrl cells.

116

ACTN4 plays a role in GR-transrepressed genes in a promoter context-dependent manner

It has been experimentally established that transrepression accounts for the majority of the anti-inflammatory properties of GCs. We have previously demonstrated that Dex treatment represses the expression of NF-κB target genes, such as IL-1β, IL-6, and IL-8 in HPCs. The current transrepression model suggests that Dex induces the association of GR with NF-

κB and histone deacetylases (HDACs) to transrepress NF-κB target genes (336). The

ENCODE database indicates that there is one NF-κB binding site (NRE) present in the promoters of IL-1β and IL-6, but none in the IL-8 promoter (Fig. 27A, light grey color squares), although we have previously mapped NF-κB sites in IL-1β, IL-6 and IL-8 promoters, according to a published database (339)(Fig. 27A, dark grey color squares).

Additionally, a putative GR site (GRE) was mapped. With this information, we carried out

ChIP assays and examined the association of ACTN4, GR and NF-κB on these NF-κB inducible promoters in response to Dex treatment. Our data indicated that Dex promotes the recruitment of GR to NF-κB sites to both putative NF-κB binding sites in the promoter of IL-1β (Fig. 27B). Similarly, Dex promotes the recruitment of GR to both NF-κB binding sites on the IL-6 promoter (Fig. 27C), although to a lesser extent. Furthermore, Dex promotes the recruitment of GR to the GRE on IL-8 promoter as mapped by the ENCODE project (Fig. 27D). However, Dex had no or very little effect on GR recruitment to the previously mapped NRE in the IL-8 promoter (Fig. 27D, right panel). Increased association of ACTN4 with the NF-κB sites was also detected in all but this site. Indeed, Dex treatment reduced the association of ACTN4 with the GRE in the IL-8 promoter (~ 50%) (Fig. 27D,

117 left panel). Lastly, while Dex treatment did not affect the association of p65 with the

ENCODE mapped NRE or GR binding sites (GRE). In fact, Dex treatment resulted in reduced association of p65 with previously mapped NREs in IL-1β, IL-6, and IL-8 promoters.

Knockdown of ACTN4 reduced expression of IL-1β, IL-6, IL-8 and MCP-1 in HPCs in the absence of Dex (Fig. 27E). ACTN4 knockdown further reduced Dex-mediated repression of IL-6 and MCP-1 but had no effect on IL-8 expression (lanes 9 and 10). Interestingly,

ACTN4 knockdown HPCs resulted in reduced association of GR and p65 with the NF-κB sites (NRE, dark gray square in Fig. 27A) on the IL-1β, IL-6 and IL-8 promoters (Fig. 27F-

G). In the absence of Dex, knockdown of ACTN4 reduced the expression of NF-κB target genes, though to varying degrees. This is consistent with our previous findings that ACTN4 is an NF-κB co-activator (336). Furthermore, loss of ACTN4 also reduced the association of GR with the NF-κB sites on IL-1β, IL-6, and IL-8 promoters (Fig. 27F-G, lane 3) and significantly blocked the recruitment of p65 (> 90%) to the IL-8 promoter (Fig. 26H, lane

2). Thus, the reduced expression of IL-8 in ACTN4 KD HPCs could potentially be due to the loss of p65 binding on this promoter. However, while knockdown of ACTN4 reduced the recruitment of p65 (> 90%) to the putative GRE site of the IL-8 promoter (Fig. 27H, lane5), only a 60% decrease in IL-8 mRNA levels was observed. These results suggest that other transcription factors also play a role in controlling IL-8 expression. Unlike the IL-8 promoter, much more potent Dex-mediated transrepression activity was observed in IL-1β expression and this correlated with significant recruitment of GR to both NREs in the IL-

1β promoter (Fig 27B).

118

119

120

121

Figure 27. The effects of Dex on the recruitment of GR, ACTN4, and p65 to NF-κB targeted promoters.

A, Diagrams of mapped NF-κB response elements (NRE) or putative GRE and PCR primer sets. Dark gray squares indicate p65 or GR binding sites on NF-κB inducible genes. Light gray squares indicate NF-κB sites described in our previous paper. B-D, HPCs were treated with vehicle or Dex for 4 h followed by ChIP assays with anti-ACTN4, anti-GR and anti- p65 antibodies. Immunoprecipitated chromatin was analyzed by qPCR using the primers

(small arrows) flanking the putative p65-binding sites in the promoters of IL-1β, IL-6, and

IL-8. E, Control and ACTN4 knockdown HPCs were treated with vehicle or Dex for 8 h prior to harvest. Total RNA was extracted and quantitative RT-PCR analysis was conducted using gene-specific primers. F-H, HPCs stably expressing shCtrl or shACTN4 were treated with vehicle or Dex for 4 h prior to harvest. The relative recruitment of

ACTN4, GR, and p65 to the promoters of IL-1β, IL-6 and IL-8 was determined by normalizing the PCR products from shACTN4 cells to that of shCtrl cells.

122

Figure 28. A model depicting the mechanism by which ACTN4 regulates Dex- and

TNFα-mediated transcriptional regulation in HPCs.

123

DISCUSSION

Our observations suggest a regulatory mechanism of ligand-induced nuclear translocation of GR and Dex-mediated transcriptional regulation that is similar to that previously described in other tissues. First, Dex induces dissociation of cytoplasmic GR from HSP90, thus promoting nuclear translocation of GR in HPCs. Furthermore, Dex possesses both transactivation and transrepression activity of GR target genes in HPCs (Fig. 28).

The observations that both GR and ACTN4 localize in both the nucleus and cytoplasm raised several intriguing questions: 1) in which subcellular compartments do GR and

ACTN4 interact 2) does ACTN4 modulate ligand-dependent nuclear translocation of GR, and 3) does the actin-binding activity of ACTN4 play a role in regulating GR transcription activity? Our results indicated that GR and ACTN4 only interact in the nucleus. This is in part due to sequestering of GR by HSP90 and Dex-inducible nuclear translocation of GR.

Thus, loss of ACTN4 had little effect on Dex-induced nuclear translocation of GR.

Furthermore, we found that the actin binding-deficient ACTN4 isoform, ACTN4 (Iso), still potently activates GR transcriptional activity and that the ACTN4 mutant, LXXLL, though is capable of binding actin filaments, failed to activate a GRE-driven reporter. Based on these observations, we conclude that the ability of ACTN4 to co-activate GR transcription activity is independent of its actin-binding activity.

Dex induces the expression of GR target genes through positive GREs or composite binding motifs (340). We have previously demonstrated that Dex induces the expression

124 of SERPINE1, ANGPLT4, CCL20 and SAA1 in HPCs (286). In this report, we showed that

Dex promotes the recruitment of GR to the promoters of these Dex transactivated genes.

Furthermore, knockdown of ACTN4 blocked Dex-induced expression of SERPINE1,

ANGPTL4, SAA1 and slightly increased CCL20 mRNA (Fig. 26). ChIP assays validated the enhanced recruitment of ACTN4 to these GR targeted regions in response to Dex, consistent with the observation that Dex enhances the association of ACTN4 with GR.

However, loss of ACTN4 did not significantly reduce the association of GR with its targeted promoters, indicating that the recruitment of GR to these promoters does not rely on the association of ACTN4 with these promoters. Together, these data support a model in which

Dex-bound GRα recruits ACTN4 to GRα targeted promoters to potentiate transcription.

While commonly used for its ability to suppress inflammation, Dex also solicits unwanted side effects (341). SERPINE1 encodes plasminogen activator inhibitor-1 (PAI-1) that is present in trace amounts in healthy kidneys but is increased in a wide variety of both acute and chronic diseased kidneys. Reduced PAI-1 activity has been shown to be protective for the development of albuminuria and glomerulosclerosis in experimental diabetes (287).

Moreover, CCL20 is up-regulated in patients with progressive IgA nephropathy (288).

Podocyte-specific overexpression of ANGPTL4 mediates proteinuria in glucocorticoid- sensitive nephrotic syndrome in animal models (256). Thus, it is possible that the ability of Dex to induce SERPINE1, ANGPTL4 and CCL20 expression accounts for some of its adverse effects. SAA1 is induced by Dex in other tissues (342) and its expression is associated with kidney diseases (343). However, although SAA1-containing amyloid

125 fibers interfere with kidney filtration leading to kidney failure, the exact function of SAA1 in kidney remains largely unknown.

It has been well-established that the beneficial anti-inflammatory effect of glucocorticoids is through the suppression of transcription factors including the NF-κB family of transcription factors. The observation that ACTN4 potentiates both NF-κB (336) and GR transactivation activity prompted us to investigate the role of ACTN4 in Dex-mediated transrepression activity. Indeed, Dex enhanced the recruitment of GR to NF-κB binding sites in the promoters for IL-1β and IL-6. Only the IL-8 promoter was an exception (Fig.

25). Interestingly, Dex also promoted the recruitment of ACTN4 to NF-κB target sites on the IL-1β and IL-6 promoters but reduced the recruitment of GR (50%) to the GRE on the

IL-8 promoter. Neither Dex-mediated transrepression of IL-1β nor IL-6 required ACTN4 as knockdown of ACTN4 had little effect on the ability of Dex to repress IL-1β or IL-6. In contrast, loss of ACTN4 dramatically reduces Dex-mediated transrepression of IL-8 expression. These observations suggest Dex-mediated transrepression is promoter- dependent.

In the absence of Dex, knockdown of ACTN4 reduced the expression of NF-κB target genes, though to varying degrees. This is a reminiscence of our previous findings that ACTN4 is a NF-κB co-activato. Furthermore, loss of ACTN4 also reduced the association of GR with the NF-κB sites on the IL-1β, IL-6, and IL-8 promoters and significantly blocked the recruitment of p65 (> 90%) to the IL-8 promoter. Thus, the reduced expression of IL-8 in

ACTN4 KD HPCs could be due to loss of p65 binding to its promoter. However, while

126 knockdown of ACTN4 reduced the recruitment of p65 (> 90%) to -32 -> 277 of the IL-8 promoter, only a 60% decrease in the IL-8 mRNA level was observed. These data suggest that other transcription factors also play an important role to control IL-8 expression.

Unlike the IL-8 promoter, a much more potent Dex-mediated transrepression activity was observed in IL-1β expression and this correlates with significant recruitment of GR to both

NREs in the IL-1β promoter.

The mechanism underlying the pathogenesis of ACTN4-linked FSGS is not fully understood but is likely complex. Work by others has described cytoplasmic roles of

ACTN4 mutants and cytoskeletal anomalies, and we have characterized an additional role involving transcriptional disturbances from its interaction with NRs. Thus, the FSGS- linked ACTN4 mutations may have both gain-of-function (enhanced actin-binding activity) and loss-of-function mutations (decreased transcription activity). Our continued work to characterize the NR-associated transcriptional loss-of-function activity is important considering the first line treatment for FSGS are glucocorticoids. Future investigations to understand the pathogenesis of ACTN4-linked glomerulopathies and the possible renoprotective functions of glucocorticoid treatment could lead to better treatment options for FSGS patients.

127

CHAPTER 4: CHARACTERIZE THE NOVEL FAMILIAL FOCAL SEGMENTAL

GLOMERULOSCLEROSIS-LINKED ACTN4 PROTEIN MUTATIONS

ABSTRACT

The biological function of ACTN4 in podocytes is complex and likely involves its abilities to organize cytoskeletal architect and regulate transcription. Multiple mutations in the

ACTN4 gene have been linked to autosomal dominant familial focal segmental glomerulosclerosis (FSGS). Using the data obtained from the Nephrotic Syndrome Study

Network (NEPTUNE), 3 novel ACTN4 mutations were identified in patients with nephrotic syndrome. We performed in vitro and cellular assays to characterize these novel

ACTN4 variants. We generated vectors expressing disease-linked ACTN4 mutations by site-direct mutagenesis. We transiently expressed ACTN4 mutants in our established

ACTN4 shRNA knockdown HPCs. Our preliminary data indicate that newly identified disease-associated ACTN4 mutations have a role in cytoskeletal organization by using F- actin filament sedimentation assays. The role of these ACTN4 mutations in transcriptional regulation has also been shown by protein-protein interaction assays. Furthermore, we determined the biochemical properties of ACTN4 mutants by examining their subcellular distribution and protein stability.

128

INTRODUCTION

The Nephrotic Syndrome Study Network (NEPTUNE) is a collaborative consortium that aims to develop a translational research framework for nephrotic syndrome (NS). NS is a general term for a wide array of kidney diseaes. The NEPTUNE study enrolls adults and children with NS that include MCD, FSGS, and membranous nephropathy, which themselves are heterogenous conditions (344). Large-scale multidimensional molecular, clinical data sets and samples were collected from the patients. A standard morphological analysis was designed to score patients’ renal biopsies and classify cohorts. An important mission for the NEPTUNE study is facilitating the identification of disease mechanisms, specific biomarkers and potential therapeutic targets through data sharing and providing patient samples. The NEPTUNE develops: 1) Nephrotic Variant Server, a catalogue of genetic variation for NEPTUNE patients, and 2) a web-based platform, NEPTUNE tranSMART, which provides investigators with clinical, biospecimen, and biomarker data.

Samples from each subject undergoes whole genome sequencing, exome chip genotyping, and glomerular (GLOM) and tubulointerstitial (TI) specific intrarenal whole-transcriptome data. Through the evaluation of molecular and clinical data derived directly from patients with NS, NEPTUNE provides unmatched resources to understand the mechanisms and pathways involved in NS. A significant innovation of NEPTUNE is integrating data sets across the genome-phenome continuum (including genomic sequencing, exon sequencing, whole genome kidney transcriptomes, quantitative histology, rigorous clinical phenotypes and clinical outcomes) to study genetic mutations-associated kidney diseases with humans as the experimental model (345).

129

Using exon sequencing data of ACTN4 in 311 subjects from the NEPTUNE database, our collaborators have identified 4 subjects with rare, putatively causal ACTN4 mutations.

These novel ACTN4 mutations encode mutant proteins G29S, P179L, and A830V. G29S and A830V are rare and present only once in the 311 subjects, whereas P179L is present in 2 subjects. No mutations in other genes associated with familial FSGS, such as CD2AP,

TRPC6, INF2, or NPHS2 were found in these subjects, nor were risk variants in APOL1.

The A830V variant was found in a patient with MCD. The P179L variant was identified from 2 patients with FSGS or membranoproliferative glomerulonephritis (MPGN)-like phenotype, while the patient carrying G29S was likely with MPGN.

A second class of FSGS-associated ACTN4 variants includes ACTN4 protein-altering variants that may contribute to NS, but are incompletely penetrant. For example, there are

11 subjects in NEPTUNE with the R310Q mutation that has been previously described (72,

74, 117). This group includes subjects with membranous nephropathy (MN), FSGS, and

MCD. Patients with these mutations often do not achieve complete remission with available therapies. This ACTN4 variant is found twice as frequently in nephrotic patients as in the control population. In this study, we characterized the biochemical properties of these newly identified disease-associated ACTN4 mutations using in vitro assays and various cell-based studies.

130

MATERIALS AND METHODS

Plasmid construction: CMX-HA-ACTN4, GST-ACTN4 (WT), CMX-HA-GR and the

CMX-HA-p65 were described previously (336, 346). The expression plasmids of different

ACTN4 mutant expression plasmids were generated by PCR using CMX-HA-ACTN4 or

GST-ACTN4 (WT) as templates.

Antibodies and chemicals: The anti-α-tubulin (T-5168, Sigma-Aldrich) and anti-HA antibodies (Santa Cruz Biotechnology Sc-805) were used. For immunostaining, anti-HA antibodies and rhodamine phalloidin (Cytoskeleton, Inc #PHDR1) was used to detect actin.

The secondary antibodies for immunofluorescence were purchased from Life Technologies

(anti-mouse or anti-rabbit Alexa Fluor 488 or Alexa Fluor 594). Dexamethasone (D4902) was purchased from Sigma-Aldrich.

Cell culture and differentiation: HEK293T and HeLa cells were grown in DMEM supplemented with 10% FBS and penicillin-streptomycin (50 units/ml) at 37 °C in 5% CO2.

Immortalized human podocytes (HPCs) were cultured in RPMI 1640 (Life Technologies) supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin (50 units/ml) and insulin-transferrin-selenite (Sigma). HPCs were grown at the permissive temperature of 33 °C and transferred to 37 °C to induce differentiation for 3 days prior to treatment.

Cells were serum starved in RPMI 1640 supplemented with 2% FBS, penicillin- streptomycin (50 units/ml), and insulin-transferrin-selenite.

