IDENTIFICATION OF A NOVEL CANDIDATE RECEPTOR FOR HUMAN RESPIRATORY SYNCYTL4L VIRUS SUBGROUP A
by
FARNOOSH TAYYARI
M.Sc., The University of British Columbia, 2003 M.D., Mashhad University of Medical Sciences, Mashhad, Iran, 1997
A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
in
THE FACULTY OF GRADUATE STUDIES (PATHOLOGY AND LABORATORY MEDICINE)
THE UNIVERSITY OF BRITISH COLUMBIA
October, 2008
© Farnoosh Tayyari, 2008 Abstract
Introduction: Respiratory syncytial virus (RSV) is an important pathogen, especially in children, the elderly, and immunocompromised individuals. Despite RSV being discovered decades ago, there is still no good treatment or prevention for RSV disease. The cell surface receptor for RSV is not known and identification of RSV receptor(s) will provide improved opportunities for understanding the pathogenesis of the viral disease and potential for discovering novel antiviral agents.
Hypothesis: RSV infects cells via attachment to cell surface receptor(s) which can be identified by unbiased interrogation of cell membrane constituents and functionally characterized by blocking and competition experiments.
Specific Aims: Chemical characterization of RSV receptor(s) by cell surface enzyme treatments, identifying candidate receptor(s), and confirming that any identified candidate has characteristics of a receptor were specific aims of the project.
Methods: Chemical characteristics of RSV binding molecule(s) were investigated using enzyme digestion studies. Methods used for identification of candidate receptors included: co immunoprecipitation of candidate RSV receptors using whole virion; purification of RSV surface proteins (either by chromatography or by cloning), and virus overlay protein binding assay (VOPBA) combined with mass spectrometry (MS) and protein database searching.
Neutralization experiments, in which cells were incubated with anti-candidate receptor antibodies prior to RSV exposure, and competition experiments, in which virus was pre incubated with purified candidate molecule prior to inoculation of cell cultures were performed.
Results: The results of enzyme digestion studies showed that the RSV binding molecule is a non-glycosylated, non-glycosyiphosphatidylinositol-anchored protein. Experiments involving
11 co-immunoprecipitation of RSV receptor using whole virion, or purification of RSV surface proteins (either by chromatography or by cloning), were unsuccessful. By contrast, VOPBA combined with MS resulted in cell surface nucleolin being identified as a candidate RSV binding molecule, and was reproducible in several cell lines originating from different species.
Neutralization and competition experiments showed decreased RSV infection in vitro.
Conclusion: Nucleolin, expressed on the surface of multiple cell types from diverse species, was identified as a candidate receptor for RSV. Subsequent blocking and competition experiments showed evidence of nucleolin having characteristics of a functional receptor.
These findings provide a basis for future work to investigate RSV-nucleolin interactions.
111 Table of Contents Abstract ii Table of Contents iv List of Tables viii List of Figures ix List of Abbreviations x Acknowledgements xii Dedication xiii 1 II’ITRODUCTION 1 1.1 Cell Membranes 1 1.1.1 Membrane Architecture 2 1.1.1.1 The Lipid Bilayer 2 1.l.1.2LipidRafts 2 1.1.1.3 Glycolipids 3 1.1.1.4 Membrane Proteins 3 1.1.1.5 Glycoproteins 5 1.1.1.6 Cell Membrane Structure: Summary 5 1.2 Virus Receptors 5 1.3 Discovery of Virus Receptors 8 1.3.1 Identification of Candidate Receptors 8 1.3.1.1 Cell Surface Enzyme Treatments 9 1.3.1.2 Virus Overlay Protein Binding Assay (VOPBA) 9 1.3.1.3 Virus Overlay on Thin Layer Chromatography 10 1.3.1.4 Expression Cloning 10 1.3.1.5 Anti-receptor Antibodies 10 1.3.1.6 Immunoprecipitation (IP) of the Receptor Using Viral Proteins 11 1.3.1.7. A Clever Guess 11 1.3.2 Confirmation that the Candidate is the Receptor 12 1.3.3 Summary 13 1.4 Antivirals 14 1.4.1 Vaccines 14 1.4.2 Interferons 14 1.4.3 Chemical Compound Based Drugs 15 1.4.4 Biochemical Agents 15 1.4.5 Summary 18 1.5 RSV Overview 19 1.5.1 Historical Background 19 1.5.2 Classification 19 1.5.3 Structure 20 1.5.3.1 SHProtein 21 1.5.3.2 G Protein 21 1.5.3.3 F Protein 25 1.5.4 Replication 28 1.5.5 Attachment and Entry 30 1.5.5.1 Surfactant Proteins 31 1.5.5.2 GAGs 31 1.5.5.3ICAM-1 31
iv 1.5.5.4 Lipid 32 1.5.5.5Actin 33 1.5.6 RSV PreventionRafts. and Management 33 1.5.6.1 Immunization 33 1.5.6.2 Immunoprophylaxis 34 15.6.3 Management 34 1.5.7 Summary 35 2 SCOPE OF THE THESIS 37 2.1 Hypothesis 37 2.2 Specific Aims 38 2.3 General Research Plan 38 3 METHODS 39 3.1 Cells 39 3.2 Trypan Blue Exclusion Test of Cell Viability 39 3.3 Preparation of RSV Stocks 41 3.4 RSV Plaque Assay 42 3.5 CVB3 Infection 42 3.6 CVB3 Plaque Assay 43 3.7 Cell Surface Enzyme Treatment 43 3.7.1 Trypsin 44 3.7.2 Glycosidases 45 3.7.3 P1-PLC 45 3.8 Protein Sample Preparation and Sodium Dodecyl Sulfate-Polyacralamide Gel Electrophoresis (SDS-PAGE) 46 3.8.1 Gel Electrophoresis of Native Proteins 47 3.8.2 Running Large Gels 47 3.9 Coomassie Blue Staining 49 3.10 Western Blot 49 3.11 Preparation of “Crude” Membrane Proteins 51 3.12 Preparation of “Enriched” Cell Surface Membrane Proteins 51 3.13 Preparation of Biotinylated Cell Surface Membrane Proteins 52 3.14 Caveolin-rich Light Membrane (CLM) Fractionation 54 3.15 Immunoprecipitation 55 3.15.1 Cell Lysis 55 3.15.2 Pre-Clearing 56 3.15.3 Coupling Antigen to Antibody 56 3.15.4 Precipitation of Immune Complexes 56 3.15.5 Dissociation and Analysis 57 3.16 Virus-Receptor Co-Immunoprecipitation 57 3.16.1 Co-immunoprecipitation of CAR Using CVB3 as Bait 57 3.16.2 Co-immunoprecipitation of an Unknown Receptor Using RSV as Bait 58 3.17 Chromatography for Purification of RSV F and G proteins 58 3.17.1 Cell Preparation 59 3.17.2 Column Preparation 59 3.17.2.1 HiTrapQ FF (GE Healthcare) 59 3.17.2.2 Lentil-lectin (GE Healthcare) 59 3.17.3 Processing of RSV-infected HEp-2 Cell Lysate 60 3.17.4 Running HiTrapQ FF Column 60 3.17.5 Running Lentil-Lectin Column 61
v 3.17.6 Concentrating and Spin-dialysing Purified RSV F Protein 62 3.18 RSV F Protein Cloning and Protein Expression 63 3.18.1.1 Growing and Purification of Plasmids 64 3.18.1.2 Restriction Enzyme Digestion 66 3.18.1.3 Agarose Gel Electrophoresis 66 3.18.1.4 Isolation of DNA from Agarose Gel 67 3.18.1.5 Polymerase Chain Reaction (PCR) 67 3.18.1.6 Insert-plasmid Vector Ligation 68 3.18.1.7 Transformation 69 3.18.1.8 Transient Transfection 69 3.18.2 Insertion of RSV F protein Excluding Its Signal Peptide or Extracellular Domain of RSV F Protein into pcDNA3. 1/V5-His-TOPO® 70 3.19 Pierce In-Gel®Chemiluminescent Detection 72 3.20 Virus Overlay Protein Binding Assay (VOPBA) 74 3.21 Sample Preparation for MS 75 3.22 MS Analysis 75 3.23 Enzyme Treatment of Membrane Proteins 76 3.23.1 Proteases 76 3.23.2 Glycosidases 77 3.24 Antibody Blocking Experiments 77 3.25 Competition Experiments 78 3.26 Flow Cytometry 78 3.27 Statistical Analysis 79 4 RESULTS 80 4.1 Cell Surface Enzyme Treatment 80 4.1.3 P1-PLC 86 4.2 Virus-Receptor Co-Immunoprecipitation 91 4.2.1 Immunoprecipitation of CVB3 Using Anti-enterovirus VP1 91 4.2.2 Co-immunoprecipitation of CAR Using CVB3 as Bait 91 4.2.3 Co-immunoprecipitation of an Unknown Receptor Using RSV as Bait 93 4.3 Purification of RSV F and G Proteins by Chromatography 93 4.4 Cloning RSV F Protein 97 4.5 VOPBA and In-Gel Chemiluminescent Detection 101 4.6 Membrane Protein Enzyme Treatment 108 4.7 Further Localization of the 100 kDa RSV VOPBA Signal 112 4.8 Antibody Blocking Experiments 112 4.9 Competiton Experiment: RSV Infection in the Presence of Purified Nucleolin 116 5 DISCUSSION 121 5.1 General Characteristics of RSV Receptor 121 5.1.1 Protein Digestion 122 5.1.2 Carbohydrate Digestion 123 5.1.3 Lipid Digestion 125 5.2 Feasibility of Using Proteomics for Identification of Candidate RSV Receptors 126 5.2.1 Immunoprecipitation Using RSV Virion 126 5.2.2 Immunoprecipitation Using Purified RSV Proteins 129 5.2.3 Production of Recombinant Epitope-tagged RSV F Protein 130 5.2.4 Summary: Immunoprecipitation Experiments 133 5.3 VOPBA 134 5.3.1. RSV VOPBA 138
vi 5.4. Nucleolin Structure and Biology 139 5.5 Conclusion and Future Directions 146 References 151 Appendix A Maps of Vectors 161 Appendix B Sequences and Primers 162 Appendix C Sequencing Results 164 Appendix D MS Results . 167
vii List of Tables Table 1- The Species of Origin and Description of Mammalian Cells Used in this Thesis 40 Table 2.-SDS-PAGE Details 48 Table 3- List and Source of Primary Antibodies Used for Western Blot 50 Table 4- HEp-2 Cell Viability after Enzyme Treatment 81 Table 5. Protein Identification, Score and Overall Coverage of Protein Hits Reported by MS and Highlighted in Appendix D 111
viii List of Figures Figure 1. Map of RSV G protein 24 Figure 2 Map of RSV F0 Protein 26 Figure 3. RSV life cycle 29 Figure 4. Western blot image of trypsin pretreated and non-pretreated RSV-infected cells 83 Figure 5. Results of RSV Western blot on trypsin pretreated and non-pretreated cells 24 h post infection 85 Figure 6. Effect of membrane protein enzyme treatment on EGFR and DAF 87 Figure 7. Effect of cell surface glycosidase treatment on EGFR and DAF of intact cells 88 Figure 8. Flow cytometry of DAF to study the effect of PT-PLCtreatment on intact cells 89 Figure 9. Effect of PT-PLCcell surface pretreatment on RSV infection 90 Figure 10. Successful CVB3 VP-i (33 kDa) immunoprecipitation and Western blotting 92 Figure ii. Western blot probing for CAR (46 kDa) after successful co-immunoprecipitation with anti-enterovirus VP1 94 Figure 12. Immunoprecipitation of RSV proteins using goat anti-RSV polyclonal antibody. ... 95 Figure 13. Coomassie Blue image of samples prepared from first step of chromatography 96 Figure 14. RSV F Western blot on fractions obtained from first step of chromatography 98 Figure 15. RSV G Western blot on fractions obtained from first step of chromatography 99 Figure 16. Western blot on fractions obtained from second step of chromatography, a further protein enrichment using Lentil-Lectin. chromatography 100 Figure 17. Western blot and in-gel protein detection for transferrin 103 Figure 18. AdV5-gfp VOPBA. Figure shows half of the loaded gel 105 Figure 19. Comparison of CAR Western blot (left) and AdV5-gfp VOPBA (right) 106 Figure 20. Comparison of different sample preparations in RSV VOPBA 107 Figure 21. RSV VOPBA using different cell lines prepared from biotinylated cell surface proteins 109 Figure 22. Controls for RSV VOPBA 110 Figure 23. Effect of enzyme treatment on RSV VOPBA on biotinylated cell surface membrane proteins 114 Figure 24. HEp-2 cell subfractionation using sucrose gradient 115 Figure 25. Effect of 4 IgJ mL anti-nucleolin antibody on RSV replication 117 Figure 26. Effect of 20 p.g/mL anti-nucleolin antibodies on RSV and AdV5 replication 118 Figure 27. Western blot for nucleolin using rabbit polyclonal anti-nucleolin antibodies 119 Figure 28. Effect of incubation of RSV with purified nucleolin on subsequent virus replication. 120 Figure 29. An integrative model proposed according to the findings of the current thesis 148
ix List of Abbreviations
2-DE: two dimensional gel electrophoresis ACE: angiotensin converting enzyme AdV5: adenovirus 5 ANOVA: analysis of variance AS-ONs: antisense-oligonucleotides ATCC: American type culture collection bRSV: bovine RSV BSA: bovine serum albumin CAR: coxsackie adenovirus receptor ClAP: calf intestinal alkaline phosphatase CLD: chronic lung disease CLM: caveolin-rich light membrane CMV: cytomegalovirus CVB3: coxsackie virus B3 CX3CR: CX3C receptor DAF: decay accelerating factor DC-SIGN: dendritic cell-specific intercellular adhesion molecule (ICAM)-3- grabbing nonintegrin DMEM: Dulbecco’s modified Eagle’s medium DMF: N-N-dimethylformamide DPPC: dipalmitoyl phosphatidyicholine eGFP: expresses the green fluorescent protein EGFR: epidermal growth factor receptor ER: endoplasmic reticulum FBS: fetal bovine serum FDA: Food and Drug Administration GAGs: glycosaminoglycans GPI: glycosyiphosphatidylinositol GST: glutathione-S-transferase HAV: hepatitis A virus HBV: hepatitis B virus HBSS: Hank’s buffered salt solution HCV: hepatitis C virus HIV: human immunodeficiency virus HPLC: high performance liquid chromatography HRP: horseradish peroxidase HSV: herpes simplex virus HS: heparan sulphate ICAM: intercellular adhesion molecule IEF: isoelectric focusing IgG- 1: immunoglobulin--y1 IP: Immunoprecipitation LB: Lauria-Bertani LCMV: lymphocytic choriomeningitis virus L-SIGN: liver/lymph node-specific ICAM-3 grabbing nonintegrin
x mAb: monoclonal antibodies MCLR: mannose binding C-type lectin receptor MOl: multiplicity of infection MS: mass spectrometry ORF: open reading frame PAGE: polyacrylamide gel electrophoresis PBS: phosphate buffered saline PBS-T: PBS containing 0.1% Tween-20 PCR: polymerase chain reaction PFU: plaque forming units PT-PLC: phosphatidylinositol-specific phospholipase C p1: isoelectric points PLs: phospholipases PMSF: phenylmethylsulphonyl fluoride RNAi: RNA interference RSV: respiratory syncytial virus RSV-IVIG: intravenous immunoglobulin containing high levels of RSV neutralizing antibody Rz: ribozymes SARS-CoV: severe acute respiratory syndrome associated coronavirus sCD4: soluble form of CD4 SDS-PAGE: sodium dodecyl sulfate-polyacralamide gel electrophoresis SFV: Semliki forest virus sICAM- 1: soluble ICAM- 1 SP: surfactant proteins TAE: ths-acetate-EDTA TBS: tris buffered saline VCAM: vascular cellular adhesion molecule VLA: very late antigen VOPBA: virus overlay protein binding assay WD HAE: well differentiated human airway epithelial cells
xi Acknowledgements
This research project has been made possible by the support of many people. I wish to express deepest gratitude to my supervisor Dr. Richard Hegele for his invaluable, constant, and constructive inspiration, support and guidance. I would also like to express sincere appreciation to my co-supervisor Dr. Bruce McManus for his priceless experience and advice and to Dr.
David Walker for being such an outstanding advisor. Special thanks also to other members of the supervisory committee, Dr. François Jean, Dr. Robert Molday, and Dr. John Hill for their time and effort in reviewing this research work. The close cooperation with Dr. David Marchant was a great experience and his feedback was always helpful. I would also like to thank Ms.
Aima Meredith and Ms. Beth Whalen for their assistance in flow cytometry and Dr. Gurpreet
Singhera for providing me with high titre RSV whenever I desperately needed it. Deepest appreciation to my husband for his encouragement, patience and understanding during the years spent on this project. The last (but not least) acknowledgment goes to my beloved parents for their unconditional love and support throughout my years of education, and especially my mother, for without her help in taking care of my little daughter this thesis would not have been written.
xii Dedication
‘lb mypareiits
xlii 1 INTRODUCTION
Replication of a virus in a host cell initiates with attachment of the virus to the plasma membrane via receptor-mediated 1binding This chapter will review the characteristics of cell membrane structure, virus receptors,. methods used for discovery of virus receptors, relevance of targeting viral receptors to anti-viral therapy and prevention, and finally introduction to respiratory syncytial virus (RSV), an important human respiratory pathogen for which the receptor is not known.
1.1 Cell Membranes
Cell membranes include the plasma membrane on the cell surface and the membranes of intracellular organelles such as endoplasmic reticulum (ER), Golgi apparatus, and mitochondria
Cell membranes maintain the differences between the contents of cells or organelles2 and the environment surrounding them . .2
Our understanding of cell membrane structure is mainly based on the “fluid mosaic model”, proposed by Singer and Nicolson in early 31970’s According to this model, the cell membrane is a continuous fluid lipid bilayer with proteins. embedded discontinuously all over it. Lipids and proteins are in constant motion in the flat surface of the membranes. The lipid bilayer is a selectively permeable membrane and is a barrier to the passage of most water-soluble molecules.
Almost all of the other functions of the membrane are mediated by proteins. Proteins are involved in the transport of molecules, cell respiration, connecting the cytoskeleton to the extracellular matrix or adjacent cells, or serving as receptors to detect signals and convert them to cellular responses. As a result, a cell uses many different membrane proteins to interact with
1 its environment. It is estimated that integral membrane proteins (see subsection 1.1.1.4) comprise 20—30%of the proteome of prokaryotic or eukaryotic .4cells 1.1.1 Membrane Architecture
1.1.1.1 The Lipid Bilayer
Lipid distribution in the lipid bilayer is irregular which results in asymmetry in the inner and outer leaflets or formation of microdomains within the same 5leaflet Three major components of lipid bilayers are phospholipids, cholesterol, and glycolipids,. with the phospholipids being the most abundant .
1.1.1.2 Lipid Rafts
Lipid rafts are transient moving packs of sphingolipids (phospholipids containing long mostly saturated acyl chains, allowing them to pack tightly together) and cholesterol in the lipid bilayer to which specific proteins 6attach The long hydrocarbon chains of the lipids concentrated in rafts make them thicker .than other parts better of the membrane bilayer resulting in accommodation and hence accumulation of some membrane proteins. Thus, lipid rafts can act as organizers for such proteins, either by concentrating them for transport in small vesicles or enabling them to function together in signal .2transduction Some examples of proteins that partition into lipid rafts are the glycosyiphosphatidylinositol
(GPI)-anchored proteins, which attach to the outer leaflet of the membrane, palmitoylated and myristoylated proteins (e.g., flotillins), cholesterol binding proteins (e.g., caveolins), and phospholipid-binding proteins (e.g., annexins) . Caveolae, morphologically identifiable structures, are flask-shaped, membrane invaginations found in the plasma membranes of
2 numerous types of cells and are enriched in caveolins. Flotillins are non-caveolar proteins that are also localized to lipid rafts and are thought to organize these microdomains .
1.1.1.3 Glycolipids
Glycolipids are carbohydrate-containing lipid molecules that are only found in the noncytosolic monolayer of the cell 8membrane In the plasma membrane, the concentration of glycolipids at the apical membrane is. two-three times greater than at the basolateral 8aspect Gangliosides, a subtype of glycolipids, have been identified as cell-surface receptors for. human polyoma virus, simian virus 40, and BK ’9virus
1.1.1.4 Membrane Proteins
Membrane proteins are responsible for a wide range of biological function. There are different ways for protein-lipid association to occur in the membrane and based on these, membrane proteins can be classified into two major groups: integral and .2peripheral Integral membrane proteins are embedded in the lipid bilayer and can be released only by treatments that disrupt the membrane. The most frequently used reagents for membrane disruption are detergents, which are small bipolar molecules containing both hydrophobic and hydrophilic groups Transmembrane proteins are the most common integral membrane proteins and span the entire lipid bilayer. Other integral membrane proteins are only linked to either cytosolic side or the exoplasmic side of the membrane. The latter are GPI-anchored proteins which are bound to the membrane by a covalent bind (through a specific oligosaccharide) to phosphatidylinositol in the exoplasmic side of the lipid bilayer. The GPI
3 anchored proteins are susceptible to digestion by phosphatidylinositol-specific phospholipase C
(PT-PLC),an enzyme that cleaves these proteins from their anchors and releases them from the ’212membrane Peripheral membrane proteins are indirectly associated with membranes through protein-protein interactions. These proteins dissociate from the membrane following relatively mild procedures such as exposure to extreme pH or high salt concentration, which leave the lipid bilayer .2intact’
Membrane proteins, whether integral or peripheral, are difficult to study experimentally for a number of 3reasons’ The primary difficulty is their low abundance which complicates the ability to obtain. sufficient amounts from their native environment. Strategies designed to overcome low abundance, such as overexpression of cloned constructs of membrane proteins in other systems such as E. coli, usually result in their aggregation within the cytoplasm. As a consequence, functional and stable membrane proteins cannot be easily obtained. Another problem is the close association of membrane proteins with a complex and dynamic environment such as lipid bilayer, which limits usage of many standard techniques for studying their structure and function. Furthermore, membrane proteins are usually not soluble in water solutions. This makes special synthetic systems necessary for their in vitro study; however, such systems have, in general, proven to be impractical for protein reconstitution. As a result, membrane proteins represent less than 1% of structures deposited within the Protein Data 14, Bank although with the advent of sophisticated computer modeling software and bioinfonnatics tools, the three dimensional structures of membrane proteins can be predicted from their primary amino acid .5sequences’
4 1.1.1.5 Glycoproteins
Protein glycosylation is recognized as one of the major post-translational modifications and is essential for proper protein folding, stability and 6activity’ Most transmembrane proteins are glycosylated. A SW1SS-PROT database survey showed. that 91.7% of protein entries with documented extracellular features were described as T‘glycoproteins in the keyword .7field’ Since the sugar residues are added in the lumen of the ER and Golgi apparatus, the oligosaccharide chains are invariably present on the extracellular surface of the lipid .2bilayer
1.1.1.6 Cell Membrane Structure: Summary
Cell membranes separate and maintain the differences between the contents of cells or organelles and the environment surrounding them. The fluid mosaic model proposed by Singer and Nicolson in early 1970’s has developed our current understanding of cell membrane, according to which the cell membrane is a continuous fluid lipid bilayer with proteins embedded discontinuously all over it. Integral membrane proteins are estimated to comprise 20—30%of the proteome of prokaryotic or eukaryotic cells. The cell membrane is constructed from the lipid bilayer, lipid rafts, glycolipids, membrane proteins and glycoproteins. These various components can be studied experimentally through biochemical-based approaches.
1.2 Virus Receptors
The term, “virus receptor” is generally considered to pertain to a molecule, located on the cell surface, which participates in virus attachment and internalization and contributes to viral 8infection’ In the past, it was believed that virus binding occurred through interaction of virus attachment. protein(s) with a single cell surface receptor. However, more recent data suggest that
5 virus binding to the host cell often involves several steps with two or more virus 9receptors’ Interestingly, receptor-independent mechanisms for virus uptake have been proposed. for adenovirus 5 (AdV5) infection in vitro. Dipalmitoyl phosphatidyicholine (DPPC), a component of pulmonary surfactant, interacts with the AdV5 hexon, enhancing virus uptake by a receptor- independent .20mechanism However, the importance of this interaction in vivo is not clear. The preference of a virus to infect a particular cell type is called tropism. Tissue or cell tropism is determined by both susceptibility (i.e., possession of virus receptors) and permissiveness for replication within the infected cell’. Similarly, virus receptors are one of the determinants of the host range (i.e., ability to infect certain animals or cell cultures) of .1viruses
Virus receptors can be members of different families of proteins, carbohydrates, or lipids and in addition to playing a role in virus infection, these molecules typically have other functions such as involvement in immune modulation, signal transduction and cell 21adhesion In general, virus receptor molecules are either very abundant or exclusively found on. the surface of permissive .22cells
Some cell surface molecules bind to viruses to facilitate virus concentration on the surface of target cells or transfer viruses from the cells they initially contact to the target cells. These molecules are considered as “attachment factors” and unlike true receptors, attachment factors are not responsible for guiding the attached viruses into entry pathways or conveying signals into the ’2223cell For example, members of the mannose binding C-type lectin receptor (MCLR) family, . the dendritic cell-specific intercellular adhesion molecule (ICAM)-3-grabbing nonintegrin (DC-SIGN), liver/lymph node-specific ICAM-3 grabbing nonintegrin (L-SIGN), and heparan sulfate are all considered as attachment factors to human immunodeficiency virus
6 23(HIV) Moreover, virus receptors may also induce conformational changes to initiate membrane. fusion and virus .22entry
A review article published on known virus receptors indicates that generally there is no obvious association between virus phylogeny and receptor usage; therefore, receptor prediction by virus phylogeny is unlikely to be a fruitful approach’. Moreover, viruses from different families can use the same receptors. An example of this phenomenon is the coxsackie adenovirus receptor
(CAR), a 46 kDa protein, used by coxsackie virus (a single-stranded RNA virus) and adenovirus (a double-stranded DNA virus) for cellular 24infection Furthermore, different viruses that infect the same cell type may each use different. receptors for attachment and entry. For instance, hepatitis A virus (HAy), hepatitis B virus (HBV), and hepatitis C virus (HCV) use different receptors to initiate infection of hepatocytes’. A Table that contains a comprehensive list of known virus receptors is available .25on-line In some situations, the presence of a cellular receptor is not sufficient for infection and an additional cell surface molecule called a co-receptor is required for virus entry. For example, fusion of HIV particles to host cell membranes is triggered by sequential act of binding to CD4 and a 26co-receptor For HIV-1, the predominant co-receptor is the chemokine receptor CCR5; however,. variants may switch to use chemokine receptor CXCR4 and perhaps other co receptors. Some viruses are able to utilize multiple 27receptors For example, CAR, integrin 3,,cL MHC class I, and vascular cellular adhesion molecule. (VCAM)-l have been reported as receptors for 27AdV5 28 In these cases, experiments using virus mutants along with genetically modified animals are useful tools to clarify the contributions of individual receptor 27molecules Use of alternative receptors by some viruses may be the result of low levels of expression. of a receptor on host cells, resulting in adaptation of the virus to use other molecules as receptors’.
7 For instance, laboratory adaptation of foot-and-mouth disease virus type A12 (the 0 strain of foot-and-mouth disease virus) results in binding of the virus to cell surface heparan sulfate, instead of integrin 3cLVf3 to which the wild-type virus binds’.
1.3 Discovery of Virus Receptors
Discovery of virus receptors involves two distinct steps. First, a cell surface molecule is identified as a candidate receptor and secondly, the candidate receptor is confirmed to be the virus receptor. Several different approaches have been utilized to identify a cell surface moiety as a candidate receptor and some of the more common ones are mentioned in section 1.3.1. By contrast, confinnation of the candidate as a receptor involves a more standardized experimental approach which will also be discussed further in section 1.3.2.
Before the mid-1980s the only virus receptor known was sialic acid for influenza viruses. Since the time, the development of recombinant DNA technologies and monoclonal antibodies (mAb) has revolutionized virus receptor discoveries’.
1.3.1 Identification of Candidate Receptors
Several strategies have been employed for identification of candidate receptors, and this section will emphasize a selection of strategies that have been used successfully by numerous investigators.
8 1.3.1.1 Cell Surface Enzyme Treatments
Enzymatic treatment of cells before virus infection may reveal the chemical nature of cell surface virus receptors. Different kinds of enzymes including proteases, glycosidases, and lipases (which digest proteins, carbohydrates, and lipids, respectively) can affect the ability of receptors to bind viruses and hence provide information about a receptor’s chemical characteristics. For example, if a receptor is GPI-anchored, then cell surface treatment with P1-
PLC should result in loss of the susceptibility of the cell to infection. Being the oldest technique used for discovery of animal viruse receptors, this method resulted in the discovery of sialic acid as a receptor for influenza .1virus Enzymatic digestion has been used for discovery of many other virus cell surface receptors, including those for lymphocytic choriomeningitis virus ,29(LCMV) BK virus (a 30polyomavirus) measles ,31virus and Newcastle disease .32virus
1.3.1.2 , Virus Overlay Protein Binding Assay (VOPBA)
VOPBA is a screening method in which the proteins of a cell or its membrane are separated by gel electrophoresis, blotted, and overlaid with virus to determine presence of any virus-protein 9binding’ By analogy to Western blotting, the virus serves as a “primary antibody”. This .method is successful only if the receptor activity is expressed by a single polypeptide which also maintains its binding activity in 9detergent’ The polypeptide can then be identified by other methods available, including sequential. chromatography and mass spectrometry 33(MS) VOPBA has been used for discovery of a number of virus cell surface receptors, including. those for 33LCMV Lassa fever ,33virus human 34adenovirus and human 35rhinovirus and has been established, as a useful tool in studying interactions, of virions with cellular .36proteins
9 1.3.1.3 Virus Overlay on Thin Layer Chromatography
This method is used for screening carbohydrates as potential virus receptors. Thin layer chromatography can separate glycolipids and then the virus is overlaid on the gel which has been stabilized by plastic. Monoclonal antibodies that can recognize glycolipids are then used to identify the receptors. Cell mutants unable to make different carbohydrates can be isolated and used for identification of different kinds of carbohydrates that have receptor activity.
Glycolipids added to these cells insert into the membrane and provided they can function as virus receptors, the exogenous receptors make the cells susceptible to viral 9infection’ Using this method, investigators determined that Sendai virus binds to .37gangliosides . 1.3.1.4 Expression Cloning
In this method plasmid DNAs prepared from pools of a susceptible cell cDNA library are transfected into resistant cells of another species. Transfected cells that have successfully taken up and expressed the receptor gene and protein products become permissive to the virus and can be identified after exposure to the virus. A pool containing a positive cDNA is subdivided to identify individual plasmid clones that produce the desired protein. Junction adhesion molecule A was discovered as a receptor for reovirus using this .38technique 1.3.1.5 Anti-receptor Antibodies
This method has been used for identification of several virus receptors, including CD46 for measles virus (Hallè strain). Naniche et ’3al. used over 3,000 hybridoma cell supernatants to obtain a mAb that inhibited measles virus binding and infection of human cells. They utilized the antibody to precipitate the cell surface receptor from susceptible cell lines, which was later
10 identified as 39CD46 Other examples for receptors discovered using this method include ICAM 1 for human °4rhinoviruses. and very late antigen (VLA)-2 for .41echovirus 1.3.1.6 linmunoprecipitation (IP) of the Receptor Using Viral Proteins
In this technique production of the receptor binding domain of the virus attachment protein is required. The receptor binding domain is then fused to another protein (e.g., Fe domain of human immunoglobulin-yl (IgG-1)) which can be immunoprecipitated. The complex can then be used to “pull down” the virus cell surface receptor from a labeled cell lysate (e.g., radiolabeled or biotinylated) containing the receptor. After electrophoresis, the acquired proteins are blotted on a membrane and according to their location their size is determined. From the same location on a stained gel the protein will be excised and MS with protein database searching used to identify the candidate receptor(s). This experimental approach was used for discovery of angiotensin converting enzyme (ACE)-2 as the receptor of severe acute respiratory syndrome associated coronavirus 42(SARS-CoV) and Ephrin B2 as the receptor for Nipah .43virus
1.3.1.7 A Clever Guess
Sometimes the candidate receptor is discovered by an astute guess. This was the case for discovery of decay accelerating factor (DAF, also known as CD55) as a receptor for 44echovirus The investigators immunized mice with HeLa cells and fused their splenocytes with. myeloma cells to produce hybridoma cells. Afterward, they screened hybridoma supernatants for their ability to protect susceptible cells from echovirus infection. The protective antibody found (1F7) could immunoprecipitate a 70-kDa protein from cell surface membrane preparation obtained
11 from HeLa cells. Using an indirect immunofluorescence method, the authors found that cell surface treatment of HeLa cells by P1-PLC resulted in dramatically lower expression of 1F7.
These findings indicated that the 1F7 antibody recognized a GPI-anchored protein. Knowing that
DAF was a GPI-anchored protein with molecular weight of approximately 70-kDa, the authors surmised that the candidate receptor was DAF and their subsequent experiments confirmed this suspicion.
1.3.2 Confirmation that the Candidate is the Receptor
This step of virus cell surface receptor discovery has a more standardized approach than the first step of identification of candidates. A candidate molecule is generally considered proven to be a receptor if: (a) an antibody against the candidate molecule blocks virus binding to susceptible cells; (b) expression of the candidate by previously resistant cells confers susceptibility of these altered cells to virus infection. Both of these approaches are considered essential to confirm the candidate is the receptor. Blocking by anti-candidate antibody alone is not sufficient because there is a possibility that the “real” receptor is located close to the candidate and the antibody blocks the infection without binding to the actual receptor. In addition, expression of the candidate by resistant cells is insufficient because this may confer susceptibility to virus infection only because it indirectly results in expression of the real receptor.’ In some situations
(e.g., lack of a known resistant cell line), other methods such as competition experiments (i.e., pre-incubation of virus with purified candidate receptor), virus-candidate receptor surface co localization, knock-down of candidate receptor gene and studying its effect on virus binding/infection have been used for confirming if a candidate has characteristics of a receptor.
12 1.3.3 Summary
Virus receptors are located on the cell surface and participate in virus attachment and thereby contribute to viral infection. Tropism and host range of a virus is determined by both susceptibility (i.e., possession of virus receptors) and permissiveness for replication within the infected cell. Virus receptors have been described for different families of proteins, carbohydrates, or lipids and in general virus receptors have other known functions in the cell.
Virus receptor molecules are either very abundant or exclusively found on permissive cells. In contrast to virus receptors, attachment factors only facilitate virus concentration on the surface are not responsible for leading the attached viruses into entry pathways.
To discover virus receptors one should go through two steps. The first step involves identification of a candidate receptor and the second step confirms that the candidate fulfills criteria of a functional receptor. Several strategies have been employed for identification of candidate receptors, among which are cell surface enzyme treatments, VOPBA, virus overlay on thin layer chromatography, expression cloning, anti-receptor antibodies, IP of the receptor using viral proteins, or simply a clever guess. In the confirmation step, the candidate is proved to be the actual receptor. This step typically involves a combination of anti-receptor antibody blocking studies and conferring susceptibility to infection of resistant cells after transfection of the candidate receptor gene into these cells. In some situations, alternative methods such as competition experiments (i.e., pre-incubation of virus with purified candidate receptor) are used for determining whether a candidate has characteristics of a functional receptor.
13 1.4 Antivirals
As obligate intracellular parasites, viruses exploit host machinery to replicate. This makes the development of drugs that selectively target viral functions difficult. Moreover, the clinical symptoms of viral diseases often appear after the virus has replicated and spread, which makes antiviral therapy relatively unsuccessful and requires chemoprophylaxis or early initiation of therapy. Available antivirals include vaccines, interferons, chemical compound based drugs, and biochemical agents.
1.4.1 Vaccines
In 1796, Edward Jenner made a milestone in human’s battle against viral diseases by inoculating humans with the cowpox virus to protect them against smallpox. The word “vaccination” (from the Latin vacca, which means cow) was coined by Jenner and later adopted by Pasteur for immunization against any 45disease Since that time, prevention against viral infections has been dominated by vaccination,. which protects against viral infection by boosting the host’s immune system. However, for some viruses vaccines cannot be made (e.g., human rhinovirus because of its multiple (>100) 46serotypes) or development of the vaccines have not been successful (e.g., 47H1V ).48RSV In these situations other approaches may be needed for controlling viral infections.,
1.4.2 Interferons
Interferons are cytokines that do not have direct antiviral activity but rather induce an antiviral response in uninfected cells. Binding of interferons to their receptors results in transcription of interferon-inducible genes and this is followed by synthesis of a number of proteins thought to
14 be involved in the production of an antiviral .49state Interferons are not specific for a given virus and their administration to patients can be accompanied by side 49effects Clinically, interferons have been used for control of HBV and HCV liver infections but. relapse after termination of administration is frequent°. Topical interferons have been used for suppression of condyloma 49acuminata and herpes °5keratitis infections. 1.4.3 Chemical compound based drugs
The first drug used for antiviral chemotherapy, idoxuridine, was discovered in 1959 as an effective treatment for herpes 51keratitis To date, there are more than 40 licensed drugs for treatment of viral diseases, at least. half of which are for treatment of HIV 52infections Antiviral agents can potentially target any aspect of the viral life cycle, including: attachment. of the virus to the host cell; entry of the virus through the cell membrane; uncoating of viral genome; synthesis of viral nucleic acid; synthesis regulatory or structural proteins; assembly of viral particles; or release of the virus from the cell. Examples are docosanol (blocks herpes simplex virus (HSV) entry); amantadine and rimantadine (block influenza virus A uncoating); acyclovir, foscamet, entecavir, reverse transcriptase inhibitors (block HSV, cytomegalovirus (CMV), HBV,
11W nucleic acid synthesis, respectively) protease inhibitors (block HIV protein synthesis), zanamivir and oseltamivir (block influenza virus .50release)
1.4.4 Biochemical Agents
Biochemical agents are proteins or oligonucleotides utilized to interrupt the viral life cycle at the molecular level An intriguing approach is blocking virus attachment or entry by administration of soluble virus receptors or mAb that bind to the receptors in competition with virus. For example, ICAM-1 is the cell surface receptor for approximately 90% of human
15 rhinovirus serotypes. Tremacamra is a form of soluble ICAM-l (sICAM-l) and has been evaluated in experimental infection trials. Tremacamra, given 7 hours before or 12 hours after infection, six times daily, has been shown to reduce the severity of experimental colds. While these results were encouraging, the challenge remains to show effectiveness of Tremacamra when administered later than 12 h after infection (as would typically occur in the “real world” setting), that no untoward immune response to sICAM-l develops, and that compliance or tolerability associated with frequent daily administration can be .54overcome Effective viral inhibition by receptor-blocking using mAb is possible in vitro but to date no drug in this category is on the market. Administration of anti-ICAM- 1 mAb in human cases reduced rhinovirus infection symptoms but did not affect the incidence of infection. In order to improve the efficacy of the mAb, an anti-ICAM--1tetravalent recombinant antibody, CFY196, has been synthesized which, compared to its bivalent counterpart, has improved the functional affinity by two orders of magnitude. In preclinical studies, CFY 196 has shown positive effects but further studies are needed to entirely assess its potential as an antiviral agent for the human rhinovirus .55infections Likewise, intervention of the interaction between the HTVenvelope (gp 120) and host CD4 (a well-conserved site for HIV binding) has become an attractive antiviral 56approach A soluble form of CD4 (sCD4) containing the four extracellular domains inhibited infection. by T-cell line adapted HIV- 1 57strains but primary isolates of HIV- 1 showed more resistance to sCD4 58inhibition probably because of sCD4-induced conformational fixation in gp 1205960which ,resulted in poor sCD4 61binding In order to compete with clustered cell surface CD4 molecules for gpl2O, a multimeric. CD4 construct, D1D2-Igutp has been 62synthesized D1D2-Igcttp comprises the two extracellular N-terminal domains of human CD4, Dl and D2, fused to the C . 16 terminus of 1IgG heavy chain, fused in turn to the 18-amino acid human IgA ct secretory 62tailpiece The ct-secretory tailpiece attached to C-terminus of IgGi heavy chain promotes immunoglobulin. 62multimerization Effectiveness of this molecule against diverse HIV-1 strains has been observed in .62vitro As a result of discovery of CD4 as an HIV receptor, it is anticipated that more. novel approaches will come from understanding the crystal structure of gpl2OICD4 63complexes For instance, the surface of gpl2O consists of a pocket that provides room for the. phenyl 43 ring of CD4 to bind and antivirals that block this pocket may interfere with the gpl2O and CD4 interaction hence block the .63infection In the biochemical category of antiviral agents, there are entry blockers approved by the United
States Food and Drug Administration (FDA) such as Palivizumab (a mAb against the RSV F protein) 64 and Enfuvirtide (a synthetic 36-amino-acid peptide which binds HIV gp4l and prevents the conformational changes required for fusion of the viral envelope with the host cell .65membrane) Other biochemicals include antisense-oligonucleotides (AS-ONs), ribozymes, and recently, RNA interference (RNAi), which target 53mRNA AS-ONs, short synthetic oligonucleotides complementary to the specific viral mRNA. targets, block viral mRNA translation and trigger its degradation. Vitravene® is a drug on the market that was produced by the AS-ON technology. It is a potent and selective antiviral agent for CMV 66retinitis Ribozymes (Rz) are ONs that bind and cleave target RNAs. Results of many studies have. shown that ribozymes are potential viral inhibitors but in vivo studies have reported difficulties in efficient intercellular delivery of these biochemicals, as well as achievement of sufficient 53potency Heptazyme is a ribozyme against HCV and was tested in a Phase II clinical trial, but. due to lacking sufficient efficacy was later withdrawn. Thus far, no other antiviral ribozyme has been tested in advanced clinical 53trials . 17 In RNAi technology, double-stranded RNAs inhibit expression of specific genes. Compared to antisense method, RNAi technology has much greater 53potency So far, use of RNAi has effectively inhibited the replication of several viruses including:. ’67RSV 68, influenza ’69virus 70, “ 7poliovirus , 7273HIV-1 and coxsackie virus B3 (CVB3) in vitro and in animal models. Moreover,’ RNAi,’ technology has been employed in targeting essential host factors such as CD4 required for HIV- 1 attachment and the chemokine receptor CCR5, a co-receptor for HIV-1 cell
75entry Despite these promising results, intracellular delivery of RNAi and viral escape of
RNAi. suppression (e.g., by single mismatches within the targeted region or entire deletion the of region) still remains a formidable challenge to this .76technology 1.4.5 Summary
Antivirals include vaccines, interferons, chemical compound based drugs, and biochemical agents. Development of vaccines for some viruses (including RSV) has not been successful and thus other approaches are required to control viral infections. Interferons are not specific for a given virus and their administration is associated with side effects. Moreover, relapse of infection after termination of interferon administration is frequent. Most of the chemical compound based drugs and biochemical agents target viral components and viral replication inside the cell. A few of these drugs, such as soluble ICAM-l (against human rhinovirus and which still needs more preclinical and clinical studies), and FDA-approved entry blockers such as Palivizumab (anti-RSV F mAb) and Enfuvirtide (a synthetic peptide which binds HIV gp4l and prevents entry) target attachment and entry of the viruses. Knowledge about virus receptors, combined with relatively recently described methods such as RNAi, may give rise to the
18 development of new antivirals which keep the cells safe from virus from the earliest stages of infection.
1.5 RSV Overview
1.5.1 Historical Background
RSV was first isolated in 1956 from a chimpanzee suffering from cold symptoms and the discovered virus was called the “Chimpanzee coryza 77agent” The following year, the same virus was isolated from infants with respiratory 78disease. and was renamed “respiratory syncytial virus” to signify its clinical and laboratory characteristics. Today RSV is considered the most important cause of bronchiolitis and lower respiratory tract infection in young children, and is responsible for 50% to 90% of all hospitalizations from 79bronchiolitis Almost all children are infected with RSV during the first two years of life; 2.5% are hospitalized, and
0.1% die from the infection To date, there is neither a good treatment. nor a safe, effective 80 vaccine for .79RSV .An improved understanding of RSV disease pathogenesis may lead to the development of novel antiviral treatments.
1.5.2 Classification
RSV is categorized in the genus Pneumovirus within the family Paramyxoviridae. Viruses in this family have a single-stranded, negative-polarity RNA genome located in a helical nucleocapsid that is RNAse-resistant and also contains the viral polymerase. The genome is transcribed in a stop-restart mode, in which the polymerase produces subgenomic messenger
RNAs (mRNA5). The viral replicative cycle takes place in the cytoplasm of the host. The virus is enveloped by the plasma membrane of the infected host cell and enters the cell by fusion to
19 the surface. The number and arrangement of genes and the lack of hemagglutinin and neuraminidase activity are distinctive features of RSV in its .81family
RSV has two major antigenic subgroups (A and B) which are classified according to their surface G protein 81variations Some studies of hospitalized infants have reported that subgroup A infections usually. dominate and result in more severe clinical disease than subgroup B 8283infections while a more recent study did not find any association between RSV subgroup ’and severity of the 84disease Even within one antigenic subgroup, different RSV strains can ,stimulate different immune responses For example, Schiender et at. 86 have shown that . 85 subgroup A, RSV Long strain. is a potent inducer of interferon in plasmacytoid dendritic cells, while RSV A2 87strain inhibits interferon production.
1.5.3 Structure
The RSV virion measures about 150-300 nm in diameter and consists of a nucleocapsid within a lipid 81envelope The viral genome is made of about 15,000 nucleotides that encode for 11 88proteins. The nucleocapsid is associated with the N, P, L, and M2-l 88proteins RSV L protein .is the viral RNA polymerase and the other nucleocapsid proteins. are also involved in transcriptional activity 88 The M2-2 protein, which is expressed at low levels at early stages of infection in cells but increases during infection, is involved in regulation of 81transcription however, the M2-2 protein is not essential for growth and replication of the; virus. The M (matrix) protein organizes assembly of envelope proteins and nucleocapsid proteins and is vital for viral 81viability RSV also has nonstructural proteins (NS1 and N52), which enhance virus growth but. are not essential for 81viability Nonstructural proteins may be antagonists for 381 88 interferon-ct and The envelope. has three transmembrane surface glycoproteins: F, G, and 20 SH. The F and G proteins appear to be important in the pathogenesis of RSV infections. The diameter of these surface glycoproteins is 11-20 nm and they are spaced at intervals of 6-10 nm in the 81envelope As indicated above, the two major antigenic groups of RSV (A and B) are mainly.classified according to their 0 protein variations, while the F protein is highly conserved between the strains (89% amino acid identity) 89 Because of their importance in virus attachment and entry, the RSV envelope proteins are described in more detail below.
1.5.3.1 SH Protein
The function of SH (small hydrophobic) protein is not 88known The SH protein is not necessary for cell viability, syncytium formation, and cell 90entry . On the contrary, SH protein shows some negative effect on virus fusion in A recent. study indicates that SH protein can inhibit .90vitro TNF-a .91signaling 1.5.3.2 G Protein
The RSV G protein was originally identified as the viral attachment protein because antibodies specific to the protein blocked the attachment of purified RSV Long strain virions to HeLa .92cells The RSV G protein is smaller than the attachment proteins of other paramyxoviruses and does not have sequence homology or structural similarity to 9394them This glycoprotein is a type II transmembrane protein, consisting of a cytoplasmic.’ N-terminus, a hydrophobic transmembrane region and an extracellular C-terminus which due to its relatively high content of carbohydrates and serine, threonine, and proline residues has similarities to .81mucins
21 The unprocessed precursor of RSV G protein has a molecular weight of about 32 kDa; however, by extensive N-linked and mainly 0-linked glycosylation the molecular weight of the glycoprotein can reach up to 90 .94kDa The infectivity of RSV in vitro is reduced by 97% after the N- and 0-linked oligosaccharides are removed from the virus, suggestive of carbohydrate— protein interactions during viral attachment to host cells
Among RSV strains, the G protein has a high degree of antigenic and sequence diversity which occurs mainly in the ectodomain of the protein. However, between the subgroups there is a highly conserved 13 amino acid segment in the middle of the ectodomain (residues 164-176).
There is also a domain (residues 173-186) which contains four cysteine residues and hence called “cysteine noose region”. Because of their conserved nature, the cysteine region was originally considered important for virus attachment; however, subsequent work showed that deletion of this region had little effect on efficiency of virus replication in vitro or in 96vivo
Krusat and 97Streckert reported that preincubation of RSV with heparin’ inhibits infection of cultured cells and the G protein binds to heparin, suggesting that heparin or other cell surface glycosaminoglycans (GAGs) might be involved in RSV binding to cells. Feldman et al.98 mapped a heparin-binding domain outside the conserved segment of the G ectodomain (residues
184-198). Martinez and Melero reported that GAGs are essential elements for binding of human
RSV to some cell types. The interaction between RSV G protein and GAGs could be at the attachment step but it also could be an initial step which facilitates the second step of virus-cell 81binding It has been shown that viruses lacking G or SH (or both) genes can replicate efficiently. in cultured cells indicating that similar to SH protein, the G protein is not necessary
‘Heparin is a highly sulfated polysaccharide commonly used for anticoagulant therapy and is usually isolated from mast cells or mucosa. Heparin is used as a substitute for tissue-derived material such as heparan sulfate, a less sulfated polysaccharide at the cell surface and the extracellular 91matrix . 22 for infection, syncytium formation, and virion morphogenesis, at least in ’90vitro 99• However, the titre of virus in mutants lacking the G protein was at least 10-fold lower than titres of viruses containing G protein and it was shown that the G protein enhanced virion binding (but not virus penetration), cell-to-cell fusion, virion assembly and 90release This suggests that the only remaining RSV surface protein, the F protein, might also. act as an attachment protein, either in an alternative mechanism or in a second step of virus attachment A recent study shows that both G protein and F protein can bind to cell-surface GAGs, particularly heparan sulphate (HS), in 100vitro However, it is not clear if this binding also occurs in clinical isolates of RSV that are not. adapted to cell culture conditions’°’.
