DOCSLIB.ORG

A Realized Tuber Magnatum Niche in the Upper Sinni Area (South Italy)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Realized Tuber Magnatum Niche in the Upper Sinni Area (South Italy) Open Journal of Genetics, 2013, 3, 102-110 OJGen http://dx.doi.org/10.4236/ojgen.2013.32013 Published Online June 2013 (http://www.scirp.org/journal/ojgen/) A realized Tuber magnatum niche in the upper Sinni area (South Italy) Giovanni Figliuolo, Giovanna Trupo, Stefania Mang Dipartimento delle Culture Europee e del Mediterraneo (DICEM), Università degli Studi della Basilicata, Matera, Italy Email: [email protected] Received 7 January 2013; revised 20 February 2013; accepted 1 May 2013 Copyright © 2013 Giovanni Figliuolo et al. This is an open access article distributed under the Creative Commons Attribution Li- cense, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT species resilience and persistence within a changing en- vironment [5]. The knowledge of hypogean mushroom A realized Tuber magnatum niche, in the upper Sinni species that live in symbiosis with the surface roots of area (Serrapotamo, south Italy), was studied using many plant species, collectively known as truffles, would geographic information system, direct in situ survey be enhanced by integrating the niche concept and genetic and genetic diversity at DNA marker loci. Truffières diversity data. Niche modeling can improve the man- were north facing, associated with a fine loamy-sandy agement of both natural and artificial truffières. The soil bearing high carbonate content over a conglom- niche concept has been used primarily for Tuber melano- erate bead-rock substrate. Target area is located in sporum Vitt. (Périgord black) and subsequently for less Pavari's cold and medium-cold Lauretum phithocli- important species (T. aestivum Vitt., T. brumale var. mo- matic belts. Ascoma genomic DNA was analyzed and schatum Ferry, T. macrosporum Vitt., T. borchii Vitt. and ITS sequences, microsatellites (MA2, MA4 and MA7), T. mesentericum Vitt.) whose environmental optimal along with M13 minisatellite loci, did show low heteo- growing conditions (e.g. soil, climate and vegetation) zygosity (HE = 0.153). Serrapotamo genotypes did not show a wider range of variation than the more specialist express localized markers when compared with Pie- T. magnatum Pico. Artificial truffières are dictated by monte (north Italy) genetic material. ITS marker, validated protocols of plant inoculation, cultivation and monomorphic within T. magnatum, was efficient at truffle harvesting with trained dogs [6]. In contrast, pre- distinguishing T. borchii in a mixture of both. Ser- dicting T. magnatum fundamental niche is not so far pos- rapotamo niche represents a unique T. magnatum sible. Growing areas are not fully known while ecologi- diversity spot in the southernmost side of the Medi- cal and genetic baseline data are often insufficient. T. terranean region. Maintaining Serrapotamo T. mag- magnatum, the Italian white truffle (“tartufo bianco natum diversity by undertaking conservation meas- pregiato”), is one of the top most delicacies in the culi- ures is adviced. nary list. In the “good” years T. magnatum price oscil- lates between 1200 and 2500 €/Kg, but it can rise up to Keywords: Genetic Diversity; Conservation; Niche; 3000 or 4000 €/Kg in years with difficult environmental White Truffle conditions. Truffle market involves about 400 millions of euro and hundreds of harvesters holding a regular license 1. INTRODUCTION [7]. T. magnatum ascocarps are harvested from very local- The range of favorable environmental conditions under ized natural or quasi-natural ecosystems mapped in Italy which an organism can survive and reproduce itself [8,9], Croatia [10], Slovenia [9,11], Ticino Canton [8], (fundamental niche) can be predicted for the most im- Serbia and Hungary [12]. Italy is the main producer of portant wood tree and domesticated crop species [1-3]. “tartufo bianco pregiato”. Surprisingly, T. magnatum Nonetheless, because of the combination of negative (e.g. producing areas are reported as located in central and species competition, dispersal constraints, etc.) with northern Italy and only “rarely” south of Umbria [8,9]. positive