131

Protein stability assay: ACTN4 stable knockdown HPCs cell lines were transfected with wild-type or mutant HA-ACTN4 expression plasmids. Cells were treated with 20 μg/ml cycloheximide (CHX) for 0, 2, 4, and 8h. After treatment, whole cell extarcts were prepared, and Western blotting analyses were performed with the anti-HA and β-actin antibodies.

Quantification of ACTN4 intensities were quantified the band intensities using densitometry.

Actin-binding assays: Actin binding protein spin-down assay Biochem Kits were obtained from Cytoskeleton (Cat. # BK001) and actin-binding assays were carried out following the manufacturer's instructions. Wild-type and mutant GST-ACTN4 proteins were purified from E. coli. F-actin was polymerized and incubated with GST-ACTN4 proteins at room temperature. The mixture was incubated on ice, then centrifuged at 150,000 × g for 1.5 h at 24 °C. Both the supernatants and the pellets were subjected to 8% SDS-PAGE followed by transfer to PVDF membranes. Proteins were visualized by Coomassie Blue staining or

Western blotting.

Immunofluorescence microscopy: Transfected HPCs were fixed in 3.7% paraformaldehyde (PFA) in 1X PBS for 30 min at room temperature and permeabilized in

1X PBS with the addition of 0.1% Triton X-100 and 10% goat serum for 10 min. The cells were washed three times with 1X PBS and incubated in a 1X PBS-goat serum (10%) plus

0.1% Tween-20 solution (ABB) for 60 min. Incubation with primary antibodies was carried out for 120 min in ABB. The cells were washed three times in 1x PBS, and the secondary antibodies were added for another hour in the dark at room temperature in ABB. DAPI was

132 applied to the samples after the final wash to visualize cell nuclei. Images were visualized using a Leica epifluorescence microscope.

In vitro protein-protein interaction assays: GST-ACTN4 fusion proteins were expressed in

E. coli DH5α strain, affinity-purified, and immobilized on glutathione-sepharose 4B beads.

Immobilized, purified GST and GST-ACTN4 fusion proteins were incubated with whole cell extracts expressing HA-GR or HA-p65 followed by extensive washes as described

(336). The pull-down fractions were subjected to Western blotting with HA antibodies.

The immobilized GST and GST fusion proteins were visualized by Coomassie Brilliant

Blue staining.

133

RESULTS

Characterization of FSGS-linked ACTN4 mutant protein stability

The FSGS-linked ACTN4 (K255E) mutant exhibits rapid degradation when compared with wild-type protein. I performed a transient transfection with wild-type or disease-linked

ACTN4 mutant expression plasmids in the ACTN4 knockdown HPCs. Protein synthesis was blocked by CHX treatment followed by the measurement of their half-lives with

Western blotting. The G29S and P179L mutations are localized in the N-terminus of

ACTN4. We observed that these two mutations resulted in an increased degradation of the protein (Figure 29). By contrast the R310Q and A830V mutations are localized in the SR1 domain and the C-terminus, respectively. The stability assays indicated that these two

ACTN4 mutants had increased protein stability compared to wild-type.

134

135

Figure 29. Characterization of wild-type and disease-associated ACTN4 protein stability.

HA-ACTN4 (WT) (A) and disease-associated mutants (B-E) were transiently transfected in HPCs. Cells were treated with CHX, harvested at the indicated time points and whole cell extracts prepared. Western blot analyses were performed and probed with HA and β- actin antibodies. The differences of HA-ACTN4 WT and mutant protein decay were quantitatively analyzed by using densitometry.

136

The effect of ACTN4 mutations on F-actin-binding affinity

The FSGS-causing ACTN4 (K255E) mutant increases its binding affinity to the filamentous actin (F-actin), suggesting this mutation changes the biophysical properties of the podocyte. Thus, we performed F-actin binding assays to determine if these newly identified disease-linked ACTN4 mutants alter their F-actin binding activity (Figure 30).

We found the F-actin-binding activity of the mutants, G29S and P179L, were increased compared with that of the wild-type protein. Consistent with published results, we observed slightly decreased actin-binding activity for the R310Q mutant. However, the C-terminal

A830V mutant did not exhibit altered actin-binding activity. Together, our data suggested that the mutations in or close to the ABD of ACTN4 altered their actin-binding property.

137

Figure 30. The F-actin filaments binding affinity of disease-linked ACTN4 mutations.

The disease-linked mutations affect ACTN4 F-actin-binding activity. Recombinant GST-

ACTN4 (WT), and GST-ACTN4 mutants were purified and subjected to F-actin co- sedimentation assays. S, soluble fraction; P, pellet fraction. Samples were separated on a

10% SDS-gel and stained with Coomassie blue. The differences of GST-ACTN4 in the soluble or pellet fractions were quantitatively analyzed. The soluble fractions are setting as

1, the pellet fractions of GST-ACTN4 are compared to soluble fraction. The first two lanes are the positive control, and the second two lanes are negative control. BSA, actinin,

Arrows indicate the position of the ACTN4, actinin, BSA and actin.

138

The localization of transfected disease-associated ACTN4 mutants in podocytes

ACTN4 is highly expressed in podocytes, with lower expression elsewhere in the kidney.

By immunofluorescence staining, it was found that ACTN4 WT protein is predominantly localized in the cytoskeleton. ACTN4 is also found in the nucleus of certain cell types and is capable of translocating to the nucleus in response to extracellular stimuli. We have previously shown that ACTN4 is localized in the nucleus and cytoplasm (Figure 31). To determine the cellular distribution of the newly identified disease-associated ACTN4 mutants, we performed immunofluorescence microscopy in HPCs. We found that ACTN4

G29S and R310Q localize similarly as the wild-type protein. Interestingly, we observed that the mutant P179L showed an altered distribution with enriched staining in the nucleus.

Additionally, the A830V variant is predominantly localized in the cytoplasm, similar to that of the K255E mutant.

139

140

Figure 31. Subcellular distribution of the newly identified disease-associated ACTN4 mutants.

Immunofluorescent microscopy was used to determine the localization of transfected wild- type and mutant ACTN4 in HPCs. ACTN4 KD HPCs were transiently transfected with

HA-ACTN4 wild-type or disease-linked mutations plasmid, followed by immunostaining with the indicated antibodies and visualization by fluorescence microscopy.

141

The effect of ACTN4 mutants on their interactions with either p65 and GRα

In our previous studies, we have demonstrated that ACTN4 functions as a transcription coactivator that potentiates the activity by nuclear hormone receptors and NF-κB transcription factors. We reported that ACTN4 interacts with p65 and GR. We also showed that the FSGS-linked ACTN4 mutant, K255E, is defective in interacting with GR. However, the K255E mutant exhibits a normal interaction with p65. Thus, we performed protein- protein interaction assay to further determine any effects of the novel ACTN4 variants on their interactions with p65 (Figure 32A) and GR (Figure 32B). We observed that the interaction between p65 and ACTN4 variants, G29S and P179L, were slightly increased, and the interaction between GR and ACTN4 mutations, R310Q and A830V, were slightly decreased. It is not clear whether these modest changes in interactions with p65 and GR affect their ability to potentiate p65- and GR-mediated transcriptional activation.

142

Figure 32. Associations of disease-linked ACTN4 mutants with p65 and GRα.

HeLa cells were transfected with HA-p65 or HA-GRα expression plasmids, and lysates were prepared followed by incubating with immobilized bacterially expressed GST, GST-

ACTN4 wild-type or disease-linked mutants fusion proteins. Pulldown fractions were subjected to Western blotting with HA antibodies. The ratio of pulldown HA-p65 (A) and

HA-GRα (B) to GST-fusion protein for WT was set as 1. The expressions of GST or GST-

ACTN4 proteins were visualized by coomassie blue staining. The arrows indicated the position of the GST-ACTN4 and GST protein.

143

DISCUSSION

Our collaborator, Dr. Matthew Sampson, has identified 3 novel ACTN4 mutations, G29S,

P179L and A830V, which are linked to glomerulopathies as well as an ACTN4 mutation,

R310Q, that may contribute to nephrotic syndrome, but is incompletely penetrant, in subjects from the Nephrotic syndrome study network (Table 2). In this study, we characterized the biochemical properties of these newly identified disease-associated

ACTN4 mutant proteins by determining the effects on their protein stability, subcellular distribution and their interactions with p65 and GR.

Table 2. A summary of biochemical properties of selectvie ACTN4 variants.

WT K255E G29S P179L R310Q A830V

Actin- binding ++ +++ +++ +++ + +++

GRα binding ++ - ++ ++ ++ ++ p65 binding ++ ++ ++ ++ ++ ++

Subcellular localizaiton N/C C N/C N N/C C stability ++ + + + ++ ++

++, wild-type activity, -, no interaction, +, decrease,+++, increase in comparison to wild type. N/C, localizaed in both the nuclear and cytoplasm N, localizaed more in the nuclear C, localizaed more in the cytoplasm

144

These 3 novel ACTN4 variants reside in distinct domains of ACTN4; G29S, is in the N- terminal domain; P179L, is in the ABD, A830V, is localized in the C-terminal EF-hand domain. The previously identified mutant, R310Q, is in the SR domain. Similar to K255E mutation, G29S significantly increases F-actin binding affinity. We also found this mutant degraded at a much higher rate than did the wild-type protein. The P179L mutation, is in the same domain as K255E and also results in an aberrant actin-binding activity, however, the degradation rate is comparable to that of the wild-type protein. The A830V mutation slightly increased F-actin binding activity, and highly increase the stability of ACTN4 protein. R310Q variant has slightly decreased actin-binding activity, and also with increased protein stability. (Table 2). It will be of great interest to determine ACTN4 protein abundance in glomeruli derived from these patients.

Based on our published data and new preliminary studies, ACTN4, GR and p65 form a transcriptional network to coordinate the expression of a subset of genes. In order to determine the effects of ACTN4 variants on their interaction with GR and p65, we carried out GST-pull down assay, and these ACTN4 mutations showed no significant difference in their interaction with either GR or p65.

145

CHAPTER 5: FUTURE DIRECTIONS

As a component of the podocyte cytoskeletal structure, ACTN4 is positioned to monitor the environment of the filtration barrier. Genetic analyses showed that mutations in ACTN4 are linked to NS. Our prior observations that ACTN4 regulates transcription by NRs and

MEF2 transcription factors prompted us to investigate the role of ACTN4 in transcriptional regulation by GRα and NF-κB in podocytes and the effects of disease-linked ACTN4 mutations on transcription. We hypothesize that ACTN4 is a potential mediator that transmits environmental events to the nucleus in podocytes and mutations in ACTN4 will likely exhibit defects in their function in the cytoplasm, the nucleus or both. Based on our data, we conclude that ACTN4 is essential for transcriptional activation by NF-κB and

GRα in podocytes. Furthermore, we found that ACTN4 regulates Dex-mediated transrepression in a gene-specific manner. Results from analyses of disease-associated

ACTN4 mutants suggest that ACTN4-associated NS is complex and that disease-linked

ACTN4 mutants are likely to be both gain- and loss-of function. Furthermore, these

ACTN4 mutants display common defects and mutation-specific properties. As such,

ACTN4-associated NS cannot be classified as one NS. Indeed, our unpublished data indicated that ACTN4 mutants are linked to FSGS, MCD, MN or unidentifiable NS features.

The mechanism by which ACTN4 regulates transcription

146

Data from my studies and other reports indicate that ACTN4 functions a transcriptional coactivator. This conclusion is based on several observations: 1) ACTN4 interacts with sequence-specific transcription factors in vitro, 2) ACTN4 interacts with sequence-specific transcription factors in the nucleus, 3) when brought to a promoter, ACTN4 activates transcription, 4) ACTN4 interacts with other transcription coactivators and 5) loss of

ACTN4 by knockdown reduces transcription potency by transcriptional activators in reporter assays as well as the expression of their target genes. Nonetheless, several outstanding questions remain to be addressed: 1) what are the mechanisms that control the association between ACTN4 and sequence-specific transcription factors? 2) what are the signalings that regulate ATCN4 subcellular distribution? 3) how does the C-terminal CaM- like domain contribute to ACTN4 transcription activity? 4) How is dimeric or monomeric

ACTN4 regulated? and 5) Does dimeric or monomeric ACTN4 bind transcription factors?

Our current studies indicate that ACTN4 is present in both the nucleus and the cytoplasm.

Nonetheless, ACTN4 does not interact with cytoplasmic GRα nor cytoplasmic NF-κB.

This is consistent with our observation that loss of ACTN4 by knockdown does not alter subcellular distribution of GRα or NF-κB. However, upon Dex or TNFα treatment respectively, GRα and NF-κB translocate into the nucleus where they interact with ACTN4.

Alternatively, knockdown of HSP90 or IκBα results in an association of ACTN4 with GRα and NF-κB in cytosol, respectively. For GRα, the association with ACTN4 requires an intact LXXLL NR-interacting motif in ACTN4. These observations suggest that competitive bindings between ACTN4 and cytoplasmic sequesters of GRα and NF-κB with

GRα and NF-κB account for the inability of ACTN4 to interact with these transcription

147 factors in the cytosol. With our in vitro analyses, ACTN4 (Iso) binds co-activators better than the full-length ACTN4, suggesting the SR domains also regulate ACTN4 transcription activity and its associations with partner proteins.

Transcriptional activation by GRα and NF-κB and possibly MEF2s and other NRs is mediated by ACTN4, indicating that the abundance of nuclear ACTN4 regulates transcriptional potency of these transcription factors. Thus, regulation of nucleocytoplasmic trafficking of ACTN4 is a critical step to control its ability to regulate nuclear processes including transcription. However, the mechanism underlying nucelocytoplasmic trafficking remains largely unknown.

During our studies on the role of ACTN4 in transcription, we consistently observed that

ACTN4 constructs with an internal deletion of the C-terminal CaM-like domain significantly lost the ability of ACTN4 to potentiate in transcriptional regulation by MEF2s,

ERα, NF-kB and GRα. Because ACTN4 CaM-like domain is Ca2+-sensitive, we speculate that Ca2+ may control transcription activity of these transcription factors. Indeed, Ca2+ is required for transcriptional activation by MEF2s (347), ER (348), GR (349), and NF-κB

(350).

Structural studies indicate that ACTN4 is capable of forming anti-parallel homodimers via the SR domains (351). Such a configuration allows for accessibility of the ABD, which is responsible for binding to F-actin as well as the NR-interacting motif, LXXLL. Further, the C-terminal CaM-like domain is also available for intra- or inter-molecular interactions.

148

Of note, it has been demonstrated that phosphatidylinositol 4,5-bisphosphate regulates the interaction between ABD and CaM-like domain (352). Our current studies did not address how ACTN4 dimerization is regulated and whether dimerization status affects the ability of ACTN4 to interact with its interacting partners. These questions warrant future investigation in order to elucidate the mechanisms underlying ACTN4-mediated transcriptional regulation.

The mechanism underlying ACTN4 mutation-linked NS

Early studies suggested that FSGS-linked ACTN4 mutants acquire increased actin-binding activity and form aggregates. Further, one of these mutants, K255E, exhibits an elevated degradation rate. Thus, this mutant is both gain- (increased actin binding) and loss-of- function (less abundant). Interestingly, glomeruli from patients with MCD, IgA nephropathy, and FSGS showed a decrease in ACTN4 staining, with the most marked reduction observed in FSGS cases (117). Indeed, Actn4-/- mice exhibit severe defects in podocytes, proteinuria, and glomerular failure. Taken together, these results suggest that loss of ACTN4 contributes to glomerular podocyte injuries.

The Nephrotic Syndrome Study Network (NEPTUNE) is a collaborative consortium that involved 21 clinical centers aimed to develop a translational research framework for nephrotic syndrome (344). The ultimate goal is to facilitate mechanistic understanding of the complexity of the disease pathogenesis, which may guide further investigation toward targeted therapeutic strategies. The NEPTUNE provides unmatched resources to

149 understand the mechanisms and pathways involved in kidney disease. One can take advantage of existing data sets including genomic sequencing, exon sequencing, whole genome kidney transcriptomes, quantitative histology, rigorous clinical phenotypes and clinical outcomes to study ACTN4-associated kidney diseases. Thus, the future direction to elucidate the mechanism by which ACTN4 contributes to NS include the following steps:

1. Using exon sequencing data from NEPTUNE to first identify subjects with rare,

predicted pathogenic ACTN4 mutations and then determine associations between

subjects with these different ACTN4 missense mutations and glomerular expression

pattern differences. This will establish gene networks altered by the ACTN4

transcriptional function. Because there are only a small number of subjects with rare,

predicted pathogenic ACTN4 mutations, identification of affected pathways in these

patients is likely to be limited by power.