The RSV G protein has a CX3C chemokine motif similar to that of fractalkine at amino acid positions 182-186, which interacts with CX3C receptor 2(CX3CR)’° A recent study shows that the expression of the RSV G protein CX3C motif is associated. with reduced antiviral T cell response to RSV .03infection’ Figure 1 shows the abovementioned regions in RSV G protein.
23 __
CT TM
NH2I I COOH
I I I I 50 100 150 200 250 298
Figure 1. Map of RSV G protein
CT, cytoplasmic tail; TM, transmembrane domain; hatched area is representative of 13 amino acid conserved domain (residues 164-176); shaded area is representative of heparin binding domain (residues 184-198); the cystein noose region containes residues 173-186. The CX3C chemokine motif region is located at residues 182-186 of the cystein noose (not shown).
24 On the other hand, based on observations such as increased expression of annexin II after RSV infection and binding of recombinant annexin II to the RSV G protein, Malhotra et 4at.’° have proposed annexin II as a potential receptor for RSV. However, confirmatory studies such as blocking RSV binding and infection by anti-annexin II antibodies and/or increased binding and infection by annexin II overexpression in annexin II knocked-down cells have not been reported to date.
1.5.3.3 F Protein
The RSV F protein, a type I membrane protein, initiates both virus entry by fusing viral and host membranes, and viral spread by promoting fusing infected cells to adjacent uninfected cells, resulting in syncytia 81formation RSV F is initially synthesized as a precursor protein called FO (about 67 kDa) containing. a signal peptide sequence at the N-terminus which is removed by a 105 signal peptidase in the ER FOis cleaved at two 106sites by cellular furin protease in the trans Golgi ”°compartment’° resulting in removal of a short glycosylated sequence and generating disulfide-linked57 Fl (about 50 kDa molecular weight) and F2 (about 20 kDa molecular weight) subunits from the C- and N-termini, 05respectively’ “Fusion peptide”, a hydrophobic region at the N-terminus of the Fl subunit is believed to be involved in membrane 08insertion’ The transmembrane segment is located close. to the C-terminus followed by a short. cytoplasmic 81domain Adjacent to the fusion peptide and the transmembrane segment are two heptad repeat .sequences that make a stable trimer for which its conformational change results in entry of the 09virus’ Inhibition of this conformation by peptides that bind the heptad repeat sequence close to. the transmembrane segment may become an effective antiviral therapy 110 The aforementioned regions of RSV FOprotein are illustrated in Figure 2.
25 __
Furin cleavage site
SP FPHR HRTM CT NH2 iCOOH II 11 100 200 300 400 500 574
Figure 2 Map of RSV FOProtein
CT, cytoplasmic tail; TM, transrnembrane domain; SP, signal peptide; FP, fusion peptide; shaded areas are representative of heptad repeats (HR).
26 Similar to RSV G protein, the F protein has been shown to bind to heparin “ which is consistent with studies that have concluded that both G and F proteins can act as attachment 92proteins 99• According to a recent report, eight regions in F protein bind heparin and cellular GAGs,’ three of which facilitate infection at either an attachment or post-attachment 12step’ polarized, well differentiated human airway epithelial cells (WD HAE), RSV only infected the apical surface of these ciliated 3cells” This is in contrast with the ability of RSV to infect established, continuous cell lines. such as HEp-2 and A549 which are not ciliated. It is possible that infection of these established cell lines occurs by an alternative pathway that might not even be representative of what occurs in vivo. For instance, it has been proposed that the requirement for GAGs for efficient RSV infection of established lines might not be applicable to WD HAE 3cultures”
RhoA, a member of the Ras superfamily, also binds RSV F protein and facilitates virus-induced syncytium formation in HEp-2 4cells” A peptide containing part of the RhoA domain which interacts with RSV F inhibited RSV replication in vitro and in 115vivo RhoA may be a receptor for RSV F protein but since it is not . exposed extracellularly, it is unclear how it can act as a 81receptor On the other hand, RhoA may be involved in other subsequent steps of virus 81entry RSV. up-regulates surface expression of RhoA and stimulates RhoA-mediated signaling 16 RhoA is involved in many cell functions including cytoskeletal dynamics, cell adhesion, contractile responses, proliferation and gene transcription. Hence, it may control a number of important cellular responses to RSV .81infection RSV F protein also binds two important members of pattern recognition receptors, TLR4 and CD 14, but such binding has been shown to mediate immune responses to the 7j5l and not its internalization.
27 1.5.4 Replication
RSV can survive on inanimate objects for hours and transmission can occur through self- inoculation of secretions from 8hands” In addition, large-particle aerosols are able to transmit the virus to the nasal mucosa or.conjunctivae 118
Cell surface attachment is the first step in the viral infection process, which may occur via binding of the G protein to unknown receptor(s). Once attached, the fusion of viral envelope to the host cell membrane occurs and then the nucleocapsid is released into the cytoplasm. In the cytoplasm, mRNA transcription and genomic RNA replication take place. Viral proteins and genome are then assembled and the mature virions either leave the cell by budding or produce
RSV cell-to-cell fusion and syncytia formation. 88
28 Virion
—‘..Viral Glycoproteins Envelope RNP complex
Unknown receptor
F
mRNA Nucleus Viral RNA - I I P M + — M2-1 — M2-2
Figure 3. RSV life cycle.
After attachment to host cell receptors, RSV envelope is fused to the host cell surface membrane and RNP (ribonucleoprotein) complex is transported into the cell were mRNA transcription, protein synthesis and viral RNA replications take place. The viral components then accumulate and at the cell surface assemble into virions. At the final step, virus maturation occurs which results in release of virions from cell surface. Cuurently, the cellular location of M2-2 protein is not known. Aithogh the figure shows viral RNA transcription and replication in the cytoplasm, some evidence suggests these steps might take place in the inclusion ’10bodies.
29 1.5.5 Attachment and Entry
Despite decades of research, the details of attachment and entry of RSV into cells are not well characterized. Obstacles such as poor RSV growth in ,81vitro cell association of progeny 119virus (i.e., most of the progeny viruses stay attached to the host cell membrane and do not get released into culture media, which results in low virus yield and hence low titre), and its susceptibility to loss of potency after freeze and thawing’ 19, could be some reasons for slow progress in this area.
Moreover, RSV has a ubiquitous host range and to my knowledge no cell type resistant to RSV infection in vitro has been reported in the literature. However, there are many observations that reveal some early RSV-host interactions at the molecular level and these can lead us to a better understanding of RSV attachment and entry. In this section I mention some of the studies that have provided clues to this important issue in RSV pathogenesis.
The observation that RSV virions lacking G protein, which was originally considered as the viral attachment 20protein’ are infectious and can replicate to high titre in Vero 99cells along with the fact that, a large number of cell types are susceptible to RSV infection, points to the possibility of RSV cell surface attachment being a complex procedure involving several viral and/or cellular 21components’ Epithelial cells lining the airways are a major target for 22RSV’ The plasma membrane of airway epithelial cells is divided into two separate domains, apical. and basolateral, with. distinct membrane components’ These two domains are kept separated by 22 tight junctions, which are also involved in the formation of a monolayer of tightly adherent
22cells’ A number of cell lines or primary. cells including MDCK, Vero C 1008, WD HAE keep .the properties of polarized epithelial tissues in culture and have been used in studies of RSV entry and/or 3release” 122 It has been shown that both entry and release of RSV occurs through the apical aspect’ of polarized 122 ’3cells” 30 1.5.5.1 Surfactant Proteins
Respiratory epithelial cells produce surfactant proteins (SP), which are involved in innate immune 23responses’ In the lung SP-A and SP-D are major protein components of the collectin family and can bind bacterial, fungal and viral 24pathogens’ Studies have shown SP-A binds . 126 both the RSV G and F 25proteins’ By contrast,. there are conflicting reports concerning interaction of SP-D with’RSV: one paper reported that SP-D binds the RSV G protein while another study concluded that SP-D binds neither G nor F protein 125 Hickling et 27al.’ have shown that SP inhibit RSV infection in vitro and in vivo. Surfactant bound to RSV proteins enhanced the binding and uptake of virus by HEp-2C 26cells’ , human peripheral blood monocytes and U937 .28macrophages’ 1.5.5.2 GAGS
As mentioned above, RSV can bind GAGs and it is not known whether this attachment is also seen in viruses that are not adapted to tissue culture cells. Hence, there is a possibility that interactions with GAGs facilitate virus entry, but these do not exclude other pathways from being 2involved”
1.5.5.3 ICAM-1
ICAM-1 has been postulated as a potential cell surface receptor for 29RSV’ ICAM-l and RSV co-localize on surface of HEp-2 cells. Pretreatment of HEp-2, A549,. and normal human bronchial epithelial cell lines with an anti-ICAM-1 mAb significantly blocks RSV infection.
Decreased infection is also observed by incubation of the virus with soluble ICAM- 1. Binding of RSV to ICAM- 1 can be inhibited by an anti-RSV F protein antibody. Moreover, recombinant
31 F protein can bind to soluble ICAM- 1, suggestive of involvement of F protein in RSV and
ICAM- 1 interaction. Therefore ICAM- 1 may facilitate RSV entry and infection of human epithelial cells by binding to its F 129protein All these results suggest that ICAM- 1 has features of an RSV receptor, but more. confinnatory experiments, such as effect of ICAM-1 overexpression on RSV infection in cells expressing little ICAM-1 as well as RSV binding studies, are required to prove the molecule being a genuine receptor.
1.5.5.4 Lipid Rafts
Lipid rafts are cholesterol- and glycosphingolipid-enriched membrane microdomains and their involvement in virus entry, assembly, and budding has been shown by the localization of viral structural proteins and the effects of agents that disrupt lipid rafts in life cycle of several 130viruses The role of lipid rafts in the viral life cycle is still 30unknown’ The involvement of lipid. rafts during cell entry has been observed for many viruses. including 3132333435RSV’ Confocal microscopy showed that Caveolin- 1 and RSV F protein colocalize” on the surface of cattle dendritic cells. Moreover, caveolae inhibitors such as fihipinand phorbol. myristate acetate block RSV uptake, suggesting that RSV may enter cells by a caveolae-dependent process and/or the virus cell surface receptor is associated with lipid 35rafts’ However, since the presence of caveolin- 1 has been detected within the envelope of mature. virions, the route of RSV of cell entry is still in 36doubt’ More investigation is required to show whether an RSV receptor is concentrated in .35caveolae’.
32 1.5.5.5 Actin
Actin, an element of the cytoskeleton, has been detected in purified RSV virions and cellular actin interacts with viral components which in turn results in increased actin 37polymerization’ Alteration in actin function inhibits RSV entry, cell-associated virus formation, virus release and syncytium 38formation’ As mentioned in section 1.5.3.3, the RSV F protein binds. RhoA, which is involved in actin mobilization and facilitates virus-induced syncytium formation in Hep-2
116 . cells
1.5.6 RSV Prevention and Management
This section outlines some of the approaches used for the prevention and therapy of RSV infections. However, considering their limitations and drawbacks, infection control by good hand hygiene and avoidance of close contact with infected persons or their secretions is essential and cost .39effective’ 1.5.6.1 Immunization
A formalin-inactivated vaccine was developed for RSV in the 1960s and despite production of high levels of serum antibody in vaccinated individuals, it caused an unfortunate event of augmented disease (including several deaths) in the recipients during subsequent natural RSV infection”°. To date, despite decades of research, there is no currently approved vaccine for the prevention of human RSV 41disease’ Lack of an animal model that develops all aspects of human RSV disease, the need. for immunization of immunologically immature infants, and the difficulty for finding an optimal balance between attenuation and immunogenicity in live
33 vaccines are some reasons that have resulted in delayed development of an effective and safe .41vaccine’
1.5.6.2 linmunoprophylaxis
Passive prophylaxis is principally used for target groups who are at risk for severe RSV disease.
High-risk infants and children (i.e., those with chronic lung disease (CLD) and prematurely born infants without CLD) can be passively immunized by intravenous immunoglobulin containing high levels of RSV neutralizing antibody (RSV-IVIG) or intramuscular mAb 42(palivizumab)’ While the benefits of immunoprophylaxis are evident, the approach is expensive and of limited utility for the general 43population’ Even in some “high risk” infants, such as. those who have cyanotic congenital heart. disease, use of palivizumab has not been approved by the 44FDA’ By contrast, based on randomized controlled trials, Health Canada recommends palivizumab. for children under 24 month of age with hemodynamically significant heart 45disease’ such that the indications for using palivizumab are inconsistent and controversial. ,
1.5.6.3 Management Management for RSV infection is basically 46supportive’ In severe cases, infected children are hospitalized and managed by administration. of ribavirin, bronchodilating agents, and corticosteroids, and results of studies indicate limited, if any, clinical advantage for these 47agents’ Ribavirin also needs a prolonged aerosol administration and its cost is 48considerable’ Moreover,. ribavirin is a teratogen and potentially threatens the safety of hospital staff and .43caregivers’ .
34 Disadvantages of current means for RSV control demands for alternative ways to solve this worldwide problem. According to a review by Sidwell and 49Barnard’ researchers have tried attachment and fusion inhibitors, oligonucleotides targeting ,viral RNA, N-protein inhibitors, RNA-dependent RNA polymerase inhibitors and inosine monophosphate dehydrogenase inhibitors (other than ribavirin) in the management of RSV infections. Many of these compounds have been promising in vitro and in animal models, but most of them have failed in subsequent human preclinical or clinical trials. At present, only the siRNA (against P-protein) strategy, and A-60444 (an N-protein inhibitor) are still in phase I and II clinical trials, ’49respectively’ 150 On the other hand, a recent study by Welliver et ’al.15 shows that severe infantile RSV infection is associated with excessive RSV antigen in the lungs due to vigorous virus replication, which is associated with massive apoptotic sloughing of respiratory cells and virtual absence of adaptive immune responses. These findings, together with the fact that corticosteroids do not significantly affect the natural history of RSV 152disease provide a rationale for the application of antivirals targeting virus replication (including, virus attachment) in infants.
1.5.7 Summary
Although RSV was discovered more than 50 years ago, its receptor has not yet been identified.
In addition, recent studies show that the viral G protein (which was originally considered as the attachment protein) might not be an essential protein for virus-receptor binding since the virus can enter cells with F protein as its only surface glycoprotein. Some reasons for the delay in discovery of an RSV receptor may be related to its poor growth in vitro, its instability which
35 results in decrease in its titre over time, and cell association of progeny viruses which also leads to low titres.
Management of RSV is essentially supportive. The limited number of approved prophylaxes and treatments available indicate that there is an urgent need for an effective protective agent against this important pathogen.
36 2 SCOPE OF THE THESIS
Despite many years of research, the identity of the RSV receptor remains unknown. This thesis used an approach of avoiding, as much as possible, preconceived notions as to the nature of any moiety on the cell surface that would have characteristics of being an RSV receptor. Therefore, the goal of this thesis was to interrogate the fundamental components of cell membranes in an unbiased manner toward identification of candidate molecule(s) involved in RSV attachment to the cell surface. Once the general biochemical characteristics (e.g., protein-, carbohydrate- and/or lipid-containing) of RSV binding molecules were established, the availability of diverse types of “omics” 153 (e.g., proteomics) provided the opportunity to perform an initial screening of cell membranes from permissive cells originating from a wide of variety of species, and identifying common “hits” from broad-based screening. After common “hits” were identified to lead to candidate receptor(s), validation experiments consisted of techniques based on blocking of the candidate with antibody directed against the candidate prior to RSV exposure, and competition experiments, involving preincubation of RSV with the purified candidate receptor molecule, would be predicted to decrease subsequent viral binding to permissive cells.
2.1 Hypothesis
The working hypothesis of this thesis is:
RSV infects cells via attachment to cell surface receptor(s) which can be identified by unbiased interrogation of cell membrane constituents and functionally characterized by blocking and competition experiments.
37 2.2 Specific Aims
1. Chemical characterization of RSV receptor(s) by cell surface enzyme treatments;
2. Identifying candidate receptor(s);
3. Confirming that any identified candidate has characteristics of a receptor.
2.3 General Research Plan
The general research plan involved: literature review for methods used in the discovery of virus cell surface receptors; use of enzyme digestion strategies of cell membrane constituents of permissive cells types from multiple species to document chemical characteristics of an RSV receptor; applying and/or modifying methods of identification of a candidate receptor for RSV in cell types from multiple species, and confirming that the candidate receptor has characteristics of a functional receptor by use of antibody blocking approaches (i.e., pre incubation of antibody against the candidate receptor with cells, followed by RSV exposure) and competition experiments (i.e., incubation of RSV with purified candidate molecule prior to exposure to permissive cells).
38 3 METHODS
3.1 Cells
The species of origin and description of all mammalian cells utilized in this thesis are shown in Table 1. All cells were kept at 37°C in a humidified incubator containing 5% .2CO The cell culture media for growth and maintenance of the cells contained 10% (v/v) heat-inactivated fetal bovine serum (FBS). The HEp-2 (American Type Culture Collection (ATCC), Rockville, MD),
HeLa (ATCC), MDCK (ATCC), 1HAE (gift from Dr. D. Gruenert, University of Burlington,
Vermont), and 293FT (Invitrogen Corp. Carlsbad, CA) cell lines were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 1% L-glutamine
(Invitrogen). The CHO-Ki (ATCC), pgsA-745 (ATCC) and A549 (ATCC) cell lines were grown in Nutrient Mixture F-l2 Ham (Sigma, St. Louis, MO) containing 1% L-glutamine.
3.2 Trypan Blue Exclusion Test of Cell Viability
An aliquot (100 1iL) of cell suspension being tested for viability was mixed with equal volume of trypan blue (0.4%) (Invitrogen) and 10iL of the mixture was applied to a hemocytometer.
The hemocytometer was placed on the stage of a microscope to examine the cells. The unstained (viable) and stained (nonviable) cells were separately counted in the hemocytometer.
The total number of viable cells per mL of cell suspension was determined by multiplying the total number of viable cells counted by 2 (the dilution factor for trypan blue). The total number of cells per mL of cell suspension was calculated by adding up the total number of viable and
39 Table 1- The Species of Origin and Description of Mammalian Cells Used in this Thesis
Cell line Oriiin of species Description
HeLa Homo sapiens (human) Carcinoma of the uterine cervix*
HEp-2 Homo sapiens (human) Originally thought to be derived from an epiderinoid carcinoma of the larynx, but subsequently it was determined that cells were established via HeLa cell contamination*
A549 Homo sapiens (human) Bronchioloalveolar-like cell lung carcinoma*
1HAE Homo sapiens (human) SV4O-transformed normal human airway epithelial cells and have been characterized previously t
MDCK Canis familiaris (dog) Normal kidney*
CHO-Ki Cricetulus griseus (hamster, Chinese) Ovary*
pgsA-745 Cricetulus griseus (hamster, Chinese) Derived from CHO-Ki cells and are xylosyltransferase I deficient hence do not produce glycosaminoglycans*
293FT Homo sapiens (human) Transformed embryonal kidney cells
* http:Ilwww.atcc.org/commonlcatalog/cellBiology/cellBiologylndex .cfm t Gruenert DC, Finkbeiner WE, Widdicombe JH. Culture and transformation of human airway epithelial cells. Am J Physiol. 1995 Mar;268(3 Pt l):L347-60.
=9493
40 nonviable cells and multiplying by 2. The percentage of viable cells was determined as follows:
= total number of viable cells per mL of aliquot viable cells(%) < total number of cells per mL of aliquot
3.3 Preparation of RSV Stocks
The A2 and Long strain of subgroup A human RSV were purchased from ATCC and 55 54rgRSV224’ (expresses the green fluorescent protein, eGFP) and rrRSV-BN (expresses the red fluorescent protein, RFP) were gifts from Drs. M.E. Peeples (Ohio State University,
Columbus, OH) and P.L. Collins (National Institutes of Health, Bethesda, MD), respectively.
RSV was propagated on 70-80% confluent HEp-2 cell monolayers and kept at 37°C in a humidified incubator containing 5% 2CO for 90 mm with occasional rocking (every 10-15 mm).
Cell culture medium consisted of DMEM supplemented with 2% FBS and 1% L-glutamine. The unbound viruses were removed and the infected cells were kept for 36-48 h. Crude stocks of
RSV were prepared by addition of autoclaved 3 mm diameter glass beads (Fisher Scientific,
Nepean, ON, Canada) to infected HEp-2 cell monolayers and vortex agitation for about 30 s to release cell-associated virus. To sediment cellular debris the cell suspension underwent centrifugation at 1,500 x g for 15 mm at room temperature and aliquots of the supernatant containing free virus were prepared and kept in -80°C as crude virus stocks. Concentrated stocks of RSV were prepared by adding 15 mL of the crude stock onto Amicon® Ultra Centrifugal
Filter Devices (Millipore Corp, Bedford, MA) with molecular cutoff at 100,000 Daltons to both concentrate the virus and eliminate soluble macromolecules such as inflammatory mediators being produced during viral infection of HEp-2 cells 156 The crude stock underwent centrifugation at 25°C for 45-60 mm until about 300 1iL of concentrate was obtained.
41 3.4 RSV Plaque Assay
Virus titre was determined by incubation of serial dilutions (10’ to 108) of RSV stocks on 70-
80% confluent HEp-2 cell monolayers seeded in 12-well plates. The titre was determined for each dilution in duplicate. After 90 mm incubation at 37°C, 5% .2CO with occasional rocking, the supematant was removed. The monolayer was washed with serum free media and then overlaid with 1 mL of medium—methylcellulose (Sigma) mixture (1:1, 2X DMEM with 2%
FBS:1% methyl cellulose) to avoid detachment of the infected cells from cell culture surfaces, and incubated for 5 d. The media-methyl cellulose was removed, cells were fixed with 10% formalin (Sigma) at room temperature for 10 mm, and then methanol (Sigma) was added and removed after 1 mm. After being air-dried, the cells were stained with 0.1% neutral red (Life
Technologies, Burlington, ON, Canada) for 5 mm then washed with tap water. Syncytia were counted under an inverted light microscope and the viral titre was calculated as plaque forming units (PFU) per mL.
3.5 CVB3 Infection
As a control virus (i.e., a virus with known receptors) for some of the methods used for identification of candidate RSV receptor(s), HeLa cells were infected at a multiplicity of infection (MOI)=10 with CVB3 (Nancy strain), a gift from Dr. R. Kandolf (University Hospital of TUbingen, Tubingen, Germany) for 1 h. Cells were washed with serum free media (DMEM containing 1% L-glutamine) to remove unbound viruses and replaced with fresh media containing 10% FBS and kept at 37°C. For preparation of crude CVB3 stocks the media was collected 24-48 h post infection, when most of the cells were detached from the flask, and underwent centrifugation for 15 mm at 1,500 x g for sedimentation of cell debris. The clear supernatant containing free virus was kept in aliquots at -80°C. Concentrated stocks of CVB3
42 were prepared by adding 15 mL of the crude stock onto Amicon® Ultra Centrifugal Filter
Devices (Millipore) with molecular weight cutoff of 100,000 Daltons to concentrate the virus.
The crude stock underwent centrifugation at 4,000 x g at 25°C for 45-60 mm until about 300 iL of concentrate was obtained.
3.6 CVB3 Plaque Assay
The virus titre in the cell supematant was determined by an agar (Sigma) overlay plaque assay, done in duplicate, as follows. The virus stock was 10-fold serially diluted (10’ to 108) and overlaid on a 70-80% confluent HeLa cells. One hour after incubation, the cells were washed with phosphate buffered saline (PBS) to remove unbound viruses and overlaid with 2 mL of media containing 10% FBS and 0.75% agar in each well of a 6-well plate to avoid detachment of the infected cells from cell culture surfaces. The cells were incubated at 37°C for 72 h, fixed with 75% ethanol-25% acetic acid and stained with 1% crystal violet (Sigma). Plaques were counted, and the viral titre was calculated as number of PFU per mL.
3.7 Cell Surface Enzyme Treatment
To determine the nature and chemical characteristics of the cell surface component(s) to which a virus binds, cultured cells were pretreated with different enzymes as listed below. The viability of cells after enzyme treatment was determined by trypan blue (Invitrogen) exclusion test of cell viability as explained above. Enzyme treatments mentioned in this section were done on intact live cells (as opposed to the treatments in section 3.23, in which membrane proteins were treated with enzymes).
43 3.7.1 Trypsin
To determine if the cell surface component(s) to which RSV binds is a protein (or has a protein component) HEp-2, A549, MDCK, CHO-Ki, and pgsA-745 cell lines in monolayers were washed by PBS and incubated in 2Mgtfree17Ca PBS for 30 mm at 37°C to allow cell detachment. The cells underwent up and down pipetting to make a single cell solution and after that underwent centrifugation at 500 x g for 5 mm. After removing the supernatant, the pellet containing cells was adjusted to a concentration of 106cells/mL by addition of PBS. Aliquots of
1 mL of the cells were added to 1.5 mL centrifuge tubes and underwent centhfugation at 500 x g for 5 mm. The supematant was then removed and 300 iL of 1% Trypsin (Sigma) in Hank’s buffered salt solution (HBSS, Tiwitrogen)(for non-enzymatic negative controls, only HBSS was added). After being kept at 37°C for 5 mm, the cells were washed with ice cold PBS containing
2% FBS to inactivate the enzyme and the cells underwent centrifugation at 500 x g for 5 mm at
4°C subsequently. RSV (Long strain) or rgRSV224 (MOI=1) was added to the cells and the cells were kept at 4°C (to allow virus binding and not internalization) for another 30 mm.
Unbound viruses were washed away by another round of centrifugation using media containing
2% FBS. The cells were seeded in culture plates and kept at 37°C for 24 h.
Protein samples from these cells were prepared for gel electrophoresis and Western blotting
(section 3.10) In a preliminary experiment (not shown) testing the suitability of polyclonal anti
RSV antibody for Western blot of virus-infected HEp-2 cells, results showed that the RSV G protein had the most intense signal, such that results of anti-RSV antibody Western blotting for subsequent experiments on multiple cell types were expressed as a percentage of the signal of
RSV G protein: 3-actin ratio for HEp-2 cells in the corresponding run. This will subsequently be referred to as the “normalized RSV G/13-actinratio”.
44 3.7.2 Glycosidases
As the commercially-available enzymes had not been previously evaluated on living cells, the surface of live HEp-2 cells were treated with glycosidases from Enzymatic Protein
Deglycosylation Kit (Sigma) to determine the effect of the enzymes on known surface glycoproteins (i.e., epidermal growth factor receptor (EGFR) and DAF (CD55)). According to the manufacturer’s recommendations, the concentrations of the enzymes used were:
• PNGase F (P2619): 5000U/mL
• x-2(3,6,8,9)-Neuraminidase (N8271): 5UImL
• 0-Glycosidase (G1163): 1.25U/rnL
For each well of a 6-well plate containing subconfluent HEp-2 cells (about 8 x cells), 0.5 mL serum free media containing 1 L of either PNGase F, A-2(3,6,8,9)-Neuraminidase, or a
2(3,6,8,9)-Neuraminidase plus 0-Glycosidase was added. Since each 1 .tL of the above- mentioned enzymes is sufficient to deglycosylate 100 ig 157glycoprotein and given that each 106mammalian cells contains 100-200 g soluble 158proteins the amount of enzyme added was considered appropriate to only treat the surface of,the cells., Moreover, the amount of enzymes used could completely deglycosylate control preparations of membrane proteins prepared from
3 x 10 HEp-2 cells. After incubation at 37°C for 1 h, cells were used for Western blot sample preparation to determine the effect of the enzymes on surface glycoproteins (i.e., EGFR and
DAF).
3.7.3 P1-PLC
The efficiency of the P1-PLC (Sigma) was tested after treating cells with the enzyme and detecting cell surface DAF by flow cytometry. PT-PLC (4U/mL) was added to the cells and
45 incubated at 37°C for 1 h. The cells were then washed with PBS containing 2% FBS. Samples were prepared for flow cytometry as mentioned below (section 3.26). For each 106cells 5 iL (1 fig) mouse mAb to DAF (NaM16-4D3, Santa Cruz Biotechnology, Santa Cruz, CA) was used as primary antibody and 100 L FITC-conjugated goat anti-mouse immunoglobulin (Sigma)
(1:100) was used as secondary antibody. The samples were fixed in 1% paraformaldehyde (Ted
Pefla, Redding, CA) for 10 mm and kept at 4°C.
The effect of PT-PLC on RSV infection was tested by adding 20 L P1-PLC (5U1100 tL) 250
1iL serum free media and then adding 125 L of the diluted enzyme (4U/mL) to 80-90% confluent HEp-2 cells in a 24-well plate. The cells were incubated with the enzyme for 1 h at
37°C and then washed with PBS containing 2% FBS. Cells were exposed to rgRSV224 (MOT=l) for 30 mm at 4°C with occasional rocking. The cells were incubated in 37°C to allow one round of replication and cell infection and eGFP expression. Samples were prepared for flow cytometry directly (no antibody used).
38 Protein Sample Preparation and Sodium Dodecyl Sulfate-Polyacralamide
Gel Electrophoresis (SDS-PAGE)
Protocols used for the preparation of “crude” cell membrane proteins (i.e., proteins obtained from various types of cell membrane including membrane of organelles and cell surface membranes) and “enriched” cell surface membrane proteins (i.e., proteins obtained from cell surface but still might have some impurities from other cell components) are mentioned separately in sections 3.11 and 3.12, respectively. For whole cell protein sample preparation, which contains soluble proteins and excludes nuclei and debris, the following published method was 59used’ Cells in monolayers were washed with PBS twice. Cells were placed on ice and . 46 MOSLB (50 mM pyrophosphate, 50 mM NaF, 50 mM NaC1, 5 mM EDTA, 5 mM EGTA, 100 iM 34NaVO 10 mM -2-ethanesulfonicN-2-hydroxyethylpiperazine-N acid [HEPES], pH 7.4, 0.1%, Triton X-100 containing Protease Inhibitor Cocktail (Sigma) (300 iL of lysis buffer for 106 cells) was added. TCells were kept on ice for 10 mm. After being transferred to 1.5 mL conical tubes, the cell lysate underwent centrifugation at 14,000 x g for 10 mm at 4°C. The supernatant was transferred into a new tube and stored at -20°C. Concentration of protein was determined by Bradford assay (Bio-Rad, Hercules, CA)). The standard size markers loaded included MBenchMark Prestained Protein Ladder, TMMagicMark Western Protein Standard, and SeeBlue® Pre-Stained Protein Standard and all were purchased from Invitrogen. The proteins were separated by SDS-PAGE under reducing and/or nonreducing conditions.
3.8.1 Gel Electrophoresis of Native Proteins
Novex® Tris-Glycin Gels were used for a non-denaturing (“native”) electrophoresis. Details about the buffers and voltage used as well as running time are shown in Table 2. Coomassie blue staining of the gels (section 3.9) showed that neither crude membrane proteins (section
3.11) nor enriched cell surface proteins (section 3.12) ran through the gel in native conditions, while addition of extra detergents (octyl D-glucoside (Sigma) at 1.5% final concentration, or triton X-100 at 3% final concentration) did not facilitate the electrophoresis.
3.8.2 Running Large Gels
In order to further separate the proteins a large (1.5 mm x 160 mm x 160 mm) precast 10-20%
Tris-HC1 acrylamide gel (Bio-Rad) was used. The electrophoresis was performed similarly to that used for the smaller gels, except the chamber was kept cool during the procedure by
47 Table 2- SDS-PAGE Details
Gel type Sample Buffer Running Buffer Voltage (V’) Time (mm)
Homemade SDS sample Tris-glycine SDS 125 120 buffer* running buffert
Novex Tris- SDS sample Tris-glycine SDS 125 110 Glycint buffer running buffer
NuPAGE®Novex® NuPAGE®LDS NuPAGE®MES SDS 200 35 Bis-Tris Sample Buffer Running Buffer
NuPAGE®Novex® NuPAGE®LDS NuPAGE®Tris- 150 60 Tris-Acetate Sample Buffer Acetate SDS Running Buffer
Bio-Rad Tris-HC1 SDS sample Tris-Glycine SDS 125 270 buffer Running Buffer
* 6X SDS sample buffer contained 125mM Tris-HC1 pH 6.8, 2% SDS, 20% glycerol, and 0.2%, bromophenol blue. t Each 1 L contained 1 g SDS, 3.03 g Tris and 14.4 g Glycin. In native electrophoresis, 6X Tris-glycine native sample buffer (125mM Tris-HC1 pH 6.8, 20% glycerol, and 0.2%, bromophenol blue), Tris-glycine native running buffer (3.03 g Tris and 14.4 g Glycin), constant voltage of 125 V, and running time 2-4 h was used.
48 addition of 20% ethylene glycol in water and the running time was longer. Details about the buffers and voltage used as well as running time are shown in Table 2.
3.9 Coomassie Blue Staining
The gel was removed from the electrophoresis chamber and placed in a clean container with enough 0.5% (w/v) Coomassie Blue R (Sigma) (prepared in 50% methanol, 10% acetic acid) to cover the gel. After 1 h gentle rocking at room temperature, the stain was discarded and the gel destained with destaining solution (40% methanol, 10% acetic acid), replaced with fresh solution every 10-20 minutes for a 3-4 times, then left in the solution overnight or until faint bands were observed.
3.10 Western Blot
Proteins separated by gel electrophoresis were transferred to TMHybond ECLTM (GE Healthcare,
Uppsala, Sweden) nitrocellulose membranes overnight or for 1 h. Membranes were soaked in
5% milk PBS containing 0.1% Tween-20 (PBS-T) for 1 h at room temperature and then rinsed twice with PBS-T. Membranes were incubated with primary antibodies diluted in 2.5% milk
PBS-T for 1 h at room temperature. A list of antibodies used and their sources are shown in
After 3 times washing (10 mm each) with PBS-T, the membranes were incubated with horseradish peroxidase (HRP)-.conjugated secondary antibodies (all HRP-conjugated secondary antibodies used were purchased from Santa Cruz Biotechnologies) diluted in 2.5% milk PBS-T for an additional 1 h. The blots were visualized using SuperSignal West Pico (Pierce, Rockford,
IL) and under Chemigenius (Syngene, Frederick, MD) imaging system. Quantification of band
49 Table 3- List and Source of Primary Antibodies Used for Western Blot
Antibody Source
Goat anti-RSV polyclonal antibody Biodesign
Mouse anti-CAR mAb (clone RmcB) Upstate
Mouse anti-enterovirus VP1 DAKO
Mouse monoclonal Anti-13-Actinantibody Sigma
Mouse monoclonal anti-human EGFR Biosource, now part of Invitrogen cocktail antibodies
Mouse monoclonal anti-human DAF Santa Cruz Biotechnologies antibody
Mouse anti-human transferrin receptor Zymed Laboratories, now part of antibody Invitrogen
Mouse anti-flotillin- 1 antibody BD Transduction, San Diego, CA
Rabbit polyclonal anti-nucleolin(C23) Santa Cruz Biotechnologies antibody (H-250)
Mouse monoclonal anti-nucleolin antibody Santa Cruz Biotechnologies (MS-3)
Rabbit anti-caveolin antiserum Transduction Laboratories, Lexington, KY
Rabbit anti-transferrin antibody DAKO, Glostrup, Denmark
50 density was performed using GeneTools software (Chemigenius Gel Documentation System,
Syngene).
3.11 Preparation of “Crude” Membrane Proteins
Crude cell membranes (membranes obtained from cell surface and cell organelles) were prepared from subconfluent cell monolayers and according to a published 29protocol Using a cell scraper, adherent cells were detached from flasks into 10 mL PBS. and pelleted by centrifugation at 200 x g for 10 mm. Cells were washed homogenization buffer (250 mM sucrose, 20 mM HEPES, pH 7.4, 1 mM EDTA, 100 U of aprotinin per mL) and then resuspended in this buffer and homogenized by 35 stokes of a Dounce homogenizer to rupture the plasma membrane but leave internal organelles intact. Cell debris and nuclei were pelleted by centrifugation at 350 x g for 10 mm and subsequently membranes were pelleted from the supernatant by a further centrifugation at 170,000 x g for 1 h at 4°C. Membrane pellets were resuspended in 100 iL 0.01 M Tris-HC1 buffer, pH 7.5, and their protein concentrations were determined by the Bradford assay with bovine serum albumin (BSA) as a standard. Membrane proteins were then stored at -80°C in aliquots.
3.12 Preparation of “Enriched” Cell Surface Membrane Proteins
The technique used for cell surface membrane sub-fractionation has been published 160elsewhere Cells were grown to 80% confluence in 150-mm diameter dishes and scraped in Tris. buffered saline (TBS) buffer (50 mM Tris HC1, pH 7.6, 150 mM NaC1). Cell pellets were obtained by centrifugation at 500 x g for 3 mm, resuspended in ice-cold modified buffer M (100 mM NaC1, 20 mM Tris-HC1, pH 8, 2 mM ,2MgC1 1 mM EDTA, 0.2% Triton X-100, 1 mM 51 phenylmethylsulfonyl fluoride). After vigorous vortexing, the lysate underwent centrifugation at
600 x g for 3 mm to pellet and remove nuclei and debris. The supernatant underwent centrifugation at 6,000 x g for 5 mm to pellet the membranous organelles. The supernatant underwent ultracentrifugation at 20,800 x g for 10 mm to pellet membrane proteins. The pellet was resuspended in modified buffer M containing 0.3% Triton X-100 and stored at -80°C.
3.13 Preparation of Biotinylated Cell Surface Membrane Proteins
Cell surface biotinylation was performed using Cell Surface Protein Isolation Kit (Pierce,
Rockford, IL), which the manufacturer claims can isolate almost all cell surface proteins (unless there are problems such as steric hindrance, lack of primary amines, and/or minimal sequence with extra-cellular exposure that can prevent or interfere with biotinylation). Cell surface protein isolation was performed according to the manufacturer’s instructions as follows:
In order to achieve biotinylation of the cell surface, cells were grown in four T75 2cm flasks to
90-95% confluence. The media was removed and cells were washed twice with 8 mL of ice- cold PBS per flask. The PBS was quickly removed in order to prevent rounding and detachment of cells. The contents of one vial of Sulfo-NHS-SS-Biotin were dissolved in 48 mL of ice-cold
PBS and 10 mL of this solution was added to each flask. The flasks were then placed on a rocking platform and gently agitated for 30 mm at 4°C to ensure even coverage of the cells with the solution. The reaction was then quenched by adding 500 i.L of Quenching Solution to each flask. The flask was gently tipped back and forth for even coverage of the solution. The cells were then scraped into the solution and the contents of all four flasks were transferred to a single
50 mL conical tube. Using a single 10 mL volume of TBS, all four flasks were rinsed and the rinse was added to the transferred cells. Cells then underwent centrifugation at 500 x g for 3 mm
52 and the supernatant was discarded. Five mL TBS was added to the cell pellet and using a serological pipette the cells were gently pipetted up and down twice. Cells underwent additional centrifugation at 500 x g for 3 mm and the supernatant was discarded.
In order to lyse the cells, 40 iL protease Inhibitor Cocktail (Sigma) was added to 500 iL of
Lysis Buffer and added to the cells. Cells in the lysis solution were transferred to a 1.5 mL microcentrifuge tube and pipetted up and down to suspend the cells. Cells were disrupted by sonicating on ice using five 1 s bursts on low power to prevent foaming. Cells were incubated on ice for 30 mm and vortexed every 5 mm for 5 s. The resulting Cell lysate underwent centrifugation at 10,000 x g for 2 mm at 4°C and the clarified supernatant was transferred to a new tube.
In the next steps the biotinylated proteins were isolated. First, a column was inserted into a collection tube provided by the kit. The bottle of Immobilized NeutrAvidinTMGel Gently swirled to obtain an even suspension and 500 p1 of its contents was added to the column. The column was capped and underwent centrifugation for 1 mm at 1,000 x g and the flow-through was discarded. The collection tube was reused and 500 1L of Wash Buffer was added to the gel, underwent centrifugation for 1 mm at 1,000 x g and flow-through was discarded. This step was repeated two more times.
The bottom of the column was blocked by a provided cap and the clarified cell lysate was added to the gel in the column and then top cap was applied to close the column.
Using a rocking platform the column was rocked back and forth for 60 mm at room temperature.
To prevent leaking of the lysate from the bottom of the column first the top cap and then the
53 bottom cap were removed from the column and the column was placed in the collection tube and the top cap was replaced. The column underwent centrifugation for 1 mm at 1,000 x g and flow-through was discarded. Protease Inhibitor Cocktail (2.5 L) was added to 2.5 mL of Wash
Buffer and 500 iL of the Wash Buffer was added to the column already replaced in the collection tube. The column was capped and its contents were mixed by inverting it. The column underwent centrifugation for 1 mm at 1,000 x g. The rinse was discarded. This step was repeated three times. The bottom cap was replaced on the column.
The following steps were performed to elute the proteins. First, 50 L of deionized 2OddH was added to one TMNo-Weigh DTI Microtube to yield 1 M DTT. Then 23.7 tL of the DTT solution was added to 450 L SDS-PAGE Sample Buffer to make a final concentration of 50 mM DTF. To the gel on the column, 400 [LLof the Sample Buffer containing the DTT was added and the column was capped. The column was incubated for 60 mm at room temperature on a rocking platfonu.
First the column’s top cap and then the bottom cap was removed. The column was placed on a new collection tube and the top cap was replaced. The column underwent centrifugation for 2 mm at 1,000 x g. The sample containing biotinylated cell surface proteins was stored at -20°C.
314 Caveolin-rich Light Membrane (CLM) Fractionation
This is a detergent-free method used for isolation of caveolin-rich light membrane fraction and was performed according to the method by Waugh et 161 All the procedures were performed on ice. The buffers contained 2 mM sodium orthovanadate and 1 mM sodium fluoride to inhibit protein phosphatases. HEp-2 cells were grown to 80% confluence in a 150 mm-diameter culture
54 dish. The cells were washed with PBS twice and then scraped into 2 mL of 500 mM sodium carbonate 23CO(Na pH 11.0 containing Protease Inhibitor Cocktail. Following homogenization by 15 ) strokes of a Dounce homogenizer, cells were further homogenized by sonication on maximum setting (3 times of 20 s bursts).
The cell homogenate (2 mL) was mixed with 2 mL of 90% (w/v) sucrose in MBS buffer (25 mM Mes, 150 mM NaC1,pH 6.5) and placed in a 12-mL ultracentrifuge tube. To the tube, 4 mL of 35% (w/v) sucrose in MBS buffer (containing 250 mM sodium carbonate), followed by 4 mL of 5% (wlv) sucrose in MBS buffer (containing 250 mM sodium carbonate) was layered. The sample then underwent centrifugation at 140,000 x g in a Beckman SW28 rotor for 20 h.
Fractions in 1 mL volumes were collected from the top of the tube making 12 fractions in total.
The fractions were kept in aliquots for later analysis at -80°C.
3.15 Immunoprecipitation
3.15.1 Cell Lysis
Subconfluent HEp-2 cells in 100-mm diameter tissue culture dishes were washed twice with ice- cold PBS after removal of culture medium. The supernatant was discarded and the dishes were placed on ice and 1 mL ice-cold lysis buffer MOSLB was added to each dish. After 10—15 minutes incubation on ice with occasional rocking, the cells were transferred to a suitable homogenization tube. The cells were further disrupted by sonication while being kept on ice.
Particulate matter was removed by centrifugation at 12,000 x g for 10 mm at 4 °C. The lysate was then transferred to a fresh tube and kept on ice.
55 For experiments in which the whole virus was intended to be immunoprecipitated, instead of being added to the cells, the lysis buffer (2 mL containing 20 iL PlC) was added to the virus stock (120 iL pure CVB3 of 108PFU/mL concentration). The mixture was then incubated on ice for 30 mm and underwent pre-clearing as follows:
3.15.2 Pre-Clearing
The cell lysate was pre-cleared to prevent binding of antibodies present in the cell lysate. Pre clearing was performed by adding nProtein A Sepharose 4 Fast Flow (GE Healthcare) (100 1iL,
50% slurry) to 1 mL cell lysate in a microcentrifuge tube and gently mixing at 4°C for 1 h. The mixture underwent centrifugation at 12,000 x g for 20 s and the supernatant containing precleared cell lysate was saved.
3.15.3 Coupling Antigen to Antibody
The supernatant containing precleared cell lysate was transferred into aliquots (500 1iL) in new microcentrifuge tubes. Purified monoclonal or polyclonal antibodies (1—5tg) and for controls non-immune antibodies that were at a similar concentration and isotype matched to the specific antibody were used. The cell lysate and antibodies were gently mixed at 4°C overnight.
3.15.4 Precipitation of Immune Complexes
In order to precipitate the complex, 50 1iL nProtein A Sepharose 4 Fast Flow (50% slurry) was added and gently mixed at 4°C for 1 h. After centrifugation at 12,000 x g for 20 s the pellet was saved and washed three times with 1 mL MOSLB by centrifugation at 12,000 x g for 20 s and once with wash buffer (50 mM Tris, pH 8).
56 3.15.5 Dissociation and Analysis
The pellet was suspended in 30 1iL sample buffer (1% SDS, 100 mM DTT, 50 mM Tris, pH 7.5), then heated at 95°C for 3 mm to dissociate the antigen and antibodies from the beads. The beads were removed by centrifugation at 12,000 x g for 20 s and the supernatant was removed carefully. To analyze the supernatant by SDS-PAGE, 1 1iL 0.1% bromphenol blue was added and after electrophoresis the gel was stained to detect proteins or underwent immunoblotting.
3.16 Virus-Receptor Co-Immunoprecipitation
To use RSV virions as “baits” and co-immunoprecipitate their protein (or partly protein) receptor (“prey”) by antibodies against the virus, CVB3 and its known receptor (CAR), were used to validate the method as follows:
3.16.1 Co-immunoprecipitation of CAR Using CVB3 as Bait
HeLa cells were grown in two 100 mm-diameter culture dishes to 80% confluence. Cells were washed with ice cold PBS twice and either infected with 500 tL concentrated CVB3 (108
PFU/mL) or sham infected with media only. The cells were kept at 4°C for 1 h and rocked every
20 mm to allow virus binding but not internalization. Unbound virus was removed by 3 times wash with ice cold PBS and proteins on the cell surface became chemically crosslinked by incubation in lmg/mL BS3 (Pierce) at room temperature for 30 mm. To quench the crosslinking reaction, 20 iL of 1M Tris pH 7.5 was added to the cells and the incubation was continued at room temperature for an additional 15 mm. Cell lysate was prepared by adding 2 mL lysis buffer (MOSLB plus 10 .tL Protease Inhibitor Cocktail (Sigma) to each dish and kept at 4°C for
30 mm. Cell lysate aliquots of 1 mL were precleared with 50 iL of nProtein A Sepharose 4 Fast
57 Flow (GE) (50% slurry in MOSLB) beads at 4°C for 1 h. The mixture underwent centrifugation at 12,000 x g for 20 s to pellet the beads and the supernatant was saved and aliquots prepared
(500 tL each) in new microcentrifuge tubes. To each tube either 5 jig of anti-enterovirus VP1 antibody (DAKO) or mouse IgG (Santa Cruz Biotechnologies) was added. To couple antigen to antibody, the samples were incubated at 4°C overnight. In order to precipitate the complex 50 iL of Protein A Sepharose 4 Fast Flow (50% slurry) was added to each tube and gently mixed at 4°C for 2 h. The mixture then underwent centrifugation at 12,000 x g for 20 s and the pellet containing the complex attached to beads was collected. The pellet was washed three times with
1 mL lysis buffer and once with wash buffer (50mM Tris, pH 8) with centrifugation at 12,000 x g for 20 s between each wash and careful discarding of the supernatants to avoid losing beads.
Samples were run on 9% SDS-PAGE. Western blot was performed using 1:1000 mouse anti-
CAR mAb (clone RmcB) (Upstate, now part of Millipore). Results were interpreted as presence or absence of bands of predicted molecular weight visualized in immunoblots.
3.16.2 Co-immunoprecipitation of an Unknown Receptor Using RSV as Bait
The method used was exactly the same as the one for co-immunoprecipitation of CAR using
CVB3, except instead of CVB3 and its related antibodies, RSV and its antibodies including goat anti-RSV polyclonal antibody (Biodesign, Saco, ME), normal goat serum (Santa Cruz
Biotechnology), and donkey anti-goat IgG-HRP (Santa Cruz Biotechnology) were used.
3.17 Chromatography for Purification of RSV F and G proteins
The protocol for this method was kindly sent by Dr. Marina S. Boukhvalova (Virion Systems,
Inc., Rockville MD), which was based on a paper by Roder et 62al.’
58 3.17.1 Cell Preparation
After HEp-2 cells were grown to 80% confluence in five 150 mm-diameter tissue culture dishes, they were infected by RSV (Long strain) at MOI=0.1. After 36 h, when extensive syncytia formation was observed and while the fused cells were still attached to the culture dishes, the medium was removed and the cells were washed twice with ice-cold PBS containing 2 mM
EDTA. The dishes were placed on ice and the cells were detached by cell scraper after adding 5 mL MES Lysis Buffer (250 mM saccharose, 25 mM MES-NaOH pH 5.7, 10 mM NaC1,2 mM
EDTA, 0.1 mM phenylmethanesulphonylfiuoride or phenylmethylsulphonyl fluoride (PMSF) per dish. The RSV-infected HEp-2 cell lysate was then transferred to three 15 mL Falcon tubes, frozen on dry ice, then transferred to -80°C freezer.
3.17.2 Column Preparation
3.17.2.1 HiTrapQ FF (GE Heaithcare)
In a cold room (4°C) and under gravitational flow, the top of a new HiTrapQ FF column was removed and by appropriate adapters the column was connected to a tube containing MT-b buffer (25 mM MES-NaOH, pH 5.7, 0.1 % v/v Triton X-100, 10 mM NaC1, 0.1 mM PMSF).
After removing the lower cap of the column, the column was washed with 25 mL MT-b buffer, then with 25 mL of 1M NaC1in MT-b buffer (1.7g NaCl in 30 ml MT-b buffer), then with 50 mL MT- 10 buffer containing PMSF.