interactions (e.g. symbiosis), the realized niche For the first time Pomarico et al. [13] brought to light [4], for a given species, can be more or less extended Basilicata as the southern Italian Region rich in Tuber than the predicted one [2]. Genetic variation will ensure species. Among the edible species, T. magnatum is OPEN ACCESS G. Figliuolo et al. / Open Journal of Genetics 3 (2013) 102-110 103 common and locally distributed in “Serrapotamo”, an 2. MATERIALS AND METHODS area connected with Pollino National Park [13]. Rubini et 2.1. Biological Sample al. [9] assessed genetic distance of some T. magnatum specimens from Basilicata. Overall, genetic analyses Fifty-three T. magnatum specimens (whole ascocarp or a supported a self-fertilization breeding system consistent fragment of it) were collected with the help of trained with the estimates of the within and between population dogs, in different sites from natural or quasi-natural truf- genetic diversity [9,11,13]. However, differentiation due fle fields located in the territory of the following mu- to habitat fragmentation should not be excluded. Deline- nicipalities (Serrapotamo area): Chiaromonte, Calvera, ating geographic areas characterized by a suitable cli- Castronuovo, Fardella, Francavilla S., Teana, Carbone, mate for perennial symbiotic species is a consolidated Episcopia and S. Chirico R. Sampling sites are mostly method in forestry since the early 20th century [1]. The included within the Pollino National Park. Eight asco- Lauretum cold belt, associated with T. magnatum distri- mata from Montemagno and Mombercelli d’Asti (Pie- bution [13], requires an annual mean temperature from monte) were used as out-group (Table 1). As reference, 12˚C to 17˚C, a temperature higher than 3˚C in the cold- three different species (T. borchii, T. mesentericum and T. est month and the average of the yearly minimum tem- brumale) were used in molecular analyses (Table 1). peratures higher than −9˚C [1]. When phytoclimatic con- ditions are met, geological maps represent an excellent 2.2. DNA Analysis additional tool to identify truffle production areas given Tissue scrap (0.25 - 1 g), from each ascoma, was cleaned that suitable soils (regolithic or residual) depend on the with distilled water to eliminate soil residues, before total bed-rock type [14]. T. magnatum, whose mycelium is genomic DNA extraction. The collection (No = 54) was more widespread than can be inferred from the truffles pre-screened with the ITS molecular fragment which and ectomycorrhiza distribution [15], prefers alkaline, allows easily the distinction of different species, includ- moist, very well drained, and aerated soil [10,16]. In op- ing T. borchii from T. magnatum. T. borchii produced a posite, assessing soil micro-flora composition and pre- lower molecular weight band (~560 bp) in comparison valence is difficult; α-Proteobacteria is the most repre- with T. magnatum (~660 bp) (Table 1). T. magnatum sented bacterial component, associated with the ascoma total genomic DNA, according to the cited Authors’ pro- [17]. tocol [20-23] with minor laboratory-specific modifica- Although artificial mycorrhization of plant roots with tions, was used to screen the following different marker T. magnatum ascospores is feasible [18,19], rarely mas- types: sive ascomata productions have been reported in artifi- Minisatellite M13 using the universal primer M13 cial plantations. Thus, the actual marketed ascomata are (GAGGGTGGCGGTTCT) [20]; from natural or semi-natural realized niches. Expert har- Three microsatellite loci (MA2, MA4, MA7) [21]; vesters are aware that overexploitation in conjunction ITS1 (5’TCCGTAGGTGAACCTGCGG-3’) and with climatic impacts will produce quick T. magnatum ITS4 (5’TCCTCCGCTTATTGATATGC3’) universal genetic erosion. The ascoma intrinsic value depends on primers [22]; its authenticity, freshness, optimal readiness, fragrance, ITS sequence of seven specimens from Piemonte and size, shape regularity, integrity and weight. Truffles from seven from different Basilicata sampling sites was less important species (e.g. T. borchii) can be visually obtained throughout direct amplicon sequencing [23]. confused with T. magnatum. Furthermore, T. borchii, as