2. Pairing whole genome sequencing with microarray-based ACTN4 expression levels

in the glomeruli from the NEPTUNE study for an eQTL (expression quantitative trait

loci) study that can identify non-coding SNPs that influence ACTN4 expression level

(i.e. that may alter sequences in the promoter, enhancer or 3’-UTR (untranslated

region) of the ACTN4 gene).

3. Analyze results from above to associate differences in ACTN4-regulated pathways

with clinical phenotyping data and our cell-based assays on glucocorticoid

responsiveness that may help determine connections between ACTN4 mutations and

patient phenotype/drug responsiveness.

150

We took advantage of the NEPTUNE database and characterized 3 newly identified NS- causing ACTN4 mutants. The G29S mutation was identified in glomeruli from a patient showing distinct from FSGS or MCD. The P179L mutation was found in two NS patients, one with FSGS and one without a clear classifiction. The A830V mutation was found in a

MCD patient. Another mutant, R310, is an example of a high-frequency allele in glomerulopathic patients. Patients with this mutation include patients with MCD, FSGS,

MN or other NS diagnose. It is likely that this particular mutation does not cause NS alone.

Furthermore, there is no clear correlation between mutations and specific type of NS, nor of their sensitivity to steroid therapy. Therefore, the lack of clear-cut correlation presents a great challenge for researchers and clinicians.

As summarized in Chapter 5, we characterized several biochemical properties of three newly identified disease-associated ACTN4 mutants along with K255E, a known FSGS- linked mutant. These include the actin-binding affinity, protein stability, subcellular distribution, their association between p65 and GRα and their ability to potentiate transcription by NF-κB and GRα. However, one will not be surprised that these ACTN4 mutants could potentially have other profound effects on other cellular processes. As such, we propose to employ proteomics approaches to study disease-linked ACTN4 mutations in podocytes. To this end, we will generate several HPC lines in which disease-linked mutations are knocked in by CRISPR/CAS9 technology. These HPC lines will be used to address the following specific aims:

151

1. Determination of disease-linked ACTN4 mutant-associated complexes by proteomic approaches.

Disease-linked ACTN4 mutants could potentially gain novel or lose critical interactions.

In order to address this issue, we will utilize these HPC lines to identify novel ACTN4- interacting proteins due to the mutations and loss of the interactions known to interact wild- type proteins. For example, K255E binds F-actin better than the wild-type protein (113) and R310Q losses the interaction with CLP36 (117).

2. Determination of changes in protein abundance using proteomic analyses.

K255E is known to have an increased degradation rate and loss of ACTN4 leads to reduced

CLP36 protein levels. It is possible that disease-linked ACTN4 mutants could alter protein abundance of cellular proteins, especially for known ACTN4 interacting proteins. We will apply proteomic approaches to address this question.

3. Identification of ACTN4 global genomic binding sites

As a transcriptional coactivator, ACTN4 binds chromatin through its association with transcription factors. Because several disease-linked ACTN4 mutants exhibit altered subcellular distribution, it is possible that these mutants exhibit altered genome binding sites. Thus, it will be important to determine the effects of disease-associated ACTN4 mutants on ACTN4 chromatin binding by ChIP-seq analyses.

4. Analyses of transcriptomes of wild-type and disease-linked ACTN4 mutant expressing HPCs

152

RNA-seq is a powerful tool to determine whole genome expression profiles including coding and non-coding RNAs. Our published data show that ACTN4 is defective in transcriptional activation by PPAR (128), GR (346) and NF-kB (336). Therefore, we anticipate that disease-linked ACTN4 mutants will have distinct expression profiles from the wild-type HPCs. From these data, we will be able to establish a correlation between

ACTN4 mutations and altered pathways. As mentioned earlier, the NEPTUNE has generated transcriptomes derived from patients’ glomeruli. Our cellular transcriptome data can further be used in parallel with NEPTUNE’s transcriptome database and further pinpoint overlapped pathways between cell-based and patients derived samples.

The podocyte-specific protein, nephrin (encoded by NPHS1), is a major component of the podocyte slit diaphragm and is essential for maintaining normal glomerular permeability.

Affymetrix chip-based, genome-wide gene expression data of the glomerular transcriptomes from 90 available NEPTUNE patients indicate that: 1) ACTN4 is one of the most abundantly expressed mRNA in the glomerulus, 2) ACTN4 mRNA levels significantly correlates with eGFR, and 3) the expression of ACTN4 mRNA strongly correlates with NPHS1 mRNA levels. The correlation with NPHS1 is particularly illustrative of the power of using integrative human genomic data.

We have previously demonstrated that TNFα induces NPHS1 mRNA in HPCs (317, 336) and that TNFα promotes the recruitment of p65 and ACTN4 to the NPHS1 promoter (336).

It would be interesting to examine the expression level of NPHS1 in the knock-in HPCs

153 harboring the FSGS-ACTN4 mutants and whether these mutations affect the binding of

ACTN4 to NPHS1 promoter.

5. Identification of changes of transcriptomes in wild-type and disease-linked ACTN4 mutant expressing HPCs in response to Dex treatment

As mentioned earlier, glucocorticoids as a general class of steroids possess renoprotective activity in glomeruli (284, 328), however steroid-resistance and systemic toxicity remain major issues for their long-term use (328). With further study of both the environmental and genetic causes of glomerular disorders, the mechanism by which anti-proteinuric drugs effect podocyte homeostasis could provide new avenues for novel therapy design. We hope that by identifying Dex responsive genes in normal and disease-linked ACTN4 mutation expressing HPCs, we will be able to sort out the distinct responses to Dex in different disease-linked ACTN4 mutants.

In summary, our work has demonstrated ACTN4 regulates transcription of NF-κB, and

NRs in podocytes. Based on our observation, we proposed the future directions for the mechanism by which ACTN4 transmit environmental signal to the nucleus in podocyte, as well as the overall effects of disease-associated ACTN4 mutations.

154

References

1. Schell, C., Wanner, N., and Huber, T. B. (2014) Glomerular development--shaping the multi-cellular filtration unit. Semin Cell Dev Biol. 36, 39–49 2. Lennon, R., and Hosawi, S. (2016) Glomerular cell crosstalk. Curr Opin Nephrol Hypertens. 25, 187–193 3. Tian, X., Kim, J. J., Monkley, S. M., Gotoh, N., Nandez, R., Soda, K., Inoue, K., Balkin, D. M., Hassan, H., Son, S. H., Lee, Y., Moeckel, G., Calderwood, D. A., Holzman, L. B., Critchley, D. R., Zent, R., Reiser, J., and Ishibe, S. (2014) Podocyte- associated talin1 is critical for glomerular filtration barrier maintenance. J Clin Invest. 124, 1098–1113 4. Assady, S., Wanner, N., Skorecki, K. L., and Huber, T. B. (2017) New Insights into Podocyte Biology in Glomerular Health and Disease. J Am Soc Nephrol. 10.1681/ASN.2017010027 5. Miner, J. H. (2016) Podocyte biology in 2015: New insights into the mechanisms of podocyte health. Nat Rev Nephrol. 12, 63–64 6. Grahammer, F., Schell, C., and Huber, T. B. (2013) The podocyte slit diaphragm-- from a thin grey line to a complex signalling hub. Nat Rev Nephrol. 9, 587–598 7. Wang, Z., Liu, J., and Sun, W. (2013) Effects of asiaticoside on levels of podocyte cytoskeletal proteins and renal slit diaphragm proteins in adriamycin-induced rat nephropathy. Life Sci. 93, 352–358 8. Scott, R. P., and Quaggin, S. E. (2015) The cell biology of renal filtration. J. Cell Biol. 209, 199–210 9. Kestila, M., Lenkkeri, U., Mannikko, M., Lamerdin, J., McCready, P., Putaala, H., Ruotsalainen, V., Morita, T., Nissinen, M., Herva, R., Kashtan, C. E., Peltonen, L., Holmberg, C., Olsen, A., and Tryggvason, K. (1998) Positionally cloned gene for a novel glomerular protein--nephrin--is mutated in congenital nephrotic syndrome. Mol Cell. 1, 575–582 10. Boute, N., Gribouval, O., Roselli, S., Benessy, F., Lee, H., Fuchshuber, A., Dahan, K., Gubler, M. C., Niaudet, P., and Antignac, C. (2000) NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant

155

nephrotic syndrome. Nat Genet. 24, 349–354 11. Schwarz, K., Simons, M., Reiser, J., Saleem, M. A., Faul, C., Kriz, W., Shaw, A. S., Holzman, L. B., and Mundel, P. (2001) Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. J Clin Invest. 108, 1621–1629 12. Shih, N. Y., Li, J., Cotran, R., Mundel, P., Miner, J. H., and Shaw, A. S. (2001) CD2AP localizes to the slit diaphragm and binds to nephrin via a novel C-terminal domain. Am J Pathol. 159, 2303–2308 13. Reiser, J., Polu, K. R., Moller, C. C., Kenlan, P., Altintas, M. M., Wei, C., Faul, C., Herbert, S., Villegas, I., Avila-Casado, C., McGee, M., Sugimoto, H., Brown, D., Kalluri, R., Mundel, P., Smith, P. L., Clapham, D. E., and Pollak, M. R. (2005) TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function. Nat Genet. 37, 739–744 14. Reiser, J., Kriz, W., Kretzler, M., and Mundel, P. (2000) The glomerular slit diaphragm is a modified adherens junction. J Am Soc Nephrol. 11, 1–8 15. Inoue, T., Yaoita, E., Kurihara, H., Shimizu, F., Sakai, T., Kobayashi, T., Ohshiro, K., Kawachi, H., Okada, H., Suzuki, H., Kihara, I., and Yamamoto, T. (2001) FAT is a component of glomerular slit diaphragms. Kidney Int. 59, 1003–1012 16. Schnabel, E., Anderson, J. M., and Farquhar, M. G. (1990) The tight junction protein ZO-1 is concentrated along slit diaphragms of the glomerular epithelium. J Cell Biol. 111, 1255–1263 17. Mundel, P., Heid, H. W., Mundel, T. M., Kruger, M., Reiser, J., and Kriz, W. (1997) Synaptopodin: an actin-associated protein in telencephalic dendrites and renal podocytes. J Cell Biol. 139, 193–204 18. Guo, J. K., Menke, A. L., Gubler, M. C., Clarke, A. R., Harrison, D., Hammes, A., Hastie, N. D., and Schedl, A. (2002) WT1 is a key regulator of podocyte function: reduced expression levels cause crescentic glomerulonephritis and mesangial sclerosis. Hum Mol Genet. 11, 651–659 19. Dai, C., Stolz, D. B., Kiss, L. P., Monga, S. P., Holzman, L. B., and Liu, Y. (2009) Wnt/beta-catenin signaling promotes podocyte dysfunction and albuminuria. J Am Soc Nephrol. 20, 1997–2008

156

20. Miner, J. H. (2012) The glomerular basement membrane. Exp Cell Res. 318, 973– 978 21. St John, P. L., and Abrahamson, D. R. (2001) Glomerular endothelial cells and podocytes jointly synthesize laminin-1 and -11 chains. Kidney Int. 60, 1037–1046 22. Esser, S., Wolburg, K., Wolburg, H., Breier, G., Kurzchalia, T., and Risau, W. (1998) Vascular endothelial growth factor induces endothelial fenestrations in vitro. J Cell Biol. 140, 947–959 23. Dedhar, S., Jewell, K., Rojiani, M., and Gray, V. (1992) The receptor for the basement membrane glycoprotein entactin is the integrin alpha 3/beta 1. J Biol Chem. 267, 18908–18914 24. Adler, S., and Chen, X. (1992) Anti-Fx1A antibody recognizes a beta 1-integrin on glomerular epithelial cells and inhibits adhesion and growth. Am J Physiol. 262, F770-6 25. Regele, H. M., Fillipovic, E., Langer, B., Poczewki, H., Kraxberger, I., Bittner, R. E., and Kerjaschki, D. (2000) Glomerular expression of dystroglycans is reduced in minimal change nephrosis but not in focal segmental glomerulosclerosis. J Am Soc Nephrol. 11, 403–412 26. Abrahamson, D. R., Hudson, B. G., Stroganova, L., Borza, D.-B., and St John, P. L. (2009) Cellular origins of type IV collagen networks in developing glomeruli. J. Am. Soc. Nephrol. 20, 1471–9 27. Noakes, P. G., Miner, J. H., Gautam, M., Cunningham, J. M., Sanes, J. R., and Merlie, J. P. (1995) The renal glomerulus of mice lacking s-laminin/laminin beta 2: nephrosis despite molecular compensation by laminin beta 1. Nat Genet. 10, 400– 406 28. Iglesias-de la Cruz, M. C., Ziyadeh, F. N., Isono, M., Kouahou, M., Han, D. C., Kalluri, R., Mundel, P., and Chen, S. (2002) Effects of high glucose and TGF-beta1 on the expression of collagen IV and vascular endothelial growth factor in mouse podocytes. Kidney Int. 62, 901–913 29. Satchell, S. C., Harper, S. J., Tooke, J. E., Kerjaschki, D., Saleem, M. A., and Mathieson, P. W. (2002) Human podocytes express angiopoietin 1, a potential regulator of glomerular vascular endothelial growth factor. J Am Soc Nephrol. 13,

157

544–550 30. Satchell, S. C., Anderson, K. L., and Mathieson, P. W. (2004) Angiopoietin 1 and vascular endothelial growth factor modulate human glomerular endothelial cell barrier properties. J Am Soc Nephrol. 15, 566–574 31. Kimura, M., Toyoda, M., Kato, M., Kobayashi, K., Abe, M., Kobayashi, T., Miyauchi, M., Yamamoto, N., Umezono, T., and Suzuki, D. (2008) Expression of alpha-actinin-4 in human diabetic nephropathy. Intern Med. 47, 1099–1106 32. Pavenstadt, H. (2000) Roles of the podocyte in glomerular function. Am J Physiol Ren. Physiol. 278, F173-9 33. Susztak, K., Raff, A. C., Schiffer, M., and Bottinger, E. P. (2006) Glucose-induced reactive oxygen species cause apoptosis of podocytes and podocyte depletion at the onset of diabetic nephropathy. Diabetes. 55, 225–233 34. Shirato, I., Sakai, T., Kimura, K., Tomino, Y., and Kriz, W. (1996) Cytoskeletal changes in podocytes associated with foot process effacement in Masugi nephritis. Am J Pathol. 148, 1283–1296 35. Takeda, T., McQuistan, T., Orlando, R. A., and Farquhar, M. G. (2001) Loss of glomerular foot processes is associated with uncoupling of podocalyxin from the actin cytoskeleton. J Clin Invest. 108, 289–301 36. Kwoh, C., Shannon, M. B., Miner, J. H., and Shaw, A. (2006) Pathogenesis of nonimmune glomerulopathies. Annu Rev Pathol. 1, 349–374 37. Kim, Y. H., Goyal, M., Kurnit, D., Wharram, B., Wiggins, J., Holzman, L., Kershaw, D., and Wiggins, R. (2001) Podocyte depletion and glomerulosclerosis have a direct relationship in the PAN-treated rat. Kidney Int. 60, 957–968 38. Faul, C., Asanuma, K., Yanagida-Asanuma, E., Kim, K., and Mundel, P. (2007) Actin up: regulation of podocyte structure and function by components of the actin cytoskeleton. Trends Cell Biol. 17, 428–437 39. Drenckhahn, D., and Franke, R. P. (1988) Ultrastructural organization of contractile and cytoskeletal proteins in glomerular podocytes of chicken, rat, and man. Lab Invest. 59, 673–682 40. Garg, P., Verma, R., Cook, L., Soofi, A., Venkatareddy, M., George, B., Mizuno, K., Gurniak, C., Witke, W., and Holzman, L. B. (2010) Actin-depolymerizing factor