3.17.2.2 Lentil-lectin (GE Healthcare)
In a cold room (4°C) and under gravitational flow, 5.5 mL of Lentil Lectin Sepharose 4B
(supplied as 75% slurry) was buffer placed into a 10 cm column. The buffer dripped through, a
59 buffer head with MT-100 (25 mM MES-NaOH, pH 5.7, 0.1 % v/v Triton X-100, 100 mM NaC1,
0.1 mM PMSF) was built, and 40 mL of MT-100 was washed buffer through the column.
3.17.3 Processing of RSV-infected HEp-2 Cell Lysate
The stored, RSV-infected HEp-2 cell lysate prepared and frozen earlier was thawed in a 37°C water bath, sonicated on ice for 1 mm (6 s on-6 s oft), and 10% Triton-X was added to yield final concentration of 0.1%. The tube was kept on ice for 15 mm while being vortexed every 5 mm for 5 s. The lysate then underwent centrifugation for 10 mm at 2,000 x g at 4°C and the supernatant underwent another centrifugation at 15,000 x g at 4°C, after which the clarified supernatant was transferred to a clean tube.
3.17.4 Running HiTrapQ FF Column
The first step of protein purification was carried out by applying the clarified supernatant onto the prepared HiTrapQ FF column to perform an ion exchange chromatography. The flow- through was collected and reloaded. This step was repeated twice. The flow-through was collected and an aliquot labeled “flow-through” was saved for analysis. The column was washed with 50 mL of MT-b buffer. The concentration of NaC1 was increased using MT-100 (30 mL total volume) in order to elute the RSV F protein. Four fractions were collected and the concentration of NaC1 was further increased by using MT-300 to elute RSV G protein. This time six fractions where collected. A sample of every fraction was saved for further analysis.
Each sample was run on three identical 10% gels for Coomassie blue staining and Western blotting for RSV F and G proteins. Samples were not boiled before loading and 25 1iL of the
60 appropriate fraction was mixed with 5 L non-reducing 6X SDS-loading buffer. The primary antibody used for RSV F Western blot was rabbit polyclonal anti-RSV (abcam, Cambridge, UK)
(1: 250 in 2.5% milk PBS-T)) and the second antibody was goat anti-rabbit HRP (Santa Cruz
Biotechnology) (1:1000 in 2.5% milk PBS-T). The primary antibody used for detecting RSV G
Western blot was goat anti-RSV (Biodesign) (1:1000 in 2.5% milk PBS-T)) and the secondary antibody was donkey anti-goat HRP (Santa Cruz Biotechnology) (1:1000 in 2.5% milk PBS-T).
Fractions 2-4 contained F protein and relatively low amounts of G protein and fractions 6 and 7 contained G protein with non-detectable F protein.
3.17.5 Running Lentil-Lectin Column
Fractions 2-4 were pooled together and loaded onto the Lentil-Lectin column which was equilibrated with MT-100 buffer as described earlier. The column was reloaded then washed with 40 mL MT-100 buffer. To elute the RSV F protein, 30 mL 4% w/v a-methyl-d-mannoside in MT- 100 buffer was used. For each fraction 120 drops were collected. A sample from every fraction was collected for further analysis.
For eluting RSV G protein, fractions 6 and 7 were pooled, loaded onto a ME. 100 equilibrated.
Unbound proteins were removed by extensive washing with 10 times the column volume of
MT-100. The Lentil-Lectin column was further washed with 40 ml 2% w/v a-methyl-d mannoside in MT-IOU buffer, to elute the RSV G protein 30 mL of 8% w/v a-methyl-d mannoside in MT-lOUbuffer was used.
61 Western blots for F and G proteins and Coomassie blue staining of corresponding fractions of the gel were performed to identify fractions containing pure proteins.
3.17.6 Concentrating and Spin-dialysing Purified RSV F Protein
Fractions 2-11 were pooled and concentrated to 800 iL as follows:
The pooled fractions were loaded on Amicon Ultra Centrifugal Filter Devices with molecular weight cut-off of 5 kDa after prewashing the column with 10 mL PBS, pH 7.4. The columns underwent centrifugation at 4,000 x g at 4°C for 20 mm. Then 13 mL PBS-T (pH 7.4) was added and the columns underwent centrifugation for an additional 30 mm. This step was repeated. When an 800 iL volume was obtained aliquots were saved to determine concentration of F and/or G protein
To store the protein, BSA (2 mg/mL) was dissolved in PBST and then filter-sterilized by a 0.2 m syringe filter (Sarstedt, Montreal, Quebec, Canada) 3 times. An equal amount of BSA in
PBST was added to concentrated and spin-dialyzed F-protein, giving a 1 mglmL final concentration of BSA. The protein preparation was stored at 4°C.
To determine the concentration of purified, 10 ig/mL, 1 tg/mL and 0.1 pg/mL of BSA in PBS, pH 7.4 was prepared. To obtain a 100 tg/mL solution, a stock of 30 % BSA solution was diluted 1:300 and then 1:100. The 10 tg/mL, 1 tg/mL, and 0.1 iWmL dilutions of BSA were mixed with 6X SDS-loading buffer containing 2-Mercaptoethanol (Sigma) and boiled for 5 mm and 20 tL of each was loaded per lane. Samples of purified F and G protein in reduced and non reduced conditions were prepared for gel loading and Coomassie blue staining as well to
62 estimate the concentration of purified proteins by comparing them with different concentrations of BSA solutions.
318 RSV F Protein Cloning and Protein Expression
Two expression vectors were used to express and tag either RSV F protein excluding its signal peptide or extracellular part of RSV F protein including its signal peptide. The expression vectors included PCR3TMFC (a gift from Dr. Oscar Negrete from University of California, Los
Angeles, CA) and pcDNA3.11V5-.His TOPO TA Cloning® (Invitrogen). The cloning vector
PGEMTM3Z..RSVF(a gift from Dr J.A. Beeler, FDA) contained RSV F strain A2 protein and was grown, purified, and restriction digested to obtain the RSV F protein template for subsequent polymerase chain reactions. Map of pcDNA3. 11V5-His TOPO TA Cloning vector is available at: https:/!catalog.invitrogencom/index.cfm ?fuseaction=viewCatalog. viewProductDetails&product
Description=686.
Map of PGEM-3Z Vector is available at: http://wwwpromega.com/figures/popup.asp?partno=p2 151&product=pgem%3csup%3e%26%2
3xOOae%3b%3c%2fsup%3e-3z+vector&fn=0278va. RSV F gene was located in the BamH I site and its ORF was towards T’7promoter.
Part of Map of PCR3TMFC vector is demonstrated in Appendix A using NEBcutter V2.O available at: http://too1s.neb.com/NEBcutter2/index.php.
63 3.18.1 Insertion of RSV F Protein Excluding Its Signal Peptide or Extracellular
Domain of RSV F Protein into PCR3TMFC Vector
3.18.1.1 Growing and Purification of Plasmids:
PGEMTM3ZRSVF and PCR3TMFC were grown as follows:
Competent E. coli cells DH5TMc(Invitrogen) were thawed on ice and 20-50 iL of the cells was added to (1-2 1L) of plasmids and was pipetted up and down gently for 3 times. The mixture was left on ice for 20-30 mill and then heat shocked at 42°C water bath for exactly 35 s. The mixture was immediately placed on ice and kept there for an additional 5-10 mm. While a
Bunsen burner was used to flame-sterilize caps and tops of the tubes, 250 tL of SOC Medium
(Invitrogen), which contained 2% Tryptone, 0.5% Yeast Extract, 10 mM NaC1, 2.5 mM KC1, 10 mM ,2MgCl 10 mM 4MgSO 20 mM glucose, was added to the mixture of plasmids and cells. The mixture was shaken, at 37°C at 220 rotations per minute (rpm) for 3 h, and then 20-200 tL of the mixture was added to Lauria-Bertani (LB) broth agar plates (containing 1.0% Tryptone
(Sigma), 0.5% Yeast Extract (Sigma), 1.0% Sodium Chloride (Sigma), pH 7 plus l5gIL agar
(Sigma) and 100 .tg/mL ampicillin (Sigma) or 50 tg/mL kanamycin A (Sigma)) and spread by a flame-sterilized cell spreader. The plates were incubated at 37°C overnight. The following day, single colonies were picked and used to inoculate 4 mL of LB containing the desired antibiotic in snap-cap 15 mL sterile Falcon tubes (BD Biosciences, San Jose, CA). The tube was shaken overnight (12-16 h) at 37°C and at 220 rpm.
The next day the tube underwent centrifugation at 2,000 x g for 10 mm at room temperature.
QlAprep Spin Miniprep Kits (Qiagen Corp. Valencia, CA) were used to purify the plasmid DNA from the cells according to manufacturer’s 63instructions’ as follows: 64 All traces of supernatant were removed by inverting the open centrifuge tube and the pelleted bacterial cells were resuspended in 250 tL Buffer P1 (resuspension buffer) containing RNase A and LyseBlue reagent and transferred to a microcentrifuge tube. The bacteria were resuspended completely by vortexing until no cell clumps were visible. Subsequently, 250 iL Buffer P2
(lysis buffer) was added and mixed thoroughly and gently by inverting the tube 4—6times until the solution became viscous homogeneous and slightly clear and blue (because of LyseBlue).
No later than 5 mm afterward, 350 iL Buffer N3 (neutralization buffer) was added to the lysis reaction and mixed immediately and thoroughly (to avoid local precipitations) by inverting the tube at least 4 times. When the solution became cloudy and all traces of blue color were gone, this indicated that the SDS in the lysis buffer was effectively precipitated. The mixture underwent centrifugation at 17,000 x g for 10 mm at room temperature and in a table-top microcentrifuge. The compact white pellets were discarded and the supematants were applied on QlAprep spin columns by decanting or pipetting. The column underwent centrifugation at
17,000 x g for 60 s and the flow through was discarded. To ensure that the plasmid was not degraded, the QlAprep spin column was washed by adding 0.5 mL Buffer PB and centrifugation for 60 s, after which the flow-through was discarded to remove trace nuclease activity (present in endA+ strains such as the RB 101 and its derivatives; however, for host strains like DH5CLTM this additional wash step was not required). To remove salts, the column was washed with 0.75 mL Buffer PE (containing ethanol) and centrifuged at 17,000 x g for 60 s. The flow-through was discarded and the column was centrifuged for another 1 mm to remove remaining wash buffer because residual ethanol from Buffer PE could inhibit subsequent enzymatic reactions.
To elute DNA, the QlAprep column was placed in a clean 1.5 mL microcentrifuge tube and 50
L of distilled water was added to the center of each QlAprep spin column, let stand for 1 mm, and undergoing centrifugation at 17,000 x g for 1 mm. The concentrations of the plasmids were
65 determined by adding 5 L of purified plasmid to 495 tL 2OddH (1:100 dilution) using BioMate 3 spectrophotometer (Thermo Spectronic, Rochester, NY).
3.18.1.2 Restriction Enzyme Digestion
To 500 ng of plasmid, 1 tL of restriction enzyme(s), 2 1L of restriction enzyme compatible lOX buffer was added and the final volume was brought to 20 tL by 2O.ddH The mixture was incubated in a 37°C water bath for 1 h, and stored at -20°C. The digestion was proved by agarose gel electrophoresis. In order to avoid later religation, in some reactions Calf Intestinal
Alkaline Phosphatase (ClAP, Invitrogen) was used to dephosphorylate 5’—endof linearized vector DNA prior to insert ligation. ClAP was added after digestion of the vector DNA with restriction enzymes and before heat inactivation. ClAP (1 L) was added to the digest and incubated at 37°C for 5 mm. The reaction was then inactivated at 65°C for 15 mm.
Restriction enzyme digestion was used for either analyzing the plasmids or preparing gel purified sequences with enzyme recognition site overhangs. For example, PCR3TMFC was double digested by NheI and BamHI (New England Biolabs, Beverly, MA) for later insertion of a polymerase chain reaction (PCR) product containing NheI and BamHI recognition sites.
3.18.1.3 Agarose Gel Electrophoresis
Agarose (Sigma) powder was mixed with Tris-acetate-EDTA (TAE) buffer to make a 1.5% agarose gel then heated in a microwave oven until completely melted. Ethidium bromide (Sigma) was added to the gel to the final concentration of 0.5 ig/mL to assist visualization of DNA after electrophoresis. The solution was cooled to 55°C and poured into a casting tray with sample
66 combs and allowed to solidify. The combs were then removed and the gel in its tray was placed into the electrophoresis chamber and slightly covered with TAE buffer. Samples containing digested DNA (20 iL total volume) were mixed with 4 iL of 6X DNA loading buffer (12 % (v/v) glycerol, 60 mM 2NaEDTA pH 8 0, 6% (w/v) SDS, 0.003% (wlv) bromphenol blue) and loaded onto the wells of the gel. The lid and power leads were placed on the apparatus and a current was applied. The gel was run at constant voltage of 140V for 2 h. The DNA was then visualized by placing the gel on a ultraviolet transilluminator shortly after termination of electrophoresis.
3.18.1.4 Isolation of DNA from Agarose Gel
Under the guide of a UV transilluminator, the desired band from the agarose gel was excised by a scalpel blade as quickly as possible to keep the UV exposure time to a minimum and to avoid
DNA fragmentation. The QlAquick Gel Extraction Kit was then used to extract and purify the DNA from the gel according to the manufacturer’s 64instructions’ The amount of DNA was quantified as explained earlier. Aliquots of the gel extracted DNA was subjected to 5’ end sequencing employing dye terminators in an automated. sequencing facility (NAPS Unit,
University of British Columbia, Vancouver, BC).
3.18.1.5 Polymerase Chain Reaction (PCR)
In order to obtain the insert of interest from F protein, the whole sequence of RSV F protein was obtained from PGEMTM3ZRSVF as mentioned earlier. The sequence coding for the RSV
(strain A2) F protein obtained from GenBank (Accession No. Ml 1486) is shown in Appendix B. Primers designed (DNADynamo, Blue Tractor 65Software)’ for production of inserts are also
67 listed in Appendix B. The forward and reverse primers were flanked by Nhe I and BamH I recognition sites, respectively and the PCR3TMFC was cut with the same restriction enzymes.
PCR was performed using the Expand High Fidelity PCR System kit (Roche Molecular
Biochemicals, Mannheim, Germany) according to manufacturer’s instructions as follows:
After being thawed on ice, the reagents were briefly vortexed and underwent centrifugation on a benchtop microcentrifuge. Two mixes were prepared in sterile microfuge tubes on ice. Mix 1
(25 iL per reaction) contained 200 .tM deoxynucleotide mix, 300 nM forward primer, 300 nM reverse primer, about 3 ng DNA template. Mix 2 (25 itL per reaction) contained 1X Expand
High Fidelity buffer and 2.6U Expand High Fidelity enzyme mix. Mix 1 and Mix 2 were combined in a thin-walled PCR tube while kept on ice. The combination was gently vortexed to produce a homogeneous reaction and then centrifuged briefly to collect sample at the bottom of the tube. The samples were placed in Robocycler 96 (Stratagene; La Jolla, CA), having an initial denaturation at 94°C for 2 mm followed by 35 cycles of denaturation at 94°C for 15 s, annealing at 60°C (for insert of RSV F excluding signal peptide coding region into TM-FCPCR3 vector), 50°C (for insert of RSV F extracellular domain coding region into PCR3TMFC vector), 56°C
(for insert of RSV F excluding signal peptide coding region into pcDNA3. 1/V5-His TOPO TA
Cloning vector), or 55°C (for insert of RSV F extracellular domain coding region into pcDNA3.1/V5-His TOPO TA Cloning vector) for 30 s followed by extension at 72°C for 2 mm, and a final elongation at 72°C for 10 mm.
3.18.1.6 Insert-plasmid Vector Ligation
A molar ratio of 3:1 insert:vector and T4 DNA Ligase (Invitrogen) was used for the ligation reaction. In an autoclaved, 1.5-mL microcentrifuge tube, 5X ligase buffer (Invitrogen), insert,
68 vector, and autoclaved distilled water were mixed to make a 10 L final volume. The mixture was left on bench top at room temperature for 1 h and used for transformation.
3.18.1.7 Transformation
In order to transform DH5cLor One Shot ToplOF’, MAX Efficacy Stbl2 (all from Invitrogen) or
HB1O1 (Promega, Madison, WI) cells with the ligated insert and vector, 4 tL of ligation reaction was added to 30 L of cells. The mixture was incubated on ice for 10 mm and then heat shocked at 42°C for 35 s. After a 5 mm additional incubation on ice, 300 L of ampicillin-free
LB was added to the mixture and incubated at 37°C (or 30°C) on 220 rpm for 3h. The transformed cells were spread on LB agar plates containing the desired antibiotic and kept at
37°C (or 30°C) overnight. The colonies where then picked and grown and purified as mentioned before. Since PCR products would clone bidirectionally, the plasmids were analyzed for insertion and orientation by restriction analysis or by sequencing.
3,18.1.8 Transient Transfection
HEK 293FT or HeLa cells were grown in 6-well plates to 80% confluence. FuGENE 6 reagent
(Roche Applied Science, IN) was brought to room temperature and vortexed for 1 s. To 500iL
OptiMEM (Invitrogen) 18tL FuGENE 6 reagent was added (directly into the medium and without allowing contacting the walls of the plastic tube) and kept at room temperature for 5 mm for each plate after 1 s vortexing. Also, for each plate 3ig DNA for transfection was used.
The DNA was added to the OptiMEM/FuGENE 6 reagent mixture and after gentle up and down pipetting, the mixture was incubated at room temperature for an additional 15 mm. Meanwhile the media of the cells was replaced with 400 pL of a fresh media and then 40iL of the
DNAIOptiMEMJFuGENE 6 reagent mixture was added to each well in a drop-wise manner.
69 The plate was swirled and incubated at 37°C until the assay for gene expression was to be performed. If the cells needed to be kept for more than 24 h then media was again replaced with fresh media.
3.18.2 Insertion of RSV F protein Excluding Its Signal Peptide or Extracellular
Domain of RSV F Protein into pcDNA3.1N5-His-TOPO®:
The TOPO® Cloning reaction (6 tL) was set for transformation into chemically competent
DH5ct, One Shot ToplOF’, MAX Efficacy Stbl2, and HB1O1 E. coli. PCR product (0.5-4 FL),
Salt Solution (1 iL), sterile water added to a final volume of 51iL, and finally TOPO® vector (1 iL) were mixed gently and incubated for 5 mm at room temperature. The reaction was placed on ice and 2 tL it was added into a vial of either one of the abovementioned competent E. coli cells and mixed gently. The cells were incubated on ice for 10 mm.
The cells were then heat shocked at 42°C (water bath) for 30 s and transferred on ice immediately. SOC medium (250 1L and at room temperature) was added to the cells. The tubes of cells were placed horizontally on a shaker at 37°C (or 30°C) and shaken at 220 rpm for 1 h.
From each transformation 25 and 200 iL was spread on two previously warmed plates
(ensuring at least one of them would obtain colonies with enough space in between) containing ampicihin and incubated overnight at 37°C (or 30°C). Five colonies were picked from each plate cultured overnight in 4 mL LB medium containing 50 .tg/mL ampicillin. The plasmid
DNA was isolated using QlAprep Spin Miniprep Kit. Since PCR products would clone bidirectionally, they were further analyzed for insertion and orientation by restriction analysis or by sequencing (NAPS) using the T7 and BGH Reverse sequencing primers included in the pcDNA3. 1/V5-His-TOPO® kit.
70 Once the desired construct was obtained, it was transfected into the HEK-293FT and HeLa cells.
The pcDNA3. 1/V5-His-TOPO® kit contained an expression control vector (pcDNA3. 11V5-His-
TOPO/lacZ©) which was used to check transfection efficiencies and expression in the cell lines.
Since in mammalian cells the gene encoding (3-galactosidase is expressed under the CMV promoter, successful transfection would result in f3-galactosidase expression that was assayed with (3-GalStaining Kit according to manufacturer’s instructions as follows:
The amounts of reagents mentioned below were sufficient for one well of a 6-well culture plate.
The growth medium was removed from the pcDNA3. 11V5-His-TOPO/lacZ© transfected cells and the plate was washed with PBS. Transfected cells were fixed using Fixative Solution (2% formaldehyde 0.2% glutaraidehyde in PBS) for 10 mm at room temperature. While the plate was in the Fixative Solution, Staining Solution was prepared (in propylene plastic only) by mixing 12.5 L Solution A (400 mM potassium ferricyanide), 12.5 L Solution B (400 mM potassium ferrocyanide), 12.5 iL Solution C (200 mM magnesium chloride), 62.5 tL 20 mg/mi
X-gal (5-bromo-4-chloro-3-indolyl-J3-D galactopyranoside) in N-N-dimethylformamide (DMF), and 1.15 mL lX PBS.
Fixed cells were washed with PBS twice and incubated with 1.25 mL Staining Solution at 37°C for 0.5 to 2.0 h (or longer until the cells were stained blue only if cell confluency was not high; otherwise the dye could diffuse through gap junctions resulting in a greater number of cells being stained).
To ensure even coverage of the Staining Solution, the plates were rocked occasionally. The cells were examined under a microscope and both the number of blue cells and the total number of
71 cells per field of view (5- 10 random fields of view were counted and the average was used) was determined. The percentage of cells staining blue was calculated and reported as transfection efficiency. For long term storage at 4°C, the Staining Solution was disposed and the stained cells were overlaid with 70% glycerol.
3.19 Pierce InGe1® Chemiluminescent Detection
The Pierce In-Gel® Chemiluminescent Kit is a method in which specific protein (separated by polyacrylamide gel electrophoresis (PAGE)) interactions are detected directly in the gel. Older methods designed for this purpose have not been widely used because they require lengthy fixation, incubation and wash steps and take several days to complete. Moreover, proteins are detected either with related peroxidase-labeled antibody and 3,3-diaminobenzidine or with radiolabeled lectins or antibodies.
Pierce InGe1® Chemiluminescent Detection kits are used as an alternative to Western blot.
Although a robust method in many situations, Western blotting has its own disadvantages and 66limitations’ including the dependence of efficiency of electroelution of polypeptides on the electrical, current used, the polyacrylamide gel pore size, and the molecular weights and net charge of the polypeptides. Furthermore, protein transfer by Western blotting can destroy relevant epitopes and renaturation of antigens may be inefficient and/or incomplete. Also, during the process, antigens may be lost from membranes and finally some proteins such as fibrinogen do not transfer well to membranes.
Pierce claims that Chemiluminscent In-Gel® Detection Kits make it possible to detect antigens in-gel using an optimized pretreatment step and an extremely sensitive chemiluminescent
72 substrate for 67HRP’ In a project looking for a completely unknown protein receptor for RSV, trying this method. was an attractive option.
The approach was to use the method for in-gel VOPBA. First, the method was tried for detection of transferrin (an abundant plasma protein) using anti-transferrin antibody. The next step was detection of transferrin receptor in cell membrane preparations using pure transferrin
(as bait) and anti-transferrin antibody. The method for detection of transferrin in a plasma sample was performed as manufacturer’s instructions as follows:
On each well of a 3-8% gradient Novex Tris Acetate Gel (Invitrogen), 10 pL of 10 times serially diluted (l01106) serum sample obtained from a healthy volunteer, in reducing and/or non-reducing conditions, was loaded. The gel was run under 150V constant voltage for 1 h. The gel was then pretreated with 50 mL of 50% isopropanol. After placing in 100 mL 2OddH for 15 mm, the gel was incubated in 20 mL 1:250 anti-transferrin antibody in 1% BSA in PBS-T and left at 4°C overnight. After washing 3 times (10 mm each) with PBS-T, the gel was incubated with 20 mL 1:500 HRP-conjugated goat anti-rabbit (Santa Cruz Biotechnology) for 1 h. The gel was then washed with PBS-T as before. The gel was incubated with 20 mL Chemiluminescent Substrate Working Solution (1:1 solution of each component) for 5 mm then rinsed in 2OddH for 15 s and finally sandwiched between cellophane sheets provided by the kit and exposed to
Chemigenius imaging system. The visualized bands were then excised from the gel and sent to the UVic—GBCProteomics Centre (University of Victoria, Canada) for protein detection by MS.
The In-Gel Chemiluminescent Detection was also performed for detection of transferrin receptor by pure transferrin (Sigma) as above, except instead of using human serum, 350 tg of a cell membrane preparation from HEp-2 cells was loaded onto each well of the gel and after
73 being immersed in water for 15 mm, the gel was incubated with 20 mL of 20 g/mL pure transferrin in 1% BSA-TBST for 1 h at room temperature followed by 3 times TBS-T wash.
The kit was also used for in-gel VOPBA. All the steps were like VOPBA as mentioned in section 3.20 below except it was performed on the gel and not on a blot.
3.20 Virus Overlay Protein Binding Assay (VOPBA)
Proteins and protein markers were loaded symmetrically on Novex®Tris-Glycin or Tris Acetate
Gels (Invitrogen) to obtain a gel that could be cut in the middle and the protein markers could be overlapped band by band. After gel electrophoresis (SDS-PAGE) half of the gel was fixed and kept for subsequent MS and the other half was electrophoretically transferred onto Hybond ECL nitrocellulose membrane. The non-specific binding sites of the nitrocellulose membrane were blocked with 5% milk PBS at room temperature for 1 h. The membrane was rinsed twice with
PBS and then incubated with 106107 PFU RSV (crude or concentrated) or AdV5-gfp (Vector
Biolabs, Philadelphia, PA) per mL of 2.5% milk PBS for either 2 h at room temperature or overnight at 4°C. The membrane was washed with PBS for 10 mm on shaker for 3 times and then incubated with either 1:1,000 goat anti-RSV polyclonal antibody (Biodesign) or 1:2,000 rabbit AdV5 antibody (abcam) in 2.5% PBS-T for 1 hour at room temperature and washed 3 times with PBS for 10 mm on a shaker. The HRP-conjugated donkey anti-goat or goat anti rabbit antibodies (both from Santa Cruz Biotechnologies) were then added in 1:1,000 concentration in 2.5% PBS-T for 1 h. The membrane was washed 3 times with PBS and the bands were visualized using SuperSignal West Pico or SuperSignal West Femto (Pierce) and
Chemigenius imaging system. While taking images, the membrane was placed on a grid and the exact locations of the visualized bands were marked on the membrane. The membrane was used
74 for detection of the location of the protein on the other half of the gel saved as explained in section 3.21 below.
3.21 Sample Preparation for MS
The gel for MS analysis had to be handled under a laminar flow hood and using gloves to protect it from contamination by keratin or other extraneous molecules. After gel electrophoresis, one-half of the gel (see section 3.20) was immediately fixed (in 50% methanol, 10% acetic acid) for 20 mm. The gel was then transferred into a clean container containing 10 mM Tris pH 8.5 and kept at 4°C until VOPBA on the other half of the gel was completed. Under the laminar flow hood and using gloves and forceps, the gel was placed on a clean piece of glass and the glass was placed on the marked membrane obtained from VOPBA (wrapped in a clean cellophane sheet) in a manner that each band of the markers of the gel was placed on the same band on the membrane. This way the location of the protein visualized on VOPBA was located on the gel and the band was cut using a clean cutter and placed in an Eppendorf tube containing
10 mM Tris pH 8.5 and sent to UVic—GBCProteomics Centre at ambient temperature.
3.22 MS Analysis
At the UVic—GBCProteomics Centre, the samples were digested with trypsin, and the extracted peptides were analyzed by LC-MS/MS using an Applied Biosystems QSTAR Pulsar I
Quadrupole Time-of-Flight Mass Spectrometer equipped with nano flow HPLC. The samples were separated by reversed-phase chromatography over a minimum 120 mm gradient while spraying into the mass spectrometer. The MS/MS data were analyzed using a protein identification search engine algorithm, MASCOT. The data were searched against the
75 heterologous non-identical MSDB database, which is a protein sequence database designed specifically for MS applications. The data were searched against all species sequences in MSDB as well as against IPI Human.
3.23 Enzyme Treatment of Membrane Proteins
In these sets of experiments, isolated membrane proteins (as opposed to the cell surface of intact living cells, as described in section 3.8) were treated with a panel of enzymes to investigate the effect of enzyme digest of membrane proteins on subsequent VOPBA and collecting more data on the chemical nature of the protein to which RSV bound on blots.
3.23.1 Proteases
Proteases used for this experiment were all purchased from Sigma and included Trypsin, c chymotrypsin, and papain.
To treat the membrane proteins with the proteases, 30 tL of biotinylated and isolated cell surface membrane proteins (from HEp-2 cells) was mixed with 1 1L of 10 igItL desired enzyme solution in PBS and kept at 37°C for 4h. The samples were mixed with 6 L of 6X
SDS-PAGE loading buffer, heated at 85°C for 2 mm and then 36 iL was loaded on a 4-12%
Novex® Tris-Glycin Gel (Invitrogen) after being mixed with traces of bromophenol blue
(Sigma). The efficiency of the enzymes was tested by Western blot for DAF. Results were interpreted as presence or absence of protein bands after protease treatment, provided the enzyme would digest the protein.
76 3.23.2 Glycosidases
The Enzymatic Protein Deglycosylation Kit (Sigma) was used to deglycosylate the membrane proteins of HEp-2 cells. The manufacturer’s instructions were slightly modified because they were intended for deglycosylation of pure proteins, while the samples used in this experiment were biotinylated and isolated cell surface membrane proteins. To 30 L of biotinylated and isolated cell surface membrane proteins from HEp-2 cells, 10 tL of 5X Reaction Buffer and 2.5
1iL of Denaturation Solution were added and mixed gently. Samples were heated at 95°C for 5 mm and then cooled to room temperature. After adding 2.5 L of Triton X-lOO and gentle mixing 1 iL of the desired enzyme (PNGase F, a-2(3,6,8,9) Neuraminidase, and 0-Glycosidase) was added. To the mixture, 1 L bromophenol blue was added after it was incubated at 37°C for
3 h. The mixture was loaded (36 L per lane) on a 4-12% Novex®Tris-Glycin Gel (Invitrogen).
The efficiency of the enzymes was tested by Western blot for EGFR and DAF. Results were interpreted as presence bands of lower molecular weights than undigested parallel controls, provided the glycosidase would remove corresponding carbohydrates from the proteins.
3.24 Antibody Blocking Experiments
The effects of anti-nucleolin (C23) antibodies on RSV and AdV5 infection were studied by using rabbit polyclonal IgG C23 (H-250) (Santa Cruz Biotechnology) and HEp-2 cells. To each well of an 80% confluent HEp-2 cells in 24-well plates 200 1L of anti-nucleolin antibodies or control rabbit IgG (Santa Cruz Biotechnology) (4 or 20 igImL) was added and the cells were kept for 1 h at 37°C. Following antibody incubation, rrRSV-BN1 or AdV5-gfp at MOI=1 was added in 33 L volume per well to the cells and the infection was continued for an additional 24 h. The cells were then trypsinized and fixed for flow cytometry as described later in this section.
The percent neutralization of infection was reported as follows:
77 %Neutralization = percent of fluorescently labeled cells 100—( <100) average of percent of fluorescently labeled cells in the absence of neutralization
3.25 Competition Experiments
Purified nucleolin (Vaxron Corp. Rockaway, NJ) (30, 60, 90 nM) or purified transferrin (Sigma)
(30, 60, 90 nM) was incubated with rrRSV-BNlor AdV5-gfp (MOI=1) for 3 h at room temperature. The protein pre-incubated viruses were added to 80% confluent HEp-2 monolayers in 24-well plates and kept at 37°C for 90 mm with occasional rocking. Unbound viruses were washed and the infection was continued for an additional 24 h. The infectivity was quantified by flow cytometry as described in section 3.26. The efficiency of virus infection expressed as infectious units per mL (IU/mL) according to the following formula:
IU per well JUImL= volume of inoculum per well (mL)
In this study, the IU per well was equal to the product of percent of fluorescently labeled cells reported by flow cytometry and 20,000 (i.e., the number of cells per well).
3.26 Flow Cytometry
Attached cell monolayers were separated from the surface of 24-well plates by adding 200 iL of 0.25% trypsin (Invitrogen) for 5 mm at room temperature and after that fixed with 200 .tL of
10% formalin (Sigma). The cells then underwent several repetitions of up and down pipetting to form single cell solution and then were collected in 5mL polystyrene round bottom tubes (BD
Biosciences). The samples were kept at 4°C in the dark and were analyzed within the next 24 h.
Labeled samples and isotype controls were analyzed using a Beckman Coulter Epics-XL
78 (Beckman Coulter, Miami, Florida, USA) flow cytometer. Samples were gated based on forward and side scatter, and the fluorescent signal was determined. The fraction of positively- staining cells was determined using Summit analysis software (Dako Cytomation, Carpinteria,
CA).
3.27 Statistical Analysis
SPSS, version 11.0 (SPSS Inc., Chicago, IL) software was applied throughout for statistical analysis. Analysis of variance (ANOVA) 168 was used to compare mean values whenever comparisons involved more than two experimental groups and Student 69t-tests’ were used for pair-wise comparisons. Whenever results of ANOVA were statistically significant, post hoc pair-wise group comparisons were done by use of Student t-tests. General linear model regression °17analysis was used to compare mean levels of infection (normalized RSV G/-actin ratios) among the five different cell lines used (with or without enzyme (trypsin) treatment) and included analysis for possible interaction between cell line and trypsin status, followed by post hoc Student t-tests for pair-wise group comparisons. For competition experiments (i.e., virus incubation with nucleolin or transferrin prior to inoculation of cell cultures) that tested for the possibility of a dose-response relationship, linear regression 171analysis was used. In all analyses, a p value <0.05 was considered to be statistically significant.
79 4 RESULTS
4.1 Cell Surface Enzyme Treatment
To determine some basic chemical characteristics of RSV cell surface receptor(s) with respect to protein, carbohydrate and lipid composition, the host cell surface was treated with a protease, several glycosidases, and P1-PLC (an enzyme that cleaves proteins from their glycolipid anchors and releases them from the ),12membrane respectively.
Since exposure of cells to enzymes could potentially affect their viability, trypan blue exclusion test of cell viability was performed in duplicate for each enzyme treatment and results (mean ±
SD) are shown in Table 4. According to results of ANOVA, there was no significant difference between groups (p value = 0.2), indicating the dose of enzymes used did not significantly affect cell viability.
80 Table 4- HEp-2 Cell Viability after Enzyme Treatment
Enzyme treatment (%) Cell viability* (Mean ± SD)
Sham 1 (1 h at 37°C) 88 ± 1.4
Sham 2(2hat37°C) 86 ±2.8
Trypsin 90 ±0
PNGase F 89 ± 1.4
Sialidase A 90 ± 2.8
Sialidase A (1 h at 37°C) then 0-Glycosidase 87 ± 2.8
(1 hat 37°C)
PT-PLC 85±0
* p=O.2
81 4.1.1 Trypsin
To determine if the cell surface component(s) to which RSV binds is a protein or has a protein component, HEp-2, A549, MDCK, CHO-Ki, and pgsA-745 monolayers underwent cell surface treatment with trypsin prior to incubation with RSV (Long strain). After virus binding, cells were washed to remove unbound virus. Twenty four h after infection, cells protein samples were prepared for gel electrophoresis and Western blotting of RSV proteins. Figure 4 is representative of one of the Western blots. One-way ANOVA (dependent variable, J3-actin; independent variable, cell type) was used to compare Western blot gel loading and transfer.
82 HEp-2 A549 MDCK CHO-Ki pgsA-745
RSV G
actin
Trypsin Pretreatment + + - + + + -
Figure 4. Western blot image of trypsin pretreated and non-pretreated RSV-infected cells.
Cells, either pretreated with trypsin or not exposed to enzyme, were infected with RSV. Twenty four h post infection samples were prepared for Western blotting. To detect RSV G protein, the membranes were probed with goat anti-RSV antibody. Note the effect of trypsin pretreatment on RSV protein expression, with uniform decreased intensity of bands for each of the cell types studied. Results obtained from quantification of the density of the bands from independent experiments are shown in Figure 5.
83 There was no significant difference in 13-actinoptical density for any of the five cell types under any of the conditions (i.e., non-trypsin pretreated and trypsin pretreated) studied (p=O.39), indicating any observed differences in RSV GI f3-actinratios (see below) were not attributable to significant differences in gel loading.
