DOCSLIB.ORG

Membranes of Human Neutrophils Secretory Vesicle Membranes And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Membranes of Human Neutrophils Secretory Vesicle Membranes And Downloaded from http://www.jimmunol.org/ by guest on September 30, 2021 is online at: average * The Journal of Immunology , 25 of which you can access for free at: 2008; 180:5575-5581; ; from submission to initial decision 4 weeks from acceptance to publication J Immunol doi: 10.4049/jimmunol.180.8.5575 http://www.jimmunol.org/content/180/8/5575 Comparison of Proteins Expressed on Secretory Vesicle Membranes and Plasma Membranes of Human Neutrophils Silvia M. Uriarte, David W. Powell, Gregory C. Luerman, Michael L. Merchant, Timothy D. Cummins, Neelakshi R. Jog, Richard A. Ward and Kenneth R. McLeish cites 44 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2008/04/01/180.8.5575.DC1 This article http://www.jimmunol.org/content/180/8/5575.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 30, 2021. The Journal of Immunology Comparison of Proteins Expressed on Secretory Vesicle Membranes and Plasma Membranes of Human Neutrophils1 Silvia M. Uriarte,* David W. Powell,*† Gregory C. Luerman,† Michael L. Merchant,* Timothy D. Cummins,* Neelakshi R. Jog,‡ Richard A. Ward,* and Kenneth R. McLeish2*†§ Secretory vesicles are neutrophil intracellular storage granules formed by endocytosis. Understanding the functional consequences of secretory vesicle exocytosis requires knowledge of their membrane proteins. The current study was designed to use proteomic technologies to develop a more complete catalog of secretory vesicle membrane proteins and to compare the proteomes of secretory vesicle and plasma membranes. A total of 1118 proteins were identified, 573 (51%) were present only in plasma membrane- enriched fractions, 418 (37%) only in secretory vesicle-enriched membrane fractions, and 127 (11%) in both fractions. Gene Ontology categorized 373 of these proteins as integral membrane proteins. Proteins typically associated with other intracellular organelles, including nuclei, mitochondria, and ribosomes, were identified in both membrane fractions. Ingenuity Pathway Knowl- Downloaded from edge Base analysis determined that the majority of canonical and functional pathways were significantly associated with proteins from both plasma membrane-enriched and secretory vesicle-enriched fractions. There were, however, some canonical signaling pathways that involved proteins only from plasma membranes or secretory vesicles. In conclusion, a number of proteins were identified that may elucidate mechanisms and functional consequences of secretory vesicle exocytosis. The small number of common proteins suggests that the hypothesis that secretory vesicles are formed from plasma membranes by endocytosis requires more critical evaluation. The Journal of Immunology, 2008, 180: 5575–5581. http://www.jimmunol.org/ irculating neutrophils are capable of undergoing a series Golgi network during neutrophil maturation (1). The intragranule of phenotypic changes that result in their transition from constituents of secretory vesicles include plasma proteins, result- C cells that are poorly responsive to proinflammatory stim- ing in the hypothesis that secretory vesicles are formed by endo- uli to become the primary effector cells of innate immunity. These cytosis and that functional changes from their exocytosis are due phenotypic changes involve the incorporation of proteins from the entirely to incorporation of new molecules into the plasma mem- membranes of intracellular storage granules into the plasma mem- brane (1, 5). Thus, to understand the changes in neutrophil func- brane and the release of proteins stored in granule matrix through tional capability induced by secretory vesicle exocytosis, a com- by guest on September 30, 2021 regulated exocytosis. Granule exocytosis contributes to enhanced prehensive catalog of membrane proteins is required. neutrophil tethering and adhesion to vascular endothelial cells at a Proteomic techniques, which include methods for protein ex- site of inflammation; enhanced migration across blood vessel traction and separation, protein identification and characterization, walls; chemotaxis to a site of microbial invasion; phagocytosis of and database analysis, provide an unbiased approach to identifying invading organisms; and microbicidal activity through a combina- proteins expressed in subcellular compartments (6–9). We re- tion of enzymatic degradation, reactive oxygen species generation, cently published a comprehensive proteomic analysis of neutrophil and release of microbicidal peptides into phagosomes. Neutrophils gelatinase, specific, and azurophil granules (10). Using protein contain a heterologous group of storage granules that have been separation by two-dimensional gel electrophoresis and two-dimen- classified