158

cofilin-1 is necessary in maintaining mature podocyte architecture. J Biol Chem. 285, 22676–22688 41. Matovinovic, M. S. (2009) 3. Podocyte Injury in Glomerular Diseases. EJIFCC. 20, 21–27 42. Burghardt, T., Hochapfel, F., Salecker, B., Meese, C., Gröne, H.-J., Rachel, R., Wanner, G., Krahn, M. P., and Witzgall, R. (2015) Advanced electron microscopical techniques provide a deeper insight into the peculiar features of podocytes. Am. J. Physiol. Renal Physiol. 309, ajprenal.00338.2015 43. Mathieson, P. W. (2012) The podocyte cytoskeleton in health and in disease. Clin. Kidney J. 5, 498–501 44. Oh, J., Reiser, J., and Mundel, P. (2004) Dynamic (re)organization of the podocyte actin cytoskeleton in the nephrotic syndrome. Pediatr Nephrol. 19, 130–137 45. Sanwal, V., Pandya, M., Bhaskaran, M., Franki, N., Reddy, K., Ding, G., Kapasi, A., Valderrama, E., and Singhal, P. C. (2001) Puromycin aminonucleoside induces glomerular epithelial cell apoptosis. Exp Mol Pathol. 70, 54–64 46. Shiiki, H., Sasaki, Y., Nishino, T., Kimura, T., Kurioka, H., Fujimoto, S., and Dohi, K. (1998) Cell proliferation and apoptosis of the glomerular epithelial cells in rats with puromycin aminonucleoside nephrosis. Pathobiology. 66, 221–229 47. Schiffer, M., Bitzer, M., Roberts, I. S., Kopp, J. B., ten Dijke, P., Mundel, P., and Bottinger, E. P. (2001) Apoptosis in podocytes induced by TGF-beta and Smad7. J Clin Invest. 108, 807–816 48. Wang, T., Lafuse, W. P., and Zwilling, B. S. (2001) NFkappaB and Sp1 elements are necessary for maximal transcription of toll-like receptor 2 induced by Mycobacterium avium. J Immunol. 167, 6924–6932 49. Jia, J., Ding, G., Zhu, J., Chen, C., Liang, W., Franki, N., and Singhal, P. C. (2008) Angiotensin II infusion induces nephrin expression changes and podocyte apoptosis. Am J Nephrol. 28, 500–507 50. Ding, G., Reddy, K., Kapasi, A. A., Franki, N., Gibbons, N., Kasinath, B. S., and Singhal, P. C. (2002) Angiotensin II induces apoptosis in rat glomerular epithelial cells. Am J Physiol Ren. Physiol. 283, F173-80 51. Grahammer, F., Wanner, N., and Huber, T. B. (2013) Podocyte regeneration: Who

159

can become a podocyte? Am. J. Pathol. 183, 333–335 52. Whiteside, C., Prutis, K., Cameron, R., and Thompson, J. (1989) Glomerular epithelial detachment, not reduced charge density, correlates with proteinuria in adriamycin and puromycin nephrosis. Lab Invest. 61, 650–660 53. Whiteside, C. I., Cameron, R., Munk, S., and Levy, J. (1993) Podocytic cytoskeletal disaggregation and basement-membrane detachment in puromycin aminonucleoside nephrosis. Am J Pathol. 142, 1641–1653 54. Reiser, J., Oh, J., Shirato, I., Asanuma, K., Hug, A., Mundel, T. M., Honey, K., Ishidoh, K., Kominami, E., Kreidberg, J. A., Tomino, Y., and Mundel, P. (2004) Podocyte migration during nephrotic syndrome requires a coordinated interplay between cathepsin L and alpha3 integrin. J Biol Chem. 279, 34827–34832 55. Yu, D., Petermann, A., Kunter, U., Rong, S., Shankland, S. J., and Floege, J. (2005) Urinary podocyte loss is a more specific marker of ongoing glomerular damage than proteinuria. J Am Soc Nephrol. 16, 1733–1741 56. Wang, P., Li, M., Liu, Q., Chen, B., and Ji, Z. (2015) Detection of urinary podocytes and nephrin as markers for children with glomerular diseases. Exp. Biol. Med. 240, 169–174 57. Cameron, J. S., and Hicks, J. (2002) The origins and development of the concept of a “nephrotic syndrome.” Am J Nephrol. 22, 240–247 58. Hull, R. P., and Goldsmith, D. J. (2008) Nephrotic syndrome in adults. BMJ. 336, 1185–1189 59. Hama, T., Nakanishi, K., Shima, Y., Sato, M., Mukaiyama, H., Togawa, H., Hamahira, K., Tanaka, R., Kaito, H., Nozu, K., Iijima, K., and Yoshikawa, N. (2015) Renal biopsy criterion in idiopathic nephrotic syndrome with microscopic hematuria at onset. Pediatr Nephrol. 30, 445–450 60. Thomas, D. B., Franceschini, N., Hogan, S. L., Ten Holder, S., Jennette, C. E., Falk, R. J., and Jennette, J. C. (2006) Clinical and pathologic characteristics of focal segmental glomerulosclerosis pathologic variants. Kidney Int. 69, 920–926 61. Marshall, S., Dressler, R., and D’Agati, V. (1997) Membranous lupus nephritis with antineutrophil cytoplasmic antibody-associated segmental necrotizing and crescentic glomerulonephritis. Am J Kidney Dis. 29, 119–124

160

62. Kveder, R., Kajtna-Koselj, M., Rott, T., and Bren, A. F. (2001) Nephrotic syndrome in patients with diabetes mellitus is not always associated with diabetic nephropathy. Nephrol Dial Transpl. 16 Suppl 6, 86–87 63. Zhu, X., Wu, S., Dahut, W. L., and Parikh, C. R. (2007) Risks of proteinuria and hypertension with bevacizumab, an antibody against vascular endothelial growth factor: systematic review and meta-analysis. Am J Kidney Dis. 49, 186–193 64. Weening, J. J., D’Agati, V. D., Schwartz, M. M., Seshan, S. V, Alpers, C. E., Appel, G. B., Balow, J. E., Bruijn, J. A., Cook, T., Ferrario, F., Fogo, A. B., Ginzler, E. M., Hebert, L., Hill, G., Hill, P., Jennette, J. C., Kong, N. C., Lesavre, P., Lockshin, M., Looi, L. M., Makino, H., Moura, L. A., and Nagata, M. (2004) The classification of glomerulonephritis in systemic lupus erythematosus revisited. J Am Soc Nephrol. 15, 241–250 65. Kimmel, P. L., Barisoni, L., and Kopp, J. B. (2003) Pathogenesis and treatment of HIV-associated renal diseases: lessons from clinical and animal studies, molecular pathologic correlations, and genetic investigations. Ann Intern Med. 139, 214–226 66. Weiner, N. J., Goodman, J. W., and Kimmel, P. L. (2003) The HIV-associated renal diseases: current insight into pathogenesis and treatment. Kidney Int. 63, 1618–1631 67. Eddy, A. A., and Symons, J. M. (2003) Nephrotic syndrome in childhood. Lancet. 362, 629–639 68. D’Agati, V. D., Kaskel, F. J., and Falk, R. J. (2011) Focal segmental glomerulosclerosis. N Engl J Med. 365, 2398–2411 69. Kitiyakara, C., Kopp, J. B., and Eggers, P. (2003) Trends in the epidemiology of focal segmental glomerulosclerosis. Semin Nephrol. 23, 172–182 70. Hull, R., and Goldsmith, D. (2008) Identifying and managing nephrotic syndrome in adults. Practitioner. 252, 30,32-34,37 71. Zenker, M., Machuca, E., and Antignac, C. (2009) Genetics of nephrotic syndrome: new insights into molecules acting at the glomerular filtration barrier. J Mol Med. 87, 849–857 72. Buscher, A. K., Konrad, M., Nagel, M., Witzke, O., Kribben, A., Hoyer, P. F., and Weber, S. (2012) Mutations in podocyte genes are a rare cause of primary FSGS associated with ESRD in adult patients. Clin Nephrol. 78, 47–53

161

73. Kaplan, J. M., Kim, S. H., North, K. N., Rennke, H., Correia, L. A., Tong, H. Q., Mathis, B. J., Rodriguez-Perez, J. C., Allen, P. G., Beggs, A. H., and Pollak, M. R. (2000) Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis. Nat Genet. 24, 251–256 74. Weins, A., Kenlan, P., Herbert, S., Le, T. C., Villegas, I., Kaplan, B. S., Appel, G. B., and Pollak, M. R. (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal segmental glomerulosclerosis. J Am Soc Nephrol. 16, 3694–3701 75. Choi, H. J., Lee, B. H., Cho, H. Y., Moon, K. C., Ha, I. S., Nagata, M., Choi, Y., and Cheong, H. I. (2008) Familial focal segmental glomerulosclerosis associated with an ACTN4 mutation and paternal germline mosaicism. Am J Kidney Dis. 51, 834–838 76. Huber, T. B., Simons, M., Hartleben, B., Sernetz, L., Schmidts, M., Gundlach, E., Saleem, M. A., Walz, G., and Benzing, T. (2003) Molecular basis of the functional podocin-nephrin complex: mutations in the NPHS2 gene disrupt nephrin targeting to lipid raft microdomains. Hum Mol Genet. 12, 3397–3405 77. Koziell, A., Grech, V., Hussain, S., Lee, G., Lenkkeri, U., Tryggvason, K., and Scambler, P. (2002) Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration. Hum Mol Genet. 11, 379–388 78. Lenkkeri, U., Mannikko, M., McCready, P., Lamerdin, J., Gribouval, O., Niaudet, P. M., Antignac, C. K., Kashtan, C. E., Homberg, C., Olsen, A., Kestila, M., and Tryggvason, K. (1999) Structure of the gene for congenital nephrotic syndrome of the finnish type (NPHS1) and characterization of mutations. Am J Hum Genet. 64, 51–61 79. Donoviel, D. B., Freed, D. D., Vogel, H., Potter, D. G., Hawkins, E., Barrish, J. P., Mathur, B. N., Turner, C. A., Geske, R., Montgomery, C. A., Starbuck, M., Brandt, M., Gupta, A., Ramirez-Solis, R., Zambrowicz, B. P., and Powell, D. R. (2001) Proteinuria and perinatal lethality in mice lacking NEPH1, a novel protein with homology to NEPHRIN. Mol Cell Biol. 21, 4829–4836 80. Gigante, M., Pontrelli, P., Montemurno, E., Roca, L., Aucella, F., Penza, R., Caridi, G., Ranieri, E., Ghiggeri, G. M., and Gesualdo, L. (2009) CD2AP mutations are

162

associated with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS). Nephrol Dial Transpl. 24, 1858–1864 81. Gee, H. Y., Sadowski, C. E., Aggarwal, P. K., Porath, J. D., Yakulov, T. A., Schueler, M., Lovric, S., Ashraf, S., Braun, D. A., Halbritter, J., Fang, H., Airik, R., Vega- Warner, V., Cho, K. J., Chan, T. A., Morris, L. G., ffrench-Constant, C., Allen, N., McNeill, H., Buscher, R., Kyrieleis, H., Wallot, M., Gaspert, A., Kistler, T., Milford, D. V, Saleem, M. A., Keng, W. T., Alexander, S. I., Valentini, R. P., Licht, C., Teh, J. C., Bogdanovic, R., Koziell, A., Bierzynska, A., Soliman, N. A., Otto, E. A., Lifton, R. P., Holzman, L. B., Sibinga, N. E., Walz, G., Tufro, A., and Hildebrandt, F. (2016) FAT1 mutations cause a glomerulotubular nephropathy. Nat Commun. 7, 10822 82. Bartram, M. P., Habbig, S., Pahmeyer, C., Hohne, M., Weber, L. T., Thiele, H., Altmuller, J., Kottoor, N., Wenzel, A., Krueger, M., Schermer, B., Benzing, T., Rinschen, M. M., and Beck, B. B. (2016) Three-layered proteomic characterization of a novel ACTN4 mutation unravels its pathogenic potential in FSGS. Hum Mol Genet. 25, 1152–1164 83. Schumacher, V., Scharer, K., Wuhl, E., Altrogge, H., Bonzel, K. E., Guschmann, M., Neuhaus, T. J., Pollastro, R. M., Kuwertz-Broking, E., Bulla, M., Tondera, A. M., Mundel, P., Helmchen, U., Waldherr, R., Weirich, A., and Royer-Pokora, B. (1998) Spectrum of early onset nephrotic syndrome associated with WT1 missense mutations. Kidney Int. 53, 1594–1600 84. Yalcin, E. G., He, Y., Orhan, D., Pazzagli, C., Emiralioglu, N., and Has, C. (2015) Crucial role of posttranslational modifications of integrin alpha3 in interstitial lung disease and nephrotic syndrome. Hum Mol Genet. 24, 3679–3688 85. Winn, M. P., Conlon, P. J., Lynn, K. L., Farrington, M. K., Creazzo, T., Hawkins, A. F., Daskalakis, N., Kwan, S. Y., Ebersviller, S., Burchette, J. L., Pericak-Vance, M. A., Howell, D. N., Vance, J. M., and Rosenberg, P. B. (2005) A mutation in the TRPC6 cation channel causes familial focal segmental glomerulosclerosis. Science. 308, 1801–1804 86. Siddiqi, F. S., and Advani, A. (2013) Endothelial-podocyte crosstalk: The missing link between endothelial dysfunction and albuminuria in diabetes. Diabetes. 62,

163

3647–3655 87. Gbadegesin, R., Lavin, P., Foreman, J., and Winn, M. (2011) Pathogenesis and therapy of focal segmental glomerulosclerosis: an update. Pediatr Nephrol. 26, 1001–1015 88. Chun, M. J., Korbet, S. M., Schwartz, M. M., and Lewis, E. J. (2004) Focal segmental glomerulosclerosis in nephrotic adults: presentation, prognosis, and response to therapy of the histologic variants. J Am Soc Nephrol. 15, 2169–2177 89. Cattran, D. C., Appel, G. B., Hebert, L. A., Hunsicker, L. G., Pohl, M. A., Hoy, W. E., Maxwell, D. R., and Kunis, C. L. (1999) A randomized trial of cyclosporine in patients with steroid-resistant focal segmental glomerulosclerosis. North America Nephrotic Syndrome Study Group. Kidney Int. 56, 2220–2226 90. Bhimma, R., Adhikari, M., Asharam, K., and Connolly, C. (2006) Management of steroid-resistant focal segmental glomerulosclerosis in children using tacrolimus. Am J Nephrol. 26, 544–551 91. Mendoza, S. A., Reznik, V. M., Griswold, W. R., Krensky, A. M., Yorgin, P. D., and Tune, B. M. (1990) Treatment of steroid-resistant focal segmental glomerulosclerosis with pulse methylprednisolone and alkylating agents. Pediatr Nephrol. 4, 303–307 92. Fornoni, A., Sageshima, J., Wei, C., Merscher-Gomez, S., Aguillon-Prada, R., Jauregui, A. N., Li, J., Mattiazzi, A., Ciancio, G., Chen, L., Zilleruelo, G., Abitbol, C., Chandar, J., Seeherunvong, W., Ricordi, C., Ikehata, M., Rastaldi, M. P., Reiser, J., and Burke, G. W. (2011) Rituximab Targets Podocytes in Recurrent Focal Segmental Glomerulosclerosis. Sci. Transl. Med. 3, 85ra46-85ra46 93. Pescovitz, M. D., Book, B. K., and Sidner, R. A. (2006) Resolution of recurrent focal segmental glomerulosclerosis proteinuria after rituximab treatment. N Engl J Med. 354, 1961–1963 94. Pollard, T. D., and Cooper, J. A. (2009) Actin, a central player in cell shape and movement. Science. 326, 1208–1212 95. Shao, H., Wang, J. H., Pollak, M. R., and Wells, A. (2010) alpha-actinin-4 is essential for maintaining the spreading, motility and contractility of fibroblasts. PLoS One. 5, e13921

