CYP2A6) by P53

Transcriptional Regulation of Human Stress Responsive Cytochrome P450 2A6 (CYP2A6) by p53

Hao Hu

M.Biotech. (Biotechnology) 2012 The University of Queensland

B.B.A. 2009 University of Electronic Science and Technology of China

B.Sc. (Pharmacy) 2009 University of Electronic Science and Technology of China

A thesis submitted for the degree of Doctor of Philosophy at

The University of Queensland in 2016

School of Medicine

ABSTRACT

Human cytochrome P450 (CYP) 2A6 is highly expressed in the liver and the encoding gene is regulated by various stress activated transcription factors, such as the nuclear factor (erythroid-derived 2)-like 2 (Nrf-2). Unlike the other xenobiotic metabolising CYP enzymes (XMEs), CYP2A6 only plays a minor role in xenobiotic metabolism. The CYP2A6 is highly induced by multiple forms of cellular stress conditions, where XMEs expression is normally inhibited. Recent findings suggest that the CYP2A6 plays an important role in regulating BR homeostasis.

A computer based sequence analysis on the 3 kb proximate CYP2A6 promoter revealed several putative binding sites for p53, a protein that mediates regulation of antioxidant and apoptosis pathways. In this study, the role of p53 in CYP2A6 gene regulation is demonstrated. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. The p53 responsiveness of this site was confirmed by transfections with various stepwise deleted of CYP2A6-5’-Luc constructs containing the putative p53RE. Deletion of the putative p53RE resulted in a total abolishment of p53 responsiveness of CYP2A6 promoter. Specific binding of p53 to the putative p53RE was detected by electrophoresis mobility shift assay. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Benzo[α]pyrene treatments of MCF-7 cells upregulated endogenous p53, which enhanced the expression of p53 responsive positive control and the CYP2A6-5’-Luc construct containing the intact p53 binding site but not the mutated CYP2A6- 5’-Luc construct. Endogenous CYP2A6 expression in C3A cells was induced by benzo[α]pyrene in a dose dependent pattern at the mRNA and protein levels along with elevated p53 levels in nucleus.

It has been shown that the p53- mediated gene expression often involves interaction with other factors. The identified functional p53RE is only five base pairs upstream of the REs that govern the constitutive CYP2A6 gene expression. “Stress cluster” on the proximal CYP2A6 promoter is described in which the stress activated transcription factors: CAR, C/EBPα-Oct- 1, and the p53, together with HNF-4α, regulate the encoding CYP2A6 gene. Overexpression of these transcription factors individually in the C3A cells upregulated (with the exception of CAR) a recombinant gene consisting of proximal CYP2A6 promoter containing all the REs of

the regulatory proteins. Specific binding of these transcription factors to their REs on the CYP2A6 promoter was demonstrated by using an EMSA analysis. A series of site mutations of the REs on the proximal CYP2A6 promoter region followed by transfection of these REs mutated CYP2A6 promoters into the C3A cells demonstrated that the CAR and C/EBP/Oct-1 could support the promoter activity partially independently, while for the p53 and the HNF- 4α mediated CYP2A6 transactivation, interaction with the other factors is required. Co- transfection of the p53 together with the REs mutated CYP2A6 promoters respectively into the C3A cells further demonstrated that the p53- mediated CYP2A6 transactivation involved interaction with CAR and C/EBP/Oct-1, and its full activity was complemented by HNF-4α. Replacing the p53RE on the proximal CYP2A6 promoter with a consensus p53RE resulted in an extremely high expression of the recombinant gene regardless of p53 overexpression. While unexpected, this result agrees with the rest of the evidence and supports a model where the stress activated proteins form a compact cluster, assisted by the liver specific HNF-4a for full activity.

It has been shown that p53 interacts with Nrf-2 exerting a role in regulating several stress activated genes. Co-transfection of Nrf-2 and p53 together with CYP2A6 promoter in C3A cells demonstrated that the Nrf-2 restrained the p53- mediated CYP2A6 transactivation probably through the “stress cluster” present on the promoter region. Stepwise truncations of the distal CYP2A6 promoter followed by transfection of these promoters into the C3A cells also suggested that the potential suppressor(s) may exist on the “-2253 to -1700bp” and “-688 to-250bp” regions of the promoter.

Collectively, the results provide a mechanistic explanation for previous observations that the CYP2A6 is induced by various structurally unrelated toxic insults.

DECLARATION BY AUTHOR

This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School.

I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis.

iii

PUBLICATIONS DURING CANDIDATURE

Peer-Reviewed Journal Article by the Candidate Forming Part of the Thesis

Hu, H., Yu, T., Arpiainen, S., Lang, M.A., Hakkola, J., Abu-Bakar, A., 2015. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6. Toxicology and applied pharmacology 289, 30-39 (Appendix I).

Conference Presentations

1. Hu, H., Abu-Bakar, A., Lang, M.A., The Gene Regulatory Mechanism of Human CYP2A6 in the Application of Biosensor Development. Oral presentation at CRC-CARE communicate14 conference, 15-17 Sep, 2014 Adelaide, Australia.

2. Hu, H., Abu-Bakar, A., Lang, M.A., Tumour Suppressor Protein p53 Mediates Cytochrome P450 2A6 Gene Expression. Poster presentation on 19th International Conference on Cytochrome P450, 12-15 Jun, 2015, Tokyo, Japan.