a ITS sequences were compared using the NCBI online generalist species, is more abundant and can be sympat- standard Basic Local Alignment Search Tool (BlastN). ric to T. magnatum. In south Italy, Greece and Turkey T. borchii is ripening earlier than February-March. It fol- Table 1. Truffle DNA specimens from different ascomata ana- lows that late-ripening T. magnatum ascocarps can be lyzed with molecular markers along with ITS fragment dis- phenotypically confused with earlier-ripening T. borchii. criminating different species. Ecologic niche studies using geographic information No ascomata ITS1-2 fragment Species system integrated with molecular marker technology and (origin) (bp) in situ monitoring are appropriate to carry out prelimi- 8 (Piemonte) 660 nary assessment of areas suited to T. magnatum conser- T. magnatum 53 (Basilicata) 660 vation. We attempted to promote in situ conservation of such T. borchii 2 (Basilicata) 560 a magnificent gift of the nature by characterizing one of T. brumale var. moscatum 2 (Basilicata) 900 the most important producing niches in south Italy and assessing its level of genetic diversity. T. mesentericum 2 (Basilicata) 720 Copyright © 2013 SciRes.
Load more

Recommended publications
  • The Soil Environment for Tuber Magnatum Growth in Motovun Forest, Istria
    NAT. CROAT. VOL. 13 No 2 171¿185 ZAGREB June 30, 2004 original scientific paper / izvorni znanstveni rad THE SOIL ENVIRONMENT FOR TUBER MAGNATUM GROWTH IN MOTOVUN FOREST, ISTRIA GILBERTO BRAGATO1,BARBARA SLADONJA2 &ÐORDANO PER[URI]2 1Istituto Sperimentale per la Nutrizione delle Piante, Via Trieste 23, 34170 Gorizia, Italy 2Institut za poljoprivredu i turizam, Carla Huguesa 8, 52440 Pore~, Croatia Bragato, G., Sladonja, B. & Per{uri}, \.: The soil environment for Tuber magnatum growth in Motovun Forest, Istria. Nat. Croat., Vol. 13, No. 2, 171–185, 2004, Zagreb. The mixed oak forest located near the town of Motovun is a well-known white truffle (Tuber magnatum Pico) producing area of the Istria region. Motovun Forest covers a 900-ha area in the flu- vial plain of the Mirna River, which flows into the Adriatic Sea through a hilly landscape originat- ing in a sedimentary sequence of a Triassic-Eocene carbonatic platform and Eocene-Oligocene Flysch turbidites. T. magnatum production has been decreasing in the last 10 years and a study was specifically performed in an attempt to explain this. Productive soils of the valley bottom were compared with unproductive soils on the slopes, the latter being drier, thinner and more developed than the former. T. magnatum carpophores are not found all over the fluvial plain and Motovun Forest was further subdivided into productive, unproductive and occasionally productive areas. All soils of the valley bottom were thick and continuously rejuvenated by the frequent arrival of fine sediments from slopes, but only unproductive ones were characterized by water saturation in some periods of the year.
    [Show full text]
  • Fungal Diversity in the Mediterranean Area
    Fungal Diversity in the Mediterranean Area • Giuseppe Venturella Fungal Diversity in the Mediterranean Area Edited by Giuseppe Venturella Printed Edition of the Special Issue Published in Diversity www.mdpi.com/journal/diversity Fungal Diversity in the Mediterranean Area Fungal Diversity in the Mediterranean Area Editor Giuseppe Venturella MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade • Manchester • Tokyo • Cluj • Tianjin Editor Giuseppe Venturella University of Palermo Italy Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal Diversity (ISSN 1424-2818) (available at: https://www.mdpi.com/journal/diversity/special issues/ fungal diversity). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number, Page Range. ISBN 978-3-03936-978-2 (Hbk) ISBN 978-3-03936-979-9 (PDF) c 2020 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons license CC BY-NC-ND. Contents About the Editor .............................................. vii Giuseppe Venturella Fungal Diversity in the Mediterranean Area Reprinted from: Diversity 2020, 12, 253, doi:10.3390/d12060253 .................... 1 Elias Polemis, Vassiliki Fryssouli, Vassileios Daskalopoulos and Georgios I.