Using non-trypsin pretreated, RSV-infected HEp-2 cells as the reference cell type, normalized
RSV G/j3-actin ratios (Figure 5) for each of the experimental conditions tested underwent general linear model regression analysis for two fixed factors, cell type and trypsin pretreatment status, and possible interaction between these factors. Results showed statistically significant associations between both cell types and tryspin pretreatment status and the corresponding mean normalized RSV G/f3-actinratio (p Taken together, both cell type and trypsin pretreatment were significantly associated with differences in normalized RSV G/J3-actin ratio between groups of infected cells that were studied. Further analysis of non-trypsinized, RSV-infected cell preparations revealed no significant differences between HEp-2, A549, and MDCK cells (p=O.83);by contrast, ANOVA followed by Student t-test showed significant difference in normalized RSV G/13-actinratios between non-trypsin pretreated CHO-Ki and pgsA-745 in comparison to HEp-2 (p < 0.001), A549 (p < 0.05), MDCK (p < 0.05). Moreover, according to results of Student t-test, the normalized RSV G/13-actinratio between CHO-Ki and pgsA-745 was significantly different (p <0.05). 84 ___ * 140 120 r 100C - 80 I >0 40 20 t1 E z 0 — — — c3’ \ ‘ ) , _x Figure 5. Results of RSV Western blot on trypsin pretreated and non-pretreated cells 24 h post infection. Different cell types were either pretreated or non-pretreated with trypsin prior to RSV binding at 4°C for 30 mm. Note the statistically significant differences for cell type and trypsin pretreatment on normalized RSV G/f3-actin ratios. No significant difference was observed between non-trypsin pretreated HEp-2, A549, and MDCK cells (p=O.83 by ANOVA). Data shown are mean ± SE. * p Significantly different A549, MDCK, CHO-Ki or pgsA-745 (p <0.05) 85 4.1.2 Glycosidases The surface of live HEp-2 cells was treated with glycosidases from Enzymatic Protein Deglycosylation Kit (Sigma) to determine the effect of the enzymes on known surface glycoproteins (i.e., purified EGFR and DAF). The amount of enzymes used for about 8 x cells could completely deglycosylate control proteins of membrane proteins prepared from 3 x 106HEp-2 cells (Figure 6). After incubation at 37°C for 1 h, cells were used for Western blot sample preparation to determine the effect of the enzymes on control surface glycoproteins. Figure 7 shows that cell surface enzyme treatment did not affect the glycosylation of either membrane-associated EGFR or DAF. Comparison of results of Figure 6 and Figure 7 shows that the glycosidase treatments were effective on purified EGFR and DAF (proof of enzymes being active) but not on the surface of live intact cells. Therefore, experiments designed to specifically examine the effects of glycosidases on cell surface receptors for RSV were not pursued further. 4.1.3 P1-PLC Cells were pretreated with PT-PLCand the effect of this enzyme on cell surface DAF, a GPT anchored protein, was studied by flow cytometry. Figure 8 shows that PT-PLC cell surface pretreatment resulted in dissociation of more than 50% of DAF. The next experiment studied the effect of PT-PLCon RSV infection. As shown in Figure 9, cell surface pretreatment with PT-PLCdid not affect the level of RSV infection in HEp-2 cells (p = 0.98), consistent with the RSV receptor not being GPT-anchored. 86 EGFR DAF Figure 6. Effect of membrane protein enzyme treatment on EGFR and DAF. Samples were hiotinylated cell surface membrane proteins prepared from HEp-2 cells and then enzyme-treated as follows: Lane 1, Non-treated control not incubated at 37°C (used immediately after thawing); Lane 2, Non-treated control incubated at 37°C as enzyme treated ones; Lane 3, PNGase F; Lane 4, ft-2(3,6,8,9) Neuraminidase; Lane 5, cL-2(3,6,8,9)Neuraminidase and 0- glycosidase, Lane 6, papain; Lane 7, chymotrypsin; Lane 8, trypsin. Note the effect of PNGase F on EGFR, a heavily N-glycosylated protein and DAF, a less N-glycosylated protein (Lane 3) which has resulted in a faster electrophoretic mobility due to decrease in molecular weight of EGFR. Also note the effect of -2(3,6,8,9) Neuraminidase and 0-glycosidase on DAF, a sialated and 0-glycosylated protein (Lanes 4 and 5, respectively) resulting in a faster electrophoretic mobility due to decrease in molecular weight of DAF. Lanes 6-8 did not show any signals, indicating complete digestion of the proteins by proteases used. 87 1 2 3 4 EGFR —- _j_ DAF— Figure 7. Effect of cell surface glycosidase treatment on EGFR and DAF of intact cells. Samples were prepared from cell lysates of glycosidase-treated HEp-2 cells. Lanes are as follows Lane 1, Non-treated control; Lane 2, PNGase F; Lane 3, cL-2(3,6,8,9)Neuraminidase; Lane 4, 9CL-2(3,6,8, Neuraminidase and 0-glycosidase. No apparent differences in the size of EGFR and) DAF were visible upon enzyme treatments, indicating the enzymes not being effective on intact cells. 88 ______ 1747- ,, 1310 - Non-treated isotope 873 - R4 match C’ 4 0- iU: 10 .102 i0 10 Flit Log PT-PLCpretreated - labeled with anti-DAF - antibody - — I I 10 10’ 102 10 10 FITCLog 1125 Non-treated labeled with anti-DAF antibody C’ 375. 11 I 0 I 02 I o 1] FITCLog Figure 8. Flow cytometry of DAF to study the effect of PT-PLCtreatment on intact cells. Note the shift of the peak from right to left with PT-PLC pretreatment (comparing bottom histogram with middle one), indicative of PT-PLCcell surface pretreatment resulting in DAF (a GPT-anchoredprotein) dissociation from the cell surface. As >50% of DAF was dissociated, the results indicate the enzyme being active on the surface of intact cells. 89 7 * a, a, -J 03LL 0 o -PIPLC-RSV -PI-PLC-i-RSV ÷PIPLC÷RSV 98*p=o. Figure 9. Effect of P1-PLC cell surface pretreatment on RSV infection. Results were obtained from the tiow cytometry technique and in duplicate. Note the similar percentages of fluorescent-labelled RSV positive cells between the enzyme non-treated and enzyme-treated groups. Data shown are mean ± SE. 90 4.2 Virus-Receptor Co-Inununoprecipitation The rationale for these experiments was to use RSV virions as “bait” and co-immunoprecipitate candidate protein (or partially protein) receptor(s) (“prey”) by antibodies against RSV. To validate this approach of virus-receptor co-immunoprecipation, experiments were first performed using CVB3 and its known receptor (CAR), with results described below. 4.2.1 Immunoprecipitation of CVB3 Using Anti-enterovirus VP1 The commercially available anti-CVB3 antibody (anti-enterovirus VP 1) suitable for Western blotting was tested for its capability to immunoprecipitate the virus from CVB3 stock preparations. Five ig of either anti-enterovirus VP1 or mouse IgG was used to immunoprecipitate the virus and the success of such precipitation was tested by Western blot. Figure 10 shows successful immunoprecipitation of the coxsackievirus VP-i protein at a molecular weight of 33 kDa. To test for the possibility of whole virion immunoprecipitation, Western blot using another antibody, anti-CVB3 2A, a gift from Dr. K.U. Knowlton (Department of Medicine, University of California, San Diego, CA) was performed but this was not successful (not shown). Moreover, samples were prepared for MS analysis but the amount of protein was insufficient for detection of virus-specific proteins by MS. Despite not knowing definitively whether whole CVB3 vinons were immunoprecipitated using anti-VP1 antibody, we went on to study whether CAR could be co-immunoprecipitated using CVB3 as bait. 4.2.2 Co-immunoprecipitation of CAR Using CVB3 as Bait CVB3 viruses were bound and crosslinked to HeLa cells and the cells were lysed using a lysis buffer (MOSLB) containing 0.1% Triton X-l00. Co-immunoprecipitation of CAR was assessed 91 +ve IP -ye 55 kDa 33 kDa 25 kDa— Figure 10. Successful CVB3 VP-i (33 kDa) immunoprecipitation and Western blotting. Lanes are as follows: +ve, whole cell lysate 48 h after CVB3 infection; IP, successful immunoprecipitation of VP-i (33 kDa band) from 108 PFU CVB3 stock using anti-enterovirus VP-i antibody; -ye, control for IP using mouse lgG and 108PFU CVB3 stock. The 55 and 25 kDa bands are consistent with the molecular weight of immunoglobulin heavy chain and light chain, respectively and the band just under the 55 kDa one was considered non-specific antibody binding. 92 using Western blot. Figure 11 shows successful co-immunoprecipitation of CAR using anti enterovirus VP1 antibody. 4.2.3 Co-immunoprecipitation of an Unknown Receptor Using RSV as Bait Using exactly the same method as the one used for co-immunoprecipitation of CAR by anti enterovirus VP 1, co-immunoprecipitation of RSV receptor(s) using RSV as bait was attempted. However, it was necessary to show that the anti-RSV antibodies were capable of whole virion immunoprecipitation. Using goat anti-RSV polyclonal antibody, RSV virions in RSV stocks were subjected to the immunoprecipitation procedure. The results shown in Figure 12 were obtained. The antibody was able to immunoprecipitate a protein of 33 kDa (the molecular weight of RSV P protein) and possibly a 45 kDa protein (the molecular weight of RSV N protein), but not the protein at 90 kDa (i.e., the RSV G protein), suggesting that the virus did not remain intact as a whole virion during the TPprocedure. 4.3 Purification of RSV F and G Proteins by Chromatography This method included several steps of protein purification using a chromatography technique. In the first step the sample prepared from RSV-infected HEp-2 cells was applied onto an ion exchange column, the HiTrapQ FF. Elution of RSV F protein was performed by increasing the salt concentration from 10 mM to 100 mM and subsequently elution of RSV G protein was performed by further increasing the salt concentration from 100 mM to 300 mM. A sample of each fraction was run on three identical gels for Coomassie blue staining and Western blotting for RSV F and G proteins. Figure 13 shows the result of this step of purification. As shown in 93 1 2 3 4 5 CVB3 + + + Figure 11. Western blot probing for CAR (46 kDa) after successful co-immunoprecipitation with anti-enterovirus VP1. Lane 1, whole cell lysate 48 h after CVB3 infection serving as positive control for CAR Western blotting; Lanes 2 and 3, CVB3-bound cells after IP with anti-enterovirus VP1 and mouse IgG, respectively; Lanes 4 and 5, uninfected cells after IP with anti-enterovirus VP1 and mouse IgG, respectively. Note the signal consistent with 46 kDa molecular weight visualized in Lane 2 (arrow) but not Lanes 3-5, indicating VP1 protein of CVB3 co-immunoprecipitating CAR. The 55 and 25 kDa bands are consistent with the molecular weight of immunoglobulin heavy chain and light chain, respectively. All other bands are considered to reflect non-specific binding. 94 1 2 3 4 -90 kDa 55 kDa - -45 kDa -33 kDa 25 kDa Figure 12. Immunoprecipitation of RSV proteins using goat anti-RSV polyclonal antibody. Arrows show the precipitated proteins. Lane 1, cross-linked HEp-2 cells post-RSV attachment (5 tg goat anti-RSV polyclonal antibodies used for IP); Lane 2, cross-linked HEp-2 cells post RSV attachment, (5 tg normal goat serum used for IP); Lane 3, cross-linked non-infected HEp 2 cells (5 jig goat anti-RSV polyclonal antibodies used for IP). Lane 4, positive control for RSV Western blotting (whole cell lysate prepared 48h post infection, from RSV-infected HEp-2 cells). The 33, 45, and 90 kDa bands in Lane 4 are consistent with molecular weights of RSV P, N, and G protein respectively. The 55 and 25 kDa bands are consistent with the molecular weight of immunoglobulin heavy chain and light chain, respectively. All other bands in Lane 1 are considered to reflect non-specific binding as they are also visualized in Lane 2. The long arrow shows a definite immunoprecipitation of 33 kDa P protein; however, given the appearance of a band at about 45 kDa in Lane 2, the short arrow is possibly pointing to RSV N protein. 95 S’sI + 1 2 3 4 5 6 7 8 9 10 FT 181.8 lcD 115.5kD- 82.2 lcD 64.2kD- 37.1 kD t. 25.9 lcD- 4 19.4kD- 1 Figure 13. Coomassie Blue image of samples prepared from first step of chromatography. Samples of eluted proteins in each fraction are visualized by gel electrophoresis followed by Coomassie blue staining. SM, size marker (BenchMark); +, RSV infected HEp-2 cells before first step of chromatography; -, non-infected HEp-2 cells; Fractions 1-4 were eluted by MT-100 and fractions 5-10 were eluted by MT-300; FT, flow through. 96 Figure 14 and Figure 15, fractions 2-4 contained F protein and relatively low amounts of G protein and fractions 6 and 7 contained G protein with non-detectable F protein. Further enrichment was performed using an affinity chromatography, the Lentil-Lectin column. Fractions rich in either RSV F or G protein were pooled and applied on to the Lentil-Lectin columns. A sample from each fraction was collected for further analysis. Western blotting for RSV F and G proteins and Coomassie blue staining of the gel of corresponding fractions were performed to identify fractions containing pure proteins (Figure 16). Detection of RSV F monomer (70 kDa) and dimer (140 kDa) is consistent with results of previous .72reports’ For RSV F protein fractions 2-11 and for RSV G protein fractions 20-28 were pooled, concentrated and stored. When attempting to estimate protein concentrations by comparing with BSA solution on Coomassie stained gels, no band was observed. Considering the sensitivity of Coomassie Blue R (Sigma) being at the level of 50 ng loaded 73protein’ 30 pL of the loaded purified protein contained less than this amount. As mentioned, in the Methods chapter (subsection 3.17.6) the yield was 800 giL;therefore, the amount of purified protein was less than 1.33 tg. Compared to immunoprecipitation reactions in which each reaction would need about 5 i’g antibody in 5-50 1iL volume, the yields obtained were considered insufficient. 4.4 Cloning RSV F Protein In order to express and tag either RSV F protein (excluding its signal peptide or the extracellular part of RSV F protein including its signal peptide), two expression vectors, PCR3TMFC, which would tag the expressed protein to Fc region of human IgG,, and pcDNA3.11V5-His TOPO TA Cloning®,which would fuse the protein to V5 epitope and polyhistidine tag, were used. The 97 RSVF-’ Figure 14. RSV F Western blot on fractions obtained from first step of chromatography. Lanes are as follows: +, RSV infected HEp-2 cells before first step of chromatography; -, non infected HEp-2 cells; Fractions 1-4 were eluted by MT-100 and fractions 5-10 were eluted by MT-300; FT, flow through. Fractions 2-5 contained F protein. The band under RSV F signal which is visualized in both + and — lanes was considered to represent non-specific binding. 98 + — 1 2 3 4 5 6 7 8 9 10 FT RSV G — Figure 15. RSV G Western blot on fractions obtained from first step of chromatography. Lanes are as follows: +, RSV infected HEp-2 cells before first step of chromatography; -, non infected HEp-2 cells; Fractions 1-4 were eluted by MT-100 and fractions 5-10 were eluted by MT-300; FT, flow through. Blots were probed with goat anti-RSV polyclonal antibody and fractions 5-7 contain the most amount of RSV G, but Fraction 5 also contains RSV F protein (see Figure 14). 99 + - 2 4 7 9 11 13 16 18 20 23 25 28 RSV F dimer RSV G RSV F monomer- Figure 16. Western blot on fractions obtained from second step of chromatography, a further protein enrichment using Lentil-Lectin chromatography. Fractions rich in either RSV F or G protein were pooled and applied on to the Lentil-Lectin columns. A sample from each fraction was collected for RSV F and G proteins Western blotting. The membrane was probed with goat anti-RSV polyclonal antibody. Fractions 2-11 are enriched in RSV F and Fractions 23-28 are enriched in RSV G protein. +, RSV infected HEp-2 cells; -, non-infected HEp-2 cells; numbers above lanes indicate the fractions that were obtained during chromatography. 100 cloning vector PGEMTM3ZRSVF containing RSV F strain A2 protein was grown, purified, and restriction digested to obtain the RSV F protein template for subsequent polymerase chain reactions. Insertion of RSV F protein (either excluding its signal peptide or extracellular part of RSV F protein including its signal peptide) in PCR3TMFC was not successful. Using different cells (DH5cL,One Shot ToplOF’, MAX Efficacy Stbl2, HB1O1), lower temperature (30°C) for growing cells, TA cloning of the PCR products when applicable, and using phosphatase to dephosphorylate 5’—endof linearized vector DNA prior to insert ligation did not result in success in making the desired constructs. On the other hand, although insertion of RSV F protein (either excluding its signal peptide or extracellular part of RSV F protein including its signal peptide) in pcDNA3. 1/V5-His TOPO TA Cloning® was possible, transfection of the construct in either 293FT or HeLa cells never resulted in expression of the protein. The grown vectors and constructs were sent to NAPS unit at UBC for sequencing. Reported sequences of grown and purified PCR3TMFC vector and constructs including pcDNA3.l/V5-His TOPO TA Cloning®vector and RSV F protein (either excluding its signal peptide or extracellular part of RSV F protein including its signal peptide) inserts are shown in Appendix C. Taken together, the RSV F protein gene construct was successfully located within the cloning vector, but attempts to obtain the protein product from this were unsuccessful. 4.5 VOPBA and In-Gel Chemiluminescent Detection In VOPBA, a sample containing the virus receptor undergoes gel electrophoresis and the separated proteins are blotted on a membrane and the membrane is overlaid with the .19virus If the receptor activity is expressed by a single polypeptide which also maintains its binding 101 activity in detergent, the virus will bind to the 19receptor To identify the receptor, in-gel VOPBA, in which the separated proteins are fixed in. the gel and then the gel (not the membrane) is overlaid with the virus seemed a novel approach that would potentially save a number of steps. For in-gel VOPBA, the protein would be located in the gel, excised and sent for analysis by MS. To test the ability of the in-gel protein identification method, detection of transferrin, a highly abundant protein in serum 174, using anti-transferrin antibodies was first attempted. The sensitivity of the test was compared to Western blot using a similar gel. Figure 17 shows that transferrin could be detected at 10 dilution on Western blot and at 10 dilution by in-gel detection. Considering the normal range 180-320 mgldL of transferrin in 75plasma’ detecting transferrin at i0 dilution of plasma (i.e., 180-320 pg when 10 1iL is loaded per well) and at 3i0 dilution of plasma (i.e., 18-32 ng when 10 jiL is loaded per well) by Western blot and in-gel chemiluminescent detection, respectively is comparable to detection range claimed by the 7677company’ The visualized in-gel transferrin bands from reduced and non-reduced gels (with ”the reduced samples having a slower electrophoretic mobility than the non-reduced ones) were cut. and sent for MS analysis and transferrin was reported as a protein “hit” in both samples Appendix D, Attempts to detect the transferrin receptor in samples prepared from cell membranes, using pure transferrin as bait and anti-transferrin antibodies, as well as in-gel VOPBA of RSV were unsuccessful (not shown). Since protein-protein binding in a detergent-free condition would be more representative of that which occurs in nature, native electrophoresis of membrane proteins (i.e., non-reducing conditions) was tried but this also failed. Even adding detergents that have been reported to maintain the native status of the membrane proteins (such as octyl D-glucoside and triton-X 100)178 before loading the samples, did not facilitate the procedure. 102 82.2 kDa 82.2 kDa Figure 17. Western blot and in-gel protein detection for transferrin. Top: Western blot of transferrin using a serially-diluted plasma sample; bottom: in-gel transferrin detection using the same materials as the Western blot except the gel was not blotted on membrane and was directly used. SM, size marker (BenchMark); transferrin signal located at 82 kDa. All samples were non-reduced, except the three samples run at the right side of the gel. Reduced samples had slower electrophoretic mobility than the non-reduced ones. Note that the sensitivity of in-gel transferrin detection is about 100 times less than that of Western blot method, since transferrin signal was detected at a maximal dilution of 3i0 by the in-gel method and at a maximal dilution I0’ by Western blot. 103 Consequently, the next experiment attempted was to do RSV VOPBA on a blotted membrane, followed by overlaying the blot on an identical gel, cutting the band from the gel and sending it for MS analysis. The validity of this method was first investigated by using AdV5-gfp with its known receptors, integrin beta-i (—115kDa) and CAR (—46kDa). Figure 18 shows the results of AdV5-gfp VOPBA. In surface biotinylated membrane proteins prepared from HEp-2 cells, a signal at —46kDa was visible but was not observed in A549 or CHOK1 cells. By contrast, all cell lines showed at least one signal —115kDa. Samples were prepared from HEp-2 cell signals at 115 kDa and 46 kDa and sent to UVic—GBCProteomics Centre for MS analysis. As shown in Appendix D and as expected, MS analysis of the sample from the 115 kDa band showed integrin-beta 1 as a protein “hit”. However, unexpectedly, CAR was not among the protein hits of the 46 kDa sample. Subsequently, running a longer gel for further protein separation and for a longer time prior to excising the band for MS analysis did not lead to CAR identification. As an alternative approach to test whether the 46 kD signal from VOPBA could be CAR, on the same membrane that sample was blotted for VOPBA an identical sample underwent CAR Western blotting with anti-CAR antibody. The membrane of identical blotted samples was cut and each piece underwent the designated procedure. The membranes were placed side by side the way they were before (uncut) and the signals produced by AdV5 VOPBA and CAR Western blot were exactly at the same location (Figure 19), confirming the ability of Western blot to detect CAR in the AdV5 VOPBA system. The next step was to do VOPBA for RSV. Three different protocols for preparations cell membrane proteins were used. As shown in Figure 20, the biotinylated cell surface membrane proteins gave an intense signal at —100kDa and was also seen in samples prepared from cell surface membrane proteins and crude membrane proteins. The signal at 100 kDa was consistently observed in repeated experiments and was common among different cell lines from 104 SM1 2 3 SM -.115 kDa -.46 kDa Figure 18. AdV5-gfp VOPBA. Figure shows half of the loaded gel. The other half was loaded symmetrically, fixed and kept at 4°C for subsequent MS analysis. Lanes are as follows: SM, size marker (BenchMark); Lane 1,CR0-K 1 cells; Lane 2, A549 cells; Lane 3, HEp-2 cells. Size marker had non-specific bindings with virus and/or reagents used; however, the standard bands were visualized on picture taken under white light (not shown) and used for protein size determination. The band at -.46 kDa visualized in Lane 3 is consistent with molecular weight of CAR, a receptor for AdV5. This hand was not visualized in Lane 1 (consistent with CHO-Ki lacking CAR protein) but its absence in A549 cells was not expected. For HEp-2 cells, bands seen in the region 115 kDa were pooled when submitting samples for MS analysis. 105 AdV5-gfp VOPBA Figure 19. Comparison of CAR Western blot (left) and AdV5-gfp VOPBA (right). Figure shows that the signals obtained are localized on the same part of the gel (arrow). 106 1 2 3 SM -100 kDa -8OkDa -60 kDa -50 kDa -40 kDa -3OkDa -20 kDa Figure 20. Comparison of different sample preparations in RSV VOPBA. Lane 1, 10 p.L cell surface biotinylated membrane preparation; Lane 2, 30 iL “crude” membrane preparation; Lane 3, 30 1iL “enriched” cell surface preparation; SM, size marker (MagicMark). Note the —100kDa band (arrow) that is most intense in Lane 1 than in Lanes 2 or 3. Lane 2 contained additional bands at lower molecular weights which due to containing cell membranes other than plasma membrane were consistent with non-specific binding to cell organdies. Bands of lower molecular weight than the —-100kDa band were not consistently visualized during repeat experiments. 107 different species (Figure 21). Several other signals including one -.10-15 kDa, one -.30 kDa, and one below the 100 kDa band were not observed consistently. Although samples from -.10- 15 kDa and -.30 kDa location obtained from HEp-2 cells and MDCK were sent for MS analysis, no cell surface protein was reported as a “hit” in the results. There were two types of negative controls for VOPBA. In the first control, one membrane was overlaid without virus but with anti-virus antibodies; in the second control, one membrane was overlaid with virus but without anti-virus antibodies. Both negative controls were overlaid with the secondary antibody which was conjugated to HRP. No signal was observed in the negative controls (Figure 22), indicating the specificity of RSV-lOOkDa protein binding by VOPBA.The 100 kDa band from HEp-2, 1HAE, and MDCK was sent for MS analysis to UVic—GBCProteomics Centre. Results are shown in Appendix D. To confirm results, samples from HEp-2 and pgsA-745 were prepared in another experiment and also sent for MS analysis. As shown in Appendix D, Nucleolin was the only membrane protein reported as a protein “hit” in all cell lines tested. Table 5 shows the percent of sequence coverage and scores as non-probabilistic bases for ranking protein hits highlited in Appendix D. 4.6 Membrane Protein Enzyme Treatment To further elucidate the chemical nature of the protein to which RSV was bound to in VOPBA, biotinylated cell surface membrane proteins were treated with different proteases and glycosidases. 108 pgsA-749 CR0-K 1 MDCK HEp-2 1HAE -100 kDa Figure 21. RSV VOPBA using different cell lines prepared from biotinylated cell surface proteins. Note the 100 kDa band (arrow) visible in all cell lines examined. Lower molecular weight bands did not appear reproducibly in repeated experiments. 109 100 kDa RSV + + - Primary antibody + - + Secondary antibody + + - Figure 22. Controls for RSV VOPBA. Biotinylated cell surface membrane proteins from HEp-2 cells were used to prepare this image. Note that only the conditions that included the combination of RSV, primary and secondary antibodies yielded a signal at 100 kDa. 110 Table 5. Protein Identification, Score and Overall Coverage of Protein Hits Reported by MS and Highlighted in Appendix D Protein ID Sample Protein name Score* Sequence (ncbr) Coverage (%) TFHUP Human plasma transferrin precursor 24l 10 (non-reduced) TFHUP Human plasma transferrin precursor l59 8 (reduced) 1P100217561 HEp-2 isoform 13-iCof integrin beta-i 84 2 precursor 1P100604620 HEp-2 nucleolin 452 14 A35804 HEp-2 nucleolin 843 24 ]P100604620 1HAE nucleolin 245 16 NP 005372 MDCK nucleolin l6l 15 A27441 pgsA-745 nucleolin 767 20 * Probability Based Mowse Score tScores > 52 indicate identity or extensive homology (p Scores > 36 indicate identity or extensive homology (p iii Enzymes used included: Proteases (Trypsin, cL-chymotrypsin,and papain) and glycosidases (PNGase F, x-2(3, 6, 8, and 9) Neuraminidase, and 0-Glycosidase). The efficiency of enzymes was tested by Western blot. Enzyme-treated membrane proteins underwent SDS-PAGE, blotted onto membranes, and probed to detect DAF (recall that as shown in Figure 6, all enzymes affected purified EGFR and DAF, as expected). The proteases digested EGFR and DAF as evidenced by no signal observation and the glycosidases resulted in removing N-glycosylated sugars (by PNGase F), sialic acid (by cL-2(3,6, 8, and 9) Neuraminidase) and 0-glycosylated sugars (by 0-Glycosidase) from these proteins as evidenced by their smaller molecular weight. The enzyme-treated membrane proteins were then used for RSV VOPBA. The 100 kDa signal obtained from VOPBA vanished after protease treatments and was not affected by glycosidases, indicating that RSV was binding to a nonglycosylated protein (Figure 23). 4.7 Further Localization of the 100 kiJa RSV VOPBA Signal In order to further localize the 100 kDa signal observed in RSV VOPBA, HEp-2 cell proteins underwent subcellular fractionation. Caveolin-rich membrane preparations were obtained and underwent RSV VOPBA. Figure 24 shows that the 100 kDa signal obtained in RSV VOPBA was not colocalized with the fractions that were enriched for caveolin or flotillin. 4.8 Antibody Blocking Experiments To confirm specificity of RSV-nucleolin binding, HEp-2 cells were treated with anti-nucleolin (C23) antibodies or similar concentrations of an isotype-matched negative control, and then 112 exposed to rrRSV-BN1 or AdV5-gfp. After 24 h, samples were prepared for flow cytometry. The effect of antibody treatment on viral infection was calculated as percent neutralization. 113 100kDa Figure 23. Effect of enzyme treatment on RSV VOPBA on biotinylated cell surface membrane proteins. Lane 1, Non-treated control, not incubated at 37°C (i.e., used immediately after thawing); Lane 2, Non-treated control incubated at 37°C, same as enzyme-treated samples; Lane 3, PNGase F; Lane 4, cL-2(3,6,8,9)Neuraminidase; Lane 5, cL-2(3,6,8,9)Neuraminidase and 0-glycosidase, Lane 6, papain; Lane 7, chymotrypsin; Lane 8, trypsin. Note the 100 kDa and a closely-spaced lower molecular weight band which were not affected by glycosidase treatments (Lanes 3-5) and not present after protease treatments (Lanes 6-8), indicating the molecule(s) RSV is binding to on the membrane is probably a non-glycosylated protein. 114 Flotillin Caveolin— 100 kDa Figure 24. HEp-2 cell subfractionation using sucrose gradient. Lanes 1-9 are representative of fractions 4-12 obtained by taking 1 mL volumes from the top of the sucrose gradient. Fractions 1-3 did not contain protein and are not shown. Fraction 5 (Lane 2) has the highest concentration of flotillin (top) and caveolin (middle). RSV VOPBA (bottom) shows that the 100 kDa signal (Lanes 6-9) is not colocalized with the lanes showing the highest concentrations of caveolin or fiotillin. This fractionation only enriched caveolin and flotillin in Lanes 1-3 (Fractions 4-6, considered as lipid raft localization), although flotillin and caveolin signals are not completely absent from other lanes. 115 Figure 25 shows the results of an experiment examining the effect of 4 ig/mL of antibodies on significantly decreasing RSV infection. Figure 26 shows that a higher concentration of anti nucleolin antibody (20 .tg/mL) significantly blocked RSV infection, but not AdV5 infection. The specificity of the anti-nucleolin antibody used was confirmed by Western blot on purified nucleolin and results shown in Figure 27. 4.9 Competiton Experiment: RSV Infection in the Presence of Purified Nucleolin This competition experiment was also performed to further confirm the specificity of RSV nucleolin binding. Different concentrations of purified nucleolin (or purified transferrin, as a negative control protein) were incubated with rrRSV-BN1 or AdV5-gfp. The viruses were then used for infecting 80% confluent HEp-2 monolayers. The infectivity at 24 h was quantified by flow cytometry and calculated as infectious units per mL (IU/mL). The results are shown in Figure 28 and indicated a dose-dependent decrease in RSV infection of HEp-2 cells after incubation of virus with purified nucleolin (p 116 _ 80 70 60 2 50 I i; 40 C 30 * o 20 anti-nucleolin rabbit IgG *p Figure 25. Effect of 4 ag/ mL anti-nucleolin antibody on RSV replication. Note the significantly greater percent of RSV neutralization with anti-nucleolin antibody pre treatment of HEp-2 cells in comparison to cells pre-treated with similar concentration of an isotype-matched, irrelevant antibody. Results are obtained from two independent experiments, each done in triplicate. Data shown are mean ± SE. 117 100 * 80 60 N 40 z 0 20 0 AdV’b nantbody AdV5 anti-nucleolin RSV no antibody RSV anb-nucleolin -20 * Significantly different from other groups (p < 0.001) Figure 26. Effect of 20 ig/mL anti-nucleolin antibodies on RSV and AdV5 replication. Antibody-associated neutralization was observed only for RSV and not for AdV5 infection. Data shown are mean ± SE. 118 100 kDa Figure 27. Western blot for nucleolin using rabbit polyclonal anti-nucleolin antibodies. Lane 1, 5 ng pure nucleolin; Lane 2, biotinylated cell surface membrane proteins obtained from HEp-2 cells. Note the specificity of the antibodies for detecting purified nucleolin. 119 1.1 E+07 y=-62815x+9E+06 1.0E+07 = 0.81 9.OEi.06 -J . 8.OE+06 7.OE+06 .O 1.06÷07 y = -3824x + 8E÷06 9.OE+06 = 0.06 8,00+06 -J 7.06÷06 .2 g 6.OE-,06 5.OE÷06 4.OE÷06 3.OE+06 6P° 2.00+06 1.00+06 0 20 40 60 80 100 Nucleolin concentration (nM) 2.56+06 y = -1340.lx + 2E+06 2R = 0.0428 2.06+06 -I S 1.55+06 . C • —a za, .2 1.00+06 ts a, p=o. 5.00+05 5 0.06+00 0 20 40 60 80 100 rransterrIn concentration (nM) Figure 28. Effect of incubation of RSV with purified nucleolin on subsequent virus replication. Incubation of RSV with pure nucleolin (top) resulted in decreased infection in a dose-dependent manner. This effect was not observed when AdV5 was incubated with similar concentrations of purified nucleolin (middle), or when RSV was incubated with similar concentrations of purified transferrin (bottom). 120 5 DISCUSSION The goal of this thesis was to identify and characterize candidate cell surface receptor(s) for subgroup A human RSV. RSV is an important pathogen, especially in 79children’ 80elderly’ and immunocompromised 81adults’ Despite RSV being discovered decades, ’7778ago there, is still no good treatment or prevention. for RSV disease and the receptor for RSV is, not known. There are many reasons why it is important to know the identity and characteristics of virus receptors, including better opportunities for understanding the pathogenesis of the viral disease and potential for discovering antiviral agents. With advances in biochemical and molecular genetic approaches, including proteomics and bioinformatics that enable unbiased interrogation of biological systems, there are new opportunities to explore candidate receptors for RSV and characterize their functional properties. Co-immunoprecipitation of RSV receptor using whole virion, and purification of RSV surface proteins (either by chromatography or by cloning), were methods that were initially applied in this thesis project to discover a candidate RSV receptor, but were unsuccessful. However, VOPBA combined with MS resulted in the identification of nucleolin as a candidate receptor. Further antibody blocking and protein incubation (competition) studies provided evidence supporting the possibility that nucleolin has properties of an RSV receptor in cultured cells. 5.1 General Characteristics of RSV Receptor Considering the diversity of membrane constituents capable of acting as viral 29receptors the first step used in this project was to determine the chemical nature of the RSV, cell surface binding molecule(s), avoiding as much as possible preconceived bias as to what these surface 121 moieties could be. Hence, the host cell surface was treated with different enzymes chosen to target fundamental cell membrane constituents, including proteins, carbohydrates and lipids. The panel of enzymes used included a protease (trypsin), glycosidases, and a phospholipase (PT PLC) and the effect of such treatments on RSV infection was studied. 5.1.1 Protein Digestion Results obtained from trypsin treatment of the cell surface of five different cell lines (HEp-2, A549, MDCK, CHO-Ki, pgsA-745) from three species (human, dog, hamster) showed that the RSV receptor is a protein, or has a protein component. Importantly, the difference in the quantity of RSV infection observed between hamster cell lines (CHO-Ki and pgsA-745) and other species (Figure 4) could be attributed to either susceptibility or permissiveness to the virus because the read-outs used in enzyme digestion experiments consisted of levels of viral replication at 24 h post-exposure, which reflects the totality of a number of events of virus-host cell interaction, including viral binding and entry into cells and subsequent life cycle kinetics. Attempts to complete direct binding studies for RSV have proven difficult and most assays assess viral binding indirectly, by evaluating infection 182 Some major reasons for the difficulties encountered in RSV direct binding studies are poor viral yields in cell culture, and physical instability of the 83virion’ resulting in difficulties to label the virus either chemically (e.g., biotinylation) or radioactively. Martinez and ’2Melero’ reported a quantitative assay for studying RSV binding to the cell surface using a flow cytometry technique in which they labeled cells bound to RSV by a “homebrew” monoclonal anti-G antibody (021/19G). In this project, using the available anti-RSV antibodies, exact replication of their method was not possible. Assays to provide a direct measure of binding, independent of later steps during infection, are still being 82developed’ Given these caveats, the lower amount of RSV infection . 122 observed in pgsA-745 than in CHO-Ki is considered to be the result of lack of xylosyltransferase I (and hence GAGs deficiency) in pgsA-745 ’1184cells 85, since these two cell lines had otherwise similar properties. RSV infection being affected by trypsin treatment was also consistent with results of a previous study which showed reduced RSV binding and infection almost to background .121levels 5.1.2 Carbohydrate Digestion The cell surface was also treated with glycosidases but since the control membrane glycoproteins (DAF and EGFR) were not changed by such treatments (indicating these enzymes were not effective on the surface of live cells), no further experiments were performed to observe the effect of glycosidases on RSV infection. Borrow and Oldstone used cell surface enzyme treatment to determine the chemical nature of LCMV binding 29protein(s) Using several proteases, glycosidases and phospholipases, these authors concluded. that the LCMV binding molecule was a 29glycoprotein However, cell surface treatment by glycosidases did not affect virus binding, yet affected results of VOPBA. Given these findings, the authors concluded that the LCMV receptor. was a glycoprotein, but that glycosylation was not involved in virus 29binding however, they did not exclude an alternative possibility of incomplete glycosylation ;occurring in their experimental system. On further scrutiny of their article, it is noteworthy that Borrow and Oldstone had chosen the concentration of the enzymes according to historical controls, in which the glycosidases used at the same concentration reduced virus 186, 187, 188 binding Overall, the authors did not have a parallel experimental control for glycosidase treatments (with the exception of neuraminidase, for which they observed removal of sialic acid from cells into the supernatant fluid after treatment). In a subsequent study, investigators from the same group reported that cL-dystroglycanwas the receptor for LCMV and 123 observed that the post-translational glycosylation of the N-terminal domain of the protein was critical for virus 8990binding’ Taken together, there is a possibility that had these investigators used a cell surface.” membrane glycoprotein such as EGFR and DAF as a control for the glycosidase treatment, they would have observed that the glycosidases at the concentrations used would not have affected the cell surface glycosylation at all. A previous study of treatment of HEp-2 cells with 60 mU/mL neuraminidase (0.012 times the concentration used in the current project), did not affect binding of RSV, or may have even increased it Complete removal of sialic acid after neuraminidase treatment was not established; however, the authors showed that binding of influenza virus (with sialic acid as its known receptor) was reduced to almost background levels under the same conditions, indicating that sialic acid is not essential for binding to cells of RSV HEp-2 2.ll Others have reported that tunicamycin (an N-glycosylation 9inhibitor’ which blocks the transfer of N-acetylglucosamine 1-phosphate to dolichol monophosphate’ during 21N-glycosylation’ used at concentration of 10 tg/mL for 24 h was not able to change RSV binding in HEp-2 cells’ indicating that the RSV binding protein is either not N-glycosylated; )the N-glycosylated 2’, part of the receptor is not involved in receptor binding; or the N-glycosylated protein has a long half-life’. The same study also showed that treatment of HEp-2 cells with monensin (which has a more general effect on protein glycosylation and vesicle trafficking by disruption of the Golgi apparatus, where trimming and modification of N-linked carbohydrates occurs and 0- To oxidize cell surface sialic acids, we did an exploratory experiment in which sodium periodate was used at a concentration which has reduced binding of other 29viruses However, results showed that since Western blot experiments using sialic acid binding lectins indicated that sodium periodate at the same concentration did not affect sialic acid binding to lectins, more experiments regarding RSV infection “ . were not done. To examine the effect of tunicamycin on RSV binding, we investigated the effect of the enzyme at a concentration which inhibited LCMV binding on VOPBA experiments (1 jtgImL) on N-glycosylation of EGFR in HEp-2 cells. According to Western blot results (not shown), this enzyme concentration did not affect EGFR N glycosylation after 28 h or 53 h. More work is needed in this regard. 124 glycosylation occurs) reduced human RSV, but not influenza virus, binding almost to background 121levels These findings suggested that cell surface 0-linked, but not N-linked, carbohydrates. are involved in human RSV 21binding’ However, the authors noted that the interpretation of the effect of monensin has to .be made cautiously because of the various effects of this compound on cell biology (section 5.1.1). 5.1.3 Lipid Digestion Results of pretreatment of HEp.-2 cells with P1-PLC and subsequent RSV infection indicated that the RSV binding molecule is probably not GPI-anchored. A satisfactory protocol for using other phospholipases (PLs) was not designed for this thesis due to difficulties in controlling for the efficiency of these enzymes on living cells. In order to control for these PLs, there was a possibility to perform a lipid extraction after cell surface enzyme treatment, followed by lipid composition analysis by high performance liquid chromatography (HPLC), or measuring the enzymatic products using biochemical assays (provided they were adequately sensitive) to detect the products generated. Given these multiple considerations related to technical feasibility, additional PLs were not used for cell surface enzyme treatment in the current thesis. Other investigators have examined the effects of cell surface treatment with several phospholipases (PLs) (including PLA2, PLC, and PLD) on LCMV binding but, similar to the glycosidase treatments described in section 5.1.2, these experiments lacked appropriate .29controls 125 co-immunoprecipitation immunoprecipitate preliminary immunoprecipitate to during 5.2.1 Due membrane combined due from precipitation identification Poor and proteomic make used is Overall, Receptors 5.2 be a viral Feasibility protein to to enriched toward the Immunoprecipitation solubility a the challenges glycosylation large the first envelope current studies protein with experiment or results achieving during to contribution and for a limited the in protein-containing of project. potential related studies proteins characterization the in of isoelectric second the existing Using performing requiring cell cell the using of sample to difficult whole Instead, CVB3 surface goal surface to (i.e., viral dimension cell Proteomics two CVB3, understanding Using focusing of which surface receptors. loading, a and in 2-DE the virion enzyme the virus dimensional wide of entity, practice’ 93 . RSV use receptor, goal current membrane would (SDS-PAGE) membrane (TEF, receptor(s). of pH make of using was In for treatments which Virion membrane of anti-enterovirus bind the range the project. CAR. Identification to virus-cell the gel first meant first obtain proteins anti-virus to proteins during According application of receptors)’ 92 . electrophoresis However, indicated set dimension Although proteins, 2-DE, that cellular of interactions, have (i.e., IEF, experiments, proteomics-related antibodies antibodies extreme that to attempts of protein where of this been use of low results Proteomics-based Candidate proteomics the 2-DE), of method (2-DE) technically protein there heterogeneity receptors RSV proteomics preparations resulted to efforts of in immunoprecipitate inefficient Western are binding was sample order copy approaches tools relatively were RSV would in challenging. not can successful efforts predicted in numbers, blot molecule could made to buffers, transfer applied charge reside) clearly in 126 few co for be to to a RSV as an intact virion failed, since results of Western blot, done on samples prepared from the whole virion and immunoprecipitation using anti-RSV antibodies, did not show the 90 kDa RSV G protein. Evidence of apparent partial success for the immunoprecipitation approach for RSV was manifested by detection of a 33 kDa protein, consistent with molecular weight of the viral phosphoprotein (P) and a 45 kDa protein, consistent with molecular weight of the viral major nucleocapsid protein (N). Bearing in mind that immunoprecipitation was performed in an environment containing detergent (0.1% Triton X-100) and given that CVB3 forms a detergent-stable complex with a 46-kDa HeLa cell surface protein 194 ,24 these conditions could explain the successful immunoprecipitation of CVB3 virion (a non-enveloped virus) and unsuccessful attempts at immunoprecipitation of RSV virion (an enveloped virus). Disintegration of RSV in Triton X 100 has been reported 95previously’ however, in that study, a higher concentration (10%) of Triton X-100 was used; to isolate the RSV glycoproteins and study their morphology. Dissociation of RSV virion has also been reported by another detergent, 1% .96SDS’ Nevertheless, even if the virion was disintegrated, the question remained as to why the RSV G protein was not detectable in solution. One possibility was that the RSV G protein binds to a molecule which is located in detergent-insoluble fraction of the cell. Since the detergent- insoluble fraction contains lipid rafts and cytoskeletal 97proteins’ RSV G may have been bound to either a protein located in the lipid raft domain, ,or associated with cytoskeletal proteins. Results of RSV VOPBA suggested that the molecule which RSV binds to on the membrane is not located in caveolin- or flotillin- (lipid raft markers) rich fractions. Even so, for several reasons, including the possibility of RSV possessing more than one receptor, or that RSV F protein might be the main viral attachment 90protein the results of this experiment do not , 127 completely exclude the existence of a receptor for RSV located within lipid raft microdomains. There is also the possibility that the main RSV attachment receptor is not located in the lipid raft under basal conditions but upon ligand binding, it is translocated to the lipid raft 198microdomain in order to prepare for entry into the cytoplasm. In cattle dendritic cells, co-localization of RSV antigen and caveolae has been reported by use of confocal microscopy, and an entry route mediated by caveolae has been reported as the major route for uptake of RSV antigen by these 99cells’ On the other hand, it has been reported that alterations in actin (a cytoskeletal protein) are. involved in RSV which suggests the possibility of the receptor existing as part of a 200entry complex with the cell,cytoskeleton. Immunoprecipitation of the whole RSV virion was attempted in detergent-free media but this approach was also unsuccessful. Whole virion immunoprecipitation in a detergent-free environment has been performed for a number of viruses including HIV- 1201, Newcastle disease 202virus and murine leukemia 203virus using antibodies to cellular proteins associated with the virions, or viral protein; however, none of these studies was designed to have co immunoprecipitation of a virus and its receptor. One reason for unsuccessful immunoprecipitation of whole RSV in the current study, even under detergent-free conditions, could be due to the instability and fragility of its 83204virions’ Although disintegration of RSV in one type of detergent at a certain concentration .’can occur, this does not necessarily imply that RSV would be dissociated in all type of detergents, or in more diluted Triton X-lOO. Nevertheless, given the large number and variety of detergents available and the time and expense that would have to be spent on searching for a suitable detergent at an appropriate concentration, this line of investigation was not pursued further. 