PUBLICATION INCLUDED IN THIS THESIS Chapter 5

Contributor Statement of contribution

Designed experiments (80%) Conducted experiments (80%) Hu, H., (Candidate) Data analysis (70%) Wrote the paper (50%) Statistical analysis (50%)

Yu, T., Designed experiments (20%) Conducted experiments (10%)

Arpiainen, S., Conducted experiments (5%)

Lang, M.A., Project conceptualisation (60%) Wrote and edit the paper (25%)

Hakkola, J., Project conceptualisation (10%)

Project conceptualisation (30%) Abu-Bakar, A., Conducted experiments (5%) Wrote and edited the paper (25%) Statistical analysis (50%) Data analysis (30%)

CONTRIBUTIONS BY OTHERS TO THE THESIS

A number of people who made their significant contributions to the project are shown as follows:

Professor Matti Lang and Associate Professor A’edah Abu-Bakar ─ in the conceptualisation and design of the project based on their research works, as well as critical revision of the thesis

Dr Ting Yu ─ in the assistance of experimental design and non-route technical works

Ms Victoria Prantner ─ in the assistance of developing transient cell transfection protocol

I would also like to acknowledge the people who provided the plasmids as gift for this project.

• Professor Jukka Hakkola, University of Oulu, Oulu, Finland • Professor Paavo Honkakoski, University of Kuopio, Kuopio, Finland • Professor Masahiko Negishi, National Institute of Environmental Health Sciences, Research Triangle, USA • Professor Peter Mackenzie, Flinders University, Adelaide, Australia

STATEMENT OF PARTS OF THE THESIS SUBMITTED TO QUALIFY FOR THE AWARD OF ANOTHER DEGREE None

ACKNOWLEDGEMENTS

Although only my name appears on the cover of this thesis, there are a number of people without whose help, the thesis would not have been possible. I would like to express my sincere gratitude to all of them. Foremost, I am extremely grateful to my Principle Supervisor, Professor Matti Lang for being a tremendous mentor throughout my PhD years. I have been extremely fortunate to have a mentor who gave the freedom to explore my own path, and provided the guidance and support when my steps faltered. I would like to thank you for your immense knowledge, patience and encouragement, and training me as a research scientist. Your advices on my career development are also invaluable.

I am also greatly indebted to my Associate Supervisor, Associate Professor A’edah Abu- Bakar for her guidance, support and encouragement, especially in the first year of my PhD study when I had to make important decisions on the direction of my project. Without her guidance, I may have stuck in the beginning of this study. I really appreciate her positive thinking, invaluable discussion and encouragement to see me through the difficult time.

I also would like to take this opportunity to thank the organisations that sponsor my PhD project. Cooperative Research Centre for Contamination Assessment and Remediation of the Environment (CRC-CARE) granted a scholarship to support my study and traveling fund to attend conferences. The University of Queensland provided a scholarship for tuition fee waiver. National Research Centre for Environmental Toxicology (Entox), Faculty of Health and Behavioural Sciences (HABS) offered a research scholarship for my final semester of my PhD study. I appreciate muchly for the support that I received from these organisations.

My sincere thanks also goes to my thesis review committee, Professor Jack Ng, Dr Wasantha Wickramasinghe and Dr Steven Reid, for their encouragement, difficult questions and valuable feedbacks, especially for Dr Steven Reid who introduced me to the world of molecular biology when I did my Master’s degree under his supervision. Thank you all very much for your support.

I am also grateful to my colleagues, labmates and friends at Entox, in particularly, Dr Ting Yu for her endless discussion on the molecular biological techniques, Ms Victoria Prantner for her kind assistance in developing cell transfection protocol and Dr Siti Muhsain for her selfless help in the lab. I would like to thank the honours students of our group, Ms Katherine

vii

Jordan and Ms Josefin Ore for giving the opportunity to obtain teaching experience. I am also thankful to the youth fellowship group of Logos Christian church, brothers, sisters, Uncle Paul Hu and Aunt Anna Chen for their selfless help and prayers.

My special thanks goes to my family. Words cannot express how grateful I am to my parents (Ms Qiaoling Yu and Mr Guozhen, Hu), my parents - in - law (Ms Fengshu, Li and Mr Jihu Wang) for their unconditional support both emotionally and financially, and my sister - in - law (Ms Jie Wang) for her support in sharing the housework. Most importantly, I would like to thank my wife (Ms Wei Wang) for her understating the pressure in pursuing a PhD degree and all the sacrifices she has made on my behalf. I owe a great debt of gratitude to my beloved daughter (Ms Yaxin Hu). She is such a nice baby girl who always makes me happy. Finally, I would like to dedicate the thesis to my future son. This will be the gift for his impending birth.

viii

KEYWORDS

Benzo[α]pyrene (BaP), bilirubin (BR), cytochrome P450 2A6 (CYP2A6), haem oxygenase- 1(HMOX1), nuclear factor erythroid 2-like 2 (Nrf-2), tumour suppressor p53, constitutive androstane receptor (CAR), CCAAT-enhancer-binding protein (C/EBP), octamer-1(Oct-1), hepatocyte nuclear factor-4α (HNF-4α).