    [Show full text]
  • Determinazione N.33/2013
    AZIENDA TERRITORIALE PER L’EDILIZIA RESIDENZIALE DI POTENZA Via Manhes, 33 – 85100 – POTENZA – tel. 0971413111 – fax. 0971410493 – www.aterpotenza.it URP – NUMERO VERDE – 800291622 – fax 0971 413201 UNITA’ DI DIREZIONE “DIREZIONE “ DETERMINAZIONE N.33/2013 OGGETTO: BANDO PER LA FORMAZIONE DI ELENCHI DI OPERATORI ECONOMICI.(Art. 31 Regolamento per i lavori, le forniture e i servizi in economia). AGGIORNAMENTO ELENCHI OPERATORI ECONOMICI PER LAVORI, FORNITURE E SERVIZI AL 30.06.2013. L'anno 2013 il giorno 4 del mese di luglio nella sede dell'ATER IL DIRETTORE DELL’AZIENDA 1 PREMESSO: - che con delibera dell’Amministratore Unico n. 31 del 06.05.2008 e’ stato approvato il regolamento per i lavori, le forniture e i servizi in economia che prevede, fra l’altro, all’art.31, la costituzione di appositi elenchi di operatori economici atti agli scopi suddetti; - che con successiva delibera dell’A.U. n.32 del 21.05.2008 è stato approvato il Bando per la formazione dei citati elenchi; - che il Bando prevede, altresì, l’aggiornamento degli elenchi degli operatori, senza ulteriori forme di pubblicità, a cadenza semestrale, in base alle domande che pervengono entro il 30/06 e 31/12 di ciascun anno solare; - che, pertanto, si è proceduto alla formazione degli elenchi in relazione alle istanze ammissibili pervenute entro il 30.06.2013 o comunque inviate entro tale termine e validate dalla data del timbro postale sulla raccomandata a..r.; VISTO il regolamento per i lavori, le forniture e i servizi in economia; RITENUTO necessario dover dare attuazione a quanto previsto all’art.31 del Regolamento approvando gli elenchi aggiornati al 30.06.2013 degli operatori economici per i lavori, i servizi e le forniture allegati alla presente per farne parte integrante e sostanziale; VISTI gli articoli 125 e 253, comma 22 del D.Lgs.
    [Show full text]
  • Picco Vs Pico
    G. Pacioni, R. Rittersma, M. Iotti Italian Journal of Mycology vol. 47 (2018) ISSN 2531-7342 DOI: https://doi.org/10.6092/issn.2531-7342/7748 On the Tuber magnatum, Tuber albidum and Tuber rufum author name: Picco vs Pico _______________________________________________________________________________________ Giovanni Pacioni1, Rengenier Rittersma2, Mirco Iotti1 1Department of Health, Life and Environmental Sciences, University of L’Aquila, 67100 L’Aquila, Italy 2Dorfstraβe 11, D 56290 Heyweiler, Germany Correspondig Author e-mail: [email protected] Abstract This article presents the results of a research that has been conducted on the surname of the author of the three truffle species Tuber magnatum, T. albidum and T. rufum who in the nomenclatural databases of fungi is listed as “Picco” rather than “Pico” (how he is usually indicated). Drawing upon official documents from the Turin State and University Archives the claim is made that the surname Picco is the correct version. This name can also be found in a contemporary review of the book Melethemata Inauguralia (Picco 1788), as well as in a biographic dictionary of Piedmontese physicians dated back to 1825. Therefore, the officially used indication since Stafleu and Cowan (1983) can be considered to be correct. Keywords: systematic botany; mushrooms; truffles; history; nomenclature; Vittorio Picco; Savoy dynasty. Riassunto In questo lavoro è stata condotta un’indagine sul cognome dell’autore delle tre specie di tartufi Tuber magnatum, T. albidum e T. rufum, che nelle banche dati di riferimento nomenclaturali dei funghi viene riportato come “Picco” e non “Pico”, come usualmente viene indicato. Sulla base dei documenti ufficiali degli Archivi di Stato e dell’Università di Torino è stato possibile accertare che, in effetti, il vero cognome è Picco.