into four subsets based on density and composition: sional HPLC coupled with MALDI-TOF-MS3 and ESI-MS/MS, azurophil (primary) granules, specific (secondary) granules, gela- 286 proteins were identified on one or more granule subsets, many tinase (tertiary) granules, and secretory vesicles (1). These granule of which had not been found previously on neutrophil granules. subsets undergo hierarchical stimulated exocytosis, with secretory The current study was designed to use similar proteomic technol- vesicles the most easily and completely mobilized (2–4). Gelati- ogies to provide a more complete identification of secretory vesicle nase, specific, and azurophil granules are formed from the trans- membrane proteins and to compare those proteins with the proteins expressed on neutrophil plasma membranes. The ability to extract and solubilize membrane proteins is a major limitation to all pro- *Department of Medicine, †Department of Biochemistry and Molecular Biology, and teomic approaches. To overcome this limitation, proteins were ‡Department of Microbiology and Immunology, University of Louisville, Louisville, extracted from membranes using a recently described methanol § KY 40202; and Veterans Affairs Medical Center, Louisville, KY 40206 extraction procedure, followed by two-dimensional HPLC and Received for publication October 29, 2007. Accepted for publication February ESI-MS/MS (11). With this approach, we identified a number of 7, 2008. membrane spanning and membrane associated proteins and uncov- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance ered significant differences between secretory vesicle-enriched and with 18 U.S.C. Section 1734 solely to indicate this fact. plasma membrane-enriched proteomes. 1 This work was supported by a Merit Review Grant from the Department of Veterans Affairs (to K.R.M.), National Institutes of Health Grants DK62389 (to R.A.W. and K.R.M.) and DK176743 (to D.W.P.), and the Office of Science Financial Assistance Program, Department of Energy (to D.W.P.). 3 Abbreviations used in this paper: MS, mass spectrometry; SCX, strong cation ex- 2 Address correspondence and reprint requests to Dr. Kenneth R. McLeish, Baxter I change; RP, reversed-phase; PAF, protein abundance factor; NCBI, National Center Research Building, University of Louisville, 570 South Preston Street, Louisville, KY for Biotechnology Information; IPKB, Ingenuity Pathways Knowledge Base; 40202. E-mail address: [email protected] SNARE, soluble NSF attachment receptor. www.jimmunol.org 5576 NEUTROPHIL SECRETORY VESICLE PROTEOME Materials and Methods acid and mobile phase B: 80% acetonitrile/0.1% formic acid). Spectra were Neutrophil isolation acquired with a LTQ linear ion trap mass spectrometer (Thermo Fisher Sci- entific). During LC-MS/MS analysis, the mass spectrometer performed data- Neutrophils were isolated from healthy donors using plasma-Percoll gradients dependent acquisition with a full MS scan between 300 and 2000 mass to as described by Haslett et al. (12). Trypan blue staining revealed that at least change ratio followed by five MS/MS scans (35% collision energy) on the five 97% of cells were neutrophils with Ͼ95% viability. After isolation, neutro- most intense ions from the preceding MS scan. Data acquisition was per- phils were suspended in Krebs-Ringer phosphate buffer (pH 7.2) at 4 ϫ 107 formed using dynamic exclusion with a repeat count of 30 anda1and3min cells/ml and treated with 5 mM diisopropyl fluorophosphate for 10 min on ice exclusion duration window. to inhibit proteases (13). Extensive evaluation using respiratory burst activity and granule exocytosis indicates that this isolation technique does not prime Mass spectral data interpretations neutrophils. The Human Studies Committee of the University of Louisville approved the use of human donors. The acquired mass spectrometric data were searched against a human protein database (human RefSeq) using the Sequest algorithm and a commercial com- Plasma membrane and secretory
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Global-Scale Analysis of the Dynamic Transcriptional Adaptations Within Skeletal Muscle During Hypertrophic Growth
    University of Kentucky UKnowledge Theses and Dissertations--Physiology Physiology 2015 GLOBAL-SCALE ANALYSIS OF THE DYNAMIC TRANSCRIPTIONAL ADAPTATIONS WITHIN SKELETAL MUSCLE DURING HYPERTROPHIC GROWTH Tyler Kirby University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Kirby, Tyler, "GLOBAL-SCALE ANALYSIS OF THE DYNAMIC TRANSCRIPTIONAL ADAPTATIONS WITHIN SKELETAL MUSCLE DURING HYPERTROPHIC GROWTH" (2015). Theses and Dissertations--Physiology. 22. https://uknowledge.uky.edu/physiology_etds/22 This Doctoral Dissertation is brought to you for free and open access by the Physiology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Physiology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.