AUSTRALIAN AND NEW ZEALAND STANDARD RESEARCH CLASSIFICATIONS (ANZSRC)

060111, Signal Transduction, 70%

060199, Biochemistry and Cell Biology not elsewhere classified, 20%

060107, Enzymes, 10%

FIELDS OF RESEARCH (FOR) CLASSIFICATION

0601, Biochemistry and Cell Biology, 100%

TABLE OF CONTENTS

ABSTRACT ...... i DECLARATION BY AUTHOR ...... iii PUBLICATIONS DURING CANDIDATURE ...... iv PUBLICATION INCLUDED IN THIS THESIS ...... v CONTRIBUTIONS BY OTHERS TO THE THESIS ...... vi STATEMENT OF PARTS OF THE THESIS SUBMITTED TO QUALIFY FOR THE AWARD OF ANOTHER DEGREE ...... vi ACKNOWLEDGEMENTS ...... vii KEYWORDS ...... ix AUSTRALIAN AND NEW ZEALAND STANDARD RESEARCH CLASSIFICATIONS (ANZSRC) ...... ix FIELDS OF RESEARCH (FOR) CLASSIFICATION ...... ix TABLE OF CONTENTS ...... x LIST OF FIGURES AND TABLES...... xiv LIST OF ABBREVIATIONS ...... xvii 1. INTRODUCTION ...... 1 2. LITERATURE REVIEW ...... 3 2.1 Cytochrome P450 gene family and enzyme regulation ...... 3 2.1.1 Cytochrome P450...... 3 2.1.2 Regulation of CYP enzymes ...... 4 2.2 Structure and function of CYP2A6 ...... 6 2.2.1 Cytochrome P450 subfamily 2A (CYP2A) ...... 6 2.2.2 CYP2A6 enzyme structure ...... 7 2.2.3 Tissue specific expression and CYP2A6 polymorphism ...... 8 2.2.4 CYP2A6 in drug metabolism ...... 9 2.2.5 Cyp2a5 deficient mouse model ...... 10 2.3 Current knowledge of the CYP2A6 gene regulatory pathways ...... 11 2.3.1 Transcriptional regulation of CYP2A6 by CAR, Oct-1, C/EBPs, HNF-4α ...... 14 2.3.2 Transcriptional regulation of CYP2A6 by PXR/CAR, ER...... 15 2.3.3 Post-transcriptional regulation of CYP2A6 by hnRNPA1 ...... 16

2.3.4 Post-transcriptional regulation of CYP2A6 by micro-RNA 126 ...... 16 2.3.5 Transcriptional regulation of CYP2A6 by Nrf-2 ...... 17 2.4 The role of CYP2A6 against oxidative stress ...... 18 2.4.1 Oxidative stress ...... 19 2.4.2 Bilirubin oxidase as part of an anti-oxidant complex against intracellular oxidative stress ...... 21 2.5 The p53 protein ...... 22 2.5.1 Structure and regulation of p53 protein ...... 23 2.5.2 P53 activated signalling pathways ...... 24 2.6 Potential interplay among transcription factors in mediating CYP2A6 gene expression ...... 25 2.6.1 Nrf-2 and p53 cross talk in regulating stress responsive genes ...... 25 2.6.2 Interplay among transcription factors in mediating gene expression ...... 27 3. RESEARCH PROBLEMS ...... 29 3.1 Research questions ...... 30 3.2 Working hypotheses ...... 31 3.3 Research strategies ...... 32 4. MATERIALS AND METHODS ...... 37 4.1 List of materials and instruments ...... 37 4.2 Cell culture and maintenance ...... 37 4.3 Molecular biological techniques ...... 37 4.3.1 Computer based promoter analysis ...... 37 4.3.2 5’-truncated CYP2A6 promoter constructions ...... 38 4.3.3 Site directed Mutagenesis ...... 38 4.3.4 Transient transfection assays ...... 39 4.3.5 Synthesis of digoxigenin labelled probes ...... 40 4.3.6 Electrophoretic mobility shift assay ...... 41 4.4 Biochemical procedures ...... 42 4.4.1 BaP treatment of the transfected MCF-7 cells ...... 42 4.4.2 Protein analysis ...... 42 4.4.3 RNA extraction and mRNA analysis ...... 43 4.5 Statistical analysis ...... 43 5. RESULTS AND DISCUSSION ...... 44 5.1 Cell models for gene regulatory study (Paper I & Paper II) ...... 44

5.2 Bilirubin oxidase CYP2A6 is regulated by the stress activated transcription factor p53 (Paper I) ...... 45 5.2.1 CYP2A6 putative p53REs are responsive to p53 ...... 45 5.2.2 P53- mediated CYP2A6 transactivation is through the proximal p53RE ...... 50 5.2.3 Endogenous p53 activates CYP2A6 gene expression ...... 55 5.3 Transcriptional control of CYP2A6 by p53 involves complex interaction with CAR, Oct-1/C/EBP and HNF-4α (Paper II) ...... 60 5.3.1 Role of p53, CAR, C/EBPα, Oct-1 and HNF-4α in the regulation of the CYP2A6 gene expression ...... 60 5.3.2 Contribution by p53, CAR, C/EBP/Oct-1 and HNF-4α REs to CYP2A6 transactivation ...... 67 5.3.3 Over-expression of p53 emphasises its interaction with CAR and C/EBP/Oct-1 in the regulation of CYP2A6 ...... 71 5.3.4 Replacing the p53RE at the CYP2A6 promoter with consensus p53RE dramatically increases the expression level ...... 73 5.3.5 A model for the p53- mediated CYP2A6 transactivation ...... 75 5.4 Interaction between p53 and Nrf-2 in mediating CYP2A6 transactivation and identification of potential repressor region(s) on the CYP2A6 promoter ...... 78 5.4.1 Nrf-2 restrains p53- mediated CYP2A6 transactivation through the C/EBP-Oct- 1RE …………………………………………………………………………………78 5.4.2 Potential repressor region(s) at CYP2A6 promoter ...... 81 5.5 Conclusions ...... 83 6. GENERAL CONCLUSIONS AND FUTURE DIRECTIONS...... 86 6.1 General conclusions ...... 86 6.2 Future directions ...... 87 7. BIBLIOGRAPHY ...... 89 8. APPENDICES ...... 106 Appendix A: List of materials and instruments ...... 106 Appendix B: Transformation of CYP2A6 promoter constructs into the XL-1 blue competent cell …………………………………………………………………………………….111 Appendix C: Gene sequencing procedures ...... 112 Appendix D: Generation of mutated CYP2A6 promoter constructs ...... 113 Appendix E: List of CYP2A6 promoter constructs in the thesis ...... 114 Appendix F: Preparation nuclear and cytosolic extracts from cultured cells ...... 116 Appendix G: Western blotting procedures ...... 117