164

96. Otey, C. A., and Carpen, O. (2004) Alpha-actinin revisited: a fresh look at an old player. Cell Motil Cytoskelet. 58, 104–111 97. Djinović-Carugo, K., Young, P., Gautel, M., and Saraste, M. (1999) Structure of the alpha-actinin rod: molecular basis for cross-linking of actin filaments. Cell. 98, 537– 546 98. Trave, G., Pastore, A., Hyvonen, M., and Saraste, M. (1995) The C-terminal domain of alpha-spectrin is structurally related to calmodulin. Eur J Biochem. 227, 35–42. 99. Lek, M., MacArthur, D. G., Yang, N., and North, K. N. (2010) Phylogenetic analysis of gene structure and alternative splicing in alpha-actinins. Mol Biol Evol. 27, 773– 780 100. Provost, E., and Rimm, D. L. (1999) Controversies at the cytoplasmic face of the cadherin-based adhesion complex. Curr. Opin. Cell Biol. 11, 567–572 101. Sjoblom, B., Salmazo, A., and Djinovic-Carugo, K. (2008) Alpha-actinin structure and regulation. Cell Mol Life Sci. 65, 2688–2701 102. Otey, C. A., Pavalko, F. M., and Burridge, K. (1990) An interaction between alpha- actinin and the beta 1 integrin subunit in vitro. J Cell Biol. 111, 721–729 103. Honda, K., Yamada, T., Endo, R., Ino, Y., Gotoh, M., Tsuda, H., Yamada, Y., Chiba, H., and Hirohashi, S. (1998) Actinin-4, a novel actin-bundling protein associated with cell motility and cancer invasion. J Cell Biol. 140, 1383–1393 104. Hamill, K. J., Hiroyasu, S., Colburn, Z. T., Ventrella, R. V, Hopkinson, S. B., Skalli, O., and Jones, J. C. (2015) Alpha actinin-1 regulates cell-matrix adhesion organization in keratinocytes: consequences for skin cell motility. J Invest Dermatol. 135, 1043–1052 105. Lehtonen, S., Ryan, J. J., Kudlicka, K., Iino, N., Zhou, H., and Farquhar, M. G. (2005) Cell junction-associated proteins IQGAP1, MAGI-2, CASK, spectrins, and alpha-actinin are components of the nephrin multiprotein complex. Proc Natl Acad Sci U S A. 102, 9814–9819 106. Hayashida, Y., Honda, K., Idogawa, M., Ino, Y., Ono, M., Tsuchida, A., Aoki, T., Hirohashi, S., and Yamada, T. (2005) E-cadherin regulates the association between beta-catenin and actinin-4. Cancer Res. 65, 8836–8845 107. Nikolopoulos, S. N., Spengler, B. A., Kisselbach, K., Evans, A. E., Biedler, J. L.,

165

and Ross, R. A. (2000) The human non-muscle alpha-actinin protein encoded by the ACTN4 gene suppresses tumorigenicity of human neuroblastoma cells. Oncogene. 19, 380–386 108. Shao, H., Wu, C., and Wells, A. (2010) Phosphorylation of alpha-actinin 4 upon epidermal growth factor exposure regulates its interaction with actin. J Biol Chem. 285, 2591–2600 109. Fraley, T. S., Tran, T. C., Corgan, A. M., Nash, C. A., Hao, J., Critchley, D. R., and Greenwood, J. A. (2003) Phosphoinositide binding inhibits alpha-actinin bundling activity. J Biol Chem. 278, 24039–24045 110. Fukami, K., Furuhashi, K., Inagaki, M., Endo, T., Hatano, S., and Takenawa, T. (1992) Requirement of phosphatidylinositol 4,5-bisphosphate for alpha-actinin function. Nature. 359, 150–152 111. Feng, D., DuMontier, C., and Pollak, M. R. (2015) The role of alpha-actinin-4 in human kidney disease. Cell Biosci. 5, 44 112. Smoyer, W. E., Mundel, P., Gupta, a, and Welsh, M. J. (1997) Podocyte alpha- actinin induction precedes foot process effacement in experimental nephrotic syndrome. Am. J. Physiol. 273, F150-7 113. Michaud, J. L., Chaisson, K. M., Parks, R. J., and Kennedy, C. R. (2006) FSGS- associated alpha-actinin-4 (K256E) impairs cytoskeletal dynamics in podocytes. Kidney Int. 70, 1054–1061 114. Weins, A., Schlondorff, J. S., Nakamura, F., Denker, B. M., Hartwig, J. H., Stossel, T. P., and Pollak, M. R. (2007) Disease-associated mutant alpha-actinin-4 reveals a mechanism for regulating its F-actin-binding affinity. Proc Natl Acad Sci U S A. 104, 16080–16085 115. Benoit, G., Machuca, E., Nevo, F., Gribouval, O., Lepage, D., and Antignac, C. (2010) Analysis of recessive CD2AP and ACTN4 mutations in steroid-resistant nephrotic syndrome. Pediatr Nephrol. 25, 445–451 116. Dai, S., Wang, Z., Pan, X., Wang, W., Chen, X., Ren, H., Hao, C., Han, B., and Chen, N. (2010) Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in focal segmental glomerulosclerosis. Nephrol Dial Transpl. 25, 824–835

166

117. Liu, Z., Blattner, S. M., Tu, Y., Tisherman, R., Wang, J. H., Rastaldi, M. P., Kretzler, M., and Wu, C. (2011) Alpha-actinin-4 and CLP36 protein deficiencies contribute to podocyte defects in multiple human glomerulopathies. J Biol Chem. 286, 30795– 30805 118. Kos, C. H., Le, T. C., Sinha, S., Henderson, J. M., Kim, S. H., Sugimoto, H., Kalluri, R., Gerszten, R. E., and Pollak, M. R. (2003) Mice deficient in alpha-actinin-4 have severe glomerular disease. J Clin Invest. 111, 1683–1690 119. Yao, J., Le, T. C., Kos, C. H., Henderson, J. M., Allen, P. G., Denker, B. M., and Pollak, M. R. (2004) Alpha-actinin-4-mediated FSGS: an inherited kidney disease caused by an aggregated and rapidly degraded cytoskeletal protein. PLoS Biol. 2, e167 120. Michaud, J.-L., Lemieux, L. I., Dubé, M., Vanderhyden, B. C., Robertson, S. J., and Kennedy, C. R. J. (2003) Focal and segmental glomerulosclerosis in mice with podocyte-specific expression of mutant alpha-actinin-4. J. Am. Soc. Nephrol. 14, 1200–1211 121. Liu, Q. Y., Lei, J. X., LeBlanc, J., Sodja, C., Ly, D., Charlebois, C., Walker, P. R., Yamada, T., Hirohashi, S., and Sikorska, M. (2004) Regulation of DNaseY activity by actinin-α4 during apoptosis. Cell Death Differ. 10.1038/sj.cdd.4401401 122. Babakov, V. N., Bobkov, D. E., Petukhova, O. A., Turoverova, L. V, Kropacheva, I. V, Podol’skaia, E. P., and Pinaev, G. P. (2004) [alpha-Actinin-4 and p65/RelA subunit of NF-kappaB transcription factor are co-localized and migrate together into the nucleus in EGF-stimulated A431 cell]. Tsitologiia. 46, 1064–1072 123. Poch, M. T., Al-Kassim, L., Smolinski, S. M., and Hines, R. N. (2004) Two distinct classes of CCAAT box elements that bind nuclear factor-Y/α-actinin-4: Potential role in human CYP1A1 regulation. Toxicol. Appl. Pharmacol. 199, 239–250 124. Chakraborty, S., Reineke, E. L., Lam, M., Li, X., Liu, Y., Gao, C., Khurana, S., and Kao, H. Y. (2006) Alpha-actinin 4 potentiates myocyte enhancer factor-2 transcription activity by antagonizing histone deacetylase 7. J Biol Chem. 281, 35070–35080 125. Babakov, V. N., Petukhova, O. A., Turoverova, L. V, Kropacheva, I. V, Tentler, D. G., Bolshakova, A. V, Podolskaya, E. P., Magnusson, K. E., and Pinaev, G. P. (2008)

167

RelA/NF-kappaB transcription factor associates with alpha-actinin-4. Exp Cell Res. 314, 1030–1038 126. Khurana, S., Chakraborty, S., Cheng, X., Su, Y. T., and Kao, H. Y. (2011) The actin- binding protein, actinin alpha 4 (ACTN4), is a nuclear receptor coactivator that promotes proliferation of MCF-7 breast cancer cells. J Biol Chem. 286, 1850–1859 127. Khurana, S., Chakraborty, S., Zhao, X., Liu, Y., Guan, D., Lam, M., Huang, W., Yang, S., and Kao, H. Y. (2012) Identification of a novel LXXLL motif in alpha- actinin 4-spliced isoform that is critical for its interaction with estrogen receptor alpha and co-activators. J Biol Chem. 287, 35418–35429 128. Khurana, S., Chakraborty, S., Lam, M., Liu, Y., Su, Y. T., Zhao, X., Saleem, M. A., Mathieson, P. W., Bruggeman, L. A., and Kao, H. Y. (2012) Familial focal segmental glomerulosclerosis (FSGS)-linked alpha-actinin 4 (ACTN4) protein mutants lose ability to activate transcription by nuclear hormone receptors. J Biol Chem. 287, 12027–12035 129. Didonato, J. A., Mercurio, F., and Karin, M. (2012) NF-κB and the link between inflammation and cancer. Immunol. Rev. 246, 379–400 130. Tornatore, L., Thotakura, A. K., Bennett, J., Moretti, M., and Franzoso, G. (2012) The nuclear factor kappa B signaling pathway: integrating metabolism with inflammation. Trends Cell Biol. 22, 557–566 131. Hayden, M. S., and Ghosh, S. (2004) Signaling to NF-kappaB. Genes Dev. 18, 2195–2224 132. Pikarsky, E., Porat, R. M., Stein, I., Abramovitch, R., Amit, S., Kasem, S., Gutkovich-Pyest, E., Urieli-Shoval, S., Galun, E., and Ben-Neriah, Y. (2004) NF- kappaB functions as a tumour promoter in inflammation-associated cancer. Nature. 431, 461–466 133. Karin, M., and Greten, F. R. (2005) NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol. 5, 749–759 134. Ghosh, G., van Duyne, G., Ghosh, S., and Sigler, P. B. (1995) Structure of NF-kappa B p50 homodimer bound to a kappa B site. Nature. 373, 303–310 135. Muller, C. W., and Harrison, S. C. (1995) The structure of the NF-kappa B p50:DNA-complex: a starting point for analyzing the Rel family. FEBS Lett. 369,

168

113–117 136. Muller, C. W., Rey, F. A., Sodeoka, M., Verdine, G. L., and Harrison, S. C. (1995) Structure of the NF-kappa B p50 homodimer bound to DNA. Nature. 373, 311–317 137. Chen, F. E., Huang, D. B., Chen, Y. Q., and Ghosh, G. (1998) Crystal structure of p50/p65 heterodimer of transcription factor NF-kappaB bound to DNA. Nature. 391, 410–413 138. Chen, Y. Q., Ghosh, S., and Ghosh, G. (1998) A novel DNA recognition mode by the NF-kappa B p65 homodimer. Nat Struct Biol. 5, 67–73 139. Huxford, T., Huang, D. B., Malek, S., and Ghosh, G. (1998) The crystal structure of the IkappaBalpha/NF-kappaB complex reveals mechanisms of NF-kappaB inactivation. Cell. 95, 759–770 140. Gilmore, T. D. (2006) Introduction to NF-kappaB: players, pathways, perspectives. Oncogene. 25, 6680–6684 141. Takeda, K., Kaisho, T., and Akira, S. (2003) Toll-like receptors. Annu Rev Immunol. 21, 335–376 142. Barton, G. M., and Medzhitov, R. (2003) Linking Toll-like receptors to IFN- alpha/beta expression. Nat Immunol. 4, 432–433 143. Karin, M., and Ben-Neriah, Y. (2000) Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev Immunol. 18, 621–663 144. Yaron, A., Gonen, H., Alkalay, I., Hatzubai, A., Jung, S., Beyth, S., Mercurio, F., Manning, A. M., Ciechanover, A., and Ben-Neriah, Y. (1997) Inhibition of NF- kappa-B cellular function via specific targeting of the I-kappa-B-ubiquitin ligase. EMBO J. 16, 6486–6494 145. Ben-Neriah, Y. (2002) Regulatory functions of ubiquitination in the immune system. Nat Immunol. 3, 20–26 146. Kearns, J. D., Basak, S., Werner, S. L., Huang, C. S., and Hoffmann, A. (2006) IkappaBepsilon provides negative feedback to control NF-kappaB oscillations, signaling dynamics, and inflammatory gene expression. J Cell Biol. 173, 659–664 147. Sun, S. C. (2011) Non-canonical NF-kappaB signaling pathway. Cell Res. 21, 71– 85 148. Razani, B., Reichardt, A. D., and Cheng, G. (2011) Non-canonical NF-kappaB

169

signaling activation and regulation: principles and perspectives. Immunol Rev. 244, 44–54 149. Naumann, M., and Scheidereit, C. (1994) Activation of NF-kappa B in vivo is regulated by multiple phosphorylations. EMBO J. 13, 4597–4607 150. Kiernan, R., Bres, V., Ng, R. W., Coudart, M. P., El Messaoudi, S., Sardet, C., Jin, D. Y., Emiliani, S., and Benkirane, M. (2003) Post-activation turn-off of NF-kappa B-dependent transcription is regulated by acetylation of p65. J Biol Chem. 278, 2758–2766 151. Chen, L. F., Mu, Y., and Greene, W. C. (2002) Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-kappaB. EMBO J. 21, 6539–6548 152. Zhou, H., Wertz, I., O’Rourke, K., Ultsch, M., Seshagiri, S., Eby, M., Xiao, W., and Dixit, V. M. (2004) Bcl10 activates the NF-kappaB pathway through ubiquitination of NEMO. Nature. 427, 167–171 153. Lu, T., and Stark, G. R. (2015) NF-kappaB: Regulation by Methylation. Cancer Res. 75, 3692–3695 154. Chen, L., Fischle, W., Verdin, E., and Greene, W. C. (2001) Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science. 293, 1653–1657 155. Greene, W. C., and Chen, L. F. (2004) Regulation of NF-kappaB action by reversible acetylation. Novartis Found Symp. 259, 208–225 156. Ito, K., Jazrawi, E., Cosio, B., Barnes, P. J., and Adcock, I. M. (2001) p65-activated histone acetyltransferase activity is repressed by glucocorticoids: mifepristone fails to recruit HDAC2 to the p65-HAT complex. J Biol Chem. 276, 30208–30215 157. Saccani, S., and Natoli, G. (2002) Dynamic changes in histone H3 Lys 9 methylation occurring at tightly regulated inducible inflammatory genes. Genes Dev. 16, 2219– 2224 158. Ashburner, B. P., Westerheide, S. D., and Baldwin Jr., A. S. (2001) The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol. 21, 7065–7077 159. Oeckinghaus, A., Hayden, M. S., and Ghosh, S. (2011) Crosstalk in NF-kappaB signaling pathways. Nat Immunol. 12, 695–708

170

160. Sanceau, J., Kaisho, T., Hirano, T., and Wietzerbin, J. (1995) Triggering of the human interleukin-6 gene by interferon-gamma and tumor necrosis factor-alpha in monocytic cells involves cooperation between interferon regulatory factor-1, NF kappa B, and Sp1 transcription factors. J Biol Chem. 270, 27920–27931 161. Liu, P., Kimmoun, E., Legrand, A., Sauvanet, A., Degott, C., Lardeux, B., and Bernuau, D. (2002) Activation of NF-kappa B, AP-1 and STAT transcription factors is a frequent and early event in human hepatocellular carcinomas. J Hepatol. 37, 63– 71 162. Karin, M., Takahashi, T., Kapahi, P., Delhase, M., Chen, Y., Makris, C., Rothwarf, D., Baud, V., Natoli, G., Guido, F., and Li, N. (2001) Oxidative stress and gene expression: the AP-1 and NF-kappaB connections. Biofactors. 15, 87–89 163. Sif, S., and Gilmore, T. D. (1994) Interaction of the v-Rel oncoprotein with cellular transcription factor Sp1. J Virol. 68, 7131–7138 164. Kuang, P. P., Berk, J. L., Rishikof, D. C., Foster, J. A., Humphries, D. E., Ricupero, D. A., and Goldstein, R. H. (2002) NF-kappaB induced by IL-1beta inhibits elastin transcription and myofibroblast phenotype. Am J Physiol Cell Physiol. 283, C58-65 165. Fujioka, S., Niu, J., Schmidt, C., Sclabas, G. M., Peng, B., Uwagawa, T., Li, Z., Evans, D. B., Abbruzzese, J. L., and Chiao, P. J. (2004) NF-kappaB and AP-1 connection: mechanism of NF-kappaB-dependent regulation of AP-1 activity. Mol Cell Biol. 24, 7806–7819 166. Stein, B., and Baldwin Jr., A. S. (1993) Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF- kappa B. Mol Cell Biol. 13, 7191–7198 167. Xia, C., Cheshire, J. K., Patel, H., and Woo, P. (1997) Cross-talk between transcription factors NF-kappa B and C/EBP in the transcriptional regulation of genes. Int J Biochem Cell Biol. 29, 1525–1539 168. Smoak, K. A., and Cidlowski, J. A. (2004) Mechanisms of glucocorticoid receptor signaling during inflammation. Mech Ageing Dev. 125, 697–706 169. Almawi, W. Y., and Melemedjian, O. K. (2002) Negative regulation of nuclear factor-kappaB activation and function by glucocorticoids. J Mol Endocrinol. 28, 69– 78