    [Show full text]
  • Alpha Actinin 4: an Intergral Component of Transcriptional
    ALPHA ACTININ 4: AN INTERGRAL COMPONENT OF TRANSCRIPTIONAL PROGRAM REGULATED BY NUCLEAR HORMONE RECEPTORS By SIMRAN KHURANA Submitted in partial fulfillment of the requirements for the degree of doctor of philosophy Thesis Advisor: Dr. Hung-Ying Kao Department of Biochemistry CASE WESTERN RESERVE UNIVERSITY August, 2011 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of SIMRAN KHURANA ______________________________________________________ PhD candidate for the ________________________________degree *. Dr. David Samols (signed)_______________________________________________ (chair of the committee) Dr. Hung-Ying Kao ________________________________________________ Dr. Edward Stavnezer ________________________________________________ Dr. Leslie Bruggeman ________________________________________________ Dr. Colleen Croniger ________________________________________________ ________________________________________________ May 2011 (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS LIST OF TABLES vii LIST OF FIGURES viii ACKNOWLEDEMENTS xii LIST OF ABBREVIATIONS xiii ABSTRACT 1 CHAPTER 1: INTRODUCTION Family of Nuclear Receptors 3 Mechanism of transcriptional regulation by co-repressors and co-activators 8 Importance of LXXLL motif of co-activators in NR mediated transcription 12 Cyclic recruitment of co-regulators on the target promoters 15 Actin and actin related proteins (ABPs) in transcription
    [Show full text]
  • Β-Catenin Confers Resistance to PI3K and AKT Inhibitors and Subverts Foxo3a to Promote Metastasis in Colon Cancer
    β-catenin Confers Resistance to PI3K and AKT inhibitors and Subverts FOXO3a to Promote Metastasis in Colon Cancer Stephan P. Tenbaum1§, Paloma Ordóñez-Morán2§#, Isabel Puig1§, Irene Chicote1, Oriol Arqués1, Stefania Landolfi3, Yolanda Fernández4, José Raúl Herance5, Juan D. Gispert5, Leire Mendizabal6, Susana Aguilar7, Santiago Ramón y Cajal3, Simó Schwartz Jr4, Ana Vivancos6, Eloy Espín8, Santiago Rojas5, José Baselga9, Josep Tabernero10, Alberto Muñoz2, Héctor G. Palmer1* 1 Vall d’Hebrón Institut d´Oncología (VHIO). Stem Cells and Cancer Laboratory. Barcelona, Spain. 2 Instituto de Investigaciones Biomédicas "Alberto Sols", Consejo Superior de Investigaciones Científicas-Universidad Autónoma de Madrid, Madrid, Spain. 3 Department of Pathology, Hospital Universitari Vall d'Hebrón, Universitat Autònoma de Barcelona, Barcelona, Spain. 4 Group of Drug Delivery and Targeting, CIBBIM-Nanomedicine and Networking Biomedical Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Hospital Universitari Vall d’Hebrón, Institut de Recerca Vall d’Hebrón, Universitat Autònoma de Barcelona, Barcelona, Spain. 5 Parc de Recerca Biomèdica de Barcelona (PRBB), Centre d´Imatge Molecular (CRC) Corporació Sanitària, Barcelona, Spain. 6 Vall d’Hebrón Institut d´Oncología (VHIO). Genomics Cancer Group. Barcelona, Spain. 7 Centre for Respiratory Research, Rayne Institute, University College London, London, United Kingdom, Hematopoietic Stem Cell Laboratory, London Research Institute, Cancer Research UK, London, United Kingdom. 8 General Surgery Service, Hospital Universitari Vall d'Hebrón, Barcelona, Spain. 9 Massachusetts General Hospital Cancer Center, Harvard Medical School, Charlestown, USA; Howard Hughes Medical Institute, Chevy Chase, USA. 10 Medical Oncology Department, Hospital Universitari Vall d'Hebrón, Barcelona, Spain. # Swiss Institute for Experimental Cancer Research, École Polytechnique Fédérale de Lausanne, Lausanne, Switzerland.