xii

Appendix H: List of primers, probes and oligonucleotides used in the thesis ...... 118 Appendix I: Paper I ...... 121 Appendix J: Paper II (manuscript) ...... 122

xiii

LIST OF FIGURES AND TABLES

Page

Figure 2.1 Tertiary structure of CYP2A6 protein 8

Figure 2.2 Simulation of bilirubin docking on the CYP2A6 active site 10

Figure 2.3 A schematic depiction of current knowledge on xenobiotic and stress activated CYP2A6 gene regulatory pathways 13

Figure 2.4 Catalytic cycle of cytochrome P450 (CYP) 20

Figure 2.5 “Stress responding” cluster present on Cyp2a5 promoter region 22

Figure 2.6 Network of p53 and Nrf-2 in response to cellular stress 26

Figure 3.1 Putative p53 REs present on the CYP2A6 promoter regions from -2901 to +9 30

Figure 4.1 Schematic representation of synthesised CYP2A6 promoter probes used in EMSA 41

Figure 5.1 Effect of p53 co-transfection on CYP2A6 distal and proximal promoter driven luciferase activities in MCF-7, C3A and HepG2 cells 45

Figure 5.2 Schematic representation of putative p53 REs on CYP2A6 promoter region 46

Figure 5.3 Effect of p53 co-transfection on CYP2A6-5’-Luc construct activities in C3A cells 48

Figure 5.4 Functionality test of the p53RE site on the proximal CYP2A6 promoter 51

Figure 5.5 Effect of p53 co-transfection on the mutated and wildtype CYP2A6 proximal and distal promoters activities 51

Figure 5.6 EMSA analysis of p53 protein/CYP2A6 promoter interactions 54

Figure 5.7 Effect of BaP treatment on activation of CYP2A6-5’-160/+9-Luc promoter activity in MCF-7 cells 57

Figure 5.8 Effect of BaP treatment on endogenous p53, CYP2A6, and HMOX1 expressions in C3A cells 59

Figure 5.9 Effect of transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α CYP2A6-5’-160/+9 Luc construct activity in C3A cells 63

xiv

Figure 5.10 Schematic representation of the response elements on the CYP2A6-5’- 160/+9 Luc construct 65

Figure 5.11 EMSA analysis of the transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α binding to the proximal CYP2A6 promoter 66

Figure 5.12 Site direct mutagenesis of the response elements on proximal CYP2A6 promoter region 68

Figure 5.13 Mutational analysis of the CYP2A6-5’-160/+9 Luc construct in C3A cells 70

Figure 5.14 Effect of p53 co-transfection on the REs mutated CYP2A6-5’-160/+9 Luc construct activities in C3A cells 72

Figure 5.15 Effect of p53 co-transfection on the luciferase activity of the proximal CYP2A6 promoter containing a consensus p53RE 74

Figure 5.16 Schematic representation of the transcriptional regulation of the proximal CYP2A6 promoter 77

Figure 5.17 Effect of p53 and Nrf-2 co-expression on the luciferase activity of the CYP2A6 promoter constructs 80

Figure 5.18 Luciferase activities driven by the 5’-truncated proximal CYP2A6 promoters in C3A cells 82

LIST OF ABBREVIATIONS

A-431 Human epidermoid carcinoma cell line A549 Human lung adenocarcinoma cell line AGRF Australian Genome Research Facility AFB1 Aflatoxin B1 AHR Aryl hydrocarbon receptor Ala Alanine ALDH3A1 Aldehyde dehydrogenase 3 family, member A1 ANOVA Analysis of variance AP Alkaline phosphatase APAP Acetaminophen ARE Antioxidant response element Arnt Aryl hydrocarbon nuclear translocator Asn Asparagine BaP Benzo[α]pyrene BAX BCL-2-associated modulator of apoptosis BPQs Benzo[a]pyrene-quinones BSA Bovine serum albumin BV Biliverdin C3A Human hepatoma-derived cell line C3A CAR Constitutive androstane receptor CCRP Cytoplasmic CAR retention protein CDTA Cyclohexanediamine tetraacetic acid C/EBPα CAAT/enhancer-binding protein α C/EBPβ CAAT/enhancer-binding protein β ChIP Chromatin immunoprecipitation CHX Cycloheximide CNC/bZIP Cap ‘n’ collar/basic leacine zipper