128 5.2.2 Immunoprecipitation Using Purified RSV Proteins The next step was to purify RSV surface glycoproteins to use in co-immunoprecipitation of unknown receptor(s) from cell surface proteins. Two options were considered: (1) viral protein purification from RSV-infected host cells; (2) overexpression of recombinant viral protein. The former approach was attempted first because it appeared to be more straightforward, in that cloning and transfection techniques were not involved. It has been shown that RSV infectivity is sensitive to limited removal of N-linked and 0-linked oligosaccharides of the viral surface glycoproteins, F and .G95 Hence, it was desired to purify the proteins in their glycosylated form. Most of the published methods for RSV glycoproteins purification have used affinity chromatography with or without preparative SDS-PAGE, and these methods have several limitations, including low yield, damage to the purified proteins, and contamination with other viral or host 205206207components One attractive method for RSV protein purification using virus-infected cells was a three-step purification method published by Roder et .al.208 In this method, instead’ of using anti-RSV antibodies, the authors used ion exchange chromatography, followed by .affinity chromatography for glycoproteins using lentil lectins, and subsequently hydrophobic-interaction chromatography. Although the authors claimed the technique would provide a high yield of purified viral proteins, when essentially the same protocol was used in the current project, the yields obtained were not satisfactory. The reason for low yields in this thesis might be lack of experience with the technique to allow for successful adaptation and implementation in our research unit. 129 5.2.3 Production of Recombinant Epitope-tagged RSV F Protein Given the difficulties for purification of RSV glycoproteins, the project was led to another method for candidate receptor identification, consisting of using a “tagged” viral attachment protein to immunoprecipitate cell surface receptor(s). This method has been utilized for the discovery of ACE-2 as a receptor for 42SARS-CoV and ephrinB2 as a receptor for Nipah 43virus In . the SARS-CoV study, the authors tagged the C-terminus of the Si domain of the viral Spike (S) protein (which in all characterized coronaviruses mediate an initial high-affinity binding with their own 209210receptors 1) to the Fc domain of human IgG,. Using cell lysates prepared from metabolically-labeled’2 Vero E6 cells and protein A Sepharose, the C-terminally tagged form of the Si domain resulted in the immunoprecipitation of a protein band of molecular weight -410 kDa, which later was identified as ACE-2 by MS analysis. A similar method was used for identification of ephrinB2 as Nipah virus 43receptor The ectodomain of Nipah virus attachment (G) protein was tagged with the Fc domain. of human .1IgG By means of biotinylated cell surface membrane proteins and protein G-coupled magnetic beads, a 48 kDa protein was isolated and identified as EphrinB2 by MS analysis. In view of the comparatively simple and rapid nature of the experiment, combined with the fact that Nipah virus and RSV both belong to the same family of viruses (Paramyxoviridae), this method was attempted as the next step in the current project. Considering the results of previous studies that found RSV lacking the G protein being able to infect 212cells and also F2 subunit being identified as the determinant of RSV host cell specificity (indicating its role in binding to the main ),213receptor(s) attempts were made to produce a tagged F protein. Since the RSV F protein is a type I membrane 214protein (meaning that the N-terminus of the protein is located in its ),215ectodomain the tag was targeted to be 130 fused to the C-terminus of the protein. A vector containing the Fc domain of human 1IgG was obtained from Dr. Oscar Negrete, the first author of the study describing identification of the Nipah virus 43receptor In spite of many troubleshooting strategies, including using different cell types (DH5a,. One Shot ToplOF’, MAX Efficacy Stbl2, HB1O1), applying lower temperature (30°C) for growing cells, performing TA cloning of the PCR product, and using phosphatase to dephosphorylate 5’—endof linearized vector DNA prior to insert ligation, neither an F protein ectodomain nor an F protein lacking the signal peptide could be inserted into the vector. Signal peptides, usually (but not always) located at the N-terminal of a protein, play a key role in targeting membrane insertion of membrane 216proteins After membrane insertion, a membrane-bound signal peptidase can cleave the precursor. protein from the signal 216peptide Signal peptides might also be involved in folding, modification or oligomerization. of the translocated 216protein In a study on truncated mutants of bovine RSV (bRSV), Pastey and 217Samal reported. that the signal peptide, the F2 plus signal peptide domain, and the membrane anchor domain (but not the cytoplasmic domain) are important in transport of bRSV F protein to the cell surface. Moreover, human RSV F protein ectodomain expressed in recombinant vaccinia-infected cells appeared as secreted stable oligomers made of cone-shaped 218rods Hence, in this project it was expected that once expressed in mammalian cells, the construct. lacking the signal peptide would remain in the cytoplasm and the construct containing only the ectodomain would be secreted into the culture medium. Similar to membrane proteins of eukaryotic cells, outer membrane proteins of bacteria are often difficult to solubilize; however, in one study, a recombinant outer membrane protein lacking the region signal peptide domain was expressed and a functional protein was purified in high 219yields Importantly, deletion of the signal peptide does not always lead to production of a . 131 functional protein. For instance, a signal peptide was necessary for the full function of FliP, an inner membrane protein of E. .220co1i Insertion of RSV F protein (either the F protein ectodomain or the F protein excluding its signal peptide) into pcDNA3.1/V5-His TOPO TA Cloning®,a vector that would fuse the protein to V5 and a polyhistidine ’22tag was possible, but transfection of the construct in either 293FT or HeLa cells did not result in expression of the desired protein product. Despite being an area of interest (particularly in vaccine development), obtaining expression of a functional RSV F protein is still 222challenging Considering the importance of RSV surface protein glycosylation in early steps of 95infection expression of the recombinant glycoprotein in mammalian cells would be advantageous. Morton et al.224 designed constructs to express either the full length 223 , RSV F protein or a soluble RSV F ectodomain but the expression in transiently transfected 293 cells was .unsuccessful. They speculated that the reasons for such low expression were the presence of high percentage of rare codons in the RSV-F coding region, the existence of multiple poly-(A) addition sequences, and the presence of splice acceptor and donor sites within the coding region. Therefore, these investigators assembled an RSV F construct in which optimized codon usage (i.e., maximizing expression of a gene in an organism by making use of the codon according to the organism) was incorporated and potential polyadenylation sites (AATAAA) and splice sites were removed. Transient transfection of 293T cells with a plasmid expressing the optimized human RSV F led to RSV F production. Branigan et al.225 used the same method to synthesize human RSV F. They incorporated optimal codon usage for expression in mammalian cells and removed all potential polyadenylation (AATAAA) and splice donor (AGGT) sites. They used pcDNA 3.1 (Invitrogen) vector to clone the insert. Ternette et al.222 expressed RSV F protein by mutating two of polyadenylation sites in the RSV F open reading frame (ORF). They could even enhance the expression level by codon 132 optimization. Codon-usage effects were first found as a major obstacle to the efficient expression of HIV- 1 genes in mammalian cells and it has been proposed that poor expression of proteins in mammalian cells can benefit from codon usage 226optimization Expression of recombinant RSV F and G proteins has also. been tried in systems other than mammalian cells. Due to the absence of some glycosyl transferases, recombinant glycoproteins produced by the baculovirus-insect cell expression system usually do not have genuine glycosylations and considering the importance of the system for production of recombinant proteins, researchers are trying to overcome this 227limitation However, in a recent study using a baculovirus system, successful expression and glycosylation. of recombinant RSV F (RSV F2 subunit or RSV F lacking the transmembrane domain) glutathione-S-transferase (GST)-tagged protein in insect cells was 228reported The endogenous virus signal peptide was removed and replaced with a signal peptide. derived from a baculovirus 228glycoprotein Analysis using glycosidases showed that the recombinant proteins were modified by the addition of mature N- linked glycan 228chains Regarding the RSV G protein, although. it can be expressed using the Semliki forest.virus (SFV) in mammalian cells, the levels of expression are low and there are differences in glycosylation between the G glycoprotein expressed in RSV infected HEp-2 cells and the one expressed by SFV in BHK-21 .229cells 5.2.4 Summary: Immunoprecipitation Experiments To this point, none of the strategies applied for discovery of an RSV candidate receptor in this thesis was successful. Co-immunoprecipitation of the receptor using whole RSV virion as bait failed, possibly because of viral particle disintegration during the procedure. Purification of RSV surface glycoproteins from virus-infected cells did not result in sufficient yields, while 133 recombinant RSV F protein could not be expressed in mammalian cells. Although purified recombinant viral surface glycoproteins have contributed in finding cell surface receptors for some 4243viruses there are still some issues concerning RSV in particular. For example, there is a possibility’ that, similar to some other viruses (e.g., HIV-1 RSV uses more than one , ),230 attachment protein to attach and enter cells. Moreover, the viral attachment protein may need to be present in the context of the whole virion to have full function; in this case, results obtained from experiments using isolated viral proteins may not reflect virion-receptor 27interaction A recent study shows that RSV F and G glycoproteins interact to form a complex on. the surface of infected cells, suggesting the existence of multiple virus-glycoprotein complexes within the RSV envelope. However, given the RSV lacking G and/or SH protein can still enter 212cells there is still doubt over which RSV surface glycoprotein should be considered an attachment, protein; the G protein, which for many years was considered as the RSV attachment 20protein’ or the F protein. Given these profound limitations in our current understanding of RSV, biology, the project was directed toward experiments using the whole virion, whereby virus-receptor binding would occur irrespective of which viral surface protein(s) are involved in attachment. 5.3 VOPBA VOPBA is a method that has the advantage of using an intact virion; however, the technique is successful only if the receptor activity is expressed by a single polypeptide which also maintains its binding activity in 9detergent’ Theoretically, the best way for performing VOPBA would be on membrane proteins. kept in their native state and undergoing gel electrophoresis in non denaturing conditions; however, with the available tools and reagents, this is difficult to achieve in practice. Electrophoresis of cell membrane proteins under non-denaturing conditions was attempted in the current project but was unsuccessful. Since VOPBA cannot identify a protein 134 per se and a detected band on the membrane needs to be localized on the gel for further analysis, attempts were made to perform the VOPBA in-gel (i.e., without blotting onto membranes). As a preliminary experiment, in-gel protein detection for an abundant plasma protein (transferrin) using its antibodies and a commercially available In-Gel Chemiluminescent Detection kit was done. Considering the normal range (180-320 75mgldL’ of transferrin concentration in plasma, 18-32 ng of the protein was detectable, comparable) to the range of detection claimed by the 231manufacturer As shown in the Results Section (Figure 17), reduced transferrin migrated more slowly through the gel than did non-reduced protein. The reason for this could be that intact. disulfide bonds in non-reducing conditions kept the transferrin molecule in a more compact state, thereby allowing for faster electrophoretic 232mobility However, several attempts to detect the transferrin receptor (a cell surface protein). in the cell lysate using purified ligand (transferrin) as bait and anti-transferrin antibodies, failed. The in-gel VOPBA for RSV also did not work, possibly because of a low abundance of virus receptor protein in the samples loaded. Overall, in-gel VOPBA had limitations and was not a successful approach in the current project. By contrast, RSV VOPBA on proteins blotted onto membranes after a denaturing gel electrophoresis provided some signals, the most reproducible one being a band of molecular weight —100kDa. This was considered a specific signal because omission of each VOPBA “layer”, including the virus and the primary or secondary antibodies, resulted in the signal no longer being visualized. Moreover, VOPBA with an irrelevant virus (AdV5) resulted in completely different signals. Since the signal of molecular weight 100 kDa was observed on the membrane, the challenge was how to locate the same band on the gel. Protein identification on membranes is possible by 135 N-terminal Edman degradation but is described for pure 233samples and not for samples prepared from whole cell surface membranes, as was the case in this project. In order to locate the signal on an unstained gel, gels were loaded symmetrically with 4-6 wells loaded with standard size markers. After electrophoresis, the gel was cut in half. One half underwent VOPBA and the other half was placed in a fixative for a time that would not change dimensions (i.e., gel shrinkage), then kept at 4°C in the same buffer which the gel would be sent away for MS analysis. After visualization of the signal by VOPBA, the location of the signal was marked on the membrane and with care to avoid contamination (e.g., by keratin), the gel was overlaid on the membrane with the molecular weight size markers exactly overlapping each other, band for band. The portion of the gel overlaying the signal was excised and sent for MS analysis. The MS analysis reported many protein “hits” but considering the samples sent were not purified and contained an assortment of various cell surface membrane proteins, this was expected. Moreover, most of the protein “hits” were membrane and cytoskeletal proteins and taking into account that cytoskeletal proteins can exist in close relation with membrane proteins, this was also not surprising. To validate our method of overlaying a membrane containing signal with the fixed gel, excising the corresponding portion of the gel and sending it for MS, a set of experiments was done using AdV5, since this virus has known 27receptors AdV5 VOPBA on HEp-2 cells showed a single band at -46 kDa consistent with molecular. weight of CAR, and three closely-spaced bands at -415 kD (in the range of the molecular weight for integrin-beta 1). At least one band at the 115 kDa level was observed for each of A549 and CR0-K 1 cells. Although the results of Western blot were consistent with the possibility that the 46 kDa band was CAR, several MS analyses did not identify CAR in the samples excised from gels at the 136 corresponding 46 kDa location. There was a possibility that, compared to many other proteins in the sample, CAR was less abundant and thereby be obscured by other, more abundant proteins of similar molecular weight. This was further investigated by performing electrophoresis of cell surface membrane proteins on longer gels (about twice the length as original gels) to achieve greater protein separation and run for a longer time during MS analysis; however, neither of these strategies resulted in the identification of CAR. The detection level of the peptide mixture was in the range of 1-10 fmoles using 234MALDI-T0F Assuming a 20% yield of peptides is obtained from a gel 235slice 5-50 fmoles protein loaded on a gel should be possible to be analyzed by MS. A simple, calculation shows. that for CAR (molecular weight of 46 kDa), this would correspond to 0.23-2.3 ng 58protein’ Examination of the protein hits reported by MS analysis of the sample prepared at.46 kDa shows that many proteins close to CAR molecular weight were identified, suggesting that the gel was cut from the correct place. Taken together, CAR was not detected by MS analysis, possibly because it was in relatively low abundance compared to many other proteins in our sample and/or as a consequence of lack of enough sensitivity of the MS analysis. It should be emphasized, however, that despite failure to identify CAR by MS, Western blot using anti-CAR antibody successfully yielded a signal at —46kDa molecular weight, consistent with the VOPBA signal at this location on the membrane reflecting AdV5-CAR binding. By contrast, MS analysis of the sample prepared from bands in the —115 kDa molecular weight location of the HEp-2 cells detected integrin-beta 1, another known AdV5 27receptor However, due to proximity of the three bands visualized at the 115 kDa location and .they were all present in the sample sent for MS analysis and it is not clear as to which band(s) contained integrin-beta 1. If only one band contained integrin-beta 1, then it is conceivable that the two other bands may have contained additional (unknown) receptor(s) to AdV5 or possibly variants of integrin-beta 1. 137 Altogether, AdV5 VOPBA was able to detect at least two known receptors for AdV5, CAR (by Western blot) and integrin-beta 1 (by MS). An important caveat from VOPBA using AdV5 was that MS analysis could identify protein if present in sufficient quantity to not be obscured by other more abundant proteins of similar molecular weight in the sample. Possible approaches to further enhance sample purification can be accomplished if one has more knowledge about characteristics of the protein of interest, including membrane location (e.g., if the protein is localized in lipid rafts) or post-translational modifications (e.g., glycosylation), so that samples could be enriched based on these characteristics prior to undergoing gel electrophoresis. 5.3.1. RSV VOPBA Using VOPBA and MS analysis techniques in different cell lines from multiple different species (human, dog and hamster), nucleolin was identified as a candidate RSV binding protein. Specificity of RSV-nucleolin binding was confirmed by inhibition of RSV infection, either by using anti-nucleolin antibodies (blocking experiment) or by incubation of RSV with purified nucleolin (competition experiment). The limitation of the RSV VOPBA used was lack of an RSV non-permissive or resistant cell to serve as a definitive negative control. However, as mentioned earlier, several other controls, including VOPBA without either the virus or without each of the primary and secondary antibodies, were performed and results indicated that RSV binding during VOPBA was specific for the virus. 138 54. Nucleolin Structure and Biology In 1973, using a two-dimensional polyacrylamide gel electrophoresis technique for separation of nucleolar proteins of normal rat liver and Novikoff hepatoma ascites cells, Orrick et aL236 resolved about 100 distinct protein spots, among which nucleolin was included. Based on its mobility on two dimensional gels, this protein was initially called C23 237 In 1982, Bugler and 238colleagues detected a class of proteins in CR0 cells which were immunologically related to a 100 kDa nucleolar protein and had physico-chemical characteristics of C23 Novikoff hepatoma nuclei. Using cell subfractionation and immunoblotting techniques, the protein was localized in the nucleoli and ribosomes. Subsequently, analogous proteins were found in other systems such as mouse ascites sarcoma cells (nucleolar specific 239phosphoprotein) hamster and human cell lines, chicken cartilage cells as well as Drosophila embryonic cells 1(pp 05)240. The antigenic relatedness of these proteins in different studies, indicated that it was universally present in higher eukaryotes. Due to its abundance in nucleoli, the polypeptide was referred to as “nucleolin”, a name that today is widely used for this .241protein In exponentially growing eukaryotic cells, nucleolin is the main nucleolar 242protein Nucleolin is highly conserved and structurally related proteins are found in organisms. ranging from yeast to 243human This is consistent with observations of the human RSV F protein interacting with cells. derived from a wide range of species including human, feline, equine, canine, bat, rodent, avian, porcine and even xenopus (an amphibian), suggesting that the protein interacts with either highly conserved host cell surface molecules, or uses multiple mechanisms to enter .225cells In 139 addition the present study shows that nucleolin could be found at the surface of cells from such diverse species as human, dog and hamster. Cloning and sequencing of human nucleolin cDNA revealed an open reading frame coding for a 707 amino acid long protein of a predicted 77 kDa molecular 244weight Given that nucleolin has an apparent molecular weight of -400 kDa, the difference. could be attributed to posttranslational protein modifications and unusual structural features such as a high content of negatively charged amino acids at the N-terminal end of 245246nucleolin The signal obtained from RSV VOPBA and sent for MS analysis was at —100kDa.’ Other signals that were obtained from RSV VOPBA (inconsistently) were observed at —15,. 30 and 90 kDa and all were less intense than the —100kDa band in samples of biotinylated cell surface proteins. These “extra” signals of lower molecular weight were more prominent in the crude membrane preparations than in biotinylated preparations and possibly reflect non-cell surface protein bindings. Nucleolin is highly phosphorylated (with all of the phosphoryl groups and phosphorylated acidic regions located in the N-terminal half of the C23 polypeptide 247chain), highly methylated (in 248C-terminal), and 249ADP-ribosylated Although potential N-glycosylation sites have been predicted for 244nucleolin to my knowledge, glycosylation has not been reported as a post- translational modification, . for nucleolin. This is consistent with current results obtained from RSV VOPBA on samples prepared from enzyme-treated cell surface proteins, which showed that the protein to which RSV binds is apparently not glycosylated. Moreover, the results of the current project from cell surface enzyme treatment show that the protein(s) that RSV binds to at the cell surface are unlikely to be GPI-anchored. Nucleolin has been detected on the surface of many different types of 250cells but characteristics of its association with the membrane are not well characterized. According, to the nucleotide and amino acid sequence of nucleolin, it has 140 been predicted that this protein does not have a hydrophobic domain for its membrane 250integration The results of this thesis suggest that nucleolin is not GPI-anchored”. Others have tried. to detect nucleolin on the surface of HEp-2 and RD cells by flow cytometry but they have obtained negative 251results Nevertheless, surface nucleolin has been isolated from many cell types, including human. cells such as RD, HeLa, Daudi, MOLT4, CEM, U937, and Jurkat and murine cells T54 and .252929L Nucleolin has three structural domains including the N-terminal domain (containing highly acidic regions interspersed with basic sequences) which controls ribosomal RNA transcription, the central domain (containing four RNA binding domains) which controls pre-RNA processing, and the C-terminal domain (rich in glycine, arginine and phenylalanine residues) which controls nuclear 252localization Nucleolin has a wide range of subcellular localization and is believed to be involved in a variety of cell functions. Nucleolin is found in nucleoli, nucleoplasm, cytoplasm,. and on the cell surface and is involved in the regulation of DNA and RNA 252253metabolism For instance, RNA polymerase I-mediated transcription, proper folding and maturation’ of the preribosomal RNA, ribosomal assembly, and nucleo-cytoplasmic transport are regulated by 252nucleolin Together with its intracellular pooi in the nucleus and cytoplasm, nucleolin is continuously. expressed on the cell surface of different cell 252types. Cell surface- expressed nucleolin is reported to bind to many ligands including low density 254lipoproteins laminin-1 in the extracellular 255matrix a number of human 256257258259pathogens as well as DNA nanoparticles (composed, of pegylated polylysin and 250DNA) It has been, shown that cytoplasmic nucleolin is located in small vesicles that appear.’ to shuttle nucleolin to the cell To investigate the effect of PT-PLCon cell surface nucleolin an experiment, was designed using HEp-2 cells, anti nucleolin antibody (MS-3) (Santa Cruz), and flow cytometry technique; however, the method failed to detect nucleolin at cell surface. This negative finding is not mentioned in the results section of this thesis. Failure to detect nucleolin on surface using flow cytometry may reflect technical aspects or other factors such as antibodies being used. An alternative technique to study this issue is confocal microscopy, which provides sufficient resolution to determine the cellular localization of nucleolin morphologically. 141 252surface Low temperature and serum free media markedly reduce this translocation, while inhibitors. of intracellular glycoprotein transport (methylamine and monensin) do not affect nucleolin transportation to the surface, suggesting translocation of nucleolin is mediated by an active transport independent of the ER—Golgi.252complex Incubation of cells with an anti-nucleolin mAb at 20°C has been reported by Hovanessian et at. to result in the clustering of the cell-surface-expressed nucleolin, which is generally observed when transmembrane proteins on unfixed cells are incubated with their respective 252antibodies In the same study, when the investigators increased the temperature to 37°C, this. resulted in internalization of the antibody, showing that surface nucleolin can mediate intracellular import of its specific ligands and act as a functional cell surface receptor. Thus, the authors concluded that cell surface nucleolin could act as a membrane-anchored protein upon being crosslinked with a specific antibody. The authors also showed that nucleolin clustering at cell surface was dependent on the existence of an intact actin cytoskeleton. Surface nucleolin is closely associated with intracellular actin cytoskeleton but the mechanism responsible for this association is not known. Since no hydrophobic domain justifying potential integration into the plasma membrane could be predicted from the reported nucleolin sequence, the nucleolin and actin association may be mediated by intermediary proteins. Given that nucleolin has a strong affinity for heparin, the investigators proposed that nucleolin binds syndycans, which are type I transmembrane proteoglycans known for their association with actin and a potential binding site for syndycans could be the C-terminal domain in nucleolin, which is rich in arginine 252residues Alluding to some unpublished data regarding binding of polyanionic compounds such. as the G G-paired DNA ETS- 1 to C-terminal domain of soluble but not the cell surface nucleolin, Hovanessian et at.252 suggested that the C-terminal domain is not accessible in cell surface nucleolin. However, more recent studies by the same authors show that the anti-HIV 142 pseudopeptide HB-19 binds to the C-terminal domain of nucleolin, preventing virion attachment to plasma membrane of the host 260cells Taken together, the characteristics of membrane association and ligand binding sites. of cell surface nucleolin are complex and still not well understood. It has been found that cytoplasmic and cell surface-expressed nucleolin differ from nuclear nucleolin in terms of their isoelectric points (p1), possibly the result of posttranslational modifications. However, since both nuclear and cell surface nucleolin have been reported to be phosphorylated, other posttranslational modifications might explain their different p1 252values The difference between nuclear and surface nucleolin is confirmed by the observation.in which CVB3 was bound to surface nucleolin but not nuclelar 256nucleolin However, in this thesis project, incubation of RSV with purified nuclear nucleolin.obtained from HeLa cells resulted in a dose-dependent decreased infection at 24 h, suggesting RSV binding to a domain in nuclear nucleolin as well. Cell surface nucleolin has been reported to be an attachment receptor for enterohemorrhagic E. coli 2570157:H7 a binding protein for 256CVB3 a co-receptor for HIV-l, an entry cofactor for human, parainfluenza 259virus and a macrophage, receptor for apoptotic 261cells Several cell surface nucleolin ligands, including pseudopeptide HB-19 and physiological. ligands such as 258 262Midkine 263Pleiotrophin and lactoferrin 264 have been used to inhibit HIV infection by ,blocking virion attachment to CD4+ host cells. Similar to HIV, nucleolin is a low affinity 6264 receptor for all, of the above-mentioned More recently, endostatin was reported as a high affinity ligand for 265nucleolin However, nucleolin does not appear to be merely a “sticky” molecule on the cell membrane because nucleolin can mediate import of ligands into 265 . Moreover, in the current project, AdV5-GFP, used as a control, and results showed 143 no evidence of AdV5-nucleolin binding. Other investigators looked for an RSV receptor and after purification of HEp-2 cell lysate using fucoidan (an L-selectin binding protein) affinity matrix, they found nucleolin as an MS protein “hit” along with annexin II, but chose not to further pursue investigations of nucleolin. In the current thesis, a different approach (VOPBA) was used and nucleolin was consistently found as an MS “hit” in different cell types from several species. Given that nucleolin is involved in many cell functions, its downregulation using techniques such as siRNA can affect cells dramatically. Indeed, the effects of such depletion has been reported as low pre-ribosomal RNA accumulation, changes in nucleolar structure, blockage of cell cycle at G2 phase, increase of apoptosis, numerous nuclear alterations including the presence of micronuclei, multiple nuclei or large 266nuclei The various effects of nucleolin depletion on cell cycle, growth and proliferation,. as well as cell survival makes drawing definitive conclusions from experiments regarding effect of nucleolin downregulation on virus binding and entry difficult. Moreover, although some genome-wide expression profiling studies after siRNA knock down show specificity of the 267268technique other studies give evidence for siRNAs having off-target 269270271effects The latter’ phenomena indicate that caution is needed when interpreting results of’ experiments designed to study effect of nucleolin gene silencing on viruses (such as RSV attachment. and entry). Nevertheless, siRNA has been used to knock down cell surface nucleolin in ligand binding/entry studies. For example, in one study 48 h after siRNA transfection, the mRNA level and the cell surface nucleolin were reduced by 90 and 58.6%, 250respectively This resulted in 54.7% decrease in reporter gene expression from DNA nanoparticles (a nucleolin ligand). In the same study, overexpression of a nucleolin-GFP fusion protein increased. transfection efficiency of DNA nanoparticles containing the luciferase reporter gene. 144 The current project used a polyclonal antibody for blocking studies. While mAb are considered preferable for such experiments, our results showed that Western blot on cell surface membrane proteins had clear specificity in terms of the polyclonal antibody binding to nucleolin. Polyclonal anti-nucleolin antibodies did not block RSV infection completely, indicating that molecules in addition to nucleolin could also be involved in RSV binding and entry, since inhibition of a primary receptor usually results in total block of 259infectivity Attachment and entry of some enveloped viruses into host cells is recognized as.a complex process involving virus envelope proteins interacting with a collection of host cell proteins. The interaction of viral envelope proteins with host cell surface molecules results in conformational changes which subsequently cause interaction with another primary and/or secondary receptor(s). For example, HIV-1 surface protein gpl2O binds to CD4, attaching the virus to the host cell 230surface This enables additional interactions with a co-receptor protein (chemokine receptors. CCR5 and 230CXCR4) Subsequently, conformational changes in gpl2O enable another viral protein, gp4l .to undergo reorientation and become parallel to viral and cellular membranes contributing to events which eventually result in fusion of the two 230membranes In 1987 using polyclonal antibodies against the RSV. G protein, Levine et al. reported RSV G as the attachment 20protein’ A decade later, it was observed that a human RSV mutant lacking the RSV G protein. was still 272infectious Moreover, RSV has a vast tropism amongst diverse 225species All of these observations. indicate that attachment of RSV to cells is a complex .phenomenon possibly involving several viral and cellular components. This is why we chose to use whole virus in VOPBA experiments in the current thesis. 145 5.5 Conclusion and Future Directions This project endeavored to use an unbiased approach to interrogate cell culture systems for the identification of a novel molecule(s) involved in RSV attachment to cell surface receptors. The availability of diverse types of “omics” 153 (e.g., proteomics), provided a powerful approach to perform an initial screening, followed by experiments designed to validate the results of initial screening. This general approach resulted in identification of nucleolin as a candidate molecule involved in RSV cell surface binding. After initial identification of nucleolin, its biological role was studied by antibody neutralization assays, in which anti-nucleolin antibodies reduced RSV infection, and competition experiments, in which pre-incubation of RSV with purified nucleolin decreased virus infection in a dose-dependent manner. One limitation of this project was the lability of RSV, which precluded use of classical ligand-receptor binding assays involving radioactively-labeled virus to generate Scatchard plots, as has been done in other 273274systems Hence, a method that is capable of RSV stabilization and obtaining high yield virus.’ stocks is needed if future studies are to focus on classical ligand-receptor binding approaches. Moreover, the lack of a known RSV resistant cell type was another limitation toward definitively proving that nucleolin is an RSV receptor. As mentioned in section 1.3.2, upon identification of a candidate receptor, blocking virus binding and infection by anti-candidate antibodies is not sufficient, due to a possibility that the “real” receptor is located close to the candidate and the antibody blocks the infection without recognizing the actual receptor. Although methods such as RNAi and depleting cell surface have their own potential pitfalls, they can be used in future confirmatory experiments. Ligands that bind nucleolin such as pseudopeptide 258HB-19 and physiological ligands such as 262Midkine 263Pleiotrophin and 2Mlactoferrin may also be of additional use as potential agents to, compete for, nucleolin binding 146 and possibly inhibit RSV binding. Although production of nucleolin knockout mice has to date not been reported in the literature, based on studies of the yeast nucleolin homolog Nsrl, loss of nucleolin may not be lethal but might result in severe growth defects or other 275complications Moreover, after a candidate virus binding molecule is identified, it needs. to be further characterized. For example, in order to avoid blocking the normal function of a receptor (or a co-receptor) it is important to know the virus binding regions. This is essential when the molecule is a key protein such as CXCR4 (a co-receptor for HIV-i), but not for a redundant protein such as CCR5 (another co-receptor for HI.230V-i) Figure 29 provides an integrative perspective of the current project in which nucleolin is proposed as a functional receptor for RSV. The receptor for RSV was unlikely to be GPI anchored, glycosylated or located in caveolin-rich membrane fractions. 147 Virion ‘Viral Glycoproteins Envelope RNP complex F or G Nucleolin — F mRNA Nucleus L — NS1 Viral RNA — L,N,P,M2-1,M — N — NS2 1t —P M— + — M2-1 — M2-2 Inclusion body Figure 29. An integrative model proposed according to the findings of the current thesis. Comparison of Figures 1 and 29 indicates that in the current project nucleolin has been proposed as a functional receptor for RSV. According to the results of this project the receptor is unlikely to be GPI-anchored or glycosylated. Although another study suggested RSV cell surface receptor being associated with lipid rafts in dendritic 135cells this project failed to show such an association in HEp-2 cell. , 148 Some potential future directions are: A) Study the effect of nucleolin knock-down (siRNA) in vitro and nucleolin knock-out in vivo on RSV infection; B) Finding (or manufacturing) a nucleolin-deficient cell line into which nucleolin could be transfected and determine effect of nucleolin upregulation on subsequent RSV infection; C) Direct visualization of RSV-nucleolin co-localization on the cell surface by confocal microscopy, which provides visual evidence of interaction under intact conditions of early cellular exposure to RSV; D) Radiolabeling (or somehow labeling) RSV for direct binding assays to generate Scatchard plots, in place of relying on viral infection results at 24 h or other timepoint after cell entry as a major read-out; E) Determine which RSV surface protein (F or G) binds to nucleolin. There exists a mutant RSV with deletion of the F protein and another mutant RSV with deletion of the 6 276protein and such recombinant viruses could be used for this purpose; F) Additional blocking (mAb) and competition experiments (using known nucleolin binding ligands) to observe inhibition of RSV infection. G) Extending this project to RSV subgroup B is worthwhile, particularly if the RSV protein binding to nucleolin is established to be the less conserved viral G protein. H) Extending this project to clinical isolates of RSV and primary human airway epithelial cell cultures, to determine if the results obtained with laboratory adapted strains of RSV and continous cell lines used in this thesis are reproducible in “real world” virus and cells. 149 In conclusion, the work done in this thesis has identified nucleolin as a candidate RSV receptor. Nucleolin shows characteristics of being a functional viral receptor on the basis of results of antibody blocking and protein incubation (competition) studies. Definitive characterization of nucleolin as an RSV receptor will require a combination of experimental approaches such as knock-down or knock-out models, RSV and nucleolin cell surface co-localization, RSV radio (or non-isotopic) labeling and classical binding studies, and further characterization of specific RSV-nucleolin binding sites. 150 References 1 Flint SJ, Enquist LW, Krug RM, Racaniello VR, Skalka AM. Virus attachment to host cell. In: Principles of virology: molecular biology, pathogenesis and control. Washington, D.C.: ASM Press, 2000. pp. 101-31. 2 Alberts 4th B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Membrane structure. In: Molecular biology of the cell. ed. New York: Garland Science, 2002. pp. 583-614. Singer SJ, Nicolson GL. The fluid mosaic model of the structure of cell membranes. Science 1972;175:720-31. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 2001;305:567-580 Ikeda M, Kihara A, Igarashi Y. Lipid asymmetry of the eukaryotic plasma membrane: functions and related enzymes. Biol Pharm Bull 2006;29:1542-6 6 Simons K, Ikonen E. Functional rafts in cell membranes. Nature 1997;387:569-72 ‘ Rajendran L, Simons K. Lipid rafts and membrane dynamics. J Cell Sci 2005;118: 1099-1102 8 Van Meer G, Sprong H, and Raggers R. Lipid heterogeneity in mammalian cells: Domains and translocators. In: Jos Arnoldus Franciscus Op Den Kamp ed. Protein, lipid and membrane traffic: pathways and targeting. Netherlands: lOS Press, 2000. pp. 55-61. Tsai B, Gilbert JM, Stehle T, Lencer W, Benjamin TL, Rapoport TA. Gangliosides are receptors for murine polyoma virus and SV4O.EMBO J 2003;22:4346-55 JA, Magnuson B, Tsai B, Michael I. Imperiale identification of gangliosides GD1b and GT1b as receptors for BK virus. J Virol 2006;80:1361—6 Ohlendieck, K. Extraction of membrane proteins. In: Protein Purification Protocols. Cutler P ed. Humana Press mc; Totowa, NJ: 2004. pp. 283-94. 12 http:llwww.ncbi.nlm.nih.govlbooksfbv.fcgi?highlight=surface,cell&rid=cooper.section. 1967#1971 ‘-‘ Seddon AM, Curnowl P, Booth PJ. Membrane proteins, lipids and detergents: not just a soap opera. Biochimica et Biophysica Acta 2004;1666:105-17 14 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE. The Protein Data Bank. Nucleic Acids Res 2000;28:235—42 15 Elofsson A, von Heijne G. Membrane protein structure: prediction versus reality. Annu Rev Biochem 2007;76:125—40 16 Helenius, A. Aebi M. Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem 2004;73:1019—49 17 Gahmberg CG, Tolvanen M. Why mammalian cell surface proteins are glycoproteins. Trends Biochem Sci 1996;21:308-11. 18 Jindrák L, Grubhoffer L. Animal virus receptors. Folia Microbiol (Praha) 1999;44:467-86. 19 Haywood AM. Virus receptors: binding, adhesion strengthening, and changes in viral structure. 3 Virol 1994;68:1—5. 20 Balakireva L, Schoehn G, Thouvenin E, Chroboczek J. Binding of adenovirus capsid to dipalmitoyl phosphatidylcholine provides a novel pathway for virus entry. 3 Virol 2003 ;77:4858-66. 21 Baranowski E, Ruiz-Jarabo CM, Domingo E. Evolution of cell recognition by viruses. Science 2001;292:1102-5. 22 Smith AE, Helenius A. How viruses enter animal cells. Science 2004;304:237-42 23 Gummuluru S, Rogel M, Stamatatos L, Emerman M. Binding of human immunodeficiency virus type 1 to immature dendritic cells can occur independently of DC-sign and mannose binding c-type lectin receptors via a cholesterol-dependent pathway. J Virol 2003;77:12865-74. 