171

170. Stahn, C., Lowenberg, M., Hommes, D. W., and Buttgereit, F. (2007) Molecular mechanisms of glucocorticoid action and selective glucocorticoid receptor agonists. Mol Cell Endocrinol. 275, 71–78 171. Zhang, H., and Sun, S. C. (2015) NF-kappaB in inflammation and renal diseases. Cell Biosci. 5, 63 172. Sanz, A. B., Sanchez-Nino, M. D., Ramos, A. M., Moreno, J. A., Santamaria, B., Ruiz-Ortega, M., Egido, J., and Ortiz, A. (2010) NF-kappaB in renal inflammation. J Am Soc Nephrol. 21, 1254–1262 173. Mudge, S. J., Paizis, K., Auwardt, R. B., Thomas, R. J., and Power, D. A. (2001) Activation of nuclear factor-kappa B by podocytes in the autologous phase of passive Heymann nephritis. Kidney Int. 59, 923–931 174. Hussain, S., Romio, L., Saleem, M., Mathieson, P., Serrano, M., Moscat, J., Diaz- Meco, M., Scambler, P., and Koziell, A. (2009) Nephrin deficiency activates NF- kappaB and promotes glomerular injury. J Am Soc Nephrol. 20, 1733–1743 175. Schonenberger, E., Ehrich, J. H., Haller, H., and Schiffer, M. (2011) The podocyte as a direct target of immunosuppressive agents. Nephrol Dial Transpl. 26, 18–24 176. Panzer, U., Steinmetz, O. M., Turner, J. E., Meyer-Schwesinger, C., von Ruffer, C., Meyer, T. N., Zahner, G., Gomez-Guerrero, C., Schmid, R. M., Helmchen, U., Moeckel, G. W., Wolf, G., Stahl, R. A., and Thaiss, F. (2009) Resolution of renal inflammation: a new role for NF-kappaB1 (p50) in inflammatory kidney diseases. Am J Physiol Ren. Physiol. 297, F429-39 177. Cao, C., Wang, S., Fan, L., Wan, X., Liu, X., and Chen, X. (2010) Renal protection by ischemic preconditioning is associated with p50/p50 homodimers. Am J Nephrol. 31, 1–8 178. Duque, N., Gomez-Guerrero, C., and Egido, J. (1997) Interaction of IgA with Fc alpha receptors of human mesangial cells activates transcription factor nuclear factor-kappa B and induces expression and synthesis of monocyte chemoattractant protein-1, IL-8, and IFN-inducible protein 10. J Immunol. 159, 3474–3482 179. Danilewicz, M., and Wagrowska-Danilewicz, M. (2012) Tubular NF-κB is overexpressed in proteinuric patients with IgA nephropathy. Folia Histochem Cytobiol. 50, 93–98

172

180. Henke, N., Schmidt-Ullrich, R., Dechend, R., Park, J. K., Qadri, F., Wellner, M., Obst, M., Gross, V., Dietz, R., Luft, F. C., Scheidereit, C., and Muller, D. N. (2007) Vascular endothelial cell-specific NF-kappaB suppression attenuates hypertension- induced renal damage. Circ Res. 101, 268–276 181. Kiryluk, K., and Novak, J. (2014) The genetics and immunobiology of IgA nephropathy. J Clin Invest. 124, 2325–2332 182. Coppo, R., and Amore, A. (2004) Aberrant glycosylation in IgA nephropathy (IgAN). Kidney Int. 65, 1544–1547 183. Ruiz-Ortega, M., Lorenzo, O., Ruperez, M., Blanco, J., and Egido, J. (2001) Systemic infusion of angiotensin II into normal rats activates nuclear factor-kappaB and AP-1 in the kidney: role of AT(1) and AT(2) receptors. Am J Pathol. 158, 1743– 1756 184. Ruiz-Ortega, M., Ruperez, M., Lorenzo, O., Esteban, V., Blanco, J., Mezzano, S., and Egido, J. (2002) Angiotensin II regulates the synthesis of proinflammatory cytokines and chemokines in the kidney. Kidney Int Suppl. 10.1046/j.1523- 1755.62.s82.4.x 185. Arumugam, S., Sreedhar, R., Thandavarayan, R. A., Karuppagounder, V., Krishnamurthy, P., Suzuki, K., Nakamura, M., and Watanabe, K. (2016) Angiotensin receptor blockers: Focus on cardiac and renal injury. Trends Cardiovasc Med. 26, 221–228 186. Zhang, F., Siow, Y. L., and O, K. (2004) Hyperhomocysteinemia activates NF- kappaB and inducible nitric oxide synthase in the kidney. Kidney Int. 65, 1327–1338 187. Tesch, G. H., Yang, N., Yu, H., Lan, H. Y., Foti, R., Chadban, S. J., Atkins, R. C., and Nikolic-Paterson, D. J. (1997) Intrinsic renal cells are the major source of interleukin-1 beta synthesis in normal and diseased rat kidney. Nephrol Dial Transpl. 12, 1109–1115 188. Tesch, G. H. (2008) MCP-1/CCL2: a new diagnostic marker and therapeutic target for progressive renal injury in diabetic nephropathy. Am J Physiol Ren. Physiol. 294, F697-701 189. Sakurai, H., Hisada, Y., Ueno, M., Sugiura, M., Kawashima, K., and Sugita, T. (1996) Activation of transcription factor NF-kappa B in experimental

173

glomerulonephritis in rats. Biochim Biophys Acta. 1316, 132–138 190. Valanciute, A., le Gouvello, S., Solhonne, B., Pawlak, A., Grimbert, P., Lyonnet, L., Hue, S., Lang, P., Remy, P., Salomon, R., Bensman, A., Guellaen, G., and Sahali, D. (2004) NF-kappa B p65 antagonizes IL-4 induction by c-maf in minimal change nephrotic syndrome. J Immunol. 172, 688–698 191. Mezzano, S., Aros, C., Droguett, A., Burgos, M. E., Ardiles, L., Flores, C., Schneider, H., Ruiz-Ortega, M., and Egido, J. (2004) NF-kappaB activation and overexpression of regulated genes in human diabetic nephropathy. Nephrol Dial Transpl. 19, 2505–2512 192. Mohamed, A. K., Bierhaus, A., Schiekofer, S., Tritschler, H., Ziegler, R., and Nawroth, P. P. (1999) The role of oxidative stress and NF-kappaB activation in late diabetic complications. Biofactors. 10, 157–167 193. Rangan, G. K., Nguyen, T., Mainra, R., Succar, L., Schwensen, K. G., Burgess, J. S., and Ho, K. O. (2009) Therapeutic role of sirolimus in non-transplant kidney disease. Pharmacol. Ther. 123, 187–206 194. Martinka, S., and Bruggeman, L. A. (2006) Persistent NF-kappaB activation in renal epithelial cells in a mouse model of HIV-associated nephropathy. Am J Physiol Ren. Physiol. 290, F657-65 195. Bruggeman, L. A., Drawz, P. E., Kahoud, N., Lin, K., Barisoni, L., and Nelson, P. J. (2011) TNFR2 interposes the proliferative and NF-kappaB-mediated inflammatory response by podocytes to TNF-alpha. Lab Invest. 91, 413–425 196. Ross, M. J., Martinka, S., D’Agati, V. D., and Bruggeman, L. A. (2005) NF-kappaB regulates Fas-mediated apoptosis in HIV-associated nephropathy. J Am Soc Nephrol. 16, 2403–2411 197. Zhang, H., Ding, J., Fan, Q., and Liu, S. (2009) TRPC6 up-regulation in Ang II- induced podocyte apoptosis might result from ERK activation and NF-kappaB translocation. Exp Biol Med. 234, 1029–1036 198. Shimo, T., Adachi, Y., Yamanouchi, S., Tsuji, S., Kimata, T., Umezawa, K., Okigaki, M., Takaya, J., Ikehara, S., and Kaneko, K. (2013) A novel nuclear factor ??b inhibitor, dehydroxymethylepoxyquinomicin, ameliorates puromycin aminonucleoside-induced nephrosis in mice. Am. J. Nephrol. 37, 302–309

174

199. Beins, N. T., and Dell, K. M. (2015) Long-Term Outcomes in Children with Steroid- Resistant Nephrotic Syndrome Treated with Calcineurin Inhibitors. Front Pediatr. 3, 104 200. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) The nuclear receptor superfamily: the second decade. Cell. 83, 835–839 201. Aranda, A., and Pascual, A. (2001) Nuclear hormone receptors and gene expression. Physiol Rev. 81, 1269–1304 202. Kliewer, S. A., Lehmann, J. M., and Willson, T. M. (1999) Orphan nuclear receptors: shifting endocrinology into reverse. Science. 284, 757–760 203. Bridgham, J. T., Eick, G. N., Larroux, C., Deshpande, K., Harms, M. J., Gauthier, M. E., Ortlund, E. A., Degnan, B. M., and Thornton, J. W. (2010) Protein evolution by molecular tinkering: diversification of the nuclear receptor superfamily from a ligand-dependent ancestor. PLoS Biol. 10.1371/journal.pbio.1000497 204. Katugampola, S. D., Maguire, J. J., Kuc, R. E., Wiley, K. E., and Davenport, A. P. (2002) Discovery of recently adopted orphan receptors for apelin, urotensin II, and ghrelin identified using novel radioligands and functional role in the human cardiovascular system. Can J Physiol Pharmacol. 80, 369–374 205. Oakley, R. H., and Cidlowski, J. A. (2011) Cellular processing of the glucocorticoid receptor gene and protein: new mechanisms for generating tissue-specific actions of glucocorticoids. J Biol Chem. 286, 3177–3184 206. Revollo, J. R., and Cidlowski, J. A. (2009) Mechanisms generating diversity in glucocorticoid receptor signaling. Ann N Y Acad Sci. 1179, 167–178 207. Otto, C., Reichardt, H. M., and Schutz, G. (1997) Absence of glucocorticoid receptor-beta in mice. J Biol Chem. 272, 26665–26668 208. Schaaf, M. J., Champagne, D., van Laanen, I. H., van Wijk, D. C., Meijer, A. H., Meijer, O. C., Spaink, H. P., and Richardson, M. K. (2008) Discovery of a functional glucocorticoid receptor beta-isoform in zebrafish. Endocrinology. 149, 1591–1599 209. Beger, C., Gerdes, K., Lauten, M., Tissing, W. J., Fernandez-Munoz, I., Schrappe, M., and Welte, K. (2003) Expression and structural analysis of glucocorticoid receptor isoform gamma in human leukaemia cells using an isoform-specific real-

175

time polymerase chain reaction approach. Br J Haematol. 122, 245–252 210. Dieken, E. S., and Miesfeld, R. L. (1992) Transcriptional transactivation functions localized to the glucocorticoid receptor N terminus are necessary for steroid induction of lymphocyte apoptosis. Mol Cell Biol. 12, 589–597 211. Danielian, P. S., White, R., Lees, J. A., and Parker, M. G. (1992) Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11, 1025–1033 212. Kumar, R., and Thompson, E. B. (2003) Transactivation functions of the N-terminal domains of nuclear hormone receptors: protein folding and coactivator interactions. Mol Endocrinol. 17, 1–10 213. Bledsoe, R. K., Montana, V. G., Stanley, T. B., Delves, C. J., Apolito, C. J., McKee, D. D., Consler, T. G., Parks, D. J., Stewart, E. L., Willson, T. M., Lambert, M. H., Moore, J. T., Pearce, K. H., and Xu, H. E. (2002) Crystal structure of the glucocorticoid receptor ligand binding domain reveals a novel mode of receptor dimerization and coactivator recognition. Cell. 110, 93–105 214. Bledsoe, R. K., Stewart, E. L., and Pearce, K. H. (2004) Structure and function of the glucocorticoid receptor ligand binding domain. Vitam Horm. 68, 49–91 215. Garza, A. S., Khan, S. H., Moure, C. M., Edwards, D. P., and Kumar, R. (2011) Binding-folding induced regulation of AF1 transactivation domain of the glucocorticoid receptor by a cofactor that binds to its DNA binding domain. PLoS One. 10.1371/journal.pone.0025875 216. Kumar, R., and Thompson, E. B. (2005) Gene regulation by the glucocorticoid receptor: Structure:function relationship. J. Steroid Biochem. Mol. Biol. 94, 383– 394 217. Biddie, S. C., and Hager, G. L. (2009) Glucocorticoid receptor dynamics and gene regulation. Stress. 12, 193–205 218. Heery, D. M., Kalkhoven, E., Hoare, S., and Parker, M. G. (1997) A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature. 387, 733–736 219. Torchia, J., Glass, C., and Rosenfeld, M. G. (1998) Co-activators and co-repressors in the integration of transcriptional responses. Curr. Opin. Cell Biol. 10, 373–383

176

220. Ramamoorthy, S., and Cidlowski, J. A. (2013) Ligand-induced repression of the glucocorticoid receptor gene is mediated by an NCoR1 repression complex formed by long-range chromatin interactions with intragenic glucocorticoid response elements. Mol Cell Biol. 33, 1711–1722 221. Guenther, M. G., Barak, O., and Lazar, M. A. (2001) The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Mol Cell Biol. 21, 6091–6101 222. Chen, J. D., and Evans, R. M. (1995) A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature. 377, 454–457 223. Vandevyver, S., Dejager, L., and Libert, C. (2012) On the trail of the glucocorticoid receptor: into the nucleus and back. Traffic. 13, 364–374 224. Picard, D., Khursheed, B., Garabedian, M. J., Fortin, M. G., Lindquist, S., and Yamamoto, K. R. (1990) Reduced levels of hsp90 compromise steroid receptor action in vivo. Nature. 348, 166–168 225. Ricketson, D., Hostick, U., Fang, L., Yamamoto, K. R., and Darimont, B. D. (2007) A conformational switch in the ligand-binding domain regulates the dependence of the glucocorticoid receptor on Hsp90. J Mol Biol. 368, 729–741 226. Chandler, V. L., Maler, B. A., and Yamamoto, K. R. (1983) DNA sequences bound specifically by glucocorticoid receptor in vitro render a heterologous promoter hormone responsive in vivo. Cell. 33, 489–499 227. Starick, S. R., Ibn-Salem, J., Jurk, M., Hernandez, C., Love, M. I., Chung, H. R., Vingron, M., Thomas-Chollier, M., and Meijsing, S. H. (2015) ChIP-exo signal associated with DNA-binding motifs provides insight into the genomic binding of the glucocorticoid receptor and cooperating transcription factors. Genome Res. 25, 825–835 228. Khan, S. H., Ling, J., and Kumar, R. (2011) TBP binding-induced folding of the glucocorticoid receptor AF1 domain facilitates its interaction with steroid receptor coactivator-1. PLoS One. 6, e21939 229. Fonte, C., Grenier, J., Trousson, A., Chauchereau, A., Lahuna, O., Baulieu, E. E., Schumacher, M., and Massaad, C. (2005) Involvement of {beta}-catenin and unusual behavior of CBP and p300 in glucocorticosteroid signaling in Schwann cells.