xvi

CP-1 CCAAT-binding protein-1 CPR NADPH cytochrome P450 reductase CRC-CARE Cooperative Research Centre for Contamination Assessment and Remediation of the Environment CSPD alkaline phosphatase substrate CYP Cytochrome P450 CYP1A1 Human cytochrome P450 1A1 enzyme CYP1B Human cytochrome P450, family1, subfamily B CYP2 Human cytochrome P450, family 2 CYP2B Human cytochrome P450, family2, subfamily B CYP2E Human cytochrome P450, family2, subfamily E CYP2A5 Mouse cytochrome P450 2A5 enzyme Cyp2a5 Mouse cytochrome P450 2a5 gene CYP2A6 Human cytochrome P450 2A6 enzyme CYP2A6 Human cytochrome P450 2A6 gene CYP2A6*1 Human cytochrome P450 2A6, allelic variant 1 CYP2A6*2 Human cytochrome P450 2A6, allelic variant 2 CYP2A6*4 Human cytochrome P450 2A6, allelic variant 4 CYP2A6*9 Human cytochrome P450 2A6, allelic variant 9 CYP2A6*12 Human cytochrome P450 2A6, allelic variant 12 CYP3A Human cytochrome P450, family3, subfamily A CYP4F Human cytochrome P450, family4, subfamily F CYP7A Human cytochrome P450, family7, subfamily A CYP19A Human cytochrome P450, family17, subfamily A CYP21A Human cytochrome P450, family21, subfamily A DBP D-site binding protein DEPC Diethylpyrocarbonate DIG Digoxigenin DMEM Dulbecco’s Modified Eagle Medium

xvii

DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DTT Dithiothreitol DR-1 Direct repeat-1 DR-4 Direct repeat-4 EDTA Ethylenediamine tetra acetic acid Entox National Research Centre for Environmental Toxicology EMSA Electrophoretic mobility shift assay ER Endoplasmic reticulum ERE Estrogen response element ETC Electron transport chain FBS Fetal bovine serum Fe3+ Ferric Fe2+ Ferrous Fox A Fork head box A GADD45 Growth arrest and DNA damage 45 protein GAPDH Glyceraldehyde 3-phosphate dehydrogenase GFP Green fluorescent protein GPX Glutathione peroxidase GRIP-1 Glutamate receptor-interacting protein 1 GSH Antioxidant glutathione GST Glutathione S-transferase Gst1α1 Glutathione S-transferase gene variant 1α1

H2O2 Hydrogen peroxide HCC Hepatocellular carcinoma HCl Hydrochloric acid Hepa-1c1c7 Murine hepatoma cells HepG2 Human liver carcinoma cell line HIV-1 Human immunodeficiency virus 1

xviii

HNF-1 Hepatocyte nuclear factor-1 HNF-4α Hepatocyte nuclear factor-4α HNF-6 Hepatocyte nuclear factor-6 HnRNPA1 Heterogeneous nuclear ribonucleoprotein A1 HMOX1 Haem oxygenase 1 H-ras GTPase HRas gene Hsp90 Heat shock protein 90 HUVEC Human umbilical vein endothelial cells IFNγ Interferon-γ IGEPAL Substitute for Nonidet P-40 IL-1β Interleukin-1β IL-8 Interleukin-8 Lys Lysine KCl Potassium chloride Keap1 Kelch-like ECH associated protein 1

Km Michaelis-Menten constant KOH Potassium hydroxide LAP Full-length isoform of the C/EBPβ protein LIP Truncated isoform of the C/EBPβ protein MCF-7 Human breast adenocarcinoma cell line Mdm-2 Murine double minute 2 Met Methionine

MgCl2 Magnesium chloride MMZ Methimazole miRNA Micro RNA MRE miRNA response element mRNA Messenger ribonucleic acid NA Naphthalene NaCl Sodium chloride

xix

NaOH Sodium hydroxide NADH Nicotinamide adenine dinucleotide NADPH Nicotinamide adenine dinucleotide phosphate NF-1 Nuclear factor 1 NIG3T3 Mouse fibroblast cell line NIH National Institute of Health NO Nitric oxide Noxa Phorbol-12-myristate-13-acetate-induced protein 1 NNK 4-(methylnitrosamio)-1-(3-pyridyl)-1-butanone NQO1 NAD(P)H quinine oxidoreductase 1 NQO1 NAD(P)H quinine oxidoreductase 2 Nrf-2 Nuclear factor (erythroid-derived 2)-like 2

.- O2 Superoxide anion radicals Oct-1 Octamer transcription factor 1 p21 Cyclin-dependent kinase inhibitor 1A p53 Tumour suppressor p53 p53RE p53 response element PAHs Polycyclic aromatic hydrocarbons PBDEM Phenobarbital-responsive enhancer module PBS Phosphate-buffered saline PCR Polymerase chain reaction PEIs Polyethylenimines PGC-1α Peroxisome proliferator-activated receptor 1α PGM Phosphoglyceratemutase Phe Phenylalanine PIG3 p53-induced glycolysis and apoptosis regulator PMSF Phenylmethylsulfonylfluoride PPARs Peroxisome proliferator activated receptors PPP Pentose phosphate pathway