    [Show full text]
  • Supporting Online Material
    1 2 3 4 5 6 7 Supplementary Information for 8 9 Fractalkine-induced microglial vasoregulation occurs within the retina and is altered early in diabetic 10 retinopathy 11 12 *Samuel A. Mills, *Andrew I. Jobling, *Michael A. Dixon, Bang V. Bui, Kirstan A. Vessey, Joanna A. Phipps, 13 Ursula Greferath, Gene Venables, Vickie H.Y. Wong, Connie H.Y. Wong, Zheng He, Flora Hui, James C. 14 Young, Josh Tonc, Elena Ivanova, Botir T. Sagdullaev, Erica L. Fletcher 15 * Joint first authors 16 17 Corresponding author: 18 Prof. Erica L. Fletcher. Department of Anatomy & Neuroscience. The University of Melbourne, Grattan St, 19 Parkville 3010, Victoria, Australia. 20 Email: [email protected] ; Tel: +61-3-8344-3218; Fax: +61-3-9347-5219 21 22 This PDF file includes: 23 24 Supplementary text 25 Figures S1 to S10 26 Tables S1 to S7 27 Legends for Movies S1 to S2 28 SI References 29 30 Other supplementary materials for this manuscript include the following: 31 32 Movies S1 to S2 33 34 35 36 1 1 Supplementary Information Text 2 Materials and Methods 3 Microglial process movement on retinal vessels 4 Dark agouti rats were anaesthetized, injected intraperitoneally with rhodamine B (Sigma-Aldrich) to label blood 5 vessels and retinal explants established as described in the main text. Retinal microglia were labelled with Iba-1 6 and imaging performed on an inverted confocal microscope (Leica SP5). Baseline images were taken for 10 7 minutes, followed by the addition of PBS (10 minutes) and then either fractalkine or fractalkine + candesartan 8 (10 minutes) using concentrations outlined in the main text.
    [Show full text]
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • Human Periprostatic Adipose Tissue: Secretome from Patients With
    CANCER GENOMICS & PROTEOMICS 16 : 29-58 (2019) doi:10.21873/cgp.20110 Human Periprostatic Adipose Tissue: Secretome from Patients With Prostate Cancer or Benign Prostate Hyperplasia PAULA ALEJANDRA SACCA 1, OSVALDO NÉSTOR MAZZA 2, CARLOS SCORTICATI 2, GONZALO VITAGLIANO 3, GABRIEL CASAS 4 and JUAN CARLOS CALVO 1,5 1Institute of Biology and Experimental Medicine (IBYME), CONICET, Buenos Aires, Argentina; 2Department of Urology, School of Medicine, University of Buenos Aires, Clínical Hospital “José de San Martín”, Buenos Aires, Argentina; 3Department of Urology, Deutsches Hospital, Buenos Aires, Argentina; 4Department of Pathology, Deutsches Hospital, Buenos Aires, Argentina; 5Department of Biological Chemistry, School of Exact and Natural Sciences, University of Buenos Aires, Buenos Aires, Argentina Abstract. Background/Aim: Periprostatic adipose tissue Prostate cancer (PCa) is the second most common cancer in (PPAT) directs tumour behaviour. Microenvironment secretome men worldwide. While most men have indolent disease, provides information related to its biology. This study was which can be treated properly, the problem consists in performed to identify secreted proteins by PPAT, from both reliably distinguishing between indolent and aggressive prostate cancer and benign prostate hyperplasia (BPH) disease. Evidence shows that the microenvironment affects patients. Patients and Methods: Liquid chromatography-mass tumour behavior. spectrometry-based proteomic analysis was performed in Adipose tissue microenvironment is now known to direct PPAT-conditioned media (CM) from patients with prostate tumour growth, invasion and metastases (1, 2). Adipose cancer (CMs-T) (stage T3: CM-T3, stage T2: CM-T2) or tissue is adjacent to the prostate gland and the site of benign disease (CM-BPH). Results: The highest number and invasion of PCa.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Heterotrimeric Go Protein Links Wnt-Frizzled Signaling with Ankyrins to Regulate the Neuronal Microtubule Cytoskeleton Anne-Marie Lüchtenborg1,2, Gonzalo P