    [Show full text]
  • Back Matter (PDF)
    Index Page numbers in italics refer to Figures; page numbers in bold refer to Tables Acarinina spp. 200 Apennines 3, 22-23, 27-29, 36, facies cycles Acquarone Ridge 351 38, 40 concept of 177-179 Ad-Dour-Khalladi massif 167 Alpes-Apnnin: 42 description 179, 181,182, Adra Unit 30, 32, 32, 36 Northern 3-5, 19, 23, 33-34, 183, 184, 185, 186, Adige embayment 248, 254 36, 37, 39-41 187-188 Aeolian Island Arc 350, 351 Post-Pseudoverrucano 4 sedimentological significance aeromagnetic surveys Pseudoverrucano 4 188-189 bottom reduction method see also Helminthoid Flysch factorial correspondence analysis application of results Southern 4, 18, 23, 33, 34, 40, methods 148-152 343-347 278-279 results 152-156 data processing 338-339 Argille Varicolori unit 279 results discussed input data 338 evolution 283-286 156-158 signal analysis 339-343 stratigraphy 280-281 significance for African Domain 120, 121 structure 281-283 palaeogeography A1 Alya-A1 Hatba massif 167 Post-Pseudoverrucano 6-9 157, 158 Alboran Basin 3 Pseudoverrucano 4-6 deformation 166-167, 168, Alboran Domain 87-89, 98, 101, structural setting 289-291 170 102, 110, 114 see also Sant'Arcangelo nappe 147-148, 150, 152, Alboran Ridge 112 Basin 155-160, 162, 162-163, Alboran Sea 217, 218 Variszisch-apenninischen 43 164, 165, 165, 167, 168, A1Hamra 138-139 Anageniti Minute formation 19, 168-173, 175 196, 205 Ali Montagnareale Unit 7, 23-24, 20, 21 stratigraphy 163, 164 24, 26, 36 Apuane Unit 3, 19, 20, 21-22, 23, structure 165 Aliano Group 293 39, 40, 42-43 stratigraphy 48 Aliano synthem Apulian
    [Show full text]
  • Current Status of Truffle Cultivation: Recent Results and Future Perspectives ______Alessandra Zambonelli1, Mirco Iotti1, Ian Hall2
    A. Zambonelli, M. Iotti, I. Hall Micologia Italiana vol. 44 (2015) ISSN 2465-311X DOI: 10.6092/issn.2465-311X/5593 Current status of truffle cultivation: recent results and future perspectives ________________________________________________________________________________ Alessandra Zambonelli1, Mirco Iotti1, Ian Hall2 1Department of Agricultural Science, Bologna University, viale Fanin 46, 40127 Bologna Italy 2 Truffles & Mushrooms (Consulting) Ltd, P.O. Box 268, Dunedin, New Zealand Correspondig Author M. Iotti e-mail: [email protected] Abstract In this review the current status of truffle cultivation in Europe and outside Europe is reported. While the cultivation of Tuber melanosporum (Périgord black truffle), Tuber aestivum (summer or Burgundy truffle) and Tuber borchii (bianchetto truffle) gave good results, only the Italian white truffle (Tuber magnatum), which is the most expensive, has yet to be successfully cultivated. In future a revolutionary approach to truffle cultivation would be the application of mycelial inoculation techniques for producing Tuber infected plants which will allow to select the fungal strains adapted to specific climatic, edaphic conditions and hosts. The new insights which will be gained by the extensive Tuber genome sequencing programme will also help to improve truffle cultivation techniques. Keywords: Tuber melanosporum; Tuber magnatum; Tuber borchii; Tuber aestivum; cultivation; mycelial inoculation Riassunto I tartufi sono funghi ascomiceti appartenenti all’ordine delle Pezizales anche se molti ricercatori considerano “veri tartufi” solo le specie apparteneti al genere Tuber, che comprende le specie di maggiore interesse gastronomico e commerciale quali Tuber melanosporum (tartufo nero pregiato), Tuber magnatum (tartufo bianco pregiato), Tuber aestivum (tartufo estivo o uncinato) e Tuber borchii (tartufo bianchetto). L’elevato valore economico di questi tartufi ha suscitato grande interesse riguardo la loro coltivazione fin dal lontano rinascimento.