Pro Proline PUMA p53 upregulated modulator of apoptosis PVDF Polyvinylidene fluoride PXR Pregnane X receptor Rbx 1 Ring box protein 1 RISC RNA induced silencing complex RLA Relative luciferase activity RNA Ribonucleic acid ROS Reactive oxygen species rpm Revolutions per minute RT-PCR Reverse transcription polymerase chain reaction RXR-α Retinoid X receptor-α SAPK Stress-activated protein kinase S.D Standard deviation SDS-PAGE Sodium dodecylsulfate-polyacrylamide gel electrophoresis Ser Serine SH Sulfhydryl sMaf Small musculoaponeurotic fibrosarcoma protein SNPs Single nucleotide polymorphism SOD-2 Superoxide dismutase -2 SOH Oxygenated substrate Sp Specificity protein family SSC Saline sodium citrate TAA Thioacetamide TAE Tris-acetate-EDTA TAT Trans-activator of transcription TBE Tris/Borate/EDTA buffer TFs Transcription factors

xxi

Thr Threonine TIGAR TP53-indcued glycolysis and apoptosis regulator TNF-α Tumour necrosis factor α TSS Transcription starts site USF Upstream stimulatory factor 3’ UTR 3’ untranslated region UV Ultraviolet-A Val Valine VDR Vitamin D receptor

Vmax Maximum velocity XAP2 AH receptor-interacting protein x-ct x-c-type transporter gene XMEs Xenobiotic-metabolising enzymes XREs Xenobiotic response elements

xxii

1. INTRODUCTION

The metabolism of drugs and other xenobiotics by the cytochrome P450 (CYP) system is not always a benign process. Often, reactive electrophilic metabolites are formed which can strongly bind to cellular macromolecules such as proteins, lipids and DNA leading to toxic effects. Electrophilic molecules may be detoxified by nucleophilic glutathione through scavenging. However, if glutathione is depleted, or if critical targets associated with maintenance of redox status are affected, oxidative stress will ensue. If redox balance is not restored, the cell will eventually undergo necrotic cell death. The response to oxidative stress is therefore critical in ensuring recovery of the cell. When confronted with oxidative stress, the cell invokes specific redox-sensitive signalling pathways to activate the expression of genes that influence the cell to survive or die. For example, the transcription factor erythroid-derived 2-like 2 (Nrf2) regulates the coordinated activation of antioxidant genes that encode haem oxygenase 1 (HMOX1) and phase II (conjugative) drug-metabolising enzymes to ensure cell survival (Alam et al., 1999; Baird and Dinkova-Kostova, 2011). Another important transcription factor that activates major signalling pathways in response to oxidative stress is the p53, a protein that has both pro- and anti-oxidant functions. Depending on the degree of cellular stress, p53 regulates genes that are important in regulation of normal cell growth, cell death, or tumorigenesis (Bensaad and Vousden, 2005). Most CYP forms are down-regulated in response to oxidative stress. The exceptions appear to be some CYP2A forms: CYP2A6 in humans and CYP2A5 in mice (Fernandez- Salguero and Gonzalez, 1995; Ling et al., 2004). Importantly, the Nrf2 has been shown to regulate the expression of CYP2A6 gene (Yokota et al., 2011). Transcription factor binding site search on the CYP2A6 promoter conducted in the beginning of this investigation revealed several putative binding sites for p53. This attracted our attention and raised the question of whether the identified putative p53REs are functional and what their roles may be in CYP2A6 gene expression. The constitutive expression of CYP2A6 is regulated by a battery of transcription factors that activate the CYP2A6 promoter, including CAR, C/EBPα, C/EBPβ, Oct-1 and HNF-4α (Pitarque et al., 2005). Intriguingly, the CAR, C/EBPβ and Oct-1 have been found to be activated by different forms of stress, which include serum starvation stress, endoplasmic reticulum stress, oxidative stress, radiation and DNA damage (Zhao et al., 2000;

Jin et al., 2001; Osabe et al., 2009; Meir et al., 2010). Since the CYP2A6 is known to be induced by a variety harmful, structurally unrelated chemicals and pathophysiological conditions (Kirby et al., 1994; Donato et al., 2000; Niemela et al., 2000; De-Oliveira et al., 2006; Kirby et al., 2011; Abu-Bakar et al., 2013), and is highly expressed in the liver (Nakajima et al., 2006), lung, oesophagus, intestinal, oral and bronchial epithelium (Su et al., 1996; Koskela et al., 1999; Janmohamed et al., 2001; Oyama et al., 2006), where the cells typically suffer from high oxygen and chemical exposures, it is possible that the enzyme has a protective function in cells. This assumption is supported by the recent finding that CYP2A6 oxidises bilirubin ─ a potent antioxidant at low intracellular concentration but toxic at high concentration ─ to biliverdin which can be reduced back to bilirubin by biliverdin reductase when there is a depletion of intracellular bilirubin (Abu-Bakar et al., 2012). The purpose of this investigation was to find out whether or not the p53 is a regulator of the CYP2A6 gene and its possible interaction with other stress activated TFs in the CYP2A6 regulation.