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 3399-3409 doi:10.1242/dev.106773 RESEARCH ARTICLE Heterotrimeric Go protein links Wnt-Frizzled signaling with ankyrins to regulate the neuronal microtubule cytoskeleton Anne-Marie Lüchtenborg1,2, Gonzalo P. Solis1, Diane Egger-Adam2, Alexey Koval1, Chen Lin1,2, Maxime G. Blanchard1, Stephan Kellenberger1 and Vladimir L. Katanaev1,2,* ABSTRACT The evolutionarily conserved Wg pathway is important for Drosophila neuromuscular junctions (NMJs) represent a powerful numerous developmental programs and cellular processes (Logan model system with which to study glutamatergic synapse formation and Nusse, 2004). In the nervous system of Drosophila,Wg and remodeling. Several proteins have been implicated in these signaling is involved in the formation of neuromuscular junctions processes, including components of canonical Wingless (Drosophila (NMJs) (Packard et al., 2002; Miech et al., 2008). Being a Wnt1) signaling and the giant isoforms of the membrane-cytoskeleton glutamatergic synapse, the Drosophila NMJ provides a useful linker Ankyrin 2, but possible interconnections and cooperation experimental model with which to study mammalian central between these proteins were unknown. Here, we demonstrate that nervous system synapses, their formation and remodeling (Collins the heterotrimeric G protein Go functions as a transducer of Wingless- and DiAntonio, 2007). The Drosophila NMJ is a beads-on-a-string- Frizzled 2 signaling in the synapse. We identify Ankyrin 2 as a target like structure that is formed at the axon terminus and is composed of – – of Go signaling required for NMJ formation. Moreover, the Go-ankyrin distinct circular structures the synaptic boutons which contain interaction is conserved in the mammalian neurite outgrowth pathway.
    [Show full text]
  • Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous
    ONCOLOGY LETTERS 21: 58, 2021 Circular RNA hsa_circ_0005114‑miR‑142‑3p/miR‑590‑5p‑ adenomatous polyposis coli protein axis as a potential target for treatment of glioma BO WEI1*, LE WANG2* and JINGWEI ZHAO1 1Department of Neurosurgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130033; 2Department of Ophthalmology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China Received September 12, 2019; Accepted October 22, 2020 DOI: 10.3892/ol.2020.12320 Abstract. Glioma is the most common type of brain tumor APC expression with a good overall survival rate. UALCAN and is associated with a high mortality rate. Despite recent analysis using TCGA data of glioblastoma multiforme and the advances in treatment options, the overall prognosis in patients GSE25632 and GSE103229 microarray datasets showed that with glioma remains poor. Studies have suggested that circular hsa‑miR‑142‑3p/hsa‑miR‑590‑5p was upregulated and APC (circ)RNAs serve important roles in the development and was downregulated. Thus, hsa‑miR‑142‑3p/hsa‑miR‑590‑5p‑ progression of glioma and may have potential as therapeutic APC‑related circ/ceRNA axes may be important in glioma, targets. However, the expression profiles of circRNAs and their and hsa_circ_0005114 interacted with both of these miRNAs. functions in glioma have rarely been studied. The present study Functional analysis showed that hsa_circ_0005114 was aimed to screen differentially expressed circRNAs (DECs) involved in insulin secretion, while APC was associated with between glioma and normal brain tissues using sequencing the Wnt signaling pathway. In conclusion, hsa_circ_0005114‑ data collected from the Gene Expression Omnibus database miR‑142‑3p/miR‑590‑5p‑APC ceRNA axes may be potential (GSE86202 and GSE92322 datasets) and explain their mecha‑ targets for the treatment of glioma.
    [Show full text]
  • Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks
    906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.
    [Show full text]