    [Show full text]
  • The Venice Carnival • Cuneo Stone • Antonio Meucci • America, the Musical • Cremona Salami • Gothic Underground
    #53 • February 8th, 2015 IN THIS NUMBER: THE VENICE CARNIVAL • CUNEO STONE • ANTONIO MEUCCI • AMERICA, THE MUSICAL • CREMONA SALAMI • GOTHIC UNDERGROUND... & MUCH MORE INTERVIEW WITH Gianluca DE Novi from Basilicata to Harvard # 53 • FEBRUARy 8TH, 2015 Editorial staff We the Italians is a web portal where everybody Umberto Mucci can promote, be informed and keep in touch with anything regarding Italy happening in the US. It is Giovanni Vagnone also the one and only complete archive of every Alessandra Bitetti noncommercial website regarding Italy in the USA, Manuela Bianchi geographically and thematically tagged. Enrico De Iulis Jennifer Gentile Martin We also have our online magazine, which every 15 William Liani days describes some aspects of Italy the beautiful and some of our excellences. Paola Lovisetti Scamihorn We have several columns: all for free, in English, in Simone Callisto Manca your computer or tablet or smartphone, or printed Francesca Papasergi to be read and shared whenever and wherever you Giovanni Verde want. Anna Stein Ready? Go! Plus, articles written by: www.expo2015.org www.borghitalia.it www.buonenotizie.it www.folclore.it www.italia.it www.livingadamis.com MIPAAF © # 53 • February 8th, 2015 UNIONCAMERE ... and many more. SUBSCRIBE OUR NEWSLETTER http://wetheitalians.com/index.php/newsletter CONTACT US [email protected] 2 | WE THE ITALIANS www.wetheitalians.com # 53 • febrUARy 8TH, 2015 INDEX EDITORIAL #53: ITALIAN LITTLE ITALIES: What’s up with WTI Tagliacozzo, The ancient capital of Marsica By Umberto Mucci By I borghi più belli d’Italia pages 4 pages 36-37 THE INTERVIEW: ITALIAN ART: Gianluca De Novi Gothic underground By Umberto Mucci By Enrico De Iulis pages 5-10 pages 38-40 ITALIAN TRADITIONS: GREAT ITALIANS OF THE PAST: The Venice Carnival Antonio Meucci By folclore.it By Giovanni Verde pages 11-13 pages 41-42 ITALIAN CULTURE AND HISTORY: ITALIAN SPORT: House Museums and Historic Homes Tennis, Ferrari and ..
    [Show full text]
  • Non-Wood Forest Products in Europe
    Non-Wood Forest Products in Europe Ecologyand management of mushrooms, tree products,understory plants andanimal products Outcomes of theCOST Action FP1203 on EuropeanNWFPs Edited by HARALD VACIK, MIKE HALE,HEINRICHSPIECKER, DAVIDE PETTENELLA &MARGARIDA TOMÉ Bibliographicalinformation of Deutsche Nationalbibliothek [the German National Library] Deutsche Nationalbibliothek [the German National Library] hasregisteredthispublication in theGermanNationalBibliography. Detailed bibliographicaldatamay be foundonlineathttp: //dnb.dnb.de ©2020Harald Vacik Please cite this referenceas: Vacik, H.;Hale, M.;Spiecker,H.; Pettenella, D.;Tomé, M. (Eds)2020: Non-Wood Forest Products in Europe.Ecology andmanagementofmushrooms, tree products,understoryplantsand animal products.Outcomesofthe COST Action FP1203 on EuropeanNWFPs, BoD, Norderstedt,416p. Coverdesign, layout,produced andpublished by:BoD –Books on Demand GmbH, In de Tarpen 42,22848 Norderstedt ISBN:978-3-7526-7529-0 Content 5 1. Introduction.......................................................11 1.1Non-wood forest products.....................................11 1.2Providingevidencefor NWFP collection andusage within Europe ......................................14 1.3Outline of thebook...........................................15 1.4References ...................................................17 2. Identificationand ecologyofNWFPspecies........................19 2.1Introduction.................................................19 2.2 Theidentification of NWFP in Europe. ........................