2. LITERATURE REVIEW

2.1 Cytochrome P450 gene family and enzyme regulation

2.1.1 Cytochrome P450

The cytochrome P450 (CYP) is a superfamily of haem-containing mono-oxygenase enzymes that catalyse the oxidation of endobiotics and xenobiotics to produce both biologically inactive and, in some cases, reactive metabolites. They most commonly catalyse the monooxygenation of carbon and heteroatom centres on lipophilic chemicals using molecular oxygen and NADPH as a reducing cofactor, and release water as a by-product (Meunier et al., 2004). The CYP genes exist in virtually all species and to date there are 18,687 named protein-coding CYP genes with putative functions: 5442 in animals; more than 6800 in plants; more than 4800 in fungi; 247 in Protozoa; more than 1200 in Eubacteria; 48 in Archaebacteria; and two in viruses (http://drnelson.uthsc.edu/cytochromeP450.html). The enzymes are arranged into families and subfamilies based on percent amino acid sequence identity (Nebert et al., 1987; Nelson et al., 1996). The membrane-bound CYPs are localised mainly in endoplasmic reticulum (ER) and predominantly found in the liver of higher organisms. This enzyme system is also found in the lungs, kidney, brain, lymphocytes, vascular smooth muscle, intestinal epithelium, olfactory and nasal mucosa (Lohr et al., 1998; Su et al., 1998; Bhagwat et al., 1999). The human genome contains 18 CYP families, divided into 41 protein-coding subfamilies encoding 57 genes (Nebert et al., 2013). Families 4 and above are considered most important in metabolism of endobiotic compounds, such as steroids, fatty acids, and prostaglandins, and mainly to be found in the mitochondria (Nebert et al., 2013). Families 1-3 are generally regarded as xenobiotic-metabolising enzymes (XMEs) responsible for the oxidative clearance of drugs and environmental chemicals. These XMEs form part of a coordinated system for xenobiotic clearance, which also includes other enzymes such as glucuronosyl transferases and a series of nuclear receptors and transcription factors that regulate the response to chemical challenge (Nebert et al., 1984; Nebert and Dalton, 2006). Members of these families are typically promiscuous in their substrate specificities, metabolising wide and overlapping ranges of chemicals as befits a system for chemical defense.

2.1.2 Regulation of CYP enzymes

Generally, the expression of xenobiotic-metabolising enzymes (XMEs) is governed by a group of transcription factors and cofactors. These transcription factors may be divided into factors that mediate their constitutive and inducible expression, respectively. Transcription factors, such as the hepatocyte nuclear factor (HNF)-1, HNF-4, HNF-6, Forkhead box A (FoxA), CAAT/enhancer-binding proteins (C/EBP) and D-site binding protein (DBP) are essential in maintaining the constitutive CYP enzyme expressions (Schrem et al., 2002). Inductions of CYPs by xenobiotics are often mediated by ligand-binding nuclear receptors, such as the aryl hydrocarbon receptor (AhR), constitutive androstane receptor (CAR) and pregnane X receptor (PXR) (Fujii-Kuriyama and Mimura, 2005; Timsit and Negishi, 2007). Prior to activating a gene, AhR binds to a complex of Hsp90, XAP2 and p23 within the cytoplasm. Exposure to specific ligands would release AhR from the AhR-hsp90 complex to be translocated to the nucleus. In the nucleus, AhR forms a heterodimeric complex with the aryl hydrocarbon nuclear translocator (ARNT). The complex then binds to xenobiotic response elements (XREs) on the promoter regions of target genes (Fujii- Kuriyama and Mimura, 2005). Similarly, CAR and PXR are also activated by their ligands. Ligand binding disassociates CAR and PXR from their co-chaperone partners: cytoplasmic CAR retention protein (CCRP) and Hsp90. This results in translocation of CAR and PXR. The activated CAR and PXR dimerise with the retinoids X receptor (RXR), and bind to the phenobarbital-responsive enhancer module (PBREM) and the xenobiotic responsive enhancer module (XREM) respectively, triggering gene activation (Timsit and Negishi, 2007). Besides the ligand activated transcription factors, the oxidative stress responsive transcription factor ─ nuclear factors (erythroid-derived 2)-like 2 (Nrf-2) and the p53 ─ are also involved in CYP regulation (Abu-Bakar et al., 2007; Yokota et al., 2011; Goldstein et al., 2013). In addition to the DNA binding of transcription factors, some corepressors and coactivators such as proliferator activated receptor-γ coactivator-1α (PGC-1α), govern transcriptional events through protein-protein binding (Ding et al., 2006). The crosstalk among transcription factors is quite common, regulating each other’s expression by competing with the co-repressor or co-activator and interfering with each other’s regulatory pathways, such as the crosstalk between Nrf-2 and p53 (Faraonio et al., 2006; You et al., 2011). It should also be noted that some other nuclear receptors, such as peroxisome proliferator activated receptors (PPARs), vitamin D receptor, farnesoid receptor,

glucocorticoid receptor, and liver X receptor are involved in the regulation of CYP enzymes (Ioannides, 2008). Besides transcriptional regulation, CYP enzyme expression can be regulated at the post-transcriptional and post-translational levels through the interactions with 3’-UTR of their mRNAs by proteins such as the hnRNPA1 and micro RNA complexes (Glisovic et al., 2003; Christian et al., 2004; Tsuchiya et al., 2006), and by protein stabilisation (Abu-Bakar et al., 2012). Most drug metabolising CYPs are designed to accept several substrates. Disadvantage of this is that they often tend to be poorly coupled, with a large proportion of the reducing equivalents from the cofactor NADPH released as reactive oxygen species (ROS) through futile cycling (Zangar, 2004). This is particularly pronounced when the substrate is a poor fit to the CYP active site. However, reduction of the CYP and consequent uncoupling also occurs in the absence of substrate for some forms (Zangar, 2004). The ROS generated could contribute to oxidative stress in the cells. One of cellular responses to oxidative stress is to limit CYP-generated ROS by downregulating CYP isoforms that are prone to uncoupling, such as CYP families 1-3 (Zangar, 2004). For instance, ROS inactivation of nuclear factor (NF-1) blocks the NF-1 activation of CYP1A1 transcription thereby leading to down regulation of CYP1A1. The cysteine residue 427 in the NF-1 transactivation domain appears to have an essential role in the mediation of the CYP1A1 down-regulation as the ROS oxidises the residue inactivating the NF-1 transcription. However, the same amount of ROS did not block the transactivation and DNA binding domains of another transcription factor CP1, suggesting that NF-1 is particularly responsive redox sensor (Morel et al., 2000). In addition to the inactivation of transcription factors by ROS, oxidative stress may regulate the expression of cytokines, which may have a downregulating effect on CYPs expression. For example, the cytokine tumour necrosis factorα (TNFα) has been found to repress CYP1A1 expression in HepG2 cells through the NF-1 pathway (Morel and Barouki, 1998). Besides downregulation of the CYPs expression at the transcriptional level, the cytokines: TNFα, interleukin-1β (IL-1β) and interferon-γ (IFNγ) have been shown to stimulate intracellular nitric oxide (NO) synthesis, which blocks the CYP2B6 expression at the post-transcriptional level (Aitken et al., 2008). Although exposures to agents or pathophysiological conditions that exert oxidative stress have always been associated with diminished total CYP content (Morgan, 1997), one particular CYP, the murine CYP2A5 and its human orthologue CYP2A6, have been shown to constantly be induced in response to oxidative stress (reviewed in Abu-Bakar et al., 2013).