24 Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, Horwitz MS, Crowell RL, Finberg RW. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 1997;275:1320-3. Shttp://wwwmdcon5u1tcodasmookpoody/1 06464111-2/0/1259/10 14.html#4-ul .0-B0-443-06643-4..501 31-8-- cesec3. 26 Alkhatib G, Berger EA. HIV coreceptors: from discovery and designation to new paradigms and promise. Eur I Med Res 2007;12:375-84. 27 Thang Y, Bergelson TM. Adenovirus receptors. J Virol 2005;79:12125—31. 28Salone B, Martina Y, Piersanti S. Cundari E, Cherubini G, Franqueville L, Failla CM, Boulanger P, Saggio I. Integrin alpha3betal is an alternative cellular receptor for adenovirus serotype 5. 3 Virol. 2003;77:13448-54. 292 Borrow P, Oldstone MB. Characterization of lymphocytic choriomeningitis virus-binding protein(s): a candidate cellular receptor for the virus I Virol 1992;66:7270-81. 151 3° Ahsan N, Shah Ky. Polyomaviruses and Human Diseases. Adv Exp Med Biol 2006;577:1-18. 31 Naniche D, Wild TF, Rabourdin-Combe C, Gerlier D. A mAb recognizes a human cell surface glycoprotein involved in measles virus binding. J Gen Virol 1992;73:2617-24. 2 Ferreira L, Villar E, Muiioz-Barroso I. Gangliosides and N-glycoproteins function as Newcastle disease virus receptors. mtj Biochem Cell Biol 2004;36:2344-56. 3Cao W, Henry MD, Borrow P, Yamada H, Elder JH, Ravkov EV, Nichol ST, Compans RW, Campbell KP, Oldstone MBA. Identification of a-Dystroglycan as a receptor for lymphocytic choriomeningitis virus and lassa fever virus. Science 1998;282:2079-8 1. Defer C, Belin MT, Caillet-Boudin ML, Boulanger P. Human adenovirus-host cell interaction: comparative study with members of subgroups B and C. J Virol 1990;64:3661-73 Mischak H, Neubauer C, Berger B, Kuechier E, Blaas D. Detection of the human rhinovirus minor group receptor on renaturing Western blots. J Gen Virol 1988;69:2653—6. 36 de Verdugo UR, Selinka HC, Huber M, Kramer B, Kellermann J, Hofschneider PH, Kandolf R. Characterization of a 100-kilodalton binding protein for the six serotypes of coxsackie B viruses. J Virol 1995;69:6751—7 Hansson CC, Karisson KA, Larson G, Stromberg N, Thurin J, Orvell C, Norrby E. A novel approach to the study of glycolipid receptors for viruses. Binding of Sendai virus to thin-layer chromatograms. FEBS Lett 1984;170:15-8. 38 Barton ES, Forrest IC, Connolly JL, Chappell ID, Liu Y, Schnell FJ, Nusrat A, Parkos CA, Dermody TS. Junction adhesion molecule is a receptor for reovirus. 2001; 104:441-51. 4° Naniche D, Varior-Krishnan C, Cervoni F, Wild T, Rossi B, Rabourdin-Combe C, Gerlierl D. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J Virol 1993;67:6025-32. ‘4° Greve JM, Davis G, Meyer AM, Forte CP, Yost SC, Manor CW, Kamarck ME, McClelland A. The major human rhinovirus receptor is ICAM-1. Cell 1989 10;56:839-47. 41 Bergelson JM, Shepley MP, Chan BM, Hemler ME, Finberg RW. Identification of the integrin VLA-2 as a receptor for echovirus 1. Science 1992;255:1718-20. 42 Li W, Moore MJ, Vasilieva N, Sui I, Wong SK, Berne MA, Somasundaran M, Sullivan JL, Luzuriaga K, Greenough TC, Choe H, Farzan M. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 2003;426:450-4. ‘1 Negrete OA, Levroney EL, Aguilar HC, Bertolotti-Ciarlet A, Nazarian R, Tajyar S, Lee B. EphrinB2 is the entry receptor for Nipah virus, an emergent deadly paramyxovirus. Nature 2005;436: 40 1—5.2005. Bergelson JM, Chan M, Solomon KR, St John NF, Lin H, Finberg RW. Decay-accelerating factor (CD55), a glycosylphosphatidylinositol-anchored complement regulatory protein, is a receptor for several echoviruses. PNAS 1994;91:6245-8. ‘1 Vaccination. (2007, November 24). In: Wikipedia, The Free Encyclopedia. Retrieved 09:27, November 24, 2007, from http://en.wikipedia.org/w/index.php?title=Vaccination&oldid=1 73385579 46 Savolainen C, Blomqvist 5, Hovi T. Human rhinoviruses. Paediatr Respir Rev 2003;4:91-8. ‘1’ Watkins DI. Basic HIV vaccine development. Top HIV Med 2008;16:7-8. 48 Polack FP, Karron RA. The future of respiratory syncytial virus vaccine development. Pediatr Infect Dis J 2004;23:S65—73. ‘1 Butel IS. Pathogenesis and control of viral diseases.th24 In: Brooks GF, Carroll KC, Butel JS, Morse SA eds. Jawetz, Melnick, & Adelberg’s Medical Microbiology. ed. The McGraw-Hill Companies, 2007. pp. 393-412. ° Katzung BG. Antiviral agents. In: Basic & Clinical Pharmacology. 10th Ed. The McGraw-Hill Companies, 2007. pp. 790-8 18. 51 De Clercq E, Field HI. Antiviral prodrugs — the development of successful prodrug strategies for antiviral chemotherapy. Brit J Pharmacol 2006;147: 1—11. 52 De Clercq E. Antiviral drugs in current clinical use. J Clin Virol 2004;30:1 15—33. Le Calvez H, Yu M, Fang F. Biochemical prevention and treatment of viral infections-A new paradigm in medicine for infectious diseases. Virol J 2004;1:12 54Patick AK. Rhinovirus chemotherapy. Antivir Res 2006;71:391-6. Fang F, Yu M. Viral receptor blockage by multivalent recombinant antibody fusion proteins: inhibiting human rhinovirus (HRV) infection with CFY196. I Antimicrob Chemother 2004;53:23—5. 56 Clapham PR, McKnight A. HIV-1 receptors and cell tropism. Bnit Med Bull 200 1;58:43—59. Clapham PR, Weber N, Whitby D, McIntosh K, Daigleish LG, Maddon P1, Deen KC, Sweet RW, Weiss RA. Soluble CD4 blocks the infectivity of diverse strains of I-IIV and SW for T cells and monocytes but not for brain and muscle cells. Nature 1989;337:368—70. 58 Daar ES, Ho DD. Relative resistance of primary HIV-1 isolates to neutralization by soluble CD4. Am J Med 1991;90:22S—26S. 152 Chen B, Vogan EM, Gong H, Skehel JJ, Wiley DC. Harrison SC. Structure of an unliganded simian immunodeficiency virus gp120 core. Nature 2005;433 :834—41. 60 Kwong PD. Human immunodeficiency virus: refolding the envelope. Nature 2005;433:815-6. Kwong PD, Doyle ML, casper DJ, Cicala C, Leavitt SA, Majeed S, Steenbeke TD, Venturi M, Chaiken I, Fung M, Katinger H, Parren PW, Robinson I, Van Ryk D, Wang L, Burton DR, Freire E, Wyatt R, Sodroski J, Hendrickson WA, Arthos I. HIV-1 evades antibody-mediated neutralization through conformational masking of receptor-binding sites. Nature 2002;420:678-82. 62 Arthos J, Cicala C, Steenbeke TD, Chun TW, Dela Cruz C, Hanback DB, Khazanie P, Nam D, Schuck P, Selig SM, Van Ryk D, Chaikin MA, Fauci AS. Biochemical and biological characterization of a dodecameric CD4-Ig fusion protein: implications for therapeutic and vaccine strategies. J Biol Chem 2002;277:1 1456-64. 6i Kwong PD, Wyatt R, Robinson J, Sweet RW, Sodroski J, Hendrickson WA Structure of an HIV gpl2O envelope lycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 1998;393:648—59. No author listed. The Impact-RSV Study Group, Palivizumab, a humanized respiratory syncytial virus mAb reduces hospitalization from respiratory syncytial virus infection in high-risk infants. Pediatrics 1998;102:531-7. 65 Robertson D. US FDA approves new class of HIV therapeutics. Nat Biotechnol 2003;21:470-1. 66 Van Aerschot A. Oligonucleotides as antivirals: dream or realistic perspective? Research 2006;71:307-16. 67 Bitko V, Bank S. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses. BMC Microbiol 2001 ;1:34. 68 Bitko V, Musiyenko A, Shulyayeva 0, Bank S. Inhibition of respiratory viruses by nasally administered siRNA. Nat Med 2005;i1:50—5. 69 Ge Q,McManus MT, Nguyen T, Shen CH, Sharp PA, Eisen HN, Chen J. RNA interference of influenza virus production by directly targeting rnRNA for degradation and indirectly inhibiting all viral RNA transcription. Proc Nati Acad Sci USA 2003;100:2718-23. 70 Ge Q, Filip L, Bai A, Nguyen T, Eisen HN, Chen J. Inhibition of influenza virus production in virus infected mice by RNA interference. Proc Natl Acad Sci USA 2004;101:8676—81. 71 Gitlin L, Karelsky 5, Andino R. Short interfering RNA confers intracellular antiviral immunity in human cells. Nature 2002;418:430-4. 72 Chiu YL, Cao H, Jacque JM, Stevenson M, Rana TM. Inhibition of human immunodeficiency virus type 1 replication by RNA interference directed against human transcription elongation factor P-TEFb (CDK9/CyclinTl). J. Virol 2004;78:2517-29. Jacque JM, Triques K, Stevenson M. Modulation of HIV-1 replication by RNA interference. Nature 2002;418:435-8. 74Yuan J, Cheung PK, Zhang HM, Chau D, Yang D. Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand. J Virol 2005;79:2151-9. ‘ Boden D, Pusch 0, Ramnatnam B. HIV-1-specific RNA interference. Curr Opin Mol Ther 2004;6:373-80. 76 Van Rij RP, Andino R. The silent treatment: RNAi as a defense against virus infection in mammals. Trends Biotechnol 2006;24: 186-93. Morris IA, Blount RE Jr, Savage RE. Recovery of cytopathogenic agent from chimpanzees with coryza. Proc Soc Exp Med 1956;92:544-9. 78 Chanock RM, Roizman B, Myers R. Recovery from infants with respiratory illness of a virus related to chimpanzee coryzal agent (CCA). I. Isolation properties and characterization. Am I Hyg 1957;66:281-90. Loughlin GM, Moscona A. The cell biology of acute childhood respiratory disease: therapeutic implications. Pediatr Clin North Am. 2006;53:929-59, ix-x. Domachowske JB, Rosenberg HF. Respiratory syncytial virus infection: immune response, immunopathogenesis, 80and treatment. Clin Microbiol Rev 1999;12:298-309. 81 Collins P, Chanock R, Murphy B. Respiratory syncytial virus. In: Knipe D, Howley PM, eds. Fields’ Virology, 4th ed. Philadelphia: Lippincott Williams & Wilkins, 2001:1341-79. 82 Hall CB, Walsh EE, Schnabel KC, Long CE, McConnochie KM, Hildreth SW, Anderson LI. Occurrence of groups A and B of respiratory syncytial virus over 15 years: associated epidemiologic and clinical characteristics in hospitalized and ambulatory children. I Infect Dis 1990;162:1283-90. 8 Walsh EE, McConnochie KM, Long CE, Hall CB. Severity of respiratory syncytial virus infection is related to virus strain, J Infect Dis 1997;175:814-20 84 Fodha I Vabret A, Ghedira L, Seboui H, Chouchane 5, Dewar I, Gueddiche N, Trabelsi A, Boujaafar N, Freymuth F. Respiratory syncytial virus infections in hospitalized infants: association between viral load, virus subgroup, and disease severity. I Med Virol 2007;79:1951-8. 153 85 Lukacs NW, Moore ML, Rudd BD, Berlin AA, Collins RD, Olson SI, Ho SB, Peebles RS Jr. Differential immune responses and pulmonary pathophysiology are induced by two different strains of respiratory syncytial virus Am J Pathol 2006;169:977-86. 86 Schiender I, Hornung V, Finke S. Gunthner-Biller M, Marozin S, Berzozka, K, Moghim S, Endres S, Hartmann G, Conzelmann KK. Inhibition of toll-like receptor 7- and 9-mediated alpha/beta interferon production in human plasmacytoid dendritic cells by respiratory syncytial virus and measles virus. J Virol 2005;79:5507-1 5 Openshaw PJM, Tregoning J, Harker I. RSV 2005: Global impact, changing concepts, and new challenges. Viral Immunol 2005;18:749-51. 88 Hacking D, Hull J. Respiratory syncytial virus-viral biology and the host response. I Infect 2002;45: 18-24. 89 Branigan PJ, Liu C,Day ND, Gutshall LL, Sarisky RT, Del Vecchio AM. Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein. Virology I 2005;2:54. 90 Techaarpornkul S, Barretto N, Peeples ME. Functional analysis of recombinant respiratory syncytial virus deletion mutants lacking the small hydrophobic and/or attachment glycoprotein gene. J Virol 2001;75:6825—34. ‘ Fuentes S, Tran KC, Luthra P. Teng MN, He B. Function of the respiratory syncytial virus small hydrophobic protein. J Virol 2007;81:8361—6 Levine S, Klaiber-Franco R, Paradiso PR.. Demonstration that glycoprotein G is the attachment protein of respiratory2 syncytial virus. Gen Virol 1987;68:2521—4. I Johnson PR, Spriggs MK, Olmsted RA, Collins PL. The G glycoprotein of human respiratory syncytial virus of subgroups A and B: extensive sequence divergence between antigenically related proteins. Proc Nati Acad Sci USA 1987;84:5625-9. Wertz GW, Collins PL, Huang Y, Gruber C, Levine S, Ball LA. Nucleotide sequence of the G protein gene of human respiratory syncytial virus reveals an unusual type of viral membrane protein. Proc Natl Acad Sci USA 1985;82:4075-9. Lambert Dlvi. Role of oligosaccharides in the structure and function of respiratory syncytial virus glycoproteins. Virology 1988;164:458—66. 96 Teng MN, Collins PL. The central conserved cystine noose of the attachment G protein of human respiratory syncytial virus is not required for efficient viral infection in vitro or in vivo. I Virol 2002;76: 6164—71. Krusat T, Streckert HI. Heparin-dependent attachment of respiratory syncytial virus (RSV) to host cells. Arch Virol 1997;142:1247—54. 98 Feldman SA, Hendry RM, Beeler JA, Identification of a linear heparin binding domain for human respiratory syncytial virus attachment glycoprotein G. J Virol 1999;73:6610-7. Karron RA, Buonagurio DA, Georgiu AF, Whitehead SS, Adamus JE, Clements-Mann ML, Harris DO, Randolph VB, Udem SA, Murphy BR, Sidhu MS. Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evaluation and molecular characterization of a cold-passaged, attenuated RSV subgroup B mutant. Proc Natl Acad Sci USA 1997;94:13961—6. ‘°°Techaarpornkul S, Collins PL, Peeples ME. Respiratory syncytial virus with the fusion protein as its only viral glycoprotein is less dependent on cellular glycosaminoglycans for attachment than complete virus. Virology 2002;294: 296—304. 101 Sugrue RJ. Interactions between respiratory syncytial virus and the host cell: opportunities for antivirus strategies? expert reviews in molecular medicine 2006;8: 1-17. 102 Tripp RA, Jones LP, Haynes LM, Zheng H, Murphy PM, Anderson LI. CX3C chemokine mimicry by respiratory syncytial virus G glycoprotein. Nat Immunol 2001;2:732-8. ‘°Harcourt J, Alvarez R, Jones LP, Henderson C, Anderson U, Tripp RA. Respiratory syncytial virus G protein and3 G protein CX3C motif adversely affect CX3CR1+ T cell responses. I Immunol 2006;176:1600-8. 104Malhotra R, Ward M, Bright H, Priest R, Foster MR, Hurle M, Blair E, Bird M. Isolation and characterisation of potential respiratory syncytial virus receptor(s) on epithelial cells. Microbes Infect 2003;5:123-33. Collins PL, Mottet G: Post-translational processing and oligomerization of the fusion glycoprotein of human respiratory syncytial virus. J Gen Virol 1991;72:3095-101. 106 Gonzalez-Reyes L, Ruiz-Arguello MB, Garcia-Barreno B, Calder L, Lopez JA, Albar JP, Skehel JJ, Wiley DC, Melero IA. Cleavage of the human respiratory syncytial virus fusion protein at two distinct sites is required for activation of membrane fusion. Proc Natl Acad Sci USA 2001;98:9859-64. ‘° Bolt G, Pedersen LO, Birkeslund HH. Cleavage of the respiratory syncytial virus fusion protein is required for its surface expression: role of furin. Virus Res 2000;68:25-33. 108 Thao X, Singh M, Malashkevich VN, Kim PS: Structural characterization of the human respiratory syncytial virus fusion protein core. Proc Natl Acad Sci USA 2000;97:14172-7. 109 Matthews JM, Young TF, Tucker SP, Mackay IP. The core of the respiratory syncytial virus fusion protein is a trimeric coiled coil. I Virol 2000;74:5911-20. 154 110 Lambert DM, Barney S, Lambert AL, Guthrie K, Medinas R, Davis DE, Bucy T, Erickson J, Merutka G, Petteway SR Jr. Peptides from conserved regions of paramyxovirus fusion (F) proteins are potent inhibitors of viral fusion. Proc Nati Acad Sci USA 1996;93:2186-91. Feldman SA, Audet S, Beeler JA. The fusion glycoprotein of human respiratory syncytial virus facilitates virus attachment and infectivity via an interaction with cellular heparan sulfate. J Virol 2000;74:6442—7. 112 Crim RL, Audet SA, Feldman SA, Mostowski HS, Beeler JA. Identification of linear heparin-binding peptides derived from human respiratory syncytial virus fusion glycoprotein that inhibit infectivity. J Virol 2007;81:261-71. 113Thang L, Peeples ME, Boucher RC, Collins PL, Picides RJ. Respiratory syncytial virus infection of human airway epithelial cells is polarized, specific to ciliated cells, and without obvious cytopathology. J Virol 2002;76:5654—6. 114 Pastey MK, Crowe JE Jr, Graham BS. RhoA interacts with the fusion glycoprotein of respiratory syncytial virus and facilitates virus-induced syncytium formation. J Virol 1999;73 :7262—70. 115 Pastey MK, Gower TL, Spearman PW, Crowe JE Jr, Graham BS. A RhoA-derived peptide inhibits syncytium formation induced by respiratory syncytial virus and parainfluenza virus type 3. Nat Med 2000;6:35-40. 116 Gower TL, Peeples ME, Collins PL, Graham BS. RhoA is activated during respiratory syncytial virus infection. Virology 200L283:188—96. 117 Kurt-Jones EA, Popova L, Kwinn L, Haynes LM, Jones LP, Tripp RA,Walsh EE, Freeman MW, Golenbock DT, Anderson U, Finberg RW. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus, Nat. Immunol. 2000; 1:398—401. ‘ Musher DM. How contagious are common respiratory tract infections? N Eng J Med 2003;348:1256-66. 119 Tannock GA, Hierhoizer JC, Bryce DA, Chee C, Paul JA. Freeze-drying of respiratory syncytial viruses for transportation and storage. J Clin Microb 1987;25:1769-71. 20Jvine S, Klaiber-Franco R, Paradiso PR. Demonstration that glycoprotein G is the attachment protein of respiratory syncytial virus. J Gen Virol 1987;68:2521-4. ‘ I, Melero JA.. Binding of human respiratory virus cells: cell surface 21MartInez syncytial to implication of sulfated proteoglycans. J Gen Virol 2000;81:2715—22. 122‘ Roberts SR, Compans RW, Wertz GW. Respiratory syncytial virus matures at the apical surfaces of polarized e?ithelial cells. J Virol 1995;69:2667—73. 1 3 Hickling TP, Clark H, Malhotra R, Sim RB, Collectins and their role in lung immunity. J Leukoc Biol 2004;75:27-33. 24Lawson PR, Reid KB. The roles of surfactant proteins A and D in innate immunity. Immunol Rev 2000;173:66— 78. ‘125 Ghildyal R, Hartley C, Varrasso A, Meanger J, Voelker DR, Anders EM, Mills J. Surfactant protein A binds to the fusion glycoprotein of respiratory syncytial virus and neutralizes virion infectivity. J Infect Dis 1999;180:2009— 13, 126 Hickling TP, Malhotra R, Bright H, McDowell W, Blair ED, Sim RB. Lung surfactant protein A provides a route of entry for respiratory syncytial virus into host cells. Viral Immunol 2000;13:125—35. 127 Hickling TP, Bright H, Wing K, Gower D, Martin SU, Sim RB, Mathotra R. A recombinant trimeric surfactant protein D carbohydrate recognition domain inhibits respiratory syncytial virus infection in vitro and in vivo. Em J Immunol 1999;29:3478—84. 128 Barr FE, Pedigo H, Johnson TR, Shepherd VU. Surfactant protein-A enhances uptake of respiratory syncytial virus by monocytes and U937 macrophages. Am I Respir Cell Mol Biol 2000;23:586—92. 129 Behera AK, Matsuse H, Kumar M, Kong X, Lockey RF, Mohapatra SS. Blocking intercellular adhesion molecule-i on human epithelial cells decreases respiratory syncytial virus infection. Biochem Biophys Res Commun 200 1;280:i88-95. ‘° Suzuki T, Suzuki Y. Virus infection and lipid rafts. Biol Pharm Bull 2006;29:1538-41. ‘‘ Bavari S, Bosio CM, Wiegand E, Ruthel G, Will AB, Geisbert TW, Hevey M, Schmaljohn C, Schmaljohn A, Aman MJ. Lipid raft microdomains: a gateway for compartmentalized trafficking of Ebola and Marburg viruses. J Exp Med 2002;195:593—602 b2 Guerrero CA, Bouyssounade D, Zarate S, Isa P. Lopez T, Espinosa R, Romero P, Mendez E, Lopez 5, Arias CF. Heat shock cognate protein 70 is involved in rotavirus cell entry. I Virol 2002;76:4096—102. ‘ Marjomaki V, Pietiainen V, Matilainen H, Upla P, Ivaska J, Nissinen L,Reunanen H, Huttunen P. Hyypia T, Heino J. Internalization of echovirus 1 in caveolae. J Virol 2002;76:1856—65. ‘Norkin LC, Anderson HA, Woifrom SA, Oppenheim A. Caveolar endocytosis of simian virus 40 is followed by brefeldin A-sensitive transport to the endoplasmic reticulum, where the virus disassembles. J Virol 2002;76:5 156— 66. 155 135 Werling D, Hope JC, Chaplin P, Collins RA, Taylor G, Howard CJ. Involvement of caveolae in the uptake of respiratory syncytial virus antigen by dendritic cells. J Leukoc Biol 1999;66:50-8. 1i6 Brown G, Aitken J, Rixon HW, Sugrue RI. Caveolin-1 is incorporated into mature RSV particles during virus assembly on the surface of virus-infected cells. J Gen Virol 2002;83:611-21. 137 Ulloa L, Serra R, Asenjo A, Villanueva N. Interactions between cellular actin and human respiratory syncytial virus (HRSV). Virus Res 1998;53:13—25. Kallewaard NL, Bowen AL, Crowe JE Jr. Cooperativity of actin and microtubule elements during replication of respiratory syncytial virus. Virology 2005;331:73-81. 819 ‘ Hall CB: Nosocomial respiratory syncytial virus infections: The “cold war” has not ended. Clin Infect Dis 2000; 31:590-6. 140 Kim HW, Canchola JG, Brandt CD, Pyles 0, Chanock RM, Jensen K, Parrott RH. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am J Epidemiol 1969;89:422-34. 141 Meyer G, Deplanche M, Scheicher F. Human and bovine respiratory syncytial virus vaccine research and development. Comp Immunol Microbiol Infect Dis 2008;31:191-225. 142 No authors listed. Prevention of respiratory syncytial virus infections: indications for the use of palivizumab and update on the use of RSV-IGIV. American Academy of Pediatrics Committee on Infectious Diseases and Committee of Fetus and Newborn. Pediatrics 1998;102:1211-6. 143 Elliott MB, Tebbey PW, Pryharski KS, Scheuer CA, Laughlin TS, Hancock GE. Inhibition of respiratory syncytial virus infection with the CC chemokine RANTES (CCL5). J Med Virol 2004;73:300—8. 144 Cohen SA, Zanni R, Cohen A, Harrington M, Vanveldhuisen P, Boron ML; for the Palivizumab Outcomes Registry Group. Palivizumab use in subjects with congenital heart disease : results from the 2000-2004 palivizumab outcomes registry. Pediatr Cardiol 2008;29:382-7. 145 Canada Communicable Disease Report. 2003;29:ACS-7, 8. 146 Venkatesh MP, Weisman LE. Prevention and treatment of respiratory syncytial virus infection in infants: an update. Expert Rev Vaccines. 2006;5:261-8. 147 Garzon LS, Wiles L. Management of respiratory syncytial virus with lower respiratory tract infection in infants and children. AACN Clin Issues. 2002;13:421-30. 148 Broughton S, Greenough A. Effectiveness of drug therapies to treat or prevent respiratory syncytial virus infection-related morbidity. Expert Opin Pharmacother 2003;4:1801-8. 149 Sidwell RW, Barnard DL. Respiratory syncytial virus infections: Recent prospects for control. Antiviral Research 2006;71 :379—390. 150 Bank 5, Bitko V. Prospects of RNA interference therapy in respiratory viral diseases: update 2006. Expert Opin Biol Ther 2006;6:i 151-60. 151 Welliver TP, Garofalo RP, Hosakote Y, Hintz KH, Avendano L, Sanchez K, Velozo L, Jafri H, Chavez-Bueno S, Ogra PL, McKinney L, Reed JL, Welliver RC Sr. Severe human lower respiratory tract illness caused by respiratory syncytial virus and influenza virus is characterized by the absence of pulmonary cytotoxic lymphocyte responses. J Infect Dis 2007;195:1 126—36. 152 Buckingham SC, Jafri HS, Bush AJ, Carubelli CM, Sheeran P, Hardy RD, Ottolini MG, Ramilo 0, DeVincenzo JP. A randomized, double-blind, placebo-controlled trial of dexamethasone in severe respiratory syncytial virus (RSV) infection: effects on RSV quantity and clinical outcome. J Infect Dis 2002;185:1222—8. 153 Corella D, Ordovas JM. Integration of environment and disease into ‘omics analysis. Curr Opin Mol Ther 2005;7:569-76. 154 Hallak LK, Spillmann D, Collins PL, Peeples ME. Glycosaminoglycan sulfation requirements for respiratory syncytial virus infection. J Virol 2000;74:10508—13. 155 Guerrero-Plata A, Casola A, Suarez G, Yu X, Spetch L, Peeples ME, Garofalo RP. Differential response of dendritic cells to human metapneumovirus and respiratory syncytial virus. Am J Respir Cell Mol Biol 2006;34:320- 9. 156 Kaan PM, Hegele RG. Interaction between respiratory syncytial virus and particulate matter in guinea pig alveolar macrophages. Am J Respir Cell Mol Biol 2003;28:697-704. 157 http:/Iwww.si gmaaldrich.corn/sigma/bulletin!edeglybul.pdf 158 Harlow E, Lane D. Using antibodies: a laboratory manual, portable protocol No. 9. Woodbury: Cold Spring Harbor Laboratory Press 1999. 159 Si X, Wang Y, Wong J, Zhang J, McManus BM, Luo H. Dysregulation of the ubiquitin-proteasome system by curcumin suppresses coxsackievirus B3 replication. J Virol. 2007;81:3142-50. 160 Theppanit C, Duncan RS. Serotype-specific entry of dengue virus into liver cells: identification of the 37- kilodalton/67-kilodalton high-affinity laminin receptor as a dengue virus serotype 1 receptor. J Virol 2004;78: 12647—56. 156 161 Waugh MG, Lawson D, Hsuan JJ. Epidermal growth factor receptor activation is localized within low-buoyant density, non-caveolar membrane domains. Biochem. J 1999;337:591-7. 162 Roder C, Krusat T ,Reirners K, Werchau H Purification of respiratory syncytial virus F and G proteins. 3 Chromatography B 2000;737:97—106. 163 http://www 1.giagen.corn/literature/Default.aspx?Terrn=rniniprep&Language=EN&LiteratureType=4%3b8%3b9 %3b 10&ProductCategory=0 164 http:/!www 1.giagen.comlliterature/Default.aspx?Term=gel+extraction&Language=EN&LiteratureType=4%3b8 %3b9%3b 10&ProductCategory=0 165 www.b1uetractorsoftware.co.uk 166 http://www.piercenet.com/files/1275as4.pdf 167 http://www .piercenet.comlproductsfbrowse.cfm?fIdID=0 1041115 168 Pagano M, Gauvreau K. Principles of Biostatistics. Belmont, CA: Duxbury Press, l993.pp.257-72. 169 Pagano M, Gauvreau K. Principles of Biostatistics. Belmont, CA: Duxbury Press, l993.pp.235-56. 170 Pagano M, Gauvreau K. Principles of Biostatistics. Belmont, CA: Duxbury Press, l993.pp.409-26. 171 Pagano M, Gauvreau K. Principles of Biostatistics. Belmont, CA: Duxbury Press, 1993.pp.427-44. 172 McL. Rixon HW, Brown C, Brown G, Sugrue RI. Multiple glycosylated forms of the respiratory syncytial virus fusion protein are expressed in virus-infected cells. I Gen Virol 2002;83:61—6. 173 www.sigmaaldrich.cornlsigma/general%20information/vol4%2oissuel %20proteosilver.pdf 174 GrOnwall C, Sjoberg A, Ramström M, Hoiddn-Guthenberg I, Hober S, Jonasson P, St.h1 S. Affibody-mediated transferrin depletion for proteomics applications. Biotech I. 2007;2:1389-98. 175 Welch S. Genetic variations of human transferrin. In: Transferrin: the iron carrier. CRC Press Boca Raton, Florida. 1992. pp. 187-222. 176 http:!!www.piercenet.cornlProducts/Browse.cfm?fld ID=0 1041101 177 http://www.piercenet.comlProducts!Browse.cfm?fldID=O 1041115 178 Navarrete R, Serrano R. Solubilization of yeast plasma membranes and mitochondria by different types of non- denaturing detergents. Biochim Biophys Acta. I983;728:403-8. 179 Welliver RC. Review of epidemiology and clinical risk factors for severe respiratory syncytial virus (RSV) infection. I Pediatr 2003;143:S112-7. 180 Falsey AR, Walsh EE. Respiratory syncytial virus infection in elderly adults. Drugs Aging 2005;22:577-87. 181 Whimbey E, Ghosh S. Respiratory syncytial virus infections in immunocompromised adults. Curr Clin Top Infect Dis 2000;20:232-55. http://wwwaubwfledu/ac adernic/sciencemath/cosamldepartmentslbi ology/faculty/webpages/roberts/index.html. 82183 Collins PL, Graham BS. Viral and host factors in human respiratory syncytial virus pathogenesis. J Virol 2008;82:2040-55. 184 Esko 3D, Stewart TE, Taylor WH. Animal cell mutants defective in glycosaminoglycan biosynthesis. Proc Nat Acad Sci USA 1985;82:3197-201. 185 Feldman SA, Hendry RM, Beeler IA. Identification of a linear heparin binding domain for human respiratory syncytial virus attachment glycoprotein G. I Virol 1999;73:6610-7. 1l 6 Fingeroth JD, Weiss JJ, Tedder TF, Strominger IL, Biro PA, Fearon DT. Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc Nati Acad Sci USA 1984;81:4510-4. 187 Komai K, Kaplan M, Peeples ME. The Vero cell receptor for the hepatitis B virus small S protein is a sialoglycoprotein. Virology 1988;163:629-34. 188 Superti F, Donelli G. Gangliosides as binding sites in SA-1 1 rotavirus infection of LLC-MK2 cells. J Gen Virol 1991;72:2467-74. 189 Cao W, Henry MD, Borrow P, Yamada H, Elder JH, Ravkov EV, Nichol ST, Compans RW, Campbell KP, Oldstone MBA. IdentiPcation of a-dystroglycan as a receptor for lymphocytic choriomeningitis virus and lassa fever virus. Science 1998;282:2079-8 1. 190 Kunz 5, Rojek 3M, Kanagawa M, Spiropoulou CF,Barresi R, Campbell KP,2 Oldstone MBA. Posttranslational modification of ci-Dystroglycan, the cellular receptor for arenaviruses by the glycosyltransferase LARGE is critical for virus binding. I Virol 2005;79:14282—96. 191 Struck DK, Lennarz WJ. Evidence for the participation of saccharide-lipids in the synthesis of the oligosaccharide chain of ovalbumin. J Biol Chem 1977;252:1007-1 3. 192 Bernhard OK, Diefenbach RI, Cunningham AL. New insights into viral structure and virus-cell interactions through proteomics. Expert Rev Proteomics 2005;2:577-88. 193 Simpson RI, Connolly LM, Eddes IS, Pereira JJ, Moritz RL, Reid GE. Proteomic analysis of the human colon carcinoma cell line (LIM 1215): development of a membrane protein database. Electrophoresis 2000;21:1707-32. 157 Mapoles TB,Krah DL, Crowell RL. Purification of a HeLa cell receptor protein for group B coxsackieviruses. J Virol 1985;55:560-6. 95Ueba 0. Respiratory syncytial virus. II. isolation and morphology of the glycoproteins. Acta Medica Okayama 1980;34:245-54. 196‘ Levine S. Polypeptides of respiratory syncytial virus. J Virol. 1977;21:427-31. 197 Pompach P, Man P, Novak P. Havlicek V, Fiserová A, Bezouska K. Mass spectrometry is a powerful tool for identification of proteins associated with lipid rafts of Jurkat T-cell line. Biochem Soc Trans. 2004;32:777-9. 198 Cherukuri A, Dykstra M, Pierce SK. Floating the raft hypothesis: lipid rafts play a role in immune cell activation. Immunity, 2001;14:657—60. 199 Werling D, Hope JC, Chaplin P, Collins RA, Taylor G, Howard CJ. Involvement of caveolae in the uptake of respiratory syncytial virus antigen by dendritic cells. J Leukoc Biol. 1999;66:50-8. 200Kallewaard NL, Bowen AL, Crowe JE Jr. Cooperativity of actin and microtubule elements during replication of respiratory syncytial virus. Virology 2005;331:73-81. 201 Esser MT, Mon T, Mondor I, Sattentau QJ, Dey B, Berger EA, Boyd MR, Lifson JD. Cyanovirin-N binds to gpl2O to interfere with CD4-dependent human immunodeficiency virus type 1 virion binding, fusion, and infectivity but does not affect the CD4 binding site on gpl2O or soluble CD4-induced conformational changes in J Virol 1999;73:4360-71. O.2 2jl Laliberte JP, McGinnes LW, Morrisoni TG. Incorporation of functional HN-F glycoprotein-containing complexes into Newcastle disease virus is dependent on cholesterol and membrane lipid raft integrity. J Virol 2007;81:10636-48. 203 Burkhart MD, Kayman SC, He Y, Pinter A. Distinct mechanisms of neutralization by mAb specific for sites in the N-terminal or C-terminal domain of murine leukemia virus SU. J Virol 2003;77:3993-4003. 204 Sastre PA, Oomens 0, Wertz GW. The stability of human respiratory syncytial virus is enhanced by incorporation of the baculovirus GP64 protein. Vaccine 2007;25:5025—33. 205 Routledge EG, Willcocks MM, Samson AC, Morgan L, Scott R, Anderson JJ, Toms GL. The purification of four respiratory syncytial virus proteins and their evaluation as protective agents against experimental infection in BALB/c mice. J Gen Virol. 1988;69:293-303. 206 Roberts SR, Lichtenstein D, Ball LA, Wertz GW. The membrane-associated and secreted forms of the respiratory syncytial virus attachment glycoprotein 0 are synthesized from alternative initiation codons. J Virol. 1994;68:4538-46. 207 Walsh EE, Schlesinger JJ, Brandriss MW. Purification and characterization of GP9O, one of the envelope glycoproteins of respiratory syncytial virus. J Gen Virol. 1984;65:761-7. 208 Roder C, Krusat T, Reimers K, Werchau H. Purification of respiratory syncytial virus F and G proteins. J Chromatogr B 2000;737 97—106. 209 Kubo, H., Yamada, Y. K. & Taguchi, F. Localization of neutralizing epitopes and the receptor-binding site within the amino-terminal 330 amino acids of the murine coronavirus spike protein. J. Virol. 1994;68:5403—10. 210 Bonavia, A, Zelus, BD, Wentworth DE, Talbot PJ, Holmes Ky. Identification of a receptor-binding domain of the spike glycoprotein of human coronavirus HCoV-229E. J Virol 2003;77:2530—8 211 Breslin JJ. et al. Human coronavirus 229E: receptor binding domain and neutralization by soluble receptor at 37 degrees C. J. Virol. 2003;77:4435—8. 212 Techaarpornkul S, Barretto N, Peeples ME. Functional analysis of recombinant respiratory syncytial virus deletion mutants lacking the small hydrophobic and/or attachment glycoprotein gene. J Virol. 2001;75:6825-34. 213 Schlender J, Zimmer G, Herrier G, Conzelmann KK. Respiratory syncytial virus (RSV) fusion protein subunit F2, not attachment protein 0, determines the specificity of RSV infection. J Virol 2003;77:4609-16. 214 Brock SC, Heck JM, McGraw PA, Crowe JE. The transmembrane domain of the respiratory syncytial virus F protein is an orientation-independent apical plasma membrane sorting sequence. J Virol 2005;79:12528-35. 215 von Heijne G, Gavel Y. Topogenic signals in integral membrane proteins. Eur. J. Biochem 1988;174:671-8. 216 Martoglio B, Dobberstein B. Signal sequences: more than just greasy peptides. Trends Cell Biol 1998;8:410-5. 217 Pastey MK, Samal SK. Role of individual N-linked oligosaccharide chains and different regions of bovine respiratory syncytial virus fusion protein in cell surface transport. Arch Virol 1997;142:2309-20. 218 Calder U, Gonza’lez-Reyes L, Garci’a-Barreno B, Wharton SA, Skehel JJ, Wiley DC, Melero JA. Electron microscopy of the human respiratory syncytial virus fusion protein and complexes that it forms with mAb. Virology 2000;271:122—31. 219 Khushiramani R, Girisha SK, Karunasagar I, Karunasagar I. Cloning and expression of an outer membrane protein ornpTS of Aeromonas hydrophila and study of immunogenicity in fish. Protein Expr Purif 2007;51:303-7. 220 Pradel N, Ye C, Wu L. A cleavable signal peptide is required for the full function of the polytopic inner membrane protein FliP of Escherichia coli. Biochem Biophys Res Corn 2004;319:1276—80. 158 221 http:llwww.invitrogen.comlcontent/sfs/manuals/pcdna3. ltopota_man.pdf 222 Ternette N, Stefanou D, Kuate S, Uberla K, Grunwald T. Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple stepsVirol J 2007;4:5 1. 223 Brooks SA. Appropriate glycosylation of recombinant proteins for human use: implications of choice of expression system. Mol Biotechnol. 2004;28:241-55. 224 Morton CJ, Cameron R, Lawrence LI, Lin B, Lowe M, Luttick A, Mason A, McKimm-Breschkin I, Parker MW, Ryan I, Smout M, Sullivan I, Tucker SP, Young PR. Structural characterization of respiratory syncytial virus fusion inhibitor escape mutants: homology model of the F protein and a syncytium formation assay Virology 2003;311:275—88. 225 Branigan PJ, Liu C,Day ND, Gutshall LL, Sarisky RT, Del Vecchio AM. Use of a novel cell-based fusion rerorter assay to explore the host range of human respiratory syncytial virus F protein. Virology J 2005;2:54. 22 Haas I, Park EC, Seed B. Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Curr Biol 1996;6:315—24. 227 bluster J, Grabenhorst E, Nimtz M, Conradt H, Jarvis DL. Engineering the protein N-glycosylation pathway in insect cells for production of biantennary, complex N-glycans. Biochem. 2002;41:15093-104. 228 Tan BH, Brown G, Sugrue RJ. Secretion of the respiratory syncytial virus fusion protein from insect cells using the baculovirus expression system. Methods Mol Biol 2007;379:149-61. 229 Peroulis I, Mills I, Meanger I. Respiratory syncytial virus G glycoprotein expressed using the Semliki Forest virus replicon is biologically active. Arch Virol 1999;144:107—16. 20Estd JA, Telenti A. HIV entry inhibitors. Lancet 2007;370:81—8. 2,1 http://www.piercenet.comlProductslBrowse.cfm?fldID=01 041115 2,2 Zhoua JM, Fana YX, Kiharab H, Kimurac K, Amemiyad Y. The compactness of ribonuclease A and reduced ribonuclease A. FEBS Lett 1998;430:275-7. 23 http://www .proteincentre.comlservices/n-terminal-edman.htm 2,4 Shevchenko A, Wilm M, Vorm 0, Mann M. Mass spectrometric sequencing of proteins silver-stained olyacrylamide gels. Anal Chem 1996;1:68:850-8. ‘ http:Ilwww.sigmaaldrich.comlsigma/general%2Oinformation/vol4%2Oissuel %2oproteosilver.pdf 236 Orrick, LR, Olson MO, Busch H. Comparison of nucleolar proteins of normal rat liver and Novikoff hepatoma ascites cells by two-dimensional polyacrylamide gel electrophoresis. Proc Natl Acad Sci USA 1973;70:1316-20. 2,7 Prestayko, A. W., Klomp, G. R., Schmoll, D. I. and Busch, H. (1974). Comparison of proteins of ribosomal subunits and nucleolar preribosomal particles from Novikoff hepatoma ascites cells by two-dimensional polyacrylamide gel electrophoresis. Biochemistry 13, 1945-51. 238 Bugler B, Caizergues-Ferrer M, Bouche G, Bourbon H, Amalric F. Detection and localization of a class of proteins immunologically related to a 100-lcDnucleolar protein. Eur I Biochem 1982;128: 475-80. Kawashima K, Sato S. Izawa M. Properties and functions of a nucleolus-specific phosphoprotein of mouse ascites sarcoma cells. Cell Struct. Funct 1984;9:291-304. 240 Pfeifle I, Anderer FA. Localization of phosphoprotein PP 105 in cell lines of various species. Biochem Biophys Res Commun 1983;116:106-12. 241 Lapeyre B, Amalric F, Ghaffari Sb, Venkatarama Rao SV, Dumbar TS, Olson MOJ. Protein and cDNA sequence of a glycine-rich, dimethylargininecontaining region located near the carboxyl-terminal end of nucleolin (C23 and 100 kD). J Biol Chem 1986;261:9167-73. 242 Jordan G. At the heart of nucleolus. Nature 1987;329:489-90. 243 Ginisty H, Sicard H, Roger B, Bouvet P. Structure and functions of nucleolin. J Cell Sci 1999;112:761-72. 244 Srivastava, M., Fleming, P. J., Pollard, H. B. and Burns, A. L. Cloning and sequencing of the human nucleolin cDNA. FEBS Lett. 1989;250:99-105. 245Lapeyre, B., Bourbon, H. and Amalric, F. Nucleolin, the major nucleolar protein of growing eukaryotic cells: an unusual protein structure revealed by the nucleotide sequence. Proc. Natl. Acad. Sci. USA 1987;84: 1472-6. 246 Harms, G., Kraft, R., Grelle, C., Volz, B., Dernedde, J., and Tauber, R. Identification of nucleolin as a new L selectin ligand. Biochem I 2001;360:531—8. Rao SV, Mamrack MD, Olson MO. Localization of phosphorylated highly acidic regions in the NH2- terminal half of nucleolar protein C23. I Biol Chem 1982;257:15035-41 248 Lischwe, M. A., Roberts, K. D., Yeoman, L. C. and Busch, H. Nucleolar specific acidic phosphoprotein C23 is highly methylated. I Biol Chem 1982;257:14600-2 Leitinger N, Wesierska-Gadek I. ADP-ribosylation of nucleolar proteins in beLa tumor cells. I Cell Biochem 1993;52:153-8. 250 Chen X, Kube DM, Cooper MJ, Davis PB. Cell surface nucleolin serves as receptor for DNA nanoparticles composed of pegylated polylysine and DNA. Mol Ther. 2008;16:333-42. 159 251 Qiu I, Brown KE. A I 10-lcDnuclear shuttle protein, nucleolin, specifically binds to adeno-associated virus type 2 (AAV-2) capsid. Virol 1999;257:373-82. 252 Flovanessian AG, Puvion-Dutilleul F, Nisole S, Svab I, Perret E, Deng I, Krust B. The cell surface expressed nucleolin is associated with the actin cytoskeleton. Exp Cell Res 2000;261,312—28. 253 Mongelard F, Bouvet P. Nucleolin: a multiFACeTed protein. Trends Cell Biol. 2007;17:80-6. 254 Semenkovich CF, Ostlund RE, Olson MO, Yang JW. A protein partially expressed on the surface of HepG2 cells that binds lipoproteins specifically is nucleolin. Biochem 1990;29:9708—13. 255 Kibbey MB, Johnson B, Petryshyn R, Tucker M, Kleinman H. A 110-kD nuclear shuttling protein, nucleolin, binds to the neurite-prornoting IKVAV site of laminin-1. J. Neurosci Res 1995;42:314—22. 256 de Verdugo UR, Selinka HC, Huber M, Kramer B, Kellermann J, Hofschneider PH, Kandolf R. Characterization of a 100-kilodalton binding protein for the six serotypes of coxsackie B viruses. J. Virol. 1995;69:6751—7. 257 Sinclair I, O’Brien A. Cell surface-localized nucleolin is a eukaryotic receptor for the adhesin intimin-’yof enterohemorrhagic Escherichia coli. J Biol Chem 2002;277:2876—85. 258 Nisole S. Krust, B, Dam E, Bianco A, Seddiki N, Loaec S, Callebaut C, Guichard G, Muller 5, Briand JP., Hovanessian AG. The Anti-HIV pseudopeptide HB-19 forms a complex with the cell-surface-expressed nucleolin independent of heparan sulfate proteoglycans. J Biol Chem. 1999;274:27875-84. 259 Bose S, Basu M, Banerjee AK. Role of nucleolin in human parainfluenza virus type 3 infection of human lung ejithelial cells. J Virol 2004;78:8146—58. 2 °Nisole S, Said EA, Mische C, Prevost MC, Krust B, Bouvet P, Bianco A, Briand JP, Hovanessian AG. The anti HIV pentameric pseudopeptide HB- 19 binds the C-terminal end of nucleolin and prevents anchorage of virus in the plasma membrane of target cells. J Biol Chem 2002;277:20877-86. ?articles61 Hirano K, Miki Y, Hirai Y, Sato R, Itoh T, Hayashi A, Yamanaka M, Edal S, Beppu M. A multifunctional shuttling protein nucleolin is a macrophage receptor for apoptotic cells. 3 Biol Chem 2005;280:39284—93. ‘6’ . . . Said EA, Krust B, Nisole S, Briand JP, Hovanessian AG. The anti-HIV cytokine midkine binds the cell-surface- expressed nucleolin as a low affinity receptor, J Biol Chem 2002;277:37492-502. 263 Said EA, Courty 3, Svab 3, et al. Pleiotrophin inhibits HIV infection by binding the cell surface expressed nucleolin. FEBS J 2005; 272:4646-59. 264 Legrand D, Vigie K, Said EA, et al. Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells. Eur J Biochem 2004;271 :303-17. 265 Shi H, Huang Y, Zhou H, Song X, Yuan 5, Fu Y, Luo Y. Nucleolin is a receptor that mediates antiangiogenic and antitumor activity of endostatin. Blood 2007;1 10:2899-2906. 266 Ugrinova I, Monier K, Ivaldi C, Thiry M, Storck 5, Mongelard F, Bouvet P. Inactivation of nucleolin leads to nucleolar disruption, cell cycle arrest and defects in centrosome duplication. BMC Mol Biol 2007;8:66. 267 Chi JT, Chang HY, Wang NN, Chang DS, Dunphy N, Brown P0. Genomewide view of gene silencing by small interfering RNAs. Proc. Natl. Acad. Sci. 2003;100:6343-6. 268 Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW. Specificity of short interfering RNA determined through gene expression signatures. Proc. Natl. Acad. Sci. 2003;100:6347-52. 269 Jackson AL, Bartz SR, Schelter 3, Kobayashil SV, Burchardi J, Mao M, Li B, Cavet G, Linsley PS. Expression profiling reveals off-target gene regulation by RNAi. Nat. Biotechnol. 2003;21 :635-637. 7O Alan 3 Bridge, Stephanie Pebernard, Annick Ducraux, Anne-Laure Nicoulaz & Richard Iggo. Induction of an interferon response by RNAi vectors in mammalian cells. Nature Genetices 2003;34:263-4 271 Sledz CA, Holko M, de Veer MI, Silverman RH, Williams BRG. Activation of the interferon system by short- interfering RNAs. Nature Cell Biol 2003;5:834-9. 272 Karron RA, Bounagurio DA, Georgius AF, Whitehead SS, Adamus JE, Clements-Mann ML, Harris DO, Randolph VB, Udem SA, Murphy BR, Sidhu MS. Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro : clinical evaluation and molecular characterization of a coldpassaged attenuated RSV subgroup B mutant. Proc Nat Acad USA 1997;94:13961-6. 273 Pauza CD, Price TM. Human immunodeficiency virus infection of T cells and monocytes proceeds via receptor- mediated endocytosis. 3 Cell Biol 1988;107:959-68. 274 Tamura M, Natori K,Kobayashi M, Miyamura T, Takedal N. Interaction of recombinant Norwalk virus particles with the 105-kilodalton cellular binding protein, a candidate receptor molecule for virus attachment. 3 Virol 2000;74:1 1589-97. Ceman 5, Brown V, Warren ST. Isolation of an FMRP-associated messenger ribonucleoprotein particle and identification of nucleolin and the fragile X-related proteins as components of the complex. Mol Cell Biol 1999;19:7925—32. 276 Batonick M, Oomens AG, Wertz GW. Human respiratory syncytial virus glycoproteins are not required for apical targeting and release from polarized epithelial cells. 3 Virol. 2008;82:8664-72. 160 Appendix A. Maps of Vectors Part of Map of PCR3TMFC vector I 173 II II II II II I i II I III II I 1111 1 HndIH Hohi *AarI HpyAV MscI StaN! BsIEI ‘Bani Bsll HpyCH4V Rsa! BsoB! NotI Bbvl BbvC! Gsa! CviQ! Hpyi 88!!! Eag Dde! BsrnAi BstYI BstiJl GoulD! EcoPi5! BarnH[ j Bcci [-#ScrFi BstX! BmtI BstNI Btgl BfaI StyD4l Sty! Nhel -#PspGi Neol Eck! -#BssKl Ms!I BsCi GspCNI TspGWl ApeKi Tse! 1280IBsp Brnei 5801 The insert was cloned in frame between NheI and BamHI to use a CD5 leader. 161 Appendix B. Sequences and Primers Human RSV (strain A2) F protein coding sequence (Accession No. Ml 1486) 1 ggggcaaata acaatggagt tgctaatcct caaagcaaat gcaattacca caatcctcac 61 tgcagtcaca ttttgttttg cttctggtca aaacatcact gaagaatttt atcaatcaac 121 atgcagtgca gttagcaaag gctatcttag tgctctgaga actggttggt ataccagtgt 181 tataactata gaattaagta atatcaagga aaataagtgt aatggaacag atgctaaggt 241 aaaattgata aaacaagaat tagataaata taaaaatgct gtaacagaat tgcagttgct 301 catgcaaagc acaccaccaa caaacaatcg agccagaaga gaactaccaa ggtttatgaa 361 ttatacactc aacaatgcca aaaaaaccaa tgtaacatta agcaagaaaa ggaaaagaag 421 atttcttggt tttttgttag gtgttggatc tgcaatcgcc agtggcgttg ctgtatctaa 481 ggtcctgcac ctagaagggg aagtgaacaa gatcaaaagt gctctactat ccacaaacaa 541 ggctgtagtc agcttatcaa atggagttag tgtcttaacc agcaaagtgt tagacctcaa 601 aaactatata gataaacaat tgttacctat tgtgaacaag caaagctgca gcatatcaaa 661 tatagaaact gtgatagagt tccaacaaaa gaacaacaga ctactagaga ttaccaggga 721 atttagtgtt aatgcaggtg taactacacc tgtaagcact tacatgttaa ctaatagtga 781 attattgtca ttaatcaatg atatgcctat aacaaatgat cagaaaaagt taatgtccaa 841 caatgttcaa atagttagac agcaaagtta ctctatcatg tccataataa aagaggaagt 901 cttagcatat gtagtacaat taccactata tggtgttata gatacaccct gttggaaact 961 acacacatcc cctctatgta caaccaacac aaaagaaggg tccaacatct gtttaacaag 1021 aactgacaga ggatggtact gtgacaatgc aggatcayta tctttcttcc cacaagctga 1081 aacatgtaaa gttcaatcaa atcgagtatt ttgtgacaca atgaacagtt taacattacc 1141 aagtgaaata aatctctgca atgttgacat attcaacccc aaatatgatt gtaaaattat 1201 gacttcaaaa acagatgtaa gcagctccgt tatcacatct ctaggagcca ttgtgtcatg 1261 ctatggcaaa actaaatgta cagcatccaa taaaaatcgt ggaatcataa agacattttc 1321 taacgggtgc gattatgtat caaataaagg gatggacact gtgtctgtag gtaacacatt 1381 atattatgta aataagcaag aaggtaaaag tctctatgta aaaggtgaac caataataaa 1441 tttctatgac ccattagtat tcccctctga tgaatttgat gcatcaatat ctcaagtcaa 1501 cgagaagatt aaccagagcc tagcatttat tcgtaaatcc gatgaattat tacataatgt 1561 aaatgctggt aaatccacca caaatatcat gataactact ataattatag tgattatagt 1621 aatattgtta tcattaattg ctgttggact gctcttatac tgtaaggcca gaagcacacc 1681 agtcacacta agcaaagatc aactgagtgg tataaataat attgcattta gtaactaaat 1741 aaaaatagca cctaatcatg ttcttacaat ggtttactat ctgCtCatag acaacccatc 1801 tgtcattgga ttttcttaaa atctgaactt catcgaaact ctcatctata aaccatctca 1861 cttacactat ttaagtagat tcctagttta tagttatat 14-79: Signal Petide 80-421: F2 subunit 422-1735: Fl subunit 1601-1663: Transmembrane domain 1664-1735: Cytoplasmic domain 162 Primers forward and reverse for Fe vector: Forward (with Nhe I recognition site underlined) 5’ gct agc aca atg gag ttg cta atc ctc aaa 3’ Reverse (with BamH I recognition site underlined>: 5’ gga tcc agt agt tat cat gat att tgt 3’ Primers forward and reverse for TA cloning vector: Forward: 5’ aca atg gag ttg cta atc ctc aaa 3’ Reverse: 5’ agt agt tat cat gat att tgt 3’ Primers forward and reverse for Fe vector (without signal peptide): Forward (with Nhe I recognition site underlined) 5’ ga gct agc tgt ttt gct tct ggt caa aac 3’ Reverse (with BamH I recognition site underlined): 5’ gt gga tcc gtt act aaa tgc aat att att 3’ Primers forward and reverse for TA cloning vector (without signal peptide): Forward (underlined is the Kozak consensus 1sequence 5’ gaa atg ggt ttt gct tct ggt caa aac 3’ ) Reverse: 5’ gtt act aaa tgc aat att att 3’ ‘http:!