Open Journal of Genetics, 2013, 3, 102-110 OJGen http://dx.doi.org/10.4236/ojgen.2013.32013 Published Online June 2013 (http://www.scirp.org/journal/ojgen/) A realized Tuber magnatum niche in the upper Sinni area (South Italy) Giovanni Figliuolo, Giovanna Trupo, Stefania Mang Dipartimento delle Culture Europee e del Mediterraneo (DICEM), Università degli Studi della Basilicata, Matera, Italy Email: [email protected] Received 7 January 2013; revised 20 February 2013; accepted 1 May 2013 Copyright © 2013 Giovanni Figliuolo et al. This is an open access article distributed under the Creative Commons Attribution Li- cense, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT species resilience and persistence within a changing en- vironment [5]. The knowledge of hypogean mushroom A realized Tuber magnatum niche, in the upper Sinni species that live in symbiosis with the surface roots of area (Serrapotamo, south Italy), was studied using many plant species, collectively known as truffles, would geographic information system, direct in situ survey be enhanced by integrating the niche concept and genetic and genetic diversity at DNA marker loci. Truffières diversity data. Niche modeling can improve the man- were north facing, associated with a fine loamy-sandy agement of both natural and artificial truffières. The soil bearing high carbonate content over a conglom- niche concept has been used primarily for Tuber melano- erate bead-rock substrate. Target area is located in sporum Vitt. (Périgord black) and subsequently for less Pavari's cold and medium-cold Lauretum phithocli- important species (T. aestivum Vitt., T. brumale var. mo- matic belts. Ascoma genomic DNA was analyzed and schatum Ferry, T. macrosporum Vitt., T. borchii Vitt. and ITS sequences, microsatellites (MA2, MA4 and MA7), T. mesentericum Vitt.) whose environmental optimal along with M13 minisatellite loci, did show low heteo- growing conditions (e.g. soil, climate and vegetation) zygosity (HE = 0.153). Serrapotamo genotypes did not show a wider range of variation than the more specialist express localized markers when compared with Pie- T. magnatum Pico. Artificial truffières are dictated by monte (north Italy) genetic material. ITS marker, validated protocols of plant inoculation, cultivation and monomorphic within T. magnatum, was efficient at truffle harvesting with trained dogs [6]. In contrast, pre- distinguishing T. borchii in a mixture of both. Ser- dicting T. magnatum fundamental niche is not so far pos- rapotamo niche represents a unique T. magnatum sible. Growing areas are not fully known while ecologi- diversity spot in the southernmost side of the Medi- cal and genetic baseline data are often insufficient. T. terranean region. Maintaining Serrapotamo T. mag- magnatum, the Italian white truffle (“tartufo bianco natum diversity by undertaking conservation meas- pregiato”), is one of the top most delicacies in the culi- ures is adviced. nary list. In the “good” years T. magnatum price oscil- lates between 1200 and 2500 €/Kg, but it can rise up to Keywords: Genetic Diversity; Conservation; Niche; 3000 or 4000 €/Kg in years with difficult environmental White Truffle conditions. Truffle market involves about 400 millions of euro and hundreds of harvesters holding a regular license 1. INTRODUCTION [7]. T. magnatum ascocarps are harvested from very local- The range of favorable environmental conditions under ized natural or quasi-natural ecosystems mapped in Italy which an organism can survive and reproduce itself [8,9], Croatia [10], Slovenia [9,11], Ticino Canton [8], (fundamental niche) can be predicted for the most im- Serbia and Hungary [12]. Italy is the main producer of portant wood tree and domesticated crop species [1-3]. “tartufo bianco pregiato”. Surprisingly, T. magnatum Nonetheless, because of the combination of negative (e.g. producing areas are reported as located in central and species competition, dispersal constraints, etc.) with northern Italy and only “rarely” south of Umbria [8,9]. positive interactions (e.g. symbiosis), the realized niche For the first time Pomarico et al. [13] brought to light [4], for a given species, can be more or less extended Basilicata as the southern Italian Region rich in Tuber than the predicted one [2]. Genetic variation will ensure species. Among the edible species, T. magnatum is OPEN ACCESS G. Figliuolo et al. / Open Journal of Genetics 3 (2013) 102-110 103 common and locally distributed in “Serrapotamo”, an 2. MATERIALS AND METHODS area connected with Pollino National Park [13]. Rubini et 2.1. Biological Sample al. [9] assessed genetic distance of some T. magnatum specimens from Basilicata. Overall, genetic analyses Fifty-three T. magnatum specimens (whole ascocarp or a supported a self-fertilization breeding system consistent fragment of it) were collected with the help of trained with the estimates of the within and between population dogs, in different sites from natural or quasi-natural truf- genetic diversity [9,11,13]. However, differentiation due fle fields located in the territory of the following mu- to habitat fragmentation should not be excluded. Deline- nicipalities (Serrapotamo area): Chiaromonte, Calvera, ating geographic areas characterized by a suitable cli- Castronuovo, Fardella, Francavilla S., Teana, Carbone, mate for perennial symbiotic species is a consolidated Episcopia and S. Chirico R. Sampling sites are mostly method in forestry since the early 20th century [1]. The included within the Pollino National Park. Eight asco- Lauretum cold belt, associated with T. magnatum distri- mata from Montemagno and Mombercelli d’Asti (Pie- bution [13], requires an annual mean temperature from monte) were used as out-group (Table 1). As reference, 12˚C to 17˚C, a temperature higher than 3˚C in the cold- three different species (T. borchii, T. mesentericum and T. est month and the average of the yearly minimum tem- brumale) were used in molecular analyses (Table 1). peratures higher than −9˚C [1]. When phytoclimatic con- ditions are met, geological maps represent an excellent 2.2. DNA Analysis additional tool to identify truffle production areas given Tissue scrap (0.25 - 1 g), from each ascoma, was cleaned that suitable soils (regolithic or residual) depend on the with distilled water to eliminate soil residues, before total bed-rock type [14]. T. magnatum, whose mycelium is genomic DNA extraction. The collection (No = 54) was more widespread than can be inferred from the truffles pre-screened with the ITS molecular fragment which and ectomycorrhiza distribution [15], prefers alkaline, allows easily the distinction of different species, includ- moist, very well drained, and aerated soil [10,16]. In op- ing T. borchii from T. magnatum. T. borchii produced a posite, assessing soil micro-flora composition and pre- lower molecular weight band (~560 bp) in comparison valence is difficult; α-Proteobacteria is the most repre- with T. magnatum (~660 bp) (Table 1). T. magnatum sented bacterial component, associated with the ascoma total genomic DNA, according to the cited Authors’ pro- [17]. tocol [20-23] with minor laboratory-specific modifica- Although artificial mycorrhization of plant roots with tions, was used to screen the following different marker T. magnatum ascospores is feasible [18,19], rarely mas- types: sive ascomata productions have been reported in artifi- Minisatellite M13 using the universal primer M13 cial plantations. Thus, the actual marketed ascomata are (GAGGGTGGCGGTTCT) [20]; from natural or semi-natural realized niches. Expert har- Three microsatellite loci (MA2, MA4, MA7) [21]; vesters are aware that overexploitation in conjunction ITS1 (5’TCCGTAGGTGAACCTGCGG-3’) and with climatic impacts will produce quick T. magnatum ITS4 (5’TCCTCCGCTTATTGATATGC3’) universal genetic erosion. The ascoma intrinsic value depends on primers [22]; its authenticity, freshness, optimal readiness, fragrance, ITS sequence of seven specimens from Piemonte and size, shape regularity, integrity and weight. Truffles from seven from different Basilicata sampling sites was less important species (e.g. T. borchii) can be visually obtained throughout direct amplicon sequencing [23]. confused with T. magnatum. Furthermore, T. borchii, as a ITS sequences were compared using the NCBI online generalist species, is more abundant and can be sympat- standard Basic Local Alignment Search Tool (BlastN). ric to T. magnatum. In south Italy, Greece and Turkey T. borchii is ripening earlier than February-March. It fol- Table 1. Truffle DNA specimens from different ascomata ana- lows that late-ripening T. magnatum ascocarps can be lyzed with molecular markers along with ITS fragment dis- phenotypically confused with earlier-ripening T. borchii. criminating different species. Ecologic niche studies using geographic information No ascomata ITS1-2 fragment Species system integrated with molecular marker technology and (origin) (bp) in situ monitoring are appropriate to carry out prelimi- 8 (Piemonte) 660 nary assessment of areas suited to T. magnatum conser- T. magnatum 53 (Basilicata) 660 vation. We attempted to promote in situ conservation of such T. borchii 2 (Basilicata) 560 a magnificent gift of the nature by characterizing one of T. brumale var. moscatum 2 (Basilicata) 900 the most important producing niches in south Italy and assessing its level of genetic diversity. T. mesentericum 2 (Basilicata) 720 Copyright © 2013 SciRes.