177

Proc Natl Acad Sci U S A. 102, 14260–14265 230. Darimont, B. D., Wagner, R. L., Apriletti, J. W., Stallcup, M. R., Kushner, P. J., Baxter, J. D., Fletterick, R. J., and Yamamoto, K. R. (1998) Structure and specificity of nuclear receptor-coactivator interactions. Genes Dev. 12, 3343–3356 231. Li, X., Wong, J., Tsai, S. Y., Tsai, M. J., and O’Malley, B. W. (2003) Progesterone and glucocorticoid receptors recruit distinct coactivator complexes and promote distinct patterns of local chromatin modification. Mol Cell Biol. 23, 3763–3773 232. Ronacher, K., Hadley, K., Avenant, C., Stubsrud, E., Simons Jr., S. S., Louw, A., and Hapgood, J. P. (2009) Ligand-selective transactivation and transrepression via the glucocorticoid receptor: role of cofactor interaction. Mol Cell Endocrinol. 299, 219–231 233. Burnstein, K. L., Jewell, C. M., and Cidlowski, J. A. (1990) Human glucocorticoid receptor cDNA contains sequences sufficient for receptor down-regulation. J Biol Chem. 265, 7284–7291 234. Hudson, W. H., Youn, C., and Ortlund, E. A. (2013) The structural basis of direct glucocorticoid-mediated transrepression. Nat Struct Mol Biol. 20, 53–58 235. Hua, G., Paulen, L., and Chambon, P. (2016) GR SUMOylation and formation of an SUMO-SMRT/NCoR1-HDAC3 repressing complex is mandatory for GC-induced IR nGRE-mediated transrepression. Proc Natl Acad Sci U S A. 113, E626-34 236. Kassel, O., and Herrlich, P. (2007) Crosstalk between the glucocorticoid receptor and other transcription factors: molecular aspects. Mol Cell Endocrinol. 275, 13–29 237. Ito, K., Yamamura, S., Essilfie-Quaye, S., Cosio, B., Ito, M., Barnes, P. J., and Adcock, I. M. (2006) Histone deacetylase 2-mediated deacetylation of the glucocorticoid receptor enables NF-kappaB suppression. J Exp Med. 203, 7–13 238. De Bosscher, K., Vanden Berghe, W., Vermeulen, L., Plaisance, S., Boone, E., and Haegeman, G. (2000) Glucocorticoids repress NF-kappaB-driven genes by disturbing the interaction of p65 with the basal transcription machinery, irrespective of coactivator levels in the cell. Proc Natl Acad Sci U S A. 97, 3919–3924 239. Miner, J. N., Diamond, M. I., and Yamamoto, K. R. (1991) Joints in the regulatory lattice: composite regulation by steroid receptor-AP1 complexes. Cell Growth Differ. 2, 525–530

178

240. Ratman, D., Vanden Berghe, W., Dejager, L., Libert, C., Tavernier, J., Beck, I. M., and De Bosscher, K. (2013) How glucocorticoid receptors modulate the activity of other transcription factors: A scope beyond tethering. Mol. Cell. Endocrinol. 380, 41–54 241. Boumpas, D. T., Chrousos, G. P., Wilder, R. L., Cupps, T. R., and Balow, J. E. (1993) Glucocorticoid therapy for immune-mediated diseases: basic and clinical correlates. Ann Intern Med. 119, 1198–1208 242. Balsalobre, A., Brown, S. A., Marcacci, L., Tronche, F., Kellendonk, C., Reichardt, H. M., Schutz, G., and Schibler, U. (2000) Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science. 289, 2344–2347 243. Nader, N., Chrousos, G. P., and Kino, T. (2009) Circadian rhythm transcription factor CLOCK regulates the transcriptional activity of the glucocorticoid receptor by acetylating its hinge region lysine cluster: potential physiological implications. FASEB J. 23, 1572–1583 244. Seckl, J. R., and Walker, B. R. (2001) Minireview: 11beta-Hydroxysteroid Dehydrogenase Type 1- A Tissue-Specific Amplifier of Glucocorticoid Action. Endocrinology. 142, 1371–1376 245. Baschant, U., Lane, N. E., and Tuckermann, J. (2012) The multiple facets of glucocorticoid action in rheumatoid arthritis. Nat Rev Rheumatol. 8, 645–655 246. Buttgereit, F. (2012) A fresh look at glucocorticoids how to use an old ally more effectively. Bull NYU Hosp Jt Dis. 70 Suppl 1, 26–29 247. Perogamvros, I., Kayahara, M., Trainer, P. J., and Ray, D. W. (2011) Serum regulates cortisol bioactivity by corticosteroid-binding globulin-dependent and independent mechanisms, as revealed by combined bioassay and physicochemical assay approaches. Clin Endocrinol. 75, 31–38 248. Coutinho, A. E., and Chapman, K. E. (2011) The anti-inflammatory and immunosuppressive effects of glucocorticoids, recent developments and mechanistic insights. Mol Cell Endocrinol. 335, 2–13 249. Inaba, H., and Pui, C. H. (2010) Glucocorticoid use in acute lymphoblastic leukaemia. Lancet Oncol. 11, 1096–1106 250. Fan, Z., Sehm, T., Rauh, M., Buchfelder, M., Eyupoglu, I. Y., and Savaskan, N. E.

179

(2014) Dexamethasone alleviates tumor-associated brain damage and angiogenesis. PLoS One. 9, e93264 251. Villeneuve, J., Galarneau, H., Beaudet, M. J., Tremblay, P., Chernomoretz, A., and Vallieres, L. (2008) Reduced glioma growth following dexamethasone or anti- angiopoietin 2 treatment. Brain Pathol. 18, 401–414 252. Das, A., Banik, N. L., Patel, S. J., and Ray, S. K. (2004) Dexamethasone protected human glioblastoma U87MG cells from temozolomide induced apoptosis by maintaining Bax:Bcl-2 ratio and preventing proteolytic activities. Mol Cancer. 3, 36 253. Paakinaho, V., Kaikkonen, S., Makkonen, H., Benes, V., and Palvimo, J. J. (2014) SUMOylation regulates the chromatin occupancy and anti-proliferative gene programs of glucocorticoid receptor. Nucleic Acids Res. 42, 1575–1592 254. Haack, D., Scharer, K., Asam-Tauscher, A., and Vecsei, P. (1999) Glucocorticoid receptors in idiopathic nephrotic syndrome. Pediatr Nephrol. 13, 653–656 255. Carlotti, A. P., Franco, P. B., Elias, L. L., Facincani, I., Costa, E. L., Foss, N., Moreira, A. C., and de Castro, M. (2004) Glucocorticoid receptors, in vitro steroid sensitivity, and cytokine secretion in idiopathic nephrotic syndrome. Kidney Int. 65, 403–408 256. Clement, L. C., Avila-Casado, C., Mace, C., Soria, E., Bakker, W. W., Kersten, S., and Chugh, S. S. (2011) Podocyte-secreted angiopoietin-like-4 mediates proteinuria in glucocorticoid-sensitive nephrotic syndrome. Nat Med. 17, 117–122 257. Yu, C. Y., Mayba, O., Lee, J. V, Tran, J., Harris, C., Speed, T. P., and Wang, J. C. (2010) Genome-wide analysis of glucocorticoid receptor binding regions in adipocytes reveal gene network involved in triglyceride homeostasis. PLoS One. 5, e15188 258. Kuo, T., Lew, M. J., Mayba, O., Harris, C. A., Speed, T. P., and Wang, J. C. (2012) Genome-wide analysis of glucocorticoid receptor-binding sites in myotubes identifies gene networks modulating insulin signaling. Proc Natl Acad Sci U S A. 109, 11160–11165 259. Uhlenhaut, N. H., Barish, G. D., Yu, R. T., Downes, M., Karunasiri, M., Liddle, C., Schwalie, P., Hubner, N., and Evans, R. M. (2013) Insights into negative regulation by the glucocorticoid receptor from genome-wide profiling of inflammatory

180

cistromes. Mol Cell. 49, 158–171 260. So, A. Y., Chaivorapol, C., Bolton, E. C., Li, H., and Yamamoto, K. R. (2007) Determinants of cell- and gene-specific transcriptional regulation by the glucocorticoid receptor. PLoS Genet. 3, e94 261. Reddy, T. E., Pauli, F., Sprouse, R. O., Neff, N. F., Newberry, K. M., Garabedian, M. J., and Myers, R. M. (2009) Genomic determination of the glucocorticoid response reveals unexpected mechanisms of gene regulation. Genome Res. 19, 2163–2171 262. John, S., Sabo, P. J., Thurman, R. E., Sung, M. H., Biddie, S. C., Johnson, T. A., Hager, G. L., and Stamatoyannopoulos, J. A. (2011) Chromatin accessibility pre- determines glucocorticoid receptor binding patterns. Nat Genet. 43, 264–268 263. Rogatsky, I., Wang, J. C., Derynck, M. K., Nonaka, D. F., Khodabakhsh, D. B., Haqq, C. M., Darimont, B. D., Garabedian, M. J., and Yamamoto, K. R. (2003) Target-specific utilization of transcriptional regulatory surfaces by the glucocorticoid receptor. Proc Natl Acad Sci U S A. 100, 13845–13850 264. Yoshikawa, N., Nagasaki, M., Sano, M., Tokudome, S., Ueno, K., Shimizu, N., Imoto, S., Miyano, S., Suematsu, M., Fukuda, K., Morimoto, C., and Tanaka, H. (2009) Ligand-based gene expression profiling reveals novel roles of glucocorticoid receptor in cardiac metabolism. Am J Physiol Endocrinol Metab. 296, E1363-73 265. Picard, D., Kumar, V., Chambon, P., and Yamamoto, K. R. (1990) Signal transduction by steroid hormones: nuclear localization is differentially regulated in estrogen and glucocorticoid receptors. Cell Regul. 1, 291–299 266. Tsurufuji, S., Sugio, K., and Takemasa, F. (1979) The role of glucocorticoid receptor and gene expression in the anti-inflammatory action of dexamethasone. Nature. 280, 408–410 267. Ransom, R. F., Lam, N. G., Hallett, M. A., Atkinson, S. J., and Smoyer, W. E. (2005) Glucocorticoids protect and enhance recovery of cultured murine podocytes via actin filament stabilization. Kidney Int. 68, 2473–2483 268. Yan, K., Kudo, A., Hirano, H., Watanabe, T., Tasaka, T., Kataoka, S., Nakajima, N., Nishibori, Y., Shibata, T., Kohsaka, T., Higashihara, E., Tanaka, H., Watanabe, H., Nagasawa, T., and Awa, S. (1999) Subcellular localization of glucocorticoid

181

receptor protein in the human kidney glomerulus. Kidney Int. 56, 65–73 269. Xing, C. Y., Saleem, M. A., Coward, R. J., Ni, L., Witherden, I. R., and Mathieson, P. W. (2006) Direct effects of dexamethasone on human podocytes. Kidney Int. 70, 1038–1045 270. Asanuma, K., and Mundel, P. (2003) The role of podocytes in glomerular pathobiology. Clin Exp Nephrol. 7, 255–259 271. Patrakka, J., and Tryggvason, K. (2009) New insights into the role of podocytes in proteinuria. Nat Rev Nephrol. 5, 463–468 272. Stirling, C. M., Mathieson, P., Boulton-Jones, J. M., Feehally, J., Jayne, D., Murray, H. M., and Adu, D. (2005) Treatment and outcome of adult patients with primary focal segmental glomerulosclerosis in five UK renal units. QJM. 98, 443–449 273. Caridi, G., Bertelli, R., Carrea, A., Di Duca, M., Catarsi, P., Artero, M., Carraro, M., Zennaro, C., Candiano, G., Musante, L., Seri, M., Ginevri, F., Perfumo, F., and Ghiggeri, G. M. (2001) Prevalence, genetics, and clinical features of patients carrying podocin mutations in steroid-resistant nonfamilial focal segmental glomerulosclerosis. J Am Soc Nephrol. 12, 2742–2746 274. Faul, C. (2014) The podocyte cytoskeleton: Key to a functioning glomerulus in health and disease. in Podocytopathy, pp. 22–53, 183, 22–53 275. Savin, V. J., Sharma, R., Sharma, M., McCarthy, E. T., Swan, S. K., Ellis, E., Lovell, H., Warady, B., Gunwar, S., Chonko, A. M., Artero, M., and Vincenti, F. (1996) Circulating factor associated with increased glomerular permeability to albumin in recurrent focal segmental glomerulosclerosis. N Engl J Med. 334, 878–883 276. McCarthy, E. T., Sharma, M., and Savin, V. J. (2010) Circulating permeability factors in idiopathic nephrotic syndrome and focal segmental glomerulosclerosis. Clin J Am Soc Nephrol. 5, 2115–2121 277. Zagury, A., Oliveira, A. L., Montalvao, J. A., Novaes, R. H., Sa, V. M., Moraes, C. A., and Tavares Mde, S. (2013) Steroid-resistant idiopathic nephrotic syndrome in children: long-term follow-up and risk factors for end-stage renal disease. J Bras Nefrol. 35, 191–199 278. van Husen, M., and Kemper, M. J. (2011) New therapies in steroid-sensitive and steroid-resistant idiopathic nephrotic syndrome. Pediatr Nephrol. 26, 881–892

182

279. Hodson, E. M., Willis, N. S., and Craig, J. C. (2007) Corticosteroid therapy for nephrotic syndrome in children. Cochrane Database Syst Rev. 10.1002/14651858.CD001533.pub4 280. Lieberman, K. V, and Tejani, A. (1996) A randomized double-blind placebo- controlled trial of cyclosporine in steroid-resistant idiopathic focal segmental glomerulosclerosis in children. J Am Soc Nephrol. 7, 56–63 281. Najafi, C. C., Korbet, S. M., Lewis, E. J., Schwartz, M. M., Reichlin, M., Evans, J., and Lupus Nephritis Collaborative Study, G. (2001) Significance of histologic patterns of glomerular injury upon long-term prognosis in severe lupus glomerulonephritis. Kidney Int. 59, 2156–2163 282. Valeri, A., Barisoni, L., Appel, G. B., Seigle, R., and D’Agati, V. (1996) Idiopathic collapsing focal segmental glomerulosclerosis: a clinicopathologic study. Kidney Int. 50, 1734–1746 283. Detwiler, R. K., Falk, R. J., Hogan, S. L., and Jennette, J. C. (1994) Collapsing glomerulopathy: a clinically and pathologically distinct variant of focal segmental glomerulosclerosis. Kidney Int. 45, 1416–1424 284. Korbet, S. M. (2012) Treatment of primary FSGS in adults. J Am Soc Nephrol. 23, 1769–1776 285. Ransom, R. F., Vega-Warner, V., Smoyer, W. E., and Klein, J. (2005) Differential proteomic analysis of proteins induced by glucocorticoids in cultured murine podocytes. Kidney Int. 67, 1275–1285 286. Cheng, X., Zhao, X., Khurana, S., Bruggeman, L. A., and Kao, H. Y. (2013) Microarray analyses of glucocorticoid and vitamin D3 target genes in differentiating cultured human podocytes. PLoS One. 8, e60213 287. Huang, Y., Border, W. A., Yu, L., Zhang, J., Lawrence, D. A., and Noble, N. A. (2008) A PAI-1 mutant, PAI-1R, slows progression of diabetic nephropathy. J Am Soc Nephrol. 19, 329–338 288. Villa, L., Boor, P., Konieczny, A., Kunter, U., van Roeyen, C. R., Denecke, B., Gan, L., Neusser, M. A., Cohen, C. D., Consortium, E., Eitner, F., Scholl, T., Ostendorf, T., and Floege, J. (2013) Late angiotensin II receptor blockade in progressive rat mesangioproliferative glomerulonephritis: new insights into mechanisms. J Pathol.