/www.invitrogen.comlcontent/sfs/manuals/pcdna3. itopota man.pdf 163 Appendix C. Sequencing Results Fc NNNNNNNNNNGCGGNGNNNNCTGCCCNGGCTGAGGCAAGAGAAGGCCAGAAACCATGCCCATGGGGTCTCT GCA2CCGCTGGCCACCTTGTACCTGCTGGGGATGCTGGTCGCTTCCGTGCTAGCGGATCCCGAGGAGCCCA AATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTC CTCTTCCCCCCAAAACCCA1GGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGA CGTGAGCCACGAAGACCCTGAGGTCAAGTTCACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGA CAAAGCCGCGGGAGGAGCAGTACJACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGAC TGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAAC1AAGCCCTCCCAGCCCCCATCGAGAAAACCAT CTCCAàAGCCAAAGGGCAGCCCCGAG1ACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCA AGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCAACATCGCCGTGGAGTGGGAGAGC AATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTA CAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGG CTCTGCACAACCACTACACGCAGAAGAGCCCCTCCCTGTCTCCGGGThAATGAGTGCGACGGCCGCGACTC GAGAGGATCTTTGTGAAGGGCCCTATTCTATAGTGTCACCTAAATGCTAGAGCTCGCTGATCAGCCTCGAC TGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTNGNNNTGCCAC TCCCACTGTCCTTTNCTAATAAATGNGAMNTGCATCGCATTGTCTGANTAGNNGTCATTCTATTCTGGGG GGTGGGGNGGGGCAGG1NAGCAAGGGGGNNNANTGGNNNGANAATNN TOPOF3 T7 prim NNNNNANNNNNNTAGCTTGGTACCGAGCTCGGATCCNCTAGTCCAGTGTGGTGGAATTGCCCTTGAATGG GTTTTGCTTCTGGTCACCATCACTGI\AGAATTTTATCAATCAACATGCAGTGCAGTTAGCMAGGCTAT CTTAGTGCTCTGAG1ACTGGTTGGTATACCAGTGTTATAACTATAGAATT1AGTAATATCAAGGAZAATAA JTTGCAGTTGCTCACGCAAGCACACCAGCAACAAACAATCGAGCCAGAAGAGAACTACCPAGGTTTATG AATTATACACTCAACAATGCCAAAAAAACCAATGTAACATTZAGCAAGAAAAGGAAAAGAAGATTTCTTGG TTTTTTGTTAGGTGTTGGATCTGCAATCGCCAGTGGCGTTGCTGTATCTAAGGTCCTGCACCTAGAAGGGG AAGTGAACAAGATCAAAGTGCTCTACTATCCACAAACAAGGCTGTAGTCAGCTTATCAAATGGAGTTAGT GTCTTAACCAGCAAAGTGTTAGACCTCAAAAACTATATAGATAAACAATTGTTACCTATTGTGAACAAGCA AAGCTGCAGCATATCAAATATAGAAACTGTGATAGAGTTCCZACAAAAGAACA1CAGACTACTAGAGATTA CCAGGGAATTTAGTGTTAATGCAGGTGTAACTACACCTGTAàGCACTTACATGTTAACTAATAGTGAATTA TTGTCATTAATCAATGATATGCCTATAACAAATGATCAGAAAAAGTTAATGTCCAACAATGTTCAAATAGT TAGACAGCAAAGTTACTCTATCATGTCCATAATMAAGAGGAAGTCTTAGCATATGTAGTACZATTACCAC TATATGGTGTTATAGATACACCCTGTTGGMACTACACACATCCCCTCTATGTACNACCAACACAA.AAGNN NTCCAACATCTGTTNACNNANTGACAGAGGATGNTACTGTGACATGCNNNTCAGTATCTTTCNNNCACAGC TGAANCATGTAAGTTCANCATCGAGTATTTGNGANNNNNANAGTTNANATTACCNNTGAAGTAATCTCTG CATNNNANNATTCNNCCCNNNNN TOPF3 BGH Sequence NNNNNNNNTACTCATGGTGATGGTGANGATGACCGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGG ATAGGCTTACCTTCGAACCGCGGGCCCTCTAGACTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATT GCCCTTGTTACTAAATGCAATATTATTTATACCACTCAGTTGATCTTTGCTTAGTGTGACTGGTGTGCTTC TGGCCTTACAGTATAAGAGCAGTCCAACAGCAATTAATGATAACAATATTACTAThATCACTATAATTATA GTAGTTATCATGATATTTGTGGTGGATTTACCAGCATTTACATTATGTAAThATTCATCGGATTTACGA7T AAATGCTAGGCTCTGGTThATCTTCTCGTTGACTTGAGATATTGATGCATCAAATTCATCAGAGGGAATAC TAATGGGTCATAGAAATTTATTATTGGTTCACCTTTTACATAGAGACTTTTACCTTCTTGCTTATTTACAT AATATAATGTGTTACCTACAGACACAGTGTCCACCCCTTTATTTGATACAT?ATCGCACCCGTTAGAMAT GTCTTTATGATTCCACGATTTTTATTGGATGCTGTACATTTAGTTTTGCCATAGCATGACACAATGGCTCC TAGAGATGTGATAACGGAGCTGCTTACATCTGTTTTTGAAGTCATAATTTTACAATCATATTTGGGGTTGA ATATGTC1ACATTGCAGAGATTTACTTCACTTGGTAATGTTAAACTGTTCATTGTGTCACAJATACTCGA TTTGATTGAACTTTACATGTTTCAGCTTGTGGGAAGWGATACTGATCCTGCATTGTCACAGTACCATCC TCTGTCAGTTCTTGTTMACAGATGTTGGACCCTTCTTTTGTGTTGGTTGTACATAGAGGGGATGTGTGTA GTTTCCAACAGGTGTATCTATA2CACCATATAGTGGTAATTGTACTACATATGCTAAGACTTCCTCTTTAT 164 TATGGACATGATAGAGTAACTTTGCTGTCTAACTATTTGAACATTGTNGACATTAACTTTTTCTGATCATT TGTNATNNNATATCATTGATANGACANATTCACTATANTAACATGTAAGTGCTTACAGGTGTAGTACNCCT GCATTAAN TOPOF4 T7 primer NNNNNNNNNNNNNAGCTTGGTACCGAGCTCGGATCCNCTAGTCCAGTGTGGTGGJATTGCCCTTGTTACTA AATGCAATATTATTTATACCACTCAGTTGATCTTTGCTTAGTGTGACTGGTGTGCTTCTGGCCTTACAGTA TAAGAGCAGTCCAACAGCAATTAATGATAACAATATTACTATAATCACTATAATTATAGTAGTTATCATGA TATTTGTGGTGGATTTACCAGCATTTACATTATGTAATAATTCATCGGATTTACGAATAAATGCTAGGCTC TGGTTAATCTTCTCGTTGACTTGAGATATTGATGCATCAAATTCATCAGAGGGGAATACTAATGGGTCATA GAAZTTTATTATTGGTTCACCTTTTACATAGAGACTTTTACCTTCTTGCTTATTTACATAZTATAATGTGT TACCTACAGACACAGTGTCCACCCCTTTATTTGATACATAATCGCACCCGTTAGAAAATGTCTTTATGATT CCACGATTTTTATTGGATGCTGTACATTTAGTTTTGCCATAGCATGACACAATGGCTCCTAGAGATGTGAT AACGGAGCTGCTTACATCTGTTTTTGAAGTCATAATTTTAC1ATCATATTTGGGGTTGAATATGTCAACAT TGCAGAGATTTACTTCACTTGGTA1’JGTThAACTGTTCATTGTGTCACAA1TACTCGATTTGATTGA7CT TTACATGTTTCAGCTTGTGGGAAGIAZGATACTGATCCTGCATTGTCACAGTACCATCCTCTGTCAGTTCT TGTTAAACAGATGTTGGACCCTTCTTTTGTGTTGGTTGTACATAGAGGGGATGTGTGTAGTTTCCAACAGG GTGTATCTATAACACCATATAGTGGTAATTGTACTACATATGCTAAGACTTCCTCTTTTATTATGGACATG ATAGGGTAACTTTGCTGTCT1ACTATTTGAACATTGTTGGACATThACTTTTTCTGATCATTTGTTATAGG CATATCATTGATTAATGACATANTCACTANTAGTNANCATGTANTGCTTACNGTGTAGTTACNCTGCATNN NCTAANTNCCTGTATCTNTAGTAGTCTGNTNTTCTTTGTNNNTCTATCNCANTTNCTATATTTGANNTGCT GCAGCTTTGCTGNNANANANNNAANNN TOPF4 BGH Sequence NNNNNNNNANTCNNGGTGATGGTGATGATGACCGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGA TAGGCTTACCTTCGAACCGCGGGCCCTCTAGACTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTG AGCAAGGCTATCTTAGTGCTCTGAGAACTGGTTGGTATACCAGTGTTATAACTATAGAATTAAGTAATAT CAAGGAAAATAAGTGTAATGGMCAGATGCTAAGGTAAA)TTGATAAAACAAGAATTAGATAAATATAAAA ATGCTGTAACAGAATTGCAGTTGCTCACGCAAGCACACCAGCAACAAACAATCGAGCCAGAAGAGAACTA CCAAGGTTTATGAATTATACACTCAACAATGCCAAAAAAACCAATGTIACATTA1GCAZG1A1GGAAAZA AAAATTTCTTGNTTTTTTGTTAGGGGTTGGATCTGCAATCGCCAGTGGCGTTGCTGTATCTAAGGTCCTGC ACCTAGAGGGGAAGTGAAC2A1ATCAAAAGTGCTCTACTATCCACAAACAAGGCTGTAGTCAGCTTATCA AATGGAGTTAGTGTCTTAACCAGCAAGTGTTAGACCTCAAAAACTATATANATAAACAATTGTTACCTAT TGNGAACAAGCAAAGCTGCAGCATATCAAATATAGAAACTGTGATAGAGTTCCAACAAAAGAACAACANAC TACTANAGATTACCAGGGMTTTANNGTTAATGCAGGTGTAACTACNCCTGT.AGCACTTACATGTThACT AATANNGAATTATTGTCATTAATCAATGATATGCCTATAZCkZTGATCANAAAGTTAATGTCCANN\ATG TTCAATAGTTAGACAGCAAANTTACCCTATCATGTCCATNAThAANANGANNCTANCATATGTAGTACAN TACNCTNNNTGGNNTNNAGATACNCCNTGTGNAACTACNNNNNTCCCNNTATGTANACNNNNNAANNNNTC ANNTCTGNTNNNNANTGANNNGNNGNACTGNGANATGCNGNTCAGTANNTTCTNNNNGCTGANNTGNNNTC ATNN TA1 T7 primer NNNNNNNNNNNNAGCTTGGTACCGAGCTCGGATCCNCTAGTCCAGTGTGGTGGAATTGCCCTTACAATGGA GTTGCTAATCCTCAAAGCAAATGCAATTACCACAATCCTCACTGCAGTCACATTTTGTTTTGCTTCTGGTC AACATCACTG2AGAATTTTATCAATCAACATGCAGTGCAGTTAGCAAAGGCTATCTTAGTGCTCTGAGA ACTGGTTGGTATACCAGTGTTATAACTATAGAATTAAGTAATATCAAGGAAMThAGTGTAZTGGIACAGA CGCA7-\AGCACACCAGCAACAAACAATCGAGCCAGAAGAGAACTACCAAGGTTTATGAATTATACACTCAAC AATGCCJAAAAACCAATGTAACATThAGCAAGAAAAGGAAAZGIJkGATTTCTTGGTTTTTTGTTAGGTGT TGGATCTGCAATCGCCAGTGGCGTTGCTGTATCTAAGGTCCTGCACCTAGAAGGGGJSAGTGAACAAGATCA AAAGTGCTCTACTATCCACAAACAAGGCTGTAGTCAGCTTATCAAATGGAGTTAGTGTCTTAACCAGCAAA GTGTTAGACCTCAAAAACTATATAGATA1ACAATTGTTACCTATTGTGAACAAGCAAAGCTGCAGCATATC AAATATAGAIACTGTGATAGAGTTCCAACAAAAGAACAACAGACTACTAGAGATTACCAGGGAATTTAGTG TTAATGCAGGTGTACTACACCTGTAGCACTTACATGTTCTATAGTGMTTATTGTCATTITCAAT GATATGCCTATAACAAATGATCAGAAAAAGTTAATGTCCAACAATGTTCAAATAGTTAGACAGCAAAGTTA 165 CTCTATCATGTCCATAATAPAAGAGGAAGTCTTAGCATATGTAGTACAATTACCACTATATGGTGTTATAG ATACACCCTGTTGGAAACTACACACATCCCCNTCTATGTACAACCAACACAA1GNNNGNNCAACATCTGTT NACANANTGANNGAGGATGGTACTGNGANNTGCNNNTCAGTATCTTTNTNCCNNAGCTGAANATGTAAAGT NNANCAANTCGAGTATTTNNNNANNNNNANANNTNANNTNNNANNNANTAATNNNCNGCANNNNANNNNTC NANCCNNNNNTNNN TA1 BGFI Sequence NNNNNNNACTCATGGTGANGGTGANGATGACCGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGAT AGGCTTACCTTCGAACCGCGGGCCCTCTAGACTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTGC CCTTAGTAGTTATCATGATATTTGTGGTGGATTTACCAGCATTTACATTATGThAThATTCATCGGATTTA CGAATAAATGCTAGGCTCTGGTThATCTTCTCGTTGACTTGAGATATTGATGCATCAAATTCATCAGAGGG GAZTACTAATGGGTCATAGAAATTTATTATTGGTTCACCTTTTACATAGAGACTTTTACCTTCTTGCTTAT TTACATAATAThATGTGTTACCTACAGACACAGTGTCCACCCCTTTATTTGATACATAATCGCACCCGTTA GAAAATGTCTTTATGATTCCACGATTTTTATTGGATGCTGTACATTTAGTTTTGCCATAGCATGACACAAT GGCTCCTAGAGATGTGATAACGGAGCTGCTTACATCTGTTTTTGAAGTCATAATTTTACAATCATATTTGG GGTTGAATATGTCAACATTGCAGAGATTTACTTCACTTGGThATGTTAAACTGTTCATTGTGTCACAAAAT ACTCGATTTGATTGAACTTTACATGTTTCAGCTTGTGGGAAGAAAGATACTGATCCTGCATTGTCACAGTA CCATCCTCTGTCAGTTCTTGTTAAACAGATGTTGGACCCTTCTTTTGTGTTGGTTGTACATAGAGGGGATG TGTGTAGTTTCCAACAGGGTGTATCTATAACACCATATAGTGGTAATTGTACTACATATGCTAAGACTTCC TCTTTTATTATGGACATGATAGAGTAACTTTGCTGTCTAACTATTTGAACATTGTTGGACATTAACTTTTT CTGATCATTTGTTATAGGCATATCATTGATTAATGACAATAATTCACTATTAGTTAACATGTAAGTGCTTA CAGGTGTAGTTACACCTGCATTAACACTAAATTCCCTGGTAATCTCTAGTAGTCTGTTGTNCTTTTGTTGG AACTCTATCACAGTTTCTATATTTGATATGCTGCAGCTTTGCTNNCANATAGGTAACNATNNTTNNNNNNN NNANTTTTGANGTCTAACACTTTGCTGGNTAANANNCTAACNNCATTTGANAAGCTGANNNCNGCCTNNNT TNNNGANANNNNNNNNNNNNNNANNN 166 Appendix D. MS Results Protein hits reported for non-reduced plasma sample prepared from in-gel chemiluminescent detection using anti-transferrin antibodies. AAN17824 AF542068 HID: - Bos Taurus Keratin, type II cytoskeletal 1 (Cytokeratin 1) K2C1 HUMAN (Ki) (CK 1) (67 kDa cytokeratin) (Hair alpha )rotein S57632 serum albumin precursor - cat CAA76841 CFY17737 HID: - Canis familiaris TFHUP transferrin precursor [validated] - human ABHUS serum albumin precursor [validated] - human trypsin (EC 3.4.21.4) precursor - pig (tentative TRPGTR sequence) Q6EIY9 CANFA Epithelial keratin 1.- Canis familiaris (Dog) - Q5U3X3 RAT Albumin.- Rattus norvegicus (Rat). 146732 Ig gamma heavy chain constant region - rabbit (fragment) Q95VB7 SCHMA Albumin.- Schistosoma mansoni (Blood fluke). TRRT2 trypsin (EC 3.4.21.4) II precursor — rat BAA19418 AB001594 HID: - Homo sapiens Q7Z794 HUMAN Keratin lb.- Homo sapiens (Human) type 1 1) K2C1 MOUSE Keratin, Ilcytoskeletal (Cytokeratin (67 kDa cytokeratin) .- Mus musculus (Mouse) Q9Z1R9 MOUSE Trypsinogen 16.- Mus musculus (Mouse). Q5WSG5 LEGPL Type II alpha-keratin hA.— Gallus gallus Q6PVZ5 CHICK (Chicken) 10 days neonate skin cONA, RIKEN full-length enriched clone:4732456N10 Q8BIS2 MOUSE library, product:similar to KERATIN, TYPE II CYTOSKELETAL 6D (CYTOKERATIN 6D) (CK 6D) (K6D KERATIN).- Mus musculus (Mouse). type 8 8) K2C8 MOUSE Keratin, II cytoskeletal (Cytokeratin (Cytokeratin endo A) .- Mus musculus (Mouse) K4RB Ig kappa—B4 chain C region - rabbit (EC (D1O2N) 2TRM trypsin 3.4.21.4) mutant (with benzamidine,_pH_8) - black_rat Hypothetical L0C496627.- Xenopus tropicalis Q5M959 XENTR (Western clawed frog) (Silurana tropicalis) TrylO-like trypsinogen Mus musculus Q7M754 MOUSE precursor.- (Mouse) Q792Z0 MOUSE Trypsinogen 11.- Mus musculus (Mouse). Similar to CA380711PF9225 Candida albicans Q6BT26 DEBHA 1PF9225 unknown function.- Debaryomyces hansenii (Yeast) (Torulaspora hansenii) CAHO6 830 018740 CANFA Keratin.- Canis familiaris (Dog) 167 Protein hits reported for reduced plasma sample prepared from in-gel chemiluminescent detection using anti-transferrin antibodies. AAN17824 AF542068 NID: - Bos Taurus Keratin, type II cytoskeletal 1 (Cytokeratin 1) (Ki) K2C]. HUMAN (CK 1) (67 kDa cytokeratin) (Hair alpha protei S57632 serum albumin precursor — cat A44861 keratin, 67K type II epidermal — human CAA76841 CFY17737 NID: - Canis familiaris ABHUS serum albumin precursor [validated] — human Q6EIY9 CANFA Epithelial keratin 1.- Canis familiaris (Dog) Q5U3X3 RAT Albumin.- Rattus norvegicus (Rat) trypsin (EC 3.4.21.4) precursor - pig (tentative TRPGTR sequence) Q7Z794 HUMAN Keratin lb.- Homo sapiens (Human) KRHUO keratin 10, type I, cytoskeletal — human Mus musculus 0 day neonate head cDNA, RIKEN full- Q9D2K8 MOUSE length enriched library, clone:4833436C19 product: Keratin, type II cytoskeletal 1 (Cytokeratin 1) (67 K2C1 MOUSE :Da cytokeratin) .- Mus musculus (Mouse) Q95VB7 SCHMA Albumin.- Schistosoma mansoni (Blood fluke) TFHUP transferrin precursor [validated] - human 161771 keratin 6f, type II — human Q61G03 RAT Type II keratin Kb36.- Rattus norvegicus (Rat). Keratin, type 8 (Cytokeratin 8) K2C8 MOUSE II cytoskeletal (Cytokeratin endo A) .- Mus musculus (Mouse) Ig gamma heavy chain constant region - rabbit 146732 (fragment) TRRT2 trypsin (BC 3.4.21.4) II precursor — rat Q5XQN5 BOVIN Keratin 5.- Bos taurus (Bovine). Q6PVZ5 CHICK Type IT alpha-keratin hA.- Gallus gallus (Chicken). Mus musculus 10 days neonate skin cDNA, RIKEN full- Q8BIS2 MOUSE length enriched library, clone:4732456N10 produc Q9Z1R9 MOUSE Trypsinogen 16.- Mus musculus (Mouse) Q6PVZ3 CHICK Type II aipha-keratin IIC.- Gallus gallus (Chicken). BAA19418 AB001594 NID: - Homo sapiens Q9OZF7 RANCA Keratin 8.- Rana catesbeiana (Bull frog). Q5WSG5 LEGPL Keratin type lIE (Fragment) .- Acipenser baerii Q7SYF6 ACIBE (Siberian sturgeon) K4RB Ig kappa-34 chain C region - rabbit TrylO-like precursor.- Mus musculus Q7M754 MOUSE trypsinogen (Mouse) Q792Z0 MOUSE Trypsinogen 11.- Mus musculus (Mouse) Q61869 MOUSE Keratin 2 epidermis.- Mus musculus (Mouse) 018740 CANFA Keratin.- Canis familiaris (Dog) (Fragment) .- Notophthalmus 042435 NOTVI Cytokeratin type II iiridescens (Eastern newt) (Triturus viridescens) (EC (D1O2N) 2TRN trypsin 3.4.21.4) mutant (with benzamidine,_pH_8) - black_rat Hypothetical L0C496627.- Xenopus tropicalis (Western Q5M959 XENTR clawed_frog)__(Silurana_tropicalis) ABXL68 68K serum albumin precursor - African clawed frog 168 Protein hits reported for the sample prepared from HEp-2 cells at 115 kDa which contained integrin-beta 1. 1P100013808 Tax Id=9606 Alpha-actinin-4 1P100021290 Tax Id=9606 ATP-citrate synthase 1P100013508 Tax Id=9606 Alpha-actinin--l 1P100554702 Tax Td=9606 solute carrier family 3 (activators of dibasic and neutral amino acid transport), membe 1P100010418 Tax Id=9606 Myosin Ic Tax Id=9606 CDNA FLJ45706 fis, clone FEBRA2028457, 1P100444262 highly_similar_to_Nucleolin 1P100645078 Tax Id=9606 Ubiquitin-activating enzyme El 1P100025054 Tax Id=9606 Isoform Long of Heterogenous nuclear ribonucleoprotein U 1P100218342 Tax Id=9606 C-l-tetrahydrofolate synthase, cytoplasmic 1P100019884 Tax Id=9606 Aipha-actinin-2 Tax Id=9606 Alkaline phosphatase, placental type 1P100007289 precursor 1P100220327 Tax Id=9606 Keratin, type II cytoskeletal 1 1P100009865 Tax Id=9606 Keratin, type I cytoskeletal 10 IPI000i3495 Tax Id=9606 Isoform 2 of ATP-binding cassette sub family F member 1 1P100019359 Tax Id=9606 Keratin, type I cytoskeletal 9 1P100010740 Tax Id=9606 Isoform Long of Splicing factor, proline and glutamine-rich 1P100032137 Tax Id=9606 Alpha-actinin-3 Tax Id=9606 NAD(P) transhydrogenase, mitochondrial IPIOO33754i recursor 1P100002966 Tax Id=9606 Heat shock 70 kDa protein 4 1P100298622 Tax Id=9606 Intestinal alkaline phosphatase precursor 1P100017297 Tax Id=9606 Matrin-3 Tax Id=9606 Isoform 3 of Neutral alpha-glucosidase AB 1P100441414 precursor Tax Id=9606 Isoform 1 of Neutral alpha-glucosidase AB 1P100383581 precursor 1P100329672 Tax Id=9606 Myosin le IPI000i69iO Tax Id=9606 Eukaryotic translation initiation factor 3 subunit 8 1P100017303 Tax Id=9606 DNA mismatch repair protein Msh2 1P100329200 Tax_Id=9606 Importin beta—3 1P100021304 Tax Id=9606 Keratin, type II cytoskeletal 2 epidermal Tax Id=9606 Isoform Beta-lC of Integrin beta-i 1P100217561 recursor Tax Id=9606 ubiquitin and ribosomal protein S27a 1P100179330 precursor 1P100017451 Tax Id=9606 Splicing factor 3 subunit 1 1P100003519 Tax Id=9606 116 kDa U5 small nuclear ribonucleoprotein component 1P100298961 Tax Id=9606 Exportin-l 169 Tax_Id=9606 Keratin, type II cytoskeletal 8 IPI00554648 Tax_Id=9606 Isoform Long of Trifunctional purine IPI00025273 biosynthetic protein adenosine-3 IPI00030910 Tax_Id=9606 GPI-anchored protein pl37 IPI00018829 Tax_Id=9606 Isoform 1 of Spectrin beta chain, brain 3 IPI00215948 Tax_Id=9606 Isoform 1 of Alpha-1 catenin IPI00012837 Tax_Id=9606 Kinesin heavy chain IPI00295851 Tax Id=9606 Coatomer subunit beta Tax_Id=9606 Isoform SERCA2A of IPI00177817 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 IPI00218993 Tax_Id=9606 Isoform Beta of Heat-shock protein 105 kDa Tax_Id=9606 Lon protease homolog, mitochondrial IPI00005158 precursor Tax_Id=9606 Isoform SERCA2B of IPI00219078 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Tax_Id=9606 Isoform Beta of Nucleolar phosphoprotein IPI00216654 p!30 IPI00306369 Tax_Id=9606 N0Ll/N0P2/Sun domain family 2 protein IPI00186290 Tax_Id=9606 Elongation factor 2 IPI00013214 Tax_Id=9606 DNA replication licensing factor MCM3 IPI00396370 Tax__Id=9606 Isoform 1 of Eukaryotic translation initiation factor 3 subunit 9 Tax_Id=9606 Gene_Symbol=CCDC110 Isoform 1 of Coiled- IPI00152318 coil domain-containing protein 110 IPI00514622 Tax_Id=9606 Ran-binding protein 6 IPI00180956 Tax_Id=9606 46 kDa protein Tax_Id=9606 Staphylococcal nuclease domain-containing IPI00140420 protein 1 IPI00003269 Tax_Id=9606 hypothetical protein LOC345651 Protein hits reported for the sample prepared from HEp-2 cells at 46 kDa which did not contain CAR. IPI00021440 Tax_Id=9606 Actin, cytoplasmic 2 IPI00554648 Tax_Id=9606 Keratin, type II cytoskeletal IPI00554788 Tax_Id=9606 Keratin, type I cytoskeletal 1£ IPI00008603 Tax Id=9606 Actin, aortic smooth muscle IPI00306959 Tax_Id=9606 Keratin, type II cytoskeletal 7 IPI00011654 Tax Id=9606 Tubulin beta-2 chain IPI00450768 Tax_Id=9606 Keratin, type I cytoskeletal 17 IPI00737756 Tax_Id=9606 PREDICTED: similar to Keratin, type II cytoskeletal 8 (Cytokeratin-8) (CK-8) (Keraton-8 Tax_Id=9606 ATP synthase beta chain, mitochondrial IPI00303476 precursor Tax_Id=9606 PREDICTED: similar to protein expressed in IPI00735234 prostate, ovary, testis, and placenta 15 iso IPI00003269 Tax_Id=9606 hypothetical protein LOC345651 Tax_Id=9606 ATP synthase alpha chain, mitochondrial IPI00440493 precursor IPI00025447 Tax_Id=9606 EEF1A1 protein IPI00743092 Tax_Id=9606 36 kDa protein IPI00166768 Tax_Id=9606 TUBA6 protein IPI00013881 Tax_Id=9606 heterogeneous nuclear ribonucleoprotein HI IPI00000875 Tax_Id=9606 Elongation factor 1-gamma IPI00465248 Tax Id=9606 enolase 1 Tax_Id=9606 CDNA FLJ45525 fis, clone BRTHA2026311, IPI00299571 highly similar to Protein disulfide isomerase A6 IPI00184195 Tax_Id=9606 19 kDa protein IPI00017870 Tax Id=9606 OTTHUMP00000021786 IPI00180956 Tax_Id=9606 46 kDa protein IPI00013847 Tax__Id=9606 Ubiquinol-cytochrome-c reductase complex core protein I, mitochondrial precursor IPI00163187 Tax Id=9606 Fascin Tax_Id=9606 PREDICTED: similar to Keratin, type I IPI00738265 cytoskeletal 18 IPI00013508 Tax_Id=9606 Alpha-actinin-1 Tax_Id=9606 HLA class I histocompatibility antigen, IPI00004672 alpha chain H precursor IPI00241841 Tax Id=9606 keratin 6L IPI00025491 Tax_Id=9606 Eukaryotic initiation factor 4A-I IPI00328328 Tax_Id=9606 Isoform 1 of Eukaryotic initiation factor 4A-II IPI00220327 Tax_Id=9606 Keratin, type II cytoskeletal 1 IPI00021435 Tax_Id=9606 26S protease regulatory subunit 7 IPI00171438 Tax_Id=9606 Thioredoxin domain-containing protein 5 precursor IPI00301561 I Tax_Id=9606 Thyroid receptor-interacting protein 6 171 IPI00032541 Tax_Id=9606 Gene_Symbol=KRT85 Keratin type II cuticular Hb5 IPI00550021 Tax_Id=9606 60S ribosomal protein L3 IPI00019880 Tax_Id=9606 47 kDa heat shock protein precursor IPI00216171 Tax_Id=9606 Gene_Symbol=EN02 Gamma-enolase IPI00009865 Tax_Id=9606 Keratin, type I cytoskeletal 10 IPI00328343 Tax_Id=9606 Spliceosome RNA helicase BAT1 Tax_Id=9606 Gene_Symbol=CCDC110 Isoform 1 of Coiled- IPI00152318 coil domain-containing protein 110 IPI00019359 Tax_Id=9606 Keratin, type I cytoskeletal 9 IPI00003918 Tax_Id=9606 60S ribosomal protein L4 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00556231 protein Tax_Id=9606 Tu translation elongation factor, IPI00027107 mitochondrial Protein hits reported for the sample prepared from HEp-2 cells at 46 kDa which did not contain CAR (MS analysis was repeated for a longer time than before). Q4PKE5 AEDAE Actin 5.- Aedes aegypti (Yellowfever mosquito). ATBOG actin gamma - bovine (tentative sequence) 1HLUA beta-actin, chain A - bovine CAA27396 MMACTBR2 NID: - Mus musculus Q53G76 HUMAN Beta actin variant (Fragment) .- Home sapiens (Human) Bone marrow macrophage cDNA, RIKEN full-length enriched clone:1830016H03 Q3UBP6 MOUSE library, product:actin, beta, cytoplasmic, full insert sequence.- Mus musculus (Mouse). Q5QTD5 9MAXI Beta-actin.- Tigriopus japonicus. Q5BQE5 9VEST Actin Al.- Haliotis iris. Q4FZL1 MOUSE Eif4al protein (Fragment) .- Mus musculus (Mouse) AAN98378 AYl4l97O NID: - Bos taurus Beta-actin (Fragment).- Gasterosteus aculeatus (Three Q4U1U6 GASAC spined stickleback) Q5BQE3 9VEST Actin A3.- Haliotis iris. Q5BQE4 9VEST Actin A2.- Haliotis iris. JSO].90 actin, muscle - starfish (Pisaster ochraceus) AAA30043 SUSCYIIIBA NID: - Strongylocentrotus purpuratus Chromosome 12 SCAF151O4, whole genome shotgun Q4RG96 TETNG sequence. (Fragment) .- Tetraodon nigroviridis (Green )uffer) Q9QZ83 MOUSE Gamma actin-like protein.- Mus musculus (Mouse) Q2QJT3 9EUKA Actin (Fragment) .- Diaphanoeca grandis. Actin, cytoskeletal 11A- Strongylocentrotus ACTC STRPU )urpuratus__(Purple sea urchin) AAA3003O BUSACTO5 NID: - Strongylocentrotus purpuratus Q95UUO MONBE Actin.- Monosiga brevicollis. CAD34734 Sequence 42 from Patent W00222660- Homo sapiens (Human). Q9BIJ1 DROVI Actin E2.- Drosophila virilis (Fruit fly). ATFF8 actin 8 - fruit fly (Drosophila melanogaster) CAB06627 BMACTIN NID: - Brugia malayi Cytoplasmic actin.- Hirudo medicinalis (Medicinal Q2LDZ7 HIRME leech) Q6JUF2 9EUKA Actin- Nuclearia simplex. ACTA PHYPO Actin, plasmodial isoform.- Physarum polycephalum (Slime mold) S33387 actin, muscle - sea squirt (Styela plicata) Q5ZKM2 CHICK Hypothetical protein.- Gallus gallus (Chicken) Actin (Fragment) .- Epiphyas postvittana (Light brown Q3HLZ8 EPIPO apple moth). Q90Z02 9CHON Fast muscle actin- Scyliorhinus retifer. 1COFA actin, chain A - slime mold (fragments) 173 AAA53363 LPU09651 NID: - Lytechinus pictus Alpha-muscle actin (Fragment) .- Styela clava (Sea 1226484 STYCL squirt) DKFZp468B197 Q5RBS3 PONPY Hypothetical protein (Hypothetical )rotein DKFZp468PO97) .- Pongo pygmaeus (Orangutan) Q5G907 ISOGA Actin (Fragment).- Isochrysis galbana. Keratin, I 18 K1C1B HUMAN type cytoskeletal (Cytokeratin-18) (CK 18) (Keratin-18) (K18) .- Homo sapiens (Human) Q6UUXO 9CNID Actin.- Stylophora pistillata. Elongation factor 1 alpha.- Hyla japonica (Japanese Q4H447 HYLJA tree frog) ACTGCEPAC Actin, gamma.- Gibberella zeae (Fusarium Q41623 GIBZE graminearum) A37431 actin, type 1 - Emiliania huxleyi (fragment) Q9NGO9 DAPPU Actin (Fragment) .- Daphnia pulex (Water flea) translation elongation factor eEF-l alpha chain - A60491 frican clawed frog 018553 HELTB Cytoplasmic actin Cyil (Fragment) .- Heliocidaris tuberculata (Sea urchin) 018554 HELER Cytoplasmic actin Cyll (Fragment) .- Heliocidaris erythrogramma__(Sea urchin) 6 days neonate head cDNA, RIKEN full-length enriched clone:5430439D06 Q3UZQ3 MOUSE library, product:eukaryotic translation elongation factor 1 alpha 1, full insert sequence.- Mus musculus (Mouse) Q6JL98 PARBR Actin.- Paracoccidioides brasiliensis. AAN65657 AYO88lll MID: - Arabidopsis thaliana 018555 HELER Cytoplasmic actin Cyll (Fragment) .- Heliocidaris rythrogramma (Sea urchin) Elongation 1-gamma (EF-l-gamma) EF1G HUMAN factor (eEF-1B gamma) .- Homo_sapiens__(Human) Q6WE53 9EUKA Actin (Fragment) .- Platyamoeba placida. Q3BCE5 9VEST Actin (Fragment) .- Diloma samoaensis. AAC80573 ECCACTNI MID: - Echinococcus granulosus Q6WE55 9EUKA Actin.- Vannella ebro. Peroxisomal multifunctional enzyme type 2 (MFE-2) (D Difunctional protein) (DBP) (17-beta-hydroxysteroid DHB4 HUMAN ehydrogenase 4) (l7-beta-I-ISD 4) [Includes: D-3- iydroxyacyl-CoA dehydratase (EC 4.2.1.107) (3- alpha,7- alpha, 12-alpha-trihydroxy-5-beta-cholest- Q5J1K2 ELAGV Actine.- Elaeis guineensis var. tenera (Oil palm) Actin-l, putative, expressed.- Oryza sativa (japonica Q2QLI5 ORYSA cultivar-group) AAC16055 AFO61O2O MID: - Mesostigma viride PLECA Type 4 actin (Fragment) .- Pleurochrysis carterae Q9SWP8 (Marine alga) Q6JtJF1 9EUKA Actin (Fragment) .- Gromia ovitormis. Q9NBY7 9MOLL Actin (Fragment).- Japetella diaphana. Q9NC6O 9MOLL Actin (Fragment) .- Nautilus pompilius. BAA12315 YSPL972A NID: - Schizosaccharomyces pombe 174 Translational eukaryotic inititation factor 4AII Q8JFP1 CHICK (Hypothetical protein).- Gallus gallus (Chicken). Q72U67 BRARE Eukaryotic translation initiation factor 4A, isoform IB.- Brachydanio rerio (Zebrafish) (Danio rerio) . Q3BCF2 9VEST Actin (Fragment).- Austrocochlea diminuta. AAD38854 AF156258 NID: - Suillus bovinus Q6F3E7 LAMJA Elongation factor-1 alpha.- Lampetra japonica (Japanese lamprey) (Entosphenus japonicus) . Q3BCF7 9VEST Actin (Fragment).- Micrelenchus huttoni Q4 60Y4 9VEST Actin (Fragment).- Monodonta labio. Q9NC24 9M0LL Actin (Fragment) Cycloteuthis sirventi. Q460Y1 9VEST Actin (Fragment).- Monodonta perplexa perplexa. Q9NC44 9M0LL Actin (Fragment).- Sepioloidea lineolata. Q9GQJ9 9MYRI Elongation factor-lalpha (Fragment).- Uroblaniulus canadensis. Host actin-2 (Host actin-1) (Fragment).- Teleaulax Q2WGN4 9CRYP acuta. JE0147 actin 1 - sorghum Q460Y6 9VEST Actin (Fragment).- Oxystele tigrina. Q2TTE1 9ZYGM Actin (Fragment).- Smittium simulii. Q3BCE6 9VEST Actin (Fragment).- Diloma radula. 06 5016 SOYBN Actin 4.- Glycine max (Soybean) Q672N3 9EUKA Actin (Fragment).- Gromia oviformis. Q6JXH3 9STRA Actin (Fragment).- Actinosphaerium eichhornii. Q9GQJ1 9MYRI Elongation factor-lalpha (Fragment).- Striaria columbiana. Q5IHX8 9EUKA Actin (Fragment).- Capsaspora owczarzaki Q9I8Q4 ICTPU Alpha actin.- Ictalurus punctatus (Channel catfish). Q3BCE8 9VEST Actin (Fragment).- Austrocochlea brevis. Q802E1 ZOAVI Beta actin (Fragment).- Zoarces viviparus (Eelpout) Q8T4J8 SIMVI Actin (Fragment).- Simulium vittatum (Black fly) Q9M572 9LILI Actin 1 (Fragment) Vallisneria natans. Phosphoglycerate kinase 1 (EC 2.7.2.3).- Bos taurus PGK1 BOVIN (Bovine). Q865G0 CAPHI Beta-actin (Fragment) Capra hircus (Goat). PGK1 CRIGR Phosphoglycerate kinase 1 (EC 2.7.2.3).- Cricetulus griseus (Chinese hamster). Phosphoglycerate kinase 1 (EC 2.7.2.3).- Equus PGK1 HORSE caballus (Horse). 10 days neonate skin cDNA, RIKEN full-length enriched library, clone:4732493G14 product:ACTIN, CYTOPLASMIC Q8BFZ3 MOUSE TYPE 5 homolog (10 days neonate skin cDNA, RIKEN full- length enriched library, clone:4732495G21 product:ACTIN, CYTOPLASMIC TYPE 5 homolog).- M Q4 6 0Y7 9VEST Actin (Fragment).- Oxystele tabularis. Q8MVL3 9ASCI Cytoplasmic actin 2 (Fragment) Boltenia villosa. Q4ZIR3 VANCA Beta-actin (Fragment).- Vanessa cardui (Painted lady). Q8T5L6 9ASIL Elongation factor-1 alpha (Fragment).- Hybos sp. NCSU- 99071974. Q3BCE7 9VEST Actin (Fragment) .- Austrocochiea concamerata. Elongation factor-i alpha (Fragment).- Eubosmina Q8MUD6 9CRUS coregoni. AAF37002 AF101729 NID: - Naegleria gruberi Q5TJK2 9SACH Actin (Fragment) .- Debaryomyces maramus. P93634 MAIZE Actin (Fragment) .- Zea mays (Maize) ACT4 DICDI Actin-3-sub 2.- Dictyostelium discoideum (Slime mold) 096658 PENNO Actin 2.- Penaeus monodon (Penoeid shrimp) Multifunctional protein ADE2 [Includes: Phosphoribosylaminoimidazole- succinocarboxamide PUR6 HUMAN synthase (EC 6.3.2.6) (SAICAR synthetase); Phosphoribosylaminoimidazole carboxylase (EC 4 .1.1.21) (AIR carboxylase) (AIRC)] . - Homo sapiens (Human) Q6ZYL2 9PULM Actin (Fragment) .- Anon lusitanicus. Actin T2.- Penaeus vannamei (Penoeid shrimp) (European Q6DTY3 PENVA hite shrimp) Q9U9N2 9HEMI Elongation factor 1 alpha (Fragment) .- Cinara etsuhoe. Q4U1P4 9NEOP Elongation factor-i alpha (Fragment) .- Miletus ancon. Q4TBR8 TETNG Chromosome 21 SCAF7O9S, whole genome shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) SJCHGCOO214 protein.- Schistosoma japonicum (Blood Q5DEG6 SCHJA fluke) AAD38199 AF155930 NID: - Suillus bovinus Q2HXS6 9NEOP Actin (Fragment) .- Ciostera anastomosis. ATRZ3 actin 3 - rice Actin (Fragment) .- Debaryomyces polymorphus var. Q5W553 9SACH )Olymorphus. Q2T9Y9 BOVIN Hypothetical protein.- Bos taurus (Bovine) Q597G4 9EUKA Actin (Fragment).- Micronuclearia podoventralis. A29939 epoxide hydrolase (EC 3.3.2.3) 1, microsomal - human AAI02469 BC102468 HID: - Bos taurus Q9LKG5 9MAGN Actin.- Magnolia denudata. Actin (Fragment).- Procambarus clarkii (Red swamp ACT PROCL crayfish) Translation elongation factor 1-alpha (Fragment) Q3ZV68 9ASCO lanseniaspora vineae. AAC80574 ECCACTNII HID: - Echinococcus granulosus Putative elongation factor 1 alpha.- Hirudo Q2LDS1 HIRNE aedicinalis__(Medicinal_leech) Elongation factor-l alpha (Fragment) .- Eurypauropus Q6JUE5 9MYRI spinosus. Q55ZP4 CRYNE Hypothetical protein.- Cryptococcus neoformans var. ieoformans B-3501A. ACT YARLI Actin.- Yarrowia lipolytica (Candida iipolytica) Elongation factor 1-alpha (Fragment) .- Tanystylurn Q9XY81 9CHEL )rbiculare. Translation elongation factor 1-alpha (Fragment) Q7Z8YO 9ASCO Candida castellii. 176 Q95319 PIG Beta-actin, cytoplasmic (Fragment) .- Sus scrofa (Pig) SAHH Adenosyihomocysteinase (EC 3.3.1.1) (S-adenosyl-L homocysteine hydrolase) (AdoHcyase) .- Sus scrofa (Pig). 002479 9ARAC Elongation factor-i alpha (Fragment) .- Vonones ornata. Elongation factor-i alpha.- Carassius auratus Q9OYC1 CARAU (Goldfish) AAH26185 BCO26185 NID: - Homo sapiens Heterogeneous nuclear ribonucleoprotein F (hnRNP F) HNRPF HUMAN (Nucleolin-like protein mcs94-1).- Homo sapiens (Human) AAC16053 AFO6lOl8 NID: - Scherffelia dubia Q2WEB1 9SACH Actin (Fragment) .- Debaryomyces robertsiae. Translation elongation factor EF-i, subunit alpha. Q22GX4 TETTH Tetrahymena_thermophila_SB21O. T51182 actin [imported] - Malva pusilla Q5AKXO CANAL Hypothetical protein ACT1.- Candida albicans (Yeast) S25488 actin 1 - garden pea Q7ZWE5 BRARE Proteasome, 26S, non-ATPase regulatory subunit 6.- 3rachydanio rerio (Zebrafish) (Danio rerio) Q2VBR5 9DIPT Elongation factor 1-alpha (Fragment) .- Simulium cf. tuberosum/appalachiense PA-l998. 061569 OSTOS Actin (Fragment) .- Ostertagia ostertagi. Q96405 CHLVU Actin (Fragment) -- Chlorella vulgaris (Green alga) Q8T299 DICDI Similar to Dictyostelium discoideum (Slime mold) ctin.- Dictyostelium discoideum (Slime mold) 096978 9CILI Translation elongation factor 1-alpha (Fragment) Slaxelia sp. AAA61793 PPU08844 NID: - Porphyra purpurea Elongation factor 1 alpha (Fragment).- Parides Q3ZJQ1 9NEOP chabrias. Major histocompatibility complex, class I, C.- Pan Q1XHX3 PANTR troglodytes__(Chimpanzee) MHC Q3B9Q4 MACPA class I antigen heavy chain (Fragment) .- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) BAA13351 D87407 NID: - Branchiostoma floridae 17 K1C17 HUMAN Keratin, type I cytoskeletal (Cytokeratin-l7) (CK 17) (Keratin-17) (K17) (39.1).- Homo sapiens (Human). Actin (Fragment) .- Debaryomyces vanrijiae var. Q5W551 9SACH ranrij iae. Q5MXN9 9NEOP Elongation factor-i alpha (Fragment) .- Taygetis sosis. Q2TTF9 9ZYGM Efia (Fragment).- Smittium simulii. Q6PTJ9 METSE Elongation factor 1 alpha (Fragment) .- Metridium senile (Brown sea anemone) (Frilled sea anemone) Elongation factor 1-alpha.- Candida glabrata (Yeast) Q6FMI3 CANGA (Torulopsis glabrata) Q7XZJ6 GOSHI Actin.- Gossypium hirsutum (Upland cotton) HLA class I histocompatibility antigen, A-30 alpha lA3O HUMAN chain precursor (MHC class I antigen A*30) .- Homo sapiens (Human) HLHU69 MHC class I histocompatibility antigen HLA-Aw69 alpha chain - human (fragment) 177 Translation elongation factor 1 alpha (Fragment) Q5VCT2 9HYPO alansia henningsiana. Q2V9F6 9FUNG Elongation factor 1-alpha (Fragment) .- Synchytrium iacrosporum - Elongation factor 1 alpha (Fragment) .- Chramesus Q9GPY3 9CUCU asperatus. MHC I HLA-Aw68 HLHUAW class histocompatibility antigen alpha chain - human (fragment) MHC I heavy Macaca Q61798 MACFA class chain antigen.- fascicularis (Crab eating macaque) (Cynomolgus monkey). AAA61790 PPUO8841 HID: - Porphyra purpurea Q9GQI9 9MYRI Elongation factor-lalpha (Fragment) .- Symphylella sp. Sym’. Elongation factor 1 alpha (Fragment) .- Battus Q3ZJR5 9NEOP Dolystictus. Elongation factor 1-alpha (Fragment) .- Xyleborus Q8MZN7 9CUCU neritus. Q9NC46 9MOLL Actin (Fragment).- Spirula spirula. Elongation factor 1 alpha (Fragment) .- Castilia Q5ETR9 9NEOP erilla. Skeletal alpha-actin (Fragment) .- Gillichthys Q9DFK3 GILMI nirabilis__(Long-jawed_mudsucker) Q7GOA2 BLAHO Elongation factor-l alpha.- Blastocystis hominis. Elongation factor 1 alpha (Fragment) .- Eulaceura Q5EPZ3 9NEOP steria. tryptase inhibitor, chain E - medicinal leech 1AN1E (fragments) Elongation factor-l alpha (Fragment).- Camponotus Q6VP77 9HYME festinatus. phosphoglycerate kinase (SC 2.7.2.3) 1 - tammar PCi ii 8 allaby (fragment) Elongation factor-l alpha (Fragment).- Hipparchia Q2LAR6 9NEOP statilinus. Q7ZOV7 9CRYT Actin (Fragment) .- Cryptosporidium canis. Q6JXIO 9EUKA Actin (Fragment) .- Hedriocystis reticulata. Q9U9B5 MYTED Actin (Fragment).- Mytilus edulis (Blue mussel). MHC class I antigen (Fragment).- Pan troglodytes Q9MXI9 PANTR (Chimpanzee) AAB17465 H5U56825 HID: - Home sapiens Elongation factor-i alpha (Fragment) .- Leptodoras Q6WZ46 9TELE uruensis. Q9NJO5 9CUCU Elongation factor 1 alpha (Fragment) .- Hypothenemus sp. SCA12. S7ii23 actin alpha-anomalous, testis - Japanese pufferfish Q534J8 9ASCO Actin (Fragment).- Phoma nigrificans. Translation elongation factor 1-alpha (Fragment) Q873P2 9FUNG thizophlyctis sp. C-b. Actin (Fragment) .- Haliotis rufescens (California red 017477 HALRU abalone) Q84KN9 0XYM. Actin (Fragment) .- Oxyrrhis marina (Dinoflagellate) Chromosome undetermined 5CAF14696, whole genome Q4S9HO TETNG shotgun sequence. (Fragment) .- Tetraodon nigroviridis 178 (Green puffer) MHC heavy Q4W7C4 MACFA class I chain antigen.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) Translation elongation factor 1-alpha (Fragment) Q4TTJZ4 9APHY Sparassis crispa. Q9U7M9 9CEST Elongation factor 1-a (Fragment) .- Hepatoxylon sp. CONA FLJ16712 UTERU2032279, Q6ZMS8 HUMAN fis, clone highly similar to 47 kDa HEAT SHOCK PROTEIN.- Homo sapiens (Human). Elongation factor 1 alpha (Fragment).- Aphis Q86FR8 9HEMI spiraecola. S20093 actin 101 - potato AAM83114 AY130813 NID: - Saccharomyces cerevisiae Elongation factor-l alpha (Fragment) .- Antherina Q8T7D2 9NEOP suraka. translation elongation factor eEF-l alpha chain - EFHB1 oneybee Q2EHJ9 9HYPO Actin (Fragment) .- Trichoderma petersenii. AAHOO4O4 BC000404 NID: - Homo sapiens Q8NJ17 MONAN Gamma actin (Fragment) .- Monascus anka. Q968T9 9SPIT Actin II (Fragment) .- Diophrys sp. PPR2000. Q3B8Q2 RAT Hypothetical protein.- Rattus norvegicus (Rat) Elongation factor 1 alpha (Fragment) .- Heliconius Q5ETP7 9NEOP iortense. Q5R1M2 HUMAN MHC class I antigen (Fragment) .- Homo sapiens (Human) Elongation factor 1-alpha, putative.- Toxoplasma Q1JTD9 TOXCO ondii. Elongation factor-l alpha (Fragment).- Capraita Q86L76 9CUCU Dlarissa. Q7Z9U2 9SACH Actin (Fragment) .- Saccharomyces spencerorum. Elongation factor-l alpha (Fragment) .- Condylostylus Q8T5M4 9ASIL flavipes. Q95UK4 9DIPT Elongation factor-i alpha (Fragment).- Giuma nitida. Elongation factor 1 alpha (Fragment) .- Dryocoetes Q9GTS9 9CUCU autographus. Q156G0 9BASI Translation elongation factor 1-alpha (Fragment) 3annoa sp. MP3490. Q1981i PANTR MHC class I antigen.- Pan troglodytes (Chimpanzee) Elongation factor 1 alpha (Fragment) .- Chiosyne Q5EPW3 CHLAC acastus (Sagebrush checkerspot) 065317 9VIRI Actin (Fragment) .- Spirogyra sp. SVCK 253. Q6SR64 9EUKA Actin 3 (Fragment) .- Piasmodiophora brassicae. Q3LIA5 HUMAN Hypothetical protein NblalOOS8.- Homo sapiens (Human). Q94FA3 ACECL Actin isoform 2.- Acetabularia cliftonii (Green alga). Q2MJD3 9HYPO Actin (Fragment) .- Trichoderma caribbaeum. Citrate synthase.- Xenopus tropicaiis (Western clawed Q28DK1 XENTR frog) (Siiurana tropicalis) Q32YK3 RETFI Actin type 1 (Fragment) .- Reticuiomyxa filosa. 024272 9CONI Actin 7 (Fragment) .- Podocarpus macrophyllus. Q8T5P9 9ASIL Elongation tactor-l alpha (Fragment) .- Ceratomerus sp. 179 CSU-95O5lll6. Translation elongation factor 1-alpha (Fragment) Q670V4 9PEZI Dactylella lysipaga. Q3YBB1 9HEMI Elongation factor 1-alpha (Fragment).- Melanaspis sp. GEM-2005d. ATZM1 actin - maize Q3LV49 9DIPT Elongation factor-l alpha (Fragment) .- Cyphomyia n. sp. 1 CAB-2005. Hypothetical protein CBG16478.- Caenorhabditis Q613B3 CAEBR Driggsae. .AA53366 LPU09654 NID: - Lytechinus pictus Elongation factor 1 alpha (Fragment) .- Trichomonas 046335 9EUKA tenax. Q9AR32 ORYSA Eukaryotic initiation factor 4A.- Oryza sativa (Rice). Actin (Fragment) .- Dissophora decumbens. Q9C2VS 9ZYGO Phosphoribosylaminoimidazole carboxylase, )hosphoribosylaminoimidazole succinocarboxamide Q5RG55 BRARE synthetase (Fragment) .- Brachydanio rerio (Zebrafish) (Danio rerio) Q3L647 9MOLL EF-la (Fragment) .- Octopus kaurna. Q6H196 PICCU Actin (Fragment) .- Pichia guilliermondii (Yeast) (Candida guilliermondii) Q40981 9ASPA Actin (Fragment) .- Phalaenopsis sp. SM9108. Q5D4WO PANGI Actin (Fragment) .- Panax ginseng (Korean ginseng) K2C8 HUMN Keratin, type II cytoskeletal 8 (Cytokeratin-8) (CK-8) (Keratin-8) (1(8).- Homo sapiens (Human) - Hypothetical L0C496924- Xenopus tropicalis (Western Q5IOC1 XENTR clawed_frog)__(Silurana_tropicalis) 096974 9CILI Translation elongation factor 1-alpha (Fragment).- Colpoda inflata. Q58DR]. BOVIN Histone acetyltransferase 1.- Bos taurus (Bovine) Elongation factor 1 alpha (Fragment) .- Saccoglossus Q6PTG5 SACKO owalevskii. JQ0028 cytokeratin 19 - mouse MHC Q4W7C3 MACFA class I heavy chain antigen.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) MHC I Q61799 MACFA class heavy chain antigen.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) Q1L4L9 USTVI Elongation factor lalpha (Fragment) . - Ustilago riolacea (Smut fungus) (Microbotryum violaceum) Isocitrate dehydrogenase [NADP] cytoplasmic (EC IDHC PONPY 1.1.1.42) (Cytosolic NADP-isocitrate dehydrogenase) (Oxalosuccinate decarboxylase) (IDE) (NADP(+) -specific ICDH) (IDP) .- Pongo pygmaeus (Orangutan). Q9XZPO 9ETJKA Actin deviating protein (Fragment) -- Ammonia sp. Eukaryotic initiation factor 4A (EIF4A) (EIF-4A) Q5CKH9 CRYHO ryptosporidium_hominis. Translation elongation factor EF1-alpha (Fragment) Q5EG8O USTMA stilago_maydis__(Smut_fungus)_- 180 Translation elongation factor 1-alpha (Fragment) Q1W602 9HOMO Phallus hadriani. Translation elongation factor 1-alpha (Fragment). Q4TUZ5 9BASI Platygloea_disciformis. Translation elongation factor 1 alpha.- Hydra Q25099 agnipapil1ata__(Hydra) Q562N6 HUMAN Actin-like protein (Fragment) .- Homo sapiens (Human) Q1L4NG USTVI Elongation factor lalpha (Fragment).- Ustilago riolacea (Smut fungus) (Microbotryum violaceum) Heterogeneous nuclear ribonucleoprotein G (hnRNP G) HNRPG RAT (RNA-binding motif protein, X chromosome) .- Rattus lorvegicus (Rat) Translation elongation factor 1-alpha (Fragment) Q1W607 9AGAR Lactarius lignyotus. Translation elongation factor EF1-alpha (Fragment) Q5EGI3 PLEOS Pleurotus ostreatus (Oyster mushroom) (White-rot fungus). Elongation factor 1-alpha (Fragment) .- Xyleborus Q8MZP9 9CUCU biuncus. AVID CHICK Avidin precursor.- Gallus gallus (Chicken). Q9MXG3 PANTR MHC class I antigen.- Pan troglodytes (Chimpanzee) Q5W1MO HUMAN MHC class I antigen (Fragment) .- Homo sapiens (Human). JC2109 long-chain-fatty-acid beta-oxidation multienzyme complex beta chain precursor, mitochondrial - human 15 K1C15 MOUSE Keratin, type I cytoskeletal (Cytokeratin-l5) (CK 15) (Keratin-15) (1<15) .- Mus musculus (Mouse) Q4N755 THEPA Phosphoglycerate kinase, putative.- Theileria parva. Nuclease sensitive element-binding protein 1 (Y-box binding protein 1) (Y-box transcription factor) (YB-l) YBOX1 BOVIN (CCAAT-binding transcription factor I subunit A) (CBF ) (Enhancer factor I subunit A) (EFI-A) (DNA-binding rotein B) (0BPS) .- Bos taurus (Bo Eukaryotic initiation factor 4a-3.- Plasmodium yoelii Q7RAQ2 PLAYO oelii. Q9BEB3 PONPY MHC-G (Fragment) .- Pongo pygmaeus (Orangutan). Proliferation-associated protein 2G4 (Cell cycle PA2G4 HUMAN rotein p38-2G4 homolog) (hG4-l) (ErbB3-binding protein 1) .- Homo_sapiens_(Human) Q2Q5H9 9HEMI Elongation factor-i alpha (Fragment) .- Maoricicada nangu mangu. Q6JXI1 9EUKA Actin (Fragment) .- Ciathrulina elegans. Q3SZU2 BOVIN Hypothetical protein.- Bos taurus (Bovine) Major Q5TM3O MACMU histocompatibility complex, class I, B.- Macaca nulatta (Rhesus macaque) Elongation factor-i alpha (Fragment) .- Paranaita Q86L55 9CUCU pima. CAF159O1 AX970793 NID: - Homo sapiens Vesicle amine 1 (Fragment) . - Q3I1S1 MACMU transport protein Macaca nulatta (Rhesus macaque) AAC37596 L78833 NID: - Homo sapiens ARP3 BOVIN Actin-like protein 3 (Actin-reiated protein 3) (Actin 2).- Bos taurus (Bovine) 181 Major complex, Q5TM33 MACMU histocompatibility class I, B.- Macaca ulatta (Rhesus macaque) Platelet-activating factor acetyihydrolase lB subunit alpha (PAF acetyihydrolase 45 kDa subunit) (PAF-AH 45 LIS1 HUMAN Wa subunit) (PAF-AH alpha) (PAFAH alpha) (Lissencephaly-l protein) (LIE-i) .- Homo sapiens (Human). TIB-55 BB88 cDNA, RIKEN full-length enriched library, :lone:1730081G10 Q3THG2 MOUSE product:proteasome (prosome, iacropain) 26S subunit, non-ATPase, 11, full insert sequence.- Mus musculus (Mouse) Q3Y5AO 9APHY Actin (Fragment) .- Wolfiporia cocos. Blastocyst biastocyst cDNA, RIKEN full-length enriched clone:11C0033M16 (Hsp4O) homolog, Q3TK61 MOUSE library, product:DnaJ subfamily A, member 1, full insert sequence.- Mus iusculus (Mouse) I JHO 538 class histocompatibility antigen Gogo-Oko heavy chain precursor - lowland gorilla (EC Q2RXI4 RHORT Isocitrate dehydrogenase 1.1.1.42) thodospirillum rubrum (strain ATCC 11170 / NCIB 8255) GDI2 (GOP Homo Q6IAT1 HUMAN protein dissociation inhibitor 2).- sapiens (Human) Elongation factor-i alpha (Fragment) .- Disonycha Q86L89 9CUCU conjuncta. 015593 ENTHI Actin (Fragment) .- Entamoeba histolytica. Major histocompatibility complex, class I, G.- Pan Q1XHW6 PANTR troglodytes (Chimpanzee) Hypothetical protein DKFZp468B239.- Pongo pygmaeus Q5R8F3 PONPY (Orangutan) Chloroplast phosphoglycerate kinase (EC 2.7.2.3) Q66PT3 EUGGR (Fragment) .- Euglena gracilis. Q7Z9T3 SACEX Actin (Fragment) .- Saccharomyces exiguus (Yeast) AS-i complex subunit mu-l (Adaptor-related protein complex 1 mu-i subunit) (Mu-adaptin 1) (Adaptor protein AP1N1 BOVIN complex AP-l mu-i subunit) (Golgi adaptor HAl/APi adaptin mu-i subunit) (Ciathrin assembly protein assembly protein complex 1 medium chain 1) - Q5K9R3 CRYNE 6-phosphogluconate dehydrogenase, decarboxylating. Cryptococcus neoformans (Filobasidielia neoformans) Eukaryotic translation initiation factor 4A-i Q94BM5 ELAOL (Fragment)_.-_Elaeis_oleifera_(Oil_palm) Q562L3 HUMAN Actin-like protein (Fragment) .- Homo sapiens (Human) 60S L3 TAR RL3 HUMAN ribosomal protein (HIV-l RNA-binding Drotein B) (TARBP-B).- Homo sapiens (Human). Eukaryotic 1 Q8JIU6 BRARE translation elongation factor gamma. 3rachydanio rerio (Zebrafish) (Danio rerio) Putative eukaryotic translation initiation factor 4A Q5K406 9CARY (Fragment) .- Silene viscosa. Q4Y7E4 PLACH Isocitrate dehydrogenase (NADP) , mitochondrial, utative (Fragment) .- Plasmodium chabaudi. Q91A63 9NEOB Putative cardiac actin (Fragment).- Bufo gutturalis. Beta actin (Fragment) .- Fundulus heteroclitus Q5XVR2 FUNHE (Killifish)__(Mummichog) 182 Eukaryotic translation elongation factor 1 gamma Q801K7 SCYCA (Fragment) .- Scyliorhinus canicula (Spotted dogfish) (Spotted catshark) Q966R9 ASTAM HF-la (Fragment) .- Asterias amurensis (Starfish). MHC class I heavy chain antigen (Fragment) .- Gorilla Q9MWKJ. 9PRIM jorilla (gorilla) Q9C494 9ZYGO Actin (Fragment) .- Absidia blakesleeana. Q7Z9U6 9SACH Actin (Fragment) Saccharomyces martiniae. Q91A54 9NEOB Putative cardiac actin (Fragment) .- Bufo gariepensis. Acyl-coenzyme A oxidase 1, peroxisomal (EC li3.3.6) ACOX1 HUMAN (Palmitoyl-CQA oxidase) (AOX) (Straight-chain acyl-C0A oxidase)_(SCOX).-_Homo_sapiens_(Human). Q4G2G1 9ALVE Actin (Fragment) .- Perkinsus sp. ATCC 50864. Q2HJ33 BOVIN Similar to Putative GTP-binding protein PTDOO4.- Bos taurus (Bovine) Elongation factor 1 alpha (Fragment) .- Rhodomonas Q5EUA1 9CRYP salina. Translation elongation factor 1-alpha (Fragment) Q4PS62 9HOMO Cantharellus cibarius (chanterelle) Hypothetical protein DKFZp469F1421.- Pongo pygmaeus Q5RFDO PONPY (Orangutan) Sahh protein.- Xenopus laevis (African clawed frog) Q6DKD5 XENLA Bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:1830028N06 Q3UAG2 MOUSE roduct:phosphogluconate dehydrogenase, full insert sequence (Bone marrow macrophage cDNA, RIKEN full- length enriched library, clone:1830089J15 Droduct :phosphogluconat T04408 actin - barley (fragment) Q2VIK8 HUMAN RcNSEP1 (Fragment) .- Homo sapiens (Human) Elongation factor Tu (Fragment) .- Ash yellows Q6DMOO ASHYP hytoplasma. Elongation factor Tu, mitochondrial precursor (EF-Tu) EFTU CHICK (Fragment)_.-_Gallus_gallus_(Chicken) Acetyl-Coenzyme A acyltransferase 2 (Fragment) Q2LDJ7 SPEPA Spermophilus parryii (Arctic ground squirrel) (Citellus Darryii) Q3T143 BOVIN L0C506562 protein (Fragment) .- Bos taurus (Bovine) Chromosome undetermined SCAF145O5, whole genome Q4SRP1 TETNG shotgun sequence.- Tetraodon nigroviridis (Green uffer) Hypothetical KYNU (Fragment) Homo Q53SYO HUMAN protein .- sapiens (Human). Q94635 OXYNO Actin II.- Oxytricha nova. (Hsp4O) Q2HJ94 BOVIN DnaJ homolog, subfamily A, member 2.- Bos taurus (Bovine) Small Q5JIWO PYRKO neutral amino acid transporter.- Pyrococcus odakaraensis (Thermococcus kodakaraensis) Q74MR9 NANEQ NEQ238.- Nanoarchaeum equitans. 183 Myocyte enhancer factor 2D/deleted in azoospermia Q5IRN4 HUMAN associated protein 1 fusion protein.- Homo sapiens (Human). 1 cell embryo 1 cell cDNA, RIKEN full-length enriched Q3TLC8 MOUSE library, clone:10C0030H13 product:hypothetical protein, full insert sequence.- Mus musculus (Mouse) RGD1309034.- Q510E6 RAT Hypothetical protein Rattus norvegicus (Rat) AAF87729 AF276629 NID: - Homo sapiens Crp Q1WUQ5 LAcS). Transcription regulator, family.