    [Show full text]
  • Venosa – Chiaromonte – Lauria
    UNITA’ OPERATIVA PATOLOGIA CLINICA - ASP Laboratorio Analisi Chimiche, cliniche e microbiologiche SEDI: Venosa – (Sede U.O.C.) Altre Sedi: Chiaromonte - Lauria Presentazione L'Unità Operativa di Patologia Clinica dell’ASP ha sede principale presso il Presidio Ospedaliero di Venosa, cui si aggiungono le articolazioni funzionali con sede presso i Presidi Ospedalieri Distrettuali di Chiaromonte e Lauria. Il compito istituzionale consiste nell'eseguire esami e ricerche di diagnostica di laboratorio su campioni a matrice biologica, per fornire informazioni clinicamente utili, corrette e tempestive finalizzate alla gestione appropriata del paziente-utente, perseguendo l’obiettivo di favorire la cultura della prevenzione; di valutare lo stato di salute, orientando la diagnosi e monitorando la terapia instaurata per la cura delle malattie; di offrire un supporto di consulenza nell'interpretazione dei risultati e di suggerire ulteriori indagini di approfondimento diagnostico. Per questa funzione si avvale di risorse professionali, strutturali e strumentali: difatti impiega una equipe costituita da personale dipendente ben motivato, sotto il profilo umano e professionale, appartenente a diverse discipline sanitarie: Medici, Biologi, Tecnici di Laboratorio bio-medico ed Infermieri, che partecipa ai programmi di Educazione Continua in Medicina (ECM) per l'aggiornamento professionale delle figure sanitarie; utilizza tecnologie di ultima generazione per l'attività analitica e si avvale di strumenti che consentono il miglioramento continuo dei requisiti
    [Show full text]
  • WERESILIENT the PATH TOWARDS INCLUSIVE RESILIENCE The
    UNISDR ROLE MODEL FOR INCLUSIVE RESILIENCE AND TERRITORIAL SAFETY 2015 #WERESILIENT COMMUNITY CHAMPION “KNOWLEDGE FOR LIFE” - IDDR2015 THE PATH TOWARDS INCLUSIVE RESILIENCE EU COVENANT OF MAYORS FOR CLIMATE AND The Province of Potenza experience ENERGY COORDINATOR 2016 CITY ALLIANCE BEST PRACTICE “BEYOND SDG11” 2018 K-SAFETY EXPO 2018 Experience Sharing Forum: Making Cities Sustainable and Resilient in Korea Incheon, 16th November 2018 Alessandro Attolico Executive Director, Territorial and Environment Services, Province of Potenza, Italy UNISDR Advocate & SFDRR Local Focal Point, UNISDR “Making Cities Resilient” Campaign [email protected] Area of interest REGION: Basilicata (580.000 inh) 2 Provinces: Potenza and Matera PROVINCE OF POTENZA: - AREA: 6.500 sqkm - POPULATION: 378.000 inh - POP. DENSITY: 60 inh/sqkm - MUNICIPALITIES: 100 - CAPITAL CITY: Potenza (67.000 inh) Alessandro Attolico, Province of Potenza, Italy Experience Sharing Forum: Making Cities Sustainable and Resilient in Korea Incheon, November 16th, 2018 • Area of interest Population (2013) Population 60.000 20.000 30.000 40.000 45.000 50.000 65.000 70.000 25.000 35.000 55.000 10.000 15.000 5.000 0 Potenza Melfi Lavello Rionero in Vulture Lauria Venosa distribution Avigliano Tito Senise Pignola Sant'Arcangelo Picerno Genzano di Lagonegro Muro Lucano Marsicovetere Bella Maratea Palazzo San Latronico Rapolla Marsico Nuovo Francavilla in Sinni Pietragalla Moliterno Brienza Atella Oppido Lucano Ruoti Rotonda Paterno Tolve San Fele Tramutola Viggianello
    [Show full text]