183

229, 672–684 289. Huang, Z., Zhang, L., Chen, Y., Zhang, H., Yu, C., Zhou, F., Zhang, Z., Jiang, L., Li, R., Ma, J., Li, Z., Lai, Y., Lin, T., Zhao, X., Zhang, Q., Zhang, B., Ye, Z., Liu, S., Wang, W., Liang, X., Liao, R., and Shi, W. (2016) RhoA deficiency disrupts podocyte cytoskeleton and induces podocyte apoptosis by inhibiting YAP/dendrin signal. BMC Nephrol. 17, 66 290. Wada, T., Pippin, J. W., Marshall, C. B., Griffin, S. V, and Shankland, S. J. (2005) Dexamethasone prevents podocyte apoptosis induced by puromycin aminonucleoside: role of p53 and Bcl-2-related family proteins. J Am Soc Nephrol. 16, 2615–2625 291. LIU, H., GAO, X., XU, H., FENG, C., KUANG, X., LI, Z., and ZHA, X. (2012) ?- Actinin-4 is involved in the process by which dexamethasone protects actin cytoskeleton stabilization from adriamycin-induced podocyte injury. Nephrology. 17, 669–675 292. Nijenhuis, T., Sloan, A. J., Hoenderop, J. G. J., Flesche, J., Van Goor, H., Kistler, A. D., Bakker, M., Bindels, R. J. M., De Boer, R. A., Möller, C. C., Hamming, I., Navis, G., Wetzels, J. F. M., Berden, J. H. M., Reiser, J., Faul, C., and Van Der Vlag, J. (2011) Angiotensin II contributes to podocyte injury by increasing TRPC6 expression via an NFAT-mediated positive feedback signaling pathway. Am. J. Pathol. 179, 1719–1732 293. Wang, Z., Wei, X., Zhang, Y., Ma, X., Li, B., Zhang, S., Du, P., Zhang, X., and Yi, F. (2009) NADPH oxidase-derived ROS contributes to upregulation of TRPC6 expression in puromycin aminonucleoside-induced podocyte injury. Cell Physiol Biochem. 24, 619–626 294. Yu, S., and Yu, L. (2012) Dexamethasone Resisted Podocyte Injury via Stabilizing TRPC6 Expression and Distribution. Evid Based Complement Altern. Med. 2012, 652059 295. Moller, C. C., Wei, C., Altintas, M. M., Li, J., Greka, A., Ohse, T., Pippin, J. W., Rastaldi, M. P., Wawersik, S., Schiavi, S., Henger, A., Kretzler, M., Shankland, S. J., and Reiser, J. (2007) Induction of TRPC6 channel in acquired forms of proteinuric kidney disease. J Am Soc Nephrol. 18, 29–36

184

296. Morigi, M., Buelli, S., Angioletti, S., Zanchi, C., Longaretti, L., Zoja, C., Galbusera, M., Gastoldi, S., Mundel, P., Remuzzi, G., and Benigni, A. (2005) In response to protein load podocytes reorganize cytoskeleton and modulate endothelin-1 gene: implication for permselective dysfunction of chronic nephropathies. Am. J. Pathol. 166, 1309–20 297. Yoshida, S., Nagase, M., Shibata, S., and Fujita, T. (2008) Podocyte injury induced by albumin overload in vivo and in vitro: Involvement of TGF-beta and p38 MAPK. Nephron - Exp. Nephrol. 10.1159/000124236 298. Agrawal, S., Guess, A. J., Chanley, M. A., and Smoyer, W. E. (2014) Albumin- induced podocyte injury and protection are associated with regulation of COX-2. Kidney Int. 86, 1150–1160 299. Kawamura, T., Yoshioka, T., Bills, T., Fogo, A., and Ichikawa, I. (1991) Glucocorticoid activates glomerular antioxidant enzymes and protects glomeruli from oxidant injuries. Kidney Int. 40, 291–301 300. Wan, X., Chen, Z., Choi, W. I., Gee, H. Y., Hildebrandt, F., and Zhou, W. (2016) Loss of Epithelial Membrane Protein 2 Aggravates Podocyte Injury via Upregulation of Caveolin-1. J Am Soc Nephrol. 27, 1066–1075 301. Meyer-Schwesinger, C., Dehde, S., von Ruffer, C., Gatzemeier, S., Klug, P., Wenzel, U. O., Stahl, R. A., Thaiss, F., and Meyer, T. N. (2009) Rho kinase inhibition attenuates LPS-induced renal failure in mice in part by attenuation of NF-kappaB p65 signaling. Am J Physiol Ren. Physiol. 296, F1088-99 302. Liu, H., Gao, X., Xu, H., Feng, C., Kuang, X., Li, Z., and Zha, X. (2012) alpha- Actinin-4 is involved in the process by which dexamethasone protects actin cytoskeleton stabilization from adriamycin-induced podocyte injury. Nephrol. 17, 669–675 303. Masaki, T., Stambe, C., Hill, P. A., Dowling, J., Atkins, R. C., and Nikolic-Paterson, D. J. (2004) Activation of the extracellular-signal regulated protein kinase pathway in human glomerulopathies. J Am Soc Nephrol. 15, 1835–1843 304. Yu-Shengyou, and Li, Y. (2013) Dexamethasone inhibits podocyte apoptosis by stabilizing the PI3K/Akt signal pathway. Biomed Res. Int. 2013, 326986 305. Zhang, J., Pippin, J. W., Krofft, R. D., Naito, S., Liu, Z. H., and Shankland, S. J.

185

(2013) Podocyte repopulation by renal progenitor cells following glucocorticoids treatment in experimental FSGS. Am J Physiol Ren. Physiol. 304, F1375-89 306. Mundel, P., and Shankland, S. J. (2002) Podocyte biology and response to injury. J Am Soc Nephrol. 13, 3005–3015 307. Rood, I. M., Deegens, J. K., and Wetzels, J. F. (2012) Genetic causes of focal segmental glomerulosclerosis: implications for clinical practice. Nephrol Dial Transpl. 27, 882–890 308. Schell, C., and Huber, T. B. (2012) New players in the pathogenesis of focal segmental glomerulosclerosis. Nephrol Dial Transpl. 27, 3406–3412 309. An, H. T., Kim, J., Yoo, S., and Ko, J. (2014) Small leucine zipper protein (sLZIP) negatively regulates skeletal muscle differentiation via interaction with alpha- actinin-4. J Biol Chem. 289, 4969–4979 310. Khurana, S., Chakraborty, S., Lam, M., Liu, Y., Su, Y. T., Zhao, X., Saleem, M. A., Mathieson, P. W., Bruggeman, L. A., and Kao, H. Y. (2012) Familial focal segmental glomerulosclerosis (FSGS)-linked α-actinin 4 (ACTN4) protein mutants lose ability to activate transcription by nuclear hormone receptors. J. Biol. Chem. 287, 12027–12035 311. Brahler, S., Ising, C., Hagmann, H., Rasmus, M., Hoehne, M., Kurschat, C., Kisner, T., Goebel, H., Shankland, S., Addicks, K., Thaiss, F., Schermer, B., Pasparakis, M., Benzing, T., and Brinkkoetter, P. T. (2012) Intrinsic proinflammatory signaling in podocytes contributes to podocyte damage and prolonged proteinuria. Am J Physiol Ren. Physiol. 303, F1473-85 312. Yamashita, M., Millward, C. A., Inoshita, H., Saikia, P., Chattopadhyay, S., Sen, G. C., and Emancipator, S. N. (2013) Antiviral innate immunity disturbs podocyte cell function. J Innate Immun. 5, 231–241 313. Liu, R., Zhong, Y., Li, X., Chen, H., Jim, B., Zhou, M. M., Chuang, P. Y., and He, J. C. (2014) Role of transcription factor acetylation in diabetic kidney disease. Diabetes. 63, 2440–2453 314. Kao, H.-Y., Lee, C.-H., Komarov, A., Han, C. C., and Evans, R. M. (2002) Isolation and characterization of mammalian HDAC10, a novel histone deacetylase. J. Biol. Chem. 277, 187–193

186

315. Guan, D., Factor, D., Liu, Y., Wang, Z., and Kao, H.-Y. (2013) The epigenetic regulator UHRF1 promotes ubiquitination-mediated degradation of the tumor- suppressor protein promyelocytic leukemia protein. Oncogene. 32, 3819–3828 316. Schlondorff, D. (1990) Preparation and study of isolated glomeruli, 10.1016/0076- 6879(90)91011-T 317. Ristola, M., Arpiainen, S., Saleem, M. A., Holthofer, H., and Lehtonen, S. (2012) Transcription of nephrin-Neph3 gene pair is synergistically activated by WT1 and NF-kappaB and silenced by DNA methylation. Nephrol Dial Transpl. 27, 1737– 1745 318. Aksenova, V., Turoverova, L., Khotin, M., Magnusson, K.-E., Tulchinsky, E., Melino, G., Pinaev, G. P., Barlev, N., and Tentler, D. (2012) Actin-binding protein alpha-actinin 4 (ACTN4) is a transcriptional co-activator of RelA/p65 sub-unit of NF-kB. Oncotarget. 4, 362–372 319. Glass, C. K., and Saijo, K. (2010) Nuclear receptor transrepression pathways that regulate inflammation in macrophages and T cells. Nat Rev Immunol. 10, 365–376 320. Glass, C. K., and Saijo, K. (2010) Nuclear receptor transrepression pathways that regulate inflammation in macrophages and T cells. Nat. Rev. Immunol. 10, 365–376 321. Dai, S., Wang, Z., Pan, X., Chen, X., Wang, W., Ren, H., Feng, Q., He, J. C., Han, B., and Chen, N. (2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic focal segmental glomerulosclerosis. Nephron Clin Pr. 111, c87-94 322. Kimura, J., Ichii, O., Otsuka, S., Sasaki, H., Hashimoto, Y., and Kon, Y. (2013) Close relations between podocyte injuries and membranous proliferative glomerulonephritis in autoimmune murine models. Am J Nephrol. 38, 27–38 323. Yasuno, K., Araki, S., Sakashita, H., Kobayashi, R., Baba, T., Kawakami, H., Kamiie, J., Ogihara, K., and Shirota, K. (2013) Development of podocyte injuries in Osborne-Mendel rats is accompanied by reduced expression of podocyte proteins. J Comp Pathol. 149, 280–290 324. Ory, V., Fan, Q., Hamdaoui, N., Zhang, S. Y., Desvaux, D., Audard, V., Candelier, M., Noel, L. H., Lang, P., Guellaen, G., Pawlak, A., and Sahali, D. (2012) c-mip down-regulates NF-kappaB activity and promotes apoptosis in podocytes. Am J

187

Pathol. 180, 2284–2292 325. Zahran, A. M., Aly, S. S., Elsayh, K. I., Badawy, A., and Gamal, Y. (2014) Glucocorticoid receptors expression and histopathological types in children with nephrotic syndrome. Ren Fail. 36, 1067–1072 326. Coppo, R. (2013) Different targets for treating focal segmental glomerular sclerosis. Contrib Nephrol. 181, 84–90 327. Korbet, S. M. (2012) Nephrology and the percutaneous renal biopsy: a procedure in jeopardy of being lost along the way. Clin J Am Soc Nephrol. 7, 1545–1547 328. Bose, B., Cattran, D., and Toronto Glomerulonephritis, R. (2014) Glomerular diseases: FSGS. Clin J Am Soc Nephrol. 9, 626–632 329. Smith, L. J. (1996) Leukotrienes in asthma. The potential therapeutic role of antileukotriene agents. Arch Intern Med. 156, 2181–2189 330. Pani, A. (2013) Standard immunosuppressive therapy of immune-mediated glomerular diseases. Autoimmun Rev. 12, 848–853 331. Heitzer, M. D., Wolf, I. M., Sanchez, E. R., Witchel, S. F., and DeFranco, D. B. (2007) Glucocorticoid receptor physiology. Rev Endocr Metab Disord. 8, 321–330 332. Reichardt, H. M., Tuckermann, J. P., Gottlicher, M., Vujic, M., Weih, F., Angel, P., Herrlich, P., and Schutz, G. (2001) Repression of inflammatory responses in the absence of DNA binding by the glucocorticoid receptor. EMBO J. 20, 7168–7173 333. Pratt, W. B. (1993) The role of heat shock proteins in regulating the function, folding, and trafficking of the glucocorticoid receptor. J Biol Chem. 268, 21455–21458 334. Wang, J.-C., Derynck, M. K., Nonaka, D. F., Khodabakhsh, D. B., Haqq, C., and Yamamoto, K. R. (2004) From The Cover: Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorticoid receptor target genes. Proc. Natl. Acad. Sci. 101, 15603–15608 335. Eichler, T. E., Ransom, R. F., and Smoyer, W. E. (2005) Differential induction of podocyte heat shock proteins by prolonged single and combination toxic metal exposure. Toxicol. Sci. 84, 120–128 336. Zhao, X., Hsu, K. S., Lim, J. H., Bruggeman, L. A., and Kao, H. Y. (2015) alpha- Actinin 4 potentiates nuclear factor kappa-light-chain-enhancer of activated B-cell (NF-kappaB) activity in podocytes independent of its cytoplasmic actin binding

188

function. J Biol Chem. 290, 338–349 337. Grgic, I., Hofmeister, A. F., Genovese, G., Bernhardy, A. J., Sun, H., Maarouf, O. H., Bijol, V., Pollak, M. R., and Humphreys, B. D. (2014) Discovery of new glomerular disease-relevant genes by translational profiling of podocytes in vivo. Kidney Int. 86, 1116–1129 338. Kirschke, E., Goswami, D., Southworth, D., Griffin, P. R., and Agard, D. A. (2014) Glucocorticoid receptor function regulated by coordinated action of the Hsp90 and Hsp70 chaperone cycles. Cell. 157, 1685–1697 339. Barish, G. D., Yu, R. T., Karunasiri, M., Ocampo, C. B., Dixon, J., Benner, C., Dent, A. L., Tangirala, R. K., and Evans, R. M. (2010) Bcl-6 and NF-kappaB cistromes mediate opposing regulation of the innate immune response. Genes Dev. 24, 2760– 2765 340. Wang, J. C., Derynck, M. K., Nonaka, D. F., Khodabakhsh, D. B., Haqq, C., and Yamamoto, K. R. (2004) Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorticoid receptor target genes. Proc Natl Acad Sci U S A. 101, 15603–15608 341. Schacke, H., Docke, W. D., and Asadullah, K. (2002) Mechanisms involved in the side effects of glucocorticoids. Pharmacol Ther. 96, 23–43 342. Thorn, C. F., Lu, Z. Y., and Whitehead, A. S. (2003) Tissue-specific regulation of the human acute-phase serum amyloid A genes, SAA1 and SAA2, by glucocorticoids in hepatic and epithelial cells. Eur J Immunol. 33, 2630–2639 343. Gershoni-Baruch, R., Brik, R., Zacks, N., Shinawi, M., Lidar, M., and Livneh, A. (2003) The contribution of genotypes at the MEFV and SAA1 loci to amyloidosis and disease severity in patients with familial Mediterranean fever. Arthritis Rheum. 48, 1149–1155 344. Gadegbeku, C. A., Gipson, D. S., Holzman, L. B., Ojo, A. O., Song, P. X. K., Barisoni, L., Sampson, M. G., Kopp, J. B., Lemley, K. V., Nelson, P. J., Lienczewski, C. C., Adler, S. G., Appel, G. B., Cattran, D. C., Choi, M. J., Contreras, G., Dell, K. M., Fervenza, F. C., Gibson, K. L., Greenbaum, L. A., Hernandez, J. D., Hewitt, S. M., Hingorani, S. R., Hladunewich, M., Hogan, M. C., Hogan, S. L., Kaskel, F. J., Lieske, J. C., Meyers, K. E. C., Nachman, P. H., Nast, C. C., Neu, A. M., Reich, H.

189

N., Sedor, J. R., Sethna, C. B., Trachtman, H., Tuttle, K. R., Zhdanova, O., Zilleruelo, G. E., and Kretzler, M. (2013) Design of the Nephrotic Syndrome Study Network (NEPTUNE) to evaluate primary glomerular nephropathy by a multidisciplinary approach. Kidney Int. 83, 749–756 345. Sampson, M. G., Hodgin, J. B., and Kretzler, M. (2015) Defining nephrotic syndrome from an integrative genomics perspective. Pediatr. Nephrol. 30, 51–63 346. Zhao, X., Khurana, S., Charkraborty, S., Tian, Y., Sedor, J. R., Bruggman, L. A., and Kao, H. Y. (2017) alpha Actinin 4 (ACTN4) Regulates Glucocorticoid Receptor-mediated Transactivation and Transrepression in Podocytes. J Biol Chem. 292, 1637–1647 347. Wu, H., Naya, F. J., McKinsey, T. A., Mercer, B., Shelton, J. M., Chin, E. R., Simard, A. R., Michel, R. N., Bassel-Duby, R., Olson, E. N., and Williams, R. S. (2000) MEF2 responds to multiple calcium-regulated signals in the control of skeletal muscle fiber type. EMBO J. 19, 1963–73 348. Improta-Brears, T., Whorton, a R., Codazzi, F., York, J. D., Meyer, T., and McDonnell, D. P. (1999) Estrogen-induced activation of mitogen-activated protein kinase requires mobilization of intracellular calcium. Proc. Natl. Acad. Sci. U. S. A. 96, 4686–4691 349. Cohen, J. J., and Duke, R. C. (1984) Glucocorticoid activation of a calcium- dependent endonuclease in thymocyte nuclei leads to cell death. J Immunol. 132, 38–42 350. Dolmetsch, R. E., Lewis, R. S., Goodnow, C. C., and Healy, J. I. (1997) Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature. 386, 855–858 351. Ribeiro, E. D. A., Pinotsis, N., Ghisleni, A., Salmazo, A., Konarev, P. V., Kostan, J., Sjöblom, B., Schreiner, C., Polyansky, A. A., Gkougkoulia, E. A., Holt, M. R., Aachmann, F. L., Žagrović, B., Bordignon, E., Pirker, K. F., Svergun, D. I., Gautel, M., and Djinović-Carugo, K. (2014) The structure and regulation of human muscle α-Actinin. Cell. 159, 1447–1460 352. Young, P., and Gautel, M. (2000) The interaction of titin and alpha-actinin is controlled by a phospholipid-regulated intramolecular pseudoligand mechanism.

190

EMBO J. 19, 6331–40

191