- Lactobacillus salivarius subsp. salivarius (strain UCCll8) l-aminocyclopropane-l-carboxylate deaminase (EC lAiD AGRTU 3.5.99.7) (ACC deaminase) (ACCD) .- Agrobacterium tumefaciens. Hypothetical protein.- Aspergillus fumigatus (Sartorya Q4WVC9 ASPFU fumigata) Zinc finger protein subfamily 1A 5.- Brachydanio rerio 6DBWO BRARE (Zebrafish)__(Danio_rerio) 184 Protein hits reported for the sample prepared from HEp-2 cells at 100 kDa which contained nucleolin. 1P100013808 Tax_Id=9606 Aipha-actinin-4 1P100186290 Tax Id=9606 Elongation factor 2 1P100022462 Tax Id=9606 Transferrin receptor protein 1 1P100382470 Tax Id=9606 Heat shock protein HSP 90-alpha 2 1P100334775 Tax Id=9606 Hypothetical protein DKFZp761KO511 1P100013508 Tax Id=9606 Alpha-actinin-l Tax Id=9606 Alkaline phosphatase, placental type 1P100007289 Drecursor 1P100001639 Tax Id=9606 Importin beta-i subunit 1P100027493 Tax Id=9606 4F2 cell-surface antigen heavy chain 1P100604620 Tax Id=9606 nucleolin 1P100298622 Tax Id=9606 Intestinal alkaline phosphatase precursor 1P100010740 Tax Id=9606 Isoform Long of Splicing factor, proline and glutamine-rich IPI000l9884 Tax_Id=9606 Alpha-actinin-2 1P100010418 Tax Id=9606 Myosin Ic 1P100027230 Tax Id=9606 Endoplasmin precursor IPIOO2l8342 Tax Id=9606 C-l-tetrahydrofolate synthase, cytoplasmic 1P100006482 Tax Id=9606 Isoform Long of Sodium/potassium- transporting ATPase alpha-i chain precursor 1P100298961 Tax Id=9606 Exportin-l 1P100020984 Tax Id=9606 Calnexin precursor 1P100015953 Tax Id=9606 Isoform 1 of Nucleolar RNA helicase 2 1P100009865 Tax Id=9606 Keratin, type I cytoskeletal 10 Tax Id=9606 Heat shock protein 75 kDa, mitochondrial 1P100030275 recursor 1P100306369 Tax Id=9606 NOL1/NOP2/Sun domain family 2 protein 1P100022774 Tax Id=9606 Transitional endoplasmic reticulum ATPase Tax Id=9606 Isoform 1 of Neutral alpha-glucosidase AS 1P10038358l recursor Tax Id=9606 ubiquitin and ribosomal protein S27a 1P100179330 recursor 1P100024364 Tax Id=9606 Transportin-l 1P100017303 Tax Id=9606 DNA mismatch repair protein Msh2 1P100018350 Tax Id=9606 DNA replication licensing factor MCM5 1P100215948 Tax Id=9606 Isoform 1 of Alpha-i catenin 1P100554648 Tax Id=9606 Keratin, type II cytoskeletal 8 1P100450768 Tax Id=9606 Keratin, type I cytoskeletal 17 1P100018349 Tax Id=9606 DNA replication licensing factor MCM4 1P100396435 Tax Id=9606 DEAR (Asp-Glu-Ala-His) box polypeptide 15 1P100295851 Tax Id=9606 Coatomer subunit beta 1P100013214 Tax Id=9606 DNA replication licensing factor MCM3 1P100012268 Tax Id=9606 26S proteasome non-ATPase regulatory subunit 2 1P100009443 Gene Symbol=MRPL3O Uncharacterized protein MRPL3O IPIOOlO3O26 Tax Id=9606 Gene Symbol=PRMT3 PRMT3 protein (Fragment) 1P100001890 Tax Id=9606 Coatomer subunit gamma 185 IPI00030910 Tax Id=9606 GPI-anchored protein pl37 Tax Id=9606 Gene Symbol=HSP90AB6P Heat shock protein IPI00555915 90Bf 186 Protein hits reported for the sample prepared from HEp-2 cells at 100 kDa which contained nucleolin (repeat). AAH05033 BC005033 NID: - Homo sapiens EF2 HUMAN Elongation factor 2 (EF-2) .- Homo sapiens (Human) 10 days neonate skin cDNA, RIKEN full-length enriched Q8C153 MOUSE library, clone:4732472Fl1 product:ELONGATION FACTOR 2 (EF-2)_homolog.-_Mus musculus (Mouse) AAK74072 AY040226 NID: - Homo sapiens Adult male thymus cDNA, RIKEN full-length enriched Q3UZ14 MOUSE library, clone:5830470E07 product:eukaryotic translation elongation factor 2, full insert sequence. 4us musculus (Mouse) dnaK-type molecular chaperone GRP78 precursor - A27414 Chinese hamster Homo Q1HE24 HUMAN Transferrin receptor (P90, CD71) .- sapiens (Human) AB GANAB HUMAN Neutral alpha-glucosidase precursor (EC 3.2.1.84) (Glucosidase II subunit alpha) .- Homo sapiens (Human) A35804 nucleolin - human Q6GNN8 RAT Actnl protein.- Rattus norvegicus (Rat). AAA51708 HUMALPPA NID: - Homo sapiens Q1PSW2 RAT 84 kDa heat shock protein.- Rattus norvegicus (Rat). Actinin alpha 4.- Brachydanio rerio (Zebrafish) (Danio Q7SYE2 BRARE rerio) Heat shock protein HSP 90-beta (HSP 84) (Tumor HS9OB MOUSE specific transplantation 84 kDa antigen) (TSTA) .- Mus nusculus (Mouse) Minichromosome 3 Q53HJ4 HUMAN maintenance protein variant (Fragment) .- Homo sapiens (Human). Actn4-prov protein.- Xenopus laevis (African clawed Q6DCS8 XENLA frog). Q7ZY34 XENLA ACTN1 protein.- Xenopus laevis (African clawed frog) AA026043 AY220757 NID: - Homo sapiens Actinin, alpha 4.- Xenopus tropicalis (Western clawed Q6DFP7 XENTR frog)__(Silurana_tropicalis) Brain cDNA, clone: QtrA-l0430, similar to human heat Q4R4P1 MACFA shock 9OkDa protein 1, alpha (HSPCA),.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) Novel Q5RG12 BRARE protein similar to heat shock protein 90-alpha (Hsp9Oa) .- Brachydanio rerio (Zebrafish) (Danio rerio) aipha-actiniri 2, skeletal muscle splice form SK - S02032 chicken Q7ZVM3 BRARE Eukaryotic translation elongation factor 2, like. Brachydanio rerio (Zebrafish) (Danjo rerio) Actn3-prov protein.- Xenopus laevis (African clawed Q6DFU3 XENLA frog). Chromosome undetermined SCAF14O91, whole genome Q4STW7 TETNG shotgun sequence. (Fragment).- Tetraodon nigroviridis (Green puffer) DM45 nucleolin - mouse 10 days neonate skin cDNA, RIKEN full-length enriched Q8CE3O MOUSE library, clone:4732495Bl8 product:nucleolin, full insert sequence.- Mus musculus (Mouse) 187 Heat shock protein gp96.- Eptatretus stoutii (Pacific Q868Z8 EPTST hagfish) Eef2-prov protein.- Xenopus laevis (African clawed Q7ZXP8 XENLA frog) DNA MCM4 MCM4 HUMAN replication licensing factor (CDC21 homolog) (Pl-CDC21)_.- Homo_sapiens_(Human)_- MGC79035 protein.- Xenopus laevis (African clawed Q6DD73 XENLA frog) BAA11226 HUM26SPSP NID: - Homo sapiens BOVIN Coatomer subunit beta’ (Beta’-coat protein) (Beta’- COPB2 COP)__(p102)_.-_Bos_taurus_(Bovine)_- Cation-transporting ATPase.- Pongo pygmaeus Q5RDR3 NPY (Orangutan) Chromosome 14 SCAF14723, whole genome shotgun Q4S742 TETNG sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) SAHU4F cell surface antigen 4F2 heavy chain - human 90-kDa heat-shock protein (Fragment) .- Leucosolenia Q7YZI8 9METZ sp. Transitional endoplasmic reticulum ATPase (TER ATPase) TERA HUMAN (155 Mg(2+)- ATPase p97 subunit) (Valosin-containing rotein)__(VCP)_. - Homo_sapiens__(Human) Brain cDNA, clone: QccE—l2334, similar to human solute 3 Q4R5N3 MACFA carrier family (activators of dibasic andneutral amino acid transport), member 2 (SLC3A2),.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) Q17UC2 9VEST 84kDa heat shock protein.- Flaliotis tuberculata. Q5ZKB2 CHICK Hypothetical protein.- Gallus gallus (Chicken) T39202 heat shock protein 90 homolog - fission yeast (Schizosaccharomyces pombe) 90-kDa heat-shock protein (Fragment) -- Monosiga Q7YZJ4 MONBE )revicollis. Chaperone GP9S Q7T3L3 BRARE protein (Tumor rejection antigen (Gp96) 1).- Brachydanio rerio (Zebrafish) (Danio rerio) Hypothetical protein DKFZp459KO43- Pongo pygmaeus Q5R4H9 PONPY (Orangutan) Heat 70 Q81866 SPOFR shock cognate protein.- Spodoptera frugiperda (Fall armyworm) AAH02384 BC002384 NID: - Homo sapiens Q86VG2 HUMAN SFPQ protein.- Homo sapiens (Human) HS9OPODAN HEAT SHOCK PROTEIN 90 HOMOLOG (SUPPRESSOR Q5ATW1 EMENI OF VEGETATIVE INCOMPATIBILITY MOD-E) .- Emericella nidulans__(Aspergillus_nidulans) 90-kDa heat-shock protein (Fragment).- Suberites Q7YZJO 9METZ fuscus. AAH74670 BC074670 NID: - Xenopus tropicalis Transcription intermediary factor 1-beta (TIF1-beta) (Tripartite motif-containing protein 28) (Nuclear TIF1B HUMAN corepressor KAP-l) (KRAB- associated protein 1) (KAP-1) (KRAB-interacting protein 1) (KRIP-1) (RING finger )rotein 96) .- Homo sapiens (Human) Heat shock protein 90 (Fragment) .- Streblomastix Q86LK1 9EUKA strix. G90082 heat shock protein 82 [imported] - Guillardia theta 188 2ucleomorph Heat shock protein 90 (Fragment) .- Streblomastix Q86LKO 9EUKA strix. Q2TFN9 CANFA Heat shock protein Apg-2.- Canis familiaris (Dog) Activated spleen cDNA, RIKEN full-length enriched clone:F830106G17 Q3T9Y4 MOUSE library, product:coatomer protein complex, subunit beta 1, full insert sequence.- Mus musculus (Mouse) CAH05460 CQ834490 NID: - Homo sapiens Q3ZB97 RAT Ap2bl protein.- Rattus norvegicus (Rat) Vesicle-fusing ATPase (EC 3.6.4.6) (Vesicular-fusion jrotein NSF) (N- ethylmaleimide sensitive fusion NSF CRIGR Drotein) (NEM-sensitive fusion protein) .- Cricetulus griseus (Chinese hamster) trypsin (EC 3.4.21.4) precursor - pig (tentative TRPGTR sequence) Q1DY84 COCIM Heat shock protein hspl.- Coccidioides immitis RS. Heat shock protein 90 (Fragment) .- Scophthalmus Q27HW6 SCOMX naximus (Turbot) Q2KJB2 BOVIN MGC128441 protein.- Bos taurus (Bovine) Q29RA2 BRARE Hypothetical protein zgc:l36908.- Brachydanio rerio (Zebrafish) (Danlo rerlo) Heat shock protein gp96.- Strongylocentrotus Q868Z7 STRPU urpuratus (Purple sea urchin) Cytosolic heat shock protein 70 (Fragment) .- Trimastix Q2MMO4 9EUKA narina. Q84KP7 Heat shock 9OkD protein (Fragment).- Cyanidioschyzon merolae (Red alga) Candida giabrata strain CBS138 chromosome L complete Q6FLU9 CANGA sequence.- Candida glabrata (Yeast) (Torulopsis jlabrata) 001948 TRIBR Heat shock protein 70.- Trichinella britovi. Chromosome 1 Q4SDC7 TETNG SCAF1464O, whole genome shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) CG5520-PA (LD23641p) Q9VAY2 DRONE .- Drosophila melanogaster (Fruit fly) - AAC07938 AF006553 NID: - Drosophila persimilis Q53RJ5 ORYSA DnaK protein.- Oryza sativa (japonica cuitivar-group) Q9BVN4 HUMAN NSUN2 protein (Fragment).- Homo sapiens (Human). Q5CD25 EISFO Valosin containing protein-i.- Sisenia foetida (Common brandling worm) (Common dung-worm) Q1LZB6 BOVIN MGC139131 protein.- Bos taurus (Bovine). Q54AC4 HUMAN Gammal-COP.-- Homo sapiens (Human) C-l-tetrahydrofolate synthase, cytoplasmic (Ci-THF synthase) [Includes: Methylenetetrahydrofolate C1TC HUMAN lehydrogenase (EC 1.5.1.5); Methenyltetrahydrofolate cyclohydrolase (EC 3.5.4.9); Formyltetrahydrofolate synthetase (SC 6.3.4.3)].- Homo sapiens (Human CAN18695 CR749840 NID: - Homo sapiens MCM3 minichromosome maintenance deficient 3 (S. Q5RH58 BRARE cerevisiae), like.- Brachydanio rerio (Zebrafish) (Danio rerio) 2 PLOD2 HUMAN Procollagen-lysine,2-oxogiutarate 5-dioxygenase )recursor (EC 1.14.11.4) (Lysyl hydroxylase 2) (LH2) 189 Homo sapiens (Human) Activated spleen cDNA, RIKEN full-length enriched clone:F830206L09 Q3U055 MOUSE library, product:procollagen lysine, 2-oxoglutarate 5- dioxygenase 2, full insert sequence. us musculus (Mouse) Elongation factor 2 (EF-2) .- Drosophila melanogaster EF2 DRONE (Fruit fly) Heat shock protein 70 (Fragment).- Liriomyza sativae Q7YXR3 9DIPT (vegetable leafminer) ATP-binding region, ATPase-like.- Halorhodospira Q2CVM6 ECTHA halophila SL1. Heat shock cognate 70.- Aedes aegypti (Yellowf ever Q1HQZ5 AEDAE nosquito) 70 Q2N1CO PLADU Cytoplasmic heat shock kDa protein (Fragment) Platynereis dumerilii (DumeriPs clam worm) Q818l3 CHITE HSP7O.- Chironomus tentans (Midge) Hypothetical protein cMSH2 (Fragment) .- Callus gallus Q7EFQ4 CHICK (Chicken) 70 kDa heat shock protein (Fragment) .- Megachile Q6QAN5 9HYME rotundata__(alfalfa_leafcutting_bee) AAC41267 AF031139 NID: - Xenopus laevis CAD23629 RN0430860 NID: - Rattus norvegicus Q2TTFO ANOPA HSP7O (Fragment) .- Amoebidium parasiticum. AVID CHICK Avidin precursor.- Gallus gallus (Chicken) Elongation factor-2 (Fragment) .- Macrobiotus Q6JU78 9BILA islandicus. AAC07922 AF006537 NID: - Drosophila pseudoobscura Dopamine Homo Q4W4Y1 HUMAN receptor interacting protein 4.- sapiens (Human). Q6ZQ49 MOUSE MKIAAO778 protein (Fragment).- Mus musculus (Mouse) AAC07923 AF006538 NID: - Drosophila pseudoobscura (EC PSA HUMAN Puromycin-sensitive aminopeptidase 3.4.11.-) (PEA)_.- Homo_sapiens_(Human) Q4PDY4 USTMA Hypothetical protein.- Ustilago maydis (Smut fungus). DNA replication licensing factor mcm-6.- MCM6 CAEBR Caenorhabditis_briggsae. Blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:11C0037K05 product:Heat shock protein 75 Q3TK29 MOUSE kDa, mitochondrial (HSP 75) (Tumor necrosis factor type 1 receptor associated protein) (TRAP- 1) (TNFR associated protein 1) , full insert Heat shock protein 70, putative.- Entamoeba Q5OQSO ENTHI histolytica_HM-l:IMSS. Protein At4g24190.- Arabidopsis thaliana (Mouse-ear Q1NZO6 ARATH cress) Q4PPB9 Heat shock protein 70 (Fragment) .- Oxytricha sp. LPJ 9STIC 2005. HSP72 CANAL Heat shock protein SSA2.- Candida albicans (Yeast). S04651 Ca2+-transporting ATPase (EC 3.6.3.8) 1, sarcoplasmic/endoplasmic reticulum - pig Q1N554 9GAMM Heat shock protein 90.- Oceanobacter sp. RED65. Q56D08 PICPA Kar2p.- Pichia pastoris (Yeast). Q1SF11 MEDTR Glyceraldehyde 3-phosphate dehydrogenase; Heat shock 190 rotein Hsp7O.- Medicago truncatula (Barrel medic) Chaperone HscA.- gamma Q1YP42 9GAMM protein marine proteobacterium HTCC22O7. B24 protein.- Triturus carnifex (Italian crested P87376 TRICI ewt) Heat shock protein Hsp7O.- Medicago truncatula (Barrel Q1SF13 MEDTR nedic) Q9ZRGO WBEAT Heat shock protein 80.- Triticum aestivum (Wheat) SJCHGCO4278 protein (Fragment) .- Schistosoma japonicum Q5BYC6 SCHJA (Blood fluke) Q4N3K7 THEPA Heat shock protein 70, putative.- Theileria parva. AAF12906 AF022186 NID: - Cyanidium caldarium 82 kD heat shock protein (Fragment) .- Brachionus Q9U7A8 9BILA calyciflorus. )AA family ATPase, possible cell division control Q8ZTN5 PYRAE )rotein cdc48.- Pyrobaculum aerophilum. AAH20569 BC020569 NID: - Homo sapiens Q71QT9 9HETE Heat-shock protein 90.- Cryptococcus bacillisporus. Nucleolin (Protein C23) .- Xenopus laevis (African NUCL XENLA clawed frog) Heat shock protein 90 (Fragment) .- Cephalobus Q2LAI6 9BILA cubaensis. ABD46211 CP000237 NID: - Neorickettsia sennetsu str. Miyayama Heat Q2PPI9 TETUR shock cognate 70.- Tetranychus urticae (Two spotted spider mite) Heat shock protein Hsp7O.- Pelodictyon luteolum Q3B577 PELLD (strain USM 273) (Chlorobium luteolum (strain DSM 273)). 151129 dnaK-type molecular chaperone hsp7o - Iberian ribbed newt 2 DAB2 MOUSE Disabled homolog (DOC-2) (Mitogen-responsive hosphoprotein) .- Mus musculus (Mouse) Q6BEQ3 CAEEL Hypothetical protein vab—lO.-- Caenorhabditis elegans. Na/K-ATPase alpha subunit isoform 2.- Drosophila Q9U458 DROME nelanogaster (Fruit fly) Chromosome 3 Q4SV44 TETNG SCAF13806, whole genome shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) Q95PU3 EUPCR Heat shock protein (Hsp7O) .- Euplotes crassus. Translation elongation factor EF-2 subunit, putative. Q4XOG7 ASPFU spergillus fumigatus (Sartorya fumigata) Q5AOM4 CANAL Hypothetical protein EFT2.- Candida albicans (Yeast) Elongation factor-2 (Fragment) .- Acanthocyclops Q6JUC1 9MAXI vernalis. Cytoplasmic 70 kDa Q2N137 9METZ heat shock protein (Fragment). Leucosolenia sp. AR-2003. SUN Mus Q1HFZO MOUSE Nyc-induced domain containing protein.- nusculus (Mouse) Novel NOL1/NOP2/Sun domain Q28E61 XENTR ‘family protein.- Xenopus tropicalis (Western clawed frog) (Silurana tropicalis) Q6TKS5 9DIPT Heat shock protein 68.- Drosophila lummei. dnaK-type molecular chaperone SSA1 - yeast HHBYA1 (Saccharomyces cerevisiae) Q5CNE3 CRYHO Heat shock protein 70.- Cryptosporidium hominis. HSP72 PICAN Heat shock protein 70 2.- Pichia angusta (Yeast) 191 (Hansenula polymorpha) Q6SYW4 9DIPT Heat shock protein Hsp7Od.- Drosophila lummei. dnaK—type molecular chaperone hsp7o - Haloarcula A4 2988 rtarismortui GTP Q1F135 9CLOT cyclohydrolase I (EC 3.5.4.16) -- Clostridium )hytofermentans ISDg. Similarity to NON-MUSCLE ALPHA ACTININ. Q8STW7 ENCCU Encephalitozoon_cuniculi. Hypothetical protein.- Emericella nidulans Q5AW83 EMENI (Aspergillus_nidulans) Heat shock 70 kDa protein (HSP 70.1) (70 kDa heat HSP7O THEPA shock protein) .- Theileria parva. Q27078 THESE Heat shock protein.- Theileria sergenti. Q2A152 9FIRM Hypothetical protein.- Halothermothrix orenii H 168. Q8JHS8 9CHON Hsp7O protein (Fragment).- Odontaspis ferox. N-ethylmaleimide-sensitive factor b.- Brachydanio Q4UOS6 BRARE rerio__(Zebrafish)__(Danio_rerio) Q1WUQ5 LACS1 Transcription regulator, Crp family.- Lactobacillus salivarius subsp. salivarius (strain UCC118) Hsp7O protein (Fragment).- Alopias pelagicus (pelagic Q8JHS7 9CHON thresher) Q5F3J8 CHICK Hypothetical protein.- Callus gallus (Chicken) Chromosome 2 SCAF1O211, Q4T2R1 TETNG whole genome shotgun sequence.- Tetraodon nigroviridis (Green puffer) MMS19-like (MET18 homolog, Q5JTG3 HUMAN S. cerevisiae) (Fragment) Homo sapiens (Human) 192 Protein hits reported for the sample prepared from 1HAE cells at 100 kDa which contained nucleolin. FAHUAA alpha-actinin 1 - human AAH05033 3C005033 NID: - Homo sapiens 5 days embryo whole body cDNA, RIKEN full-length Q3ULT2 MOUSE enriched library, clone:10C0003G06 product:actinin Q6P786 RAT Alpha actinin 4.- Rattus norvegicus (Rat). Alpha-actinin-l (Alpha-actinin cytoskeletal isoform) ACTN1 CHICK (Non-muscle alpha-actinin-l) (F-actin cross ii S45673 alpha-actinin, 115K nonmuscle isoform — chicken Q7ZY34 XENLA ACTN1 protein.- Xenopus laevis (African clawed frog) - MGC81191 protein.- Xenopus laevis (African clawed Q6NRW6 XENLA frog). Actinin alpha 4.- Brachydanio rerio (Zebrafish) (Danio Q7SYE2 BRARE rerio) Actn4-prov protein.- Xenopus laevis (African clawed Q6DCS8 XENLA frog) EF2 BOVIN Elongation factor 2 (EF-2) .- Sos taurus (Bovine) 139166 cellular apoptosis susceptibility protein CAS - human Chromosome 16 Q4RZ26 TETNG SCAF14974, whole genome shotgun sequence. (Fragment).- Tetraodon nigroviridis (Green Chromosome undetermined SCAF14O91, whole genome Q4STW7 TETNG shotgun sequence. (Fragment) -- Tetraodon nigrovirid 10 cDNA, RIKEN Q8C153 MOUSE days neonate skin full-length enriched library, clone:4732472F1l product:ELONGATION Adult male thymus cDNA, RIKEN full-length enriched Q3UZ14 MOUSE library, clorxe:5830470E07 product:eukaryotic tra Actn3-prov protein.- Xenopus laevis (African clawed Q6DFU3 XENLA frog) Hypothetical protein zgc:77243.- Brachydanio rerio Q6POJ5 BRARE (Zebrafish)__(Danio_rerio) 17 days embryo kidney cDNA, RIKEN full-length enriched Q3TGQ3 MOUSE library, clone:1920040H08 product:catenin al BAA03530 HUNAIJPHAC NID: - Homo sapiens Q7ZVM3 BRARE Eukaryotic translation elongation factor 2, like. 3rachydanio rerio (Zebrafish) (Danio rerio) NtTCL HUMAN Nucleolin (Protein C23) .- Homo sapiens (Human). FAHUA2 alpha-actinin 2 - human AAK74072 AY040226 NID: - Homo sapiens Q6P3N8 XENTR Eukaryotic translation elongation factor 2.- Xenopus tropicalis (Western clawed frog) (Silurana tro I 10 K1C1O HUMAN Keratin, type cytoskeletal (Cytokeratin-lO) (CK 10) (Keratin-lO) (KiD) .- Homo sapiens (Human). MGC79035 protein.- Xenopus laevis (African clawed Q6DD73 XENLA frog) HNRPU HUMAN Heterogeneous nuclear ribonucleoprotein U (hnRNP U) (Scaffold attachment factor A) (SAF-A) (p120) C1TC HUMAN C-1-tetrahydrofolate synthase, cytoplasmic (Cl-THF synthase) [Includes: Methylenetetrahydrofolate ci Q5NCS5 MOUSE Heat shock protein 4 (NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched librar GANAB HUMAN Neutral alpha-glucosidase AB precursor (EC 32.l.84) 193 (Glucosidase II subunit alpha) .- Homo sapiens H5M807904 NID: - 1-lomo sapiens CAH5 6174 Heat shock protein gp96.- Eptatretus stoutii (Pacific Q868Z8 EPTST hagfish) Q2TCH3 SHEEP ATP-citrate lyase.- Ovis aries (Sheep). Transcription TIF1B HUMAN intermediary factor 1-beta (TIF1-beta) (Tripartite motif-containing protein 28) (Nuci trypsin (EC 3.4.21.4) precursor - pig (tentative TRPGTR sequence) 1AN1E tryptase inhibitor, chain E - medicinal leech (fragments) DNNS nucleolin - mouse 10 days neonate skin cDNA, RIKEN full-length enriched Q8CE3O MOUSE library, clone:4732495Bl8 product:nucleolin, Homo AAP3 64 19 sapiens ubiquitin-activating enzyme El (A1S9T and BN75 temperature sensitivity complementing) cDNA Q4R336 MACFA Testis clone: QtsA-19940, similar to human mutS homolog 2, colon cancer, nonpolyposis type 1 CTN2 MOUSE Alpha-2 catenin (Aipha-catenin-related protein) (Alpha -catenin) .- Mus musculus (Mouse) AAR56418 BC056418 NID: - Homo sapiens BAA19418 AB001594 NID: - Homo sapiens Q1KMD3 HUMAN Scaffold attachment factor A2.- Homo sapiens (Human). Q5U300 RAT Hypothetical protein LOC314432.- Rattus norvegicus (Rat) Hypothetical protein DKFZp468A159.- Pongo pygmaeus Q5R8G6 PONPY (Orangutan) CG5520-PA (LD23641p) .- Drosophila melanogaster (Fruit Q9VAY2 DROME fly) Q4KM71 RAT NonO/p54nrb homolog.- Rattus norvegicus (Rat). ITB1 BOVIN Integrin beta-l precursor (Fibronectin receptor subunit beta) (Integrin VLA-4 subunit beta) (CD29 a Atpla3-prov protein.- Xenopus laevis (African clawed Q7ZYK8 XENLA frog) PWSHNA Na÷/K+-exchanging ATPase (SC 3.6.3.9) alpha chain )recursor - sheep Chromosome Q4RNG1 TETNG undetermined SCAF15O13, whole genome shotgun sequence.- Tetraodon nigroviridis (Green pu Chromosome 1 SCAF1464O, Q4SDC7 TETNG whole genome shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green p 560735 splicing factor SF3a 120K chain — human Q76FQ4 Hypothetical protein cMSH2 (Fragment) .- Gallus gallus CHICK (Chicken) 10 Q3TTXO MOUSE days neonate skin cDNA, RIKEN full-length enriched library, clone:4732457K09 product:matrin 3, f importin beta subunit b, chain A - human (fragments) 1QGRA Ubiquitin activating enzyme.- Xenopus laevis (African Q9DEE8 XENLA clawed frog) Elongation factor-2 (Fragment).- Neogonodactylus Q6JU96 9CRUS oerstedii. Q2Q3C7 CAEEL Hypothetical protein 01005.1 (Fragment) 194 Caenorhabditis elegans. EmbICAB664O4.l.- Arabidopsis thaliana (Mouse-ear Q9FNF4 ARATH cress) Q6BEQ3 CAEEL Hypothetical protein vab-lO.- Caenorhabditis elegans. 2A Q4VAQ2 HUMAN Keratin (Epidermal ichthyosis bullosa of Siemens) Homo sapiens (Human) AJHUPR phosphoribosylamine-glycine ligase (BC 6.3.4.13) - human 1BG2 kinesin motor domain - human S33533 heat shock protein 90 homolog precursor - barley Q8VEE6 MOUSE Ars2—pending protein.,- Mus musculus (Mouse) Similarity to NON-MUSCLE ALPHA ACTININ. Q8STW7 ENCCU Encephalitozoon cuniculi. Q1N554 9GANN Heat shock protein 90.- Oceanobacter sp. RED65. translation elongation factor eEF-2 - yeast A4 17 78 (Saccharomyces cerevisiae) ENSANGP00000000768 (Fragment) Q7QDI9 ANOGA .- Anopheles gambiae str. PEST. BAA07558 HUMORFOOS NID: - Homo sapiens Cytosolic heat shock protein 90 (Fragment) .- Trimastix Q2tNO7 9EUKA narina. Heat 90 Q27HW6 SCOMX shock protein (Fragment) -- Scophthalmus maximus (Turbot) ABD46211 CP000237 NID: - Neorickettsia sennetsu str. Miyayama BX842650 NID: - Bdellovibrio bacteriovorus HD100 CAE7 9666 AAH09325 BC009325 NID: - Homo sapiens male cDNA, RIKEN Q8BG11 MOUSE Adult spinal cord full-length enriched library, clone:A330042M23 product:cadherin AAR60513 BC060513 NID: - Homo sapiens Activated spleen cDNA, RIKEN full-length enriched Q3T9Y4 MOUSE library, clone:F830106G17 product:coatomer protei Q1HGM8 HUMAN Activated leukocyte cell adhesion molecule variant 2.- Homo sapiens (Human) Glycogen form (EC Homo PYGL HUMAN phosphorylase, liver 2.4.1.1).- sapiens (Human) GTP Q1F135 9CLOT cyclohydrolase I (EC 3.5.4.16).- Clostridium )hytofermentans ISDg. Bone marrow macrophage cDNA, RIKEN full-length Q3UC1O MOUSE enriched library, clone:I8300l4D02 product:minichrom ATP-c±trate .— Q9Z2G3 RAT (Pro-S-) -lyase (Fragment) Rattus norvegicus (Rat) HDIG precursor.- delta proteobacterium MLMS-l. Q1NLE2 9DELT Histidine kinase, HAMP region:Cache:Bacterial Q2ACN4 9FIRN chemotaxis sensory transducer precursor. Halothermothrix orenii H 168. Q2J866 FRASC Argininosuccinate synthase (BC 6.3.4.5).- Frankia sp. (strain Cc13) - Q3CFW6 THEET Flagellin, N-terminal. Thermoanaerobacter ethanolicus TCC 33223. Q72CBO DESVH Cell division initiation protein DivIVA. Desulfovibrio vulgaris (strain 1-lildenborough / ATCC 195 29579 / NCIMB 8303) Q467H6 METBF Conserved hypothetical transmembrane protein. - ‘lethanosarcina barkeri (strain Fusaro / DSM 804) AE010384 NID: - Methanopyrus kandleri AV19 AANO 2155 E84935 argininosuccinate synthase (EC 6.3.4.5) [imported] — 3uchnera sp. (strain APH) Chromosome undetermined SCAF11228, whole genome Q4TOC9 TETNG shotgun sequence. (Fragment) .- Tetraodon nigrovirid UvrD/REP Q22FP7 TETTH helicase family protein.- Tetrahymena thermophila SB21O. Hypothetical protein.- Coccidioldes immitis RH. Q1E676 COCIM Transitional endoplasmic reticulum ATPase (TER ATPase) TERA HtTh4A1 (159 Mg(2+)- ATPase p97 subunit) (Valosin-containing protein)__(VCP)_. - Homo_sapiens__(Human). IAA family ATPase, possible cell division control Q8ZTN5 PYRAE Drotein cdc48.- Pyrobaculum aerophilum. 196 Protein hits reported for the sample prepared from MDCK cells at 100 kDa which contained nucleolin. Q3B7N2 BOVIN Hypothetical protein MGC128689.- Bos taurus (Bovine) Q].HE25 HUMAN Actinin alpha 1 isoform b.- Homo sapiens (Human). Hypothetical protein.- Macaca fascicularis (Crab Q2PFV7 MACFA eating_macaque)__(Cynomolgus_monkey) Q6T487 RAT Brain-specific alpha actinin 1 isoform.- Rattus norvegicus (Rat) CHICK Alpha-actinin-l (Alpha-actinin cytoskeletal isoform) ACTN1 (Non-muscle alpha-actinin-l) (F-actin cross li AAH05033 BC005033 NID: - Homo sapiens 5 days embryo whole body cDNA, RIKEN full-length Q3ULT2 MOUSE enriched library, clone:10C0003G06 product:actinin Q6P786 RAT Alpha actinin 4.- Rattus norvegicus (Rat). Q7ZY34 XENLA ACTN1 protein.- Xenopus laevis (African clawed frog) 545673 alpha-actinin, 115K nonmuscie isoform - chicken MGC81191 protein.- Xenopus laevis (African clawed Q6NRW6 XENLA frog) Actn4-prov protein.- Xenopus laevis (African clawed Q6DCS8 XENIJA frog). Actinin alpha 4.- Brachydanio rerio (Zebrafish) (Danio Q7SYE2 BRARE rerio) Actinin, alpha 4.- Xenopus tropicalis (Western clawed Q6DFP7 XENTR frog) (Silurana tropicalis) Chromosome undetermined SCAF14O91, whole genome Q4STW7 TETNG shotgun sequence. (Fragment).- Tetraodon nigrovirid Chromosome 16 SCAF14974, Q4RZ26 TETNG whole genome shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green Actn3-prov protein.- Xenopus laevis (African clawed Q6DFU3 XENLA frog) Hypothetical protein zgc:77243.- Brachydanio rerio Q6POJ5 BRARE (Zebrafish)__(Danio_rerio) alpha-actinin 2, skeletal muscle splice form SK - S02 032 chicken cDNA, RIKEN Q3V117 MOUSE Adult male testis full-length enriched library, clone:4922505F07 product:ATP citrate ly Q3ZC55 BOVIN Actinin, alpha 2.- Bos taurus (Bovine). Q9QZX1 RAT Nucleolin-related protein NRP.- Rattus norvegicus (Rat) A53211 glucose-regulated protein GRP94 - dog MGC79035 protein.- Xenopus laevis (African clawed Q6DD73 XENLA frog) MGC79034 protein.- Xenopus laevis (African clawed Q61P14 XENLA frog). NUCL HUMAN Nucleolin (Protein C23) .- Homo sapiens (Human) Q4RNG2 TETNG Chromosome undetermined SCAF15O13, whole genome shotgun sequence.- Tetraodon nigroviridis (Green pu HHCHO8 heat shock protein 108 precursor - chicken 4 Q5NCS5 MOUSE Heat shock protein (NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched librar Q3NHM6 BOVIN Hypothetical protein MGC128363.- Bos taurus (Bovine). Q3U055 MOUSE Activated spleen cDNA, RIKEN full-length enriched 197 library, clone:F830206L09 product:procollagen lys 2 PLOD2 HUMAN Procollagen-lysine, 2—oxoglutarate 5-dioxygenase precursor (EC 1.14.11.4) (Lysyl hydroxylase 2) (L 17 days embryo kidney cDNA, RIKEN full-length enriched Q3TGQ3 MOUSE library, clone:1920040H08 product:catenin al BAA03530 HUMALPHAC NID: - Homo sapiens Q9TUN5 PIG Glycoprotein lila.- Bus scrofa (Pig) C1TC HtJMAN C-l-tetrahydrofolate synthase, cytoplasmic (Cl-THF synthase) [Includes: Methylenetetrahydrofolate d CAD23629 RN0430860 NID: - Rattus norvegicus KRHUO keratin 10, type I, cytoskeletal - human Zgc:92008.- Brachydanio rerio (Zebrafish) (Danio Q6DG67 BRARE rerio) Alpha-actinin (Fragment) -- Biomphalaria glabrata Q8ITHO BIOGL (Bloodfluke_planorb). Q9PVF8 Cell-adhesion protein alphas catenin (Catenin BRARE (Cadherin-associated protein), alpha) .- Brachydanio r Q9TUN3 RABIT Glycoprotein lila.- Oryctolagus cuniculus (Rabbit) C1TC RAT C-l-tetrahydrofolate synthase, cytoplasmic (C1—THF synthase) [Includes: Methylenetetrahydrofolate d Myosin (Myosin MYO1C BOVIN Ic I beta) (MMI-beta) (MMIb) .- Sos taurus (Bovine) DNMS nucleolin - mouse 10 days neonate skin cDNA, RIKEN full-length enriched QBCE3O MOUSE library, clone:4732495B18 product:nucleolin, NUCL RAT Nucleolin (Protein C23) .- Rattus norvegicus (Rat) U HNRPU HUMAN Heterogeneous nuclear ribonucleoprotein (hnRNP U) (Scaffold attachment factor A) (SAF-A) (p120) Importin IMB3 HUMAN beta-3 (Karyopherin beta-3) (Ran-binding rotein 5) (RanBP5) .- Homo sapiens (Human) Q9BVN4 HUMAN NSUN2 protein (Fragment) .- Homo sapiens (Human) Hypothetical protein DKFZp459L2O8.- Pongo pygmaeus Q5RC71 PONPY (Orangutan) Alpha(S) -catenin.- Xenopus laevis (African clawed Q91682 XENLA frog). Q5TBM7 HUMAN Heat shock lOSkDa protein 1.- Homo sapiens (Human) Chromosome SCAF15O13, Q4RNG1 TETNG undetermined whole genome shotgun sequence.- Tetraodon nigroviridis (Green pu trypsin (EC 3.4.21.4) precursor - pig (tentative TRPGTR sequence) 9 Q2NL77 HUMAN Eukaryotic translation initiation factor 3, subunit eta,_ll6kDa.- Homo_sapiens_(Human). LOC314432.- Q5U300 RAT Hypothetical protein Rattus norvegicus (Rat) Q6NSO3 XENLA Xpol protein.- Xenopus laevis (African clawed frog) IJMSFB fibronectin receptor beta chain precursor - mouse Hypothetical protein D1005.l (Fragment) Q2Q3C7 CAEEL Caenorhabditis_elegans. Q6BZU8 YARLI Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica.- Yarrowia lipolytica (Ca Q1N554 9GAMii Heat shock protein 90.- Oceanobacter sp. RED65. GA2l58l-PA (Fragment) - - Drosophila pseudoobscura Q29EW2 DROPS (Fruit fly) Q9Z2G3 RAT ATP-citrate (Pro-S-)-lyase (Fragment).- Rattus 198 norvegicus (Rat) Q6BEQ3 CAEEL Hypothetical protein vab-lO.- Caenorhabditis elegans. Similarity to NON-MUSCLE ALPHA ACTININ. Q8STW7 ENCCU Encephalitozoon_cuniculi. Osteoclast-like cell cDNA, RIKEN full-length enriched Q3TVM1 MOUSE library, clone:I420047ElS product:splicing fa UBIQ LUNTE Ubiquitin (Fragment) .- Lumbricus terrestris (Common earthworm) - Ubiquitin (Fragment) .- Scyliorhinus torazame (Cloudy Q9DEZ5 SCYTO catshark) 1BG2 kinesin motor domain - human Q5DTI2 MOUSE MKLAA4195 protein (Fragment) .- Mus musculus (Mouse) Ubiquitin activating enzyme.- Xenopus laevis (African Q9DEE8 XENLA clawed frog) B16 F1OY cells cONA, RIKEN full-length enriched Q3UFTO MOUSE library, clone:G370090]306 product:myosin heavy chai GTP Q1F135 9CLOT cyclohydrolase I (EC 3.5.4.16).- Clostridium hytofermentans ISDg. Chromosome 2 Q4S9N6 TETNG SCAF14695, whole genome shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) Q81Y17 HUMAN Sec24-related protein 0.- Homo sapiens (Human) Kluyveromyces lactis strain NRRL Y-ll4O chromosome S Q6CNH8 KLULA of strain NRRL Y- 1140 of Kluyveromyces lactis. Kluyveromyces lactis (Yeast) (Candida sphaerica) Q1RMF7 HUMAN Importin 7.- Homo sapiens (Human) Probable endo-1,4-beta-xylanase. - Clostridium Q8XM63 CLOPE perfringens. Q3B7B9 HUMAN EIF3S8 protein (Fragment).- Homo sapiens (Human). Chromosome 15 SCAF149Y2, whole genome shotgun Q4RVI5 TETNG sequence. (Fragment) .- Tetraodon nigroviridis (Green )uffer) Hypothetical protein DKFZp459K043.- Pongo pygmaeus Q5R4H9 PONPY (Orangutan) 199 Protein hits reported for the sample prepared from psgA745 cells at 100 kDa which contained nucleolin. EF2 MOUSE Elongation factor 2 (EF-2).- Mus musculus (Mouse). 10 days neonate skin cDNA, RIKEN full-length enriched clone:4732472Fll Q8C153 MOUSE library, product:ELONGATION FACTOR 2 (EF-2) homolog.- Mus ausculus (Mouse) Adult male thymus cDNA, RIKEN full-length enriched library, clone:5830470E07 product:eukaryotic Q3UZ14 MOUSE translation elongation factor 2, full insert sequence.- Mus musculus (Mouse) FAHUAA alpha-actinin 1 - human Bone marrow macrophage cDNA, RIKEN full-length enriched Q3UDJ7 MOUSE library, clone:G5301230l8 product:actinin alpha 4, full insert sequence.- Mus musculus (Mouse) AAH05033 BC005033 NID: - Homo sapiens Q6P786 RAT Alpha actinin 4.- Rattus norvegicus (Rat) Bone marrow macrophage cDNA, RIKEN full-length clone:18300l5Kl2 Q3UBUO MOUSE enriched library, product:tumor rejection antigen gp96, full insert sequence.- Mus .iusculus (Mouse) Tumor Mus musculus Q91V38 MOUSE rejection antigen gp96.- (Mouse) AAH1O319 BCOlO3l9 NID: - Mus musculus Eukaryotic 2, Q6P3J5 BRARE translation elongation factor like. Brachydanio rerio (Zebrafish) (Danio rerio) Eukaryotic translation elongation factor 2, like. Q7ZVM3 BRARE Brachydanio rerio (Zebrafish) (Danio rerio) MGC108369 protein.- Xenopus tropicalis (Western Q5FVXO XENTR clawed frog) (Silurana tropicalis) AAK74072 AY040226 NID: - Homo sapiens ACTN1 protein.- Xenopus laevis (African clawed Q7ZY34 XENLA frog) S51358 protein kinase ppk98 (BC 2.7.1.-) precursor, brain - pig MGC81191 protein.- Xenopus laevis (African clawed Q6NRW6 XENLA frog) Eukaryotic translation elongation factor 2.- Q6P3N8 XENTR Xenopus tropicalis (Western clawed frog) (Silurana tropicalis) Q7SYE2 BRARE Actinin alpha 4.- Brachydanio rerio (Zebrafish) (Danio rerio) Eet2-prov protein.- Xenopus laevis (African clawed Q7ZXP8 XENLA frog) Actn4-prov protein.- Xenopus laevis (African Q6DCS8 XENLA clawed frog) A27441 nucleolin - Chinese hamster 139166 cellular apoptosis susceptibility protein CAB - human Chromosome undetermined SCAF1431O, whole genome Q4ST3O TETNG shotgun sequence.- Tetraodon nigroviridis (Green Duffer) 200 AAF76325 AF248643 NID: - Mus musculus AAG24636 AF301152 NID: - Mus musculus S04630 Na+/K÷-exchanging ATPase (EC 3.6.3.9) alpha-i chain - horse Chromosome undetermined SCAF14O91, whole genome Q4STW7 TETNG shotgun sequence. (Fragment) .- Tetraodon nigroviridis__(Green_puffer)_- 10 days neonate skin cDNA, RIKEN full-length Q8CE3O MOUSE enriched library, clone:4732495B18 product:nucleolin, full insert sequence.- Mus musculus (Mouse) DNMS nucleolin - mouse NUCL RAT Nucleolin (Protein C23) .- Rattus norvegicus (Rat) Intracellular adhesion molecule 1.- Cricetulus Q9ERF7 CRIGR qriseus__(Chinese hamster) Chromosome 3 SCAF138O6, whole genome shotgun Q4SV44 TETNG sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) ATPase, Na+/K÷ transporting, alpha la.l Q7ZU25 BRARE Dolypeptide.- Brachydanio rerio (Zebrafish) (Danio rerio) MKIAA4195 (Fragment) Mus Q5DTI2 MOUSE protein .- musculus (Mouse) S00503 Na÷/K+-exchanging ATPase (EC 3.6.3.9) alpha chain - Pacific electric ray Na+/K+ ATPase Q9DGL4 BRARE alpha subunit isoform 3.- Brachydanio rerio (Zebrafish) (Danio rerio) 055221 CRIGR Putative CD98 protein.- Cricetulus griseus (Chinese hamster) MGC79035 protein.- Xenopus laevis (African clawed Q6DD73 XENLA frog) A26258 endoplasmin - golden hamster (fragment) Atplala.3 protein.- Brachydanio rerio (Zebrafish) Q7T2D6 BRARE (Danlo rerio) 84 kDa Q1PSW2 RAT heat shock protein.- Rattus norvegicus (Rat) Transitional endoplasmic reticulum ATPase (TER TERA HUMAN TPase) (l5 Mg(2+)- ATPase p97 subunit) (Valosin containing protein) (VCP) .- Homo sapiens (Human) Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (EC 3.6.3.8) (Calcium pump 2) (SERCA2) (SR Ca(2÷)-ATPase 2) (Calcium-transporting ATPase AT2A2 CHICK sarcoplasmic reticulum type, slow twitch skeletal nuscle isoform) (Endoplasmic reticulum class 1/2 Ca(2÷) AT A575l3 heat shock protein 110k - Chinese hamster 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2600013M03 Q9CT46 MOUSE product:nucleolin, full insert sequence. (Fragment) .- Mus musculus (Mouse) Novel protein similar to heat shock protein 90- Q5RG12 BRARE alpha (Hsp9Oa) .- Brachydanio rerio (Zebrafish) (Danio rerio) Q4ZGM5 PAGBE Na+,K+-ATPase a3 subunit.- Pagothenia bernacchii 201 (Emerald rockcod) (Trematomus bernacchii) Q2HJE3 BOVIN L0C539784 protein (Fragment).- Bos taurus (Bovine) Q5ZLU4 CHICK Hypothetical protein.- Gallus gallus (Chicken) Q29RA2 BRARE Hypothetical protein zgc:136908.- Brachydanio rerio (Zebrafish) (Danio rerio) 4F2 S6 47 02 cell surface antigen heavy chain - Rattus 1 eucopus DNA MCM4 (CDC21 MCM4 HUMAN replication licensing factor homolog) (Pl-CDC21) .- Homo sapiens (Human) Bone marrow macrophage eDNA, RIKEN full-length enriched library, clone:I8300l4002 Q3tJC1O MOUSE )roduct:minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae), full insert sequence.- Mus musculus (Mouse) L0C495046 protein.- Xenopus laevis (African clawed Q4KLX4 XENLA frog) Hypothetical MCM6 (Fragment) Homo Q4ZG57 HUMAN protein .- sapiens (Human) Q8UUT9 RANSY Eukaryotic translation elongation factor 2 (Fragment) .- Rana sylvatica (Wood frog) 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:1920096F09 product:DNA MCM3 Q3U157 MOUSE replication licensing factor (DNA polymerase alpha holoenzyme-associated protein P1) (Pl-MCM3) full insert sequence (Melanocyte cDNA, RIKEN full- length Sodium/potassium pump alpha subunit. Q98SL3 ELEEL Electrophorus electricus (Electric eel) Elongation factor-2 (Fragment) .- Paralamyctes sp. Q6JU89 9MYRI JCR-2003. Q6W965 9BILA Sodium/potassium ATPase alpha subunit (Fragment) Conopeum sp. FEA-2003. 12 days embryo female ovary cDNA, RIKEN full- Q3TSK9 MOUSE length enriched library, clone:6620401A08 )roduct:protease, serine, 15, full insert sequence.- Mus musculus (Mouse) Na+/K+-ATPase alpha-subunit.- Dugesia japonica 076154 DUGJA (Planarian) 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730419M01 product:brain Q3UZL2 MOUSE glycogen phosphorylase, full insert sequence. (Fragment) .- Mus musculus (Mouse). AAP44766 AY225854 NID: - Bos taurus HSP9O Q5AH23 CANAL Hypothetical protein (Hypothetical protein CaJ7.0234) .- Candida albicans (Yeast) A48592 transferrin receptor protein - Chinese hamster 90-kDa heat-shock protein (Fragment) .- Monosiga Q7YZJ4 MONBE )revlcollis. Elongation factor 2 (Fragment) .- Cylindroiulus Q6JSR8 9MYRI )unctatus. Hypothetical protein DKFZp459K154.- Pongo pygrnaeus Q5R922 PONPY (Orangutan) Q5ATW1 EMENI HS9OPODAN HEAT SHOCK PROTEIN 90 HOMOLOG 202 (SUPPRESSOR OF VEGETATIVE INCOMPATIBILITY MOD-E) Emericella nidulans (Aspergillus nidulans) Q5CD25 EISFO Valosin containing protein-i.- Eisenia foetida (Common brandling worm) (Common dung-worm) Heat shock protein gp96.- Strongylocentrotus Q868Z7 STRPU Durpuratus (Purple sea urchin) MGC53249 protein.- Xenopus laevis (African clawed Q7ZXD3 XENLA frog) Q86VG2 HUMAN SFPQ protein.- Homo sapiens (Human) - Novel protein similar to vertebrate ATPase, Ca÷+ Q6ZM6O BRARE transporting, cardiac muscle, slow twitch 2 (ATP2A2) Brachydanio rerio (Zebrafish) (Danio rerio) Chromosome 1 SCAF1464O, whole genome shotgun Q4SDC7 TETNG sequence. (Fragment).- Tetraodon nigroviridis (Green puffer) Q95WT4 SCHMA SNaK1- Schistosoma mansoni (Blood fluke) Testis cDNA clone: QtsA-l29l3, similar to human TPase, Ca++ transporting, cardiac muscle, fast Q4R8B2 MACFA twitch l(ATP2A1), transcript variant a,.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey). ATPase, Ca++ transporting, cardiac muscle, slow Q7ZW18 BRARE twitch 2.- Brachydanio rerio (Zebrafish) (Danio rerio) Bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:1830038J23 product:coatomer gamma, Q3U9F4 MOUSE rotein complex, subunit full insert sequence (Bone marrow macrophage cDNA, RIKEN full- length enriched library, clone:I830l24P2l Droduct : coatom Adult male hypothalamus cDNA, RIKEN full-length Q8CALO MOUSE enriched library, clone:A230045Mll product:weakly similar to Cl-tetrahydrofolate synthase.- Mus musculus (Mouse) AAH74670 BC074670 NID: - Xenopus tropicalis Q9DDB9 RANCL Ca2÷-ATPase l- Rana clamitans (Green frog) NMDA 1 Q52LG9 HUMAN receptor regulated (Hypothetical protein TBDN100) .- Homo sapiens (Human). Q6USB9 9BIVA Heat shock protein 90.- Chlamys farreri. CG5520-PA (LD2364lp) .- Drosophila melanogaster Q9VAY2 DROME (Fruit fly) Heat shock protein 90 (Fragment) .- Streblomastix Q86LJ8 9EUKA strix. Q27HW6 Heat shock protein 90 (Fragment) .- Scophthalmus maximus (Turbot) Homo XPO7 HUMAN Exportin-7 (Exp7) (Ran-binding protein 16).- sapiens (Human) Elongation factor 2 (EF-2) -- Drosophila EF2 DROME aelanogaster (Fruit fly) Neutral alpha-glucosidase AB precursor (EC GANAB HUMAN 3.2.1.84) (Glucosidase II subunit alpha).- Homo sapiens (Human) CAH18695 CR749840 NID: - Homo sapiens 203 Coatomer COPB2 HUMAN subunit beta’ (Beta’-coat protein) (Beta-COP) (p102).- Homo sapiens (Human). Heat shock 9OkD Q84KP7 CYAME protein (Fragment) Cyanidioschyzon merolae (Red alga). Novel protein similar to vertebrate eukaryotic Q1LYG5 BRARE translation elongation factor 2 (EEF2) Brachydanio rerio (Zebrafish) (Danio rerio) Candida glabrata strain CBS138 chromosome L Q6FLU9 CANGA complete sequence.- Candida glabrata (Yeast) (Torulopsis_glabrata) Hypothetical protein DKFZp459DO32.- Pongo pygmaeus Q5R407 PONPY (Orangutan) A54142 nucleoporin NUP1O7 - rat ITB5 MOUSE Integrin beta-5 precursor.- Mus musculus (Mouse). Elongation factor-2 (Fragment).- Loxothylacus Q6JUAO 9MAXI texanus. AVID CHICK Avidin precursor.- Gallus gallus (Chicken) AAH20569 BC020569 NID: - Homo sapiens Atp4a protein.- Xenopustropicalis (Western clawed Q5BL65 XENTR frog)__(Silurana_tropicalis) Wu:fc55e05prov protein.- Xenopus laevis (African Q7ZTRO XENLA clawed frog) Na/K-ATPase alpha subunit isoform 2.- Drosophila Q9U458 DRONE e1anogaster (Fruit fly) Q32PZ3 RAT Unc-45 homolog A.- Rattus norvegicus (Rat). Q6JEE9 SACKL Translation elongation factor (Fragment) Saccharomyces kluyveri (Yeast) Chromosome undetermined SCAF15O16, whole genome Q4RN34 TETNG shotgun sequence.- Tetraodon nigroviridis (Green )uffer) Na+/K+-ATPase alpha 4 subunit.- Rattus norvegicus Q5PQV3 RAT (Rat) translation elongation factor eEF-2 - Chlorella S32819 kessleri ATPase, H÷/K+ Q32MR8 MOUSE transporting, nongastric, alpha )olypeptide.-_Mus musculus (Mouse) Na+/K÷-exchanging ATPase (EC 3.6.3.9) alpha chain 506635 (clone_alpha-2850)__-_brine_shrimp Q1LZB6 BOVIN MGC139131 protein.- Bos taurus (Bovine). Q1N554 9GANM Heat shock protein 90.- Oceanobacter sp. RED65. Q6JU95 9CRUS Elongation factor-2 (Fragment) .- Nebalia hessleri. Q1HGM8 HUMAN Activated leukocyte cell adhesion molecule variant 2.- Homo sapiens (Human) Q2CVM6 ECTHA ATP-binding region, ATPase-like.- Halorhodospira halophila SL1. AAH79643 BC079643 NID: - Mus musculus Integrin beta-l precursor (Fibronectin receptor ITB1 BOVIN subunit beta) (Integrin VLA-4 subunit beta) (CD29 antigen) .- Bos taurus (Bovine) 150099 H,K-ATPase - giant toad AA100192 BC100191 NID: - Xenopus laevis 2 days neonate thymus thymic cells cDNA, RIKEN Q3U4W8 MOUSE full-length enriched library, clone:E43002l1l0 Droduct:Ubiquitin carboxyl-terminal hydrolase 5 (EC 204 3.1.2.15) (Ubiquitin thiolesterase 5) (Ubiquitin specific processing protease 5) (Deubiquitinating en z PYGL Glycogen phosphorylase, liver form (EC 2.4.1.1) lomo sapiens (Human) AP-2 complex subunit alpha—2 (Adapter-related rotein complex 2 alpha- 2 subunit) (Aipha-adaptin AP2A2 RAT C) (Adaptor protein complex AP-2 alpha-2 subunit) (Clathrin assembly protein complex 2 alpha-C large chain) (100 kDa coated vesicle protein C) (Plasma c Translation elongation factor (Fragment) Q6JEFO 9SACH Debaryomyces carsonii. Chromosome undetermined SCAF15O16, whole genome Q4RN35 TETNG shotgun sequence. (Fragment) .- Tetraodon nigroviridis (Green puffer) Elongation factor 2 (EF-2) .- Cryptosporidium Q5CMC8 CRYHO hominis. PYGL RAT Glycogen phosphorylase, liver form (EC 2.4.1.1) Rattus norvegicus (Rat) Blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0037K05 product:Heat Q3TK29 MOUSE shock protein 75 kDa, mitochondrial (HSP 75) (Tumor necrosis factor type 1 receptor associated protein) (TRAP- 1) (TNFR- associated protein 1), full insert AAN09749 AF416763 NID: - Sus scrofa Elongation factor-2 (Fragment) .- Echiniscus Q6JU8O 9BILA riridissimus. Elongation factor-2 (Fragment).- Acanthocyclops Q6JUC]. 9MAxI rernalis. Elongation factor 1 alpha, putative.- Theileria Q4N7U4 THEPA arva. IJMSFB fibronectin receptor beta chain precursor - mouse Vesicular-fusion protein nsf.- Aedes aegypti Q17KM8 AEDAE (Yellowfever mosquito) Brain cDNA, clone: QccE-l2334, similar to human solute carrier family 3 (activators of dibasic Q4R5N3 MACFA andneutral amino acid transport), member 2 (SLC3A2),.- Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey) AAA family ATPase, possible cell division control Q8ZTN5 PYRAE )rotein cdc48.- Pyrobaculum aerophilum. ENSANGP00000025525 Q5TU13 ANOGA (Fragment).- Anopheles gambiae str. PEST. MCM4 minichromosome maintenance deficient 4, Q5BTM2 SCHJA aitotin (Fragment).- Schistosoma japonicum (Blood fluke) MMS19-like (MET18 homolog, 9. Q5JTG3 HUMAN cerevisiae) (Fragment) .- Homo sapiens (Human) BAB26853 AK010326 NID: - Mus musculus A 1QGRA importin beta subunit b, chain - human ( fragments) Ubiquitin-activating enzyme El (A1S9T and 3N75 Q5JRR6 HUMAN temperature sensitivity complementing).- Homo sapiens (Human) Q4XOG7 ASPFU Translation elongation factor EF-2 subunit, 205 putative.- Aspergillus fumigatus (Sartorya fumiqata) Elongation factor-2 (Fragment) .- Libinia Q6JUA2 LIBEM emarginata (Spider crab) Chromosome undetermined SCAF5546, whole genome Q4TE94 TETNG shotgun sequence.- Tetraodon nigroviridis (Green uffer) AAF81908 AF276984 NID: - Felis catus Q2AIH8 9FIRN Polysaccharide deacetylase precursor. - Halothermothrix orenii H 168. BAA01876 STRSTSI NID: - Streptococcus sanguinis Elongation factor 1 alpha (Fragment).- Chiosyne Q5EPW3 CHLAC acastus (Sagebrush checkerspot) Hypothetical protein CBG19441 (Fragment). Q6OVQ7 CAEBR Caenorhabditis briggsae. GTP Q1F135 9CLOT cyclohydrolase I (EC 3.5.4.16).- Clostridium thytofermentans ISDg. ABD46211 CP000237 NID: - Neorickettsia sennetsu str. 4iyayama Heat shock 7OkDa Homo Q2TAL4 HUMAN protein 4, isoform a.- sapiens (Human) Hypothetical Q39TZ8 GEOMG protein.- Geobacter metallireducens (strain GS-l5 / ATCC 53774 / DSM 7210) Q5LF76 BACFN Hypothetical protein.- Bacteroides fragilis (strain ATCC 25285 / NCTC 9343) CG7762-PA (26S proteasome regulatory complex Q9VW54 DROME subunit p97) (Hypothetical protein) .- Drosophila nelanogaster (Fruit fly) Q2A152 9FIRN Hypothetical protein.- Halothermothrix orenii H 168. Adaptor-related protein complex 2, alpha 1 Q6NVT5 XENTR subunit.- Xenopus tropicalis (Western clawed frog) (Silurana tropicalis) Hypothetical protein Atlg56070 .- Arabidopsis Q56WY3 ARATH thaliana (Mouse-ear cress) Beta-actin (Fragment) .- Rhinolophus ferrumequinum Q1KMR5 RHIFE (Greater horseshoe bat) Isoleucyl-tRNA synthetase, mitochondrial precursor (SC SYIM MACFA 6.1.1.5) (Isoleucine--tRNA ligase) (I1eRS) (Fragment) .- Macaca fascicularis (Crab eating acaque) (Cynomolgus monkey) Q2PYO6 Sulfite dehydrogenase soxC.- uncultured marine 9BACT bacterium Ant4D5. ACT4 DICDI Actin-3-sub 2.- Dictyostelium discoideum (Slime mold) Q9SWP8 Type 4 actin (Fragment) .- Pleurochrysis carterae PLECA (Marine alga) 206