  • Ministero Della Salute DIREZIONE GENERALE DELLA DIGITALIZZAZIONE, DEL SISTEMA INFORMATIVO SANITARIO E DELLA STATISTICA Ufficio Di Statistica
    Ministero della Salute DIREZIONE GENERALE DELLA DIGITALIZZAZIONE, DEL SISTEMA INFORMATIVO SANITARIO E DELLA STATISTICA Ufficio di Statistica Oggetto: Regione Basilicata – Analisi della rete assistenza ambulatoriale nelle aree interne. Le prestazioni specialistiche ambulatoriali erogabili dal Servizio sanitario nazionale costituiscono il livello essenziale di assistenza garantito dal sistema di sanità pubblica in questo regime di erogazione. Si forniscono di seguito i risultati dell’analisi condotta sui dati sui dati relativi alla rete di assistenza ambulatoriale delle aree interne selezionate dalla Regione Basilicata, rilevati per l’anno 2012 attraverso le seguenti fonti informative: - Modelli di rilevazione Decreto Ministro della salute 5 dicembre 2006 STS.11 - Dati anagrafici delle strutture sanitarie; STS.21 - Assistenza specialistica territoriale: attività clinica, di laboratorio, di diagnostica per immagini e di diagnostica strumentale. Le informazioni tratte dalle suddette fonti informative consentono di caratterizzare la rete di offerta di assistenza ambulatoriale dei Comuni oggetto di analisi, con riferimento alle strutture sanitarie presenti nelle aree interne (Fonte STS.11) e ai relativi dati di attività (Fonte STS.21 – quadro F). L’analisi è stata condotta sulla base dei dati trasmessi dalla Regione Basilicata al Ministero della salute, relativamente ai Comuni ricompresi nelle seguenti aree del territorio regionale: ALTO BRADANO: Acerenza, Banzi, Forenza, Genzano di Lucania, Oppido Lucano, Palazzo San Gervasio, San Chirico
    [Show full text]
  • Truffle Farming in North America
    Examples of Truffle Cultivation Working with Riparian Habitat Restoration and Preservation Charles K. Lefevre, Ph.D. New World Truffieres, Inc. Oregon Truffle Festival, LLC What Are Truffles? • Mushrooms that “fruit” underground and depend on animals to disperse their spores • Celebrated delicacies for millennia • They are among the world’s most expensive foods • Most originate in the wild, but three valuable European species are domesticated and are grown on farms throughout the world What Is Their Appeal? • The likelihood of their reproductive success is a function of their ability to entice animals to locate and consume them • Produce strong, attractive aromas to capture attention of passing animals • Androstenol and other musky compounds French Truffle Production Trend 1900-2000 Driving Forces: • Phylloxera • Urbanization Current Annual U.S. Import volume: 15-20 tons Price Trend:1960-2000 The Human-Truffle Connection • Truffles are among those organisms that thrive in human- created environments • Urban migration and industrialization have caused the decline of truffles not by destroying truffle habitat directly, but by eliminating forms of traditional agriculture that created new truffle habitat • Truffles are the kind of disturbance-loving organisms that we can grow Ectomycorrhizae: Beneficial Symbiosis Between the Truffle Fungus and Host Tree Roots Inoculated Seedlings • Produced by five companies in the U.S. and Canada planting ~200 acres annually • ~3000 acres planted per year globally • Cultivated black truffle production now
    [Show full text]