The CYP2A6 has also has been found to be induced in fatty, inflamed or cirrhotic livers associated with microorganism infections and harmful alcohol consumption (Kirby et al., 1996; Satarug et al., 1996; Raunio et al., 1998; Niemela et al., 2000; Fisher et al., 2009). The way in which the murine CYP2A5 is regulated during oxidative stress has been described extensively (Raffalli-Mathieu et al., 2002; Glisovic et al., 2003; Abu-Bakar et al., 2004; Abu- Bakar et al., 2005; Abu-Bakar et al., 2007; Abu-Bakar et al., 2011; Kirby et al., 2011; Lamsa et al., 2012), but little is known about the mechanism(s) by which the human CYP2A6 is regulated under these conditions.

2.2 Structure and function of CYP2A6

2.2.1 Cytochrome P450 subfamily 2A (CYP2A)

Today, more than 20 CYP2A genes have been identified in different mammalian species (Raunio et al., 2008). The human CYP2 gene cluster is localised on human chromosome 19, which is made up of six different subfamilies (CYP2A, CYP2B, CYP2F, CYP2G, CYP2S and CYP2T). The human CYP2A subfamily contains three functional genes: the CYP2A6, CYP2A7 and CYP2A13. However, its mouse orthologue has four functional genes, namely Cyp2a4, Cyp2a5, Cyp2a12 and Cyp2a22 (Hoffman et al., 2001). Human CYP2A genes contain 9 exons, which are distinguished by the consensus sequence GT and AG on the boundaries between the introns and exons (Hoffman et al., 2001). The gene sequence similarity is quite high among the transcribed human CYP2A subfamily members: the CYP2A6, CYP2A7 and CYP2A13 share more than 85% sequence identity in their exonic sequences (Hoffman et al., 2001). Among the CYP2A family members the mouse CYP2A5 and human CYP2A6 have attracted most research attention for several reasons. Firstly, a number of drugs and toxins, such as halothane and aflatoxin B1 (AFB1) have been found to be metabolised by the CYP2A5 and CYP2A6, which suggests a role in pharmaco- and toxico-kinetics (Kirby et al., 1993; Pelkonen et al., 1994; Pelkonen et al., 1997; Abu-Bakar et al., 2013). Secondly, diverse groups of structurally unrelated toxicants, such as metals and pesticides are known to induce CYP2A5 and CYP2A6 expression (Lamsa et al., 2010; Abass et al., 2012). This indicates a common event, perhaps a secondary response to the inducers, regulating the expression instead of the inducers per se. Thirdly, recent findings that the CYP2A5 and

CYP2A6 catalyse the oxidation of bilirubin — the breakdown product of haem — to biliverdin (BV), indicate a significant role in the cellular haem homeostasis and in the regulation of cellular redox balance (Abu-Bakar et al., 2011; Abu-Bakar et al., 2012; Abu- Bakar et al., 2013). In accordance with this, the mouse CYP2A5 has been shown to be recruited into mitochondria during oxidative stress induced cellular damage, potentially conferring membrane protection (Muhsain et al., 2015). Together, these findings indicate that CYP2A5 and CYP2A6 may play an essential role in defense against toxic insults. Due to their response to diverse toxic insults, they may also be used as excellent markers for liver toxicity (Abu-Bakar et al., 2013).

2.2.2 CYP2A6 enzyme structure

The CYP proteins contain about 500 amino acid residues, divided into α- and β- domains. The α-domain contains 13 α-helices (A-L and B’), which form the haem binding pocket. The β-domain has 5-β-sheets (β1 – β5), which include the N-terminus (Otyepka et al., 2007). The CYP2A6 crystal structure depicts a typical mammalian CYP protein fold with two short helices (F’ and G’) in the F-L loop region and a compact hydrophobic active site (Figure2.1). A channel near F’ helix is formed from the surface of the protein to the active site by the F, G and B’ helices, which facilitates the substrate binding of the enzyme (Yano et al., 2006). The CYP2A6 amino acid residues in the I, F and B’ helices are crucial to its catalytic activity and substrate specificity. The Asn 297 which is located in the hydrophobic cavity of the protein active site, forms a hydrogen bond with substrates, such as coumarin, methoxsalen and amine derivatives. The upper surface of the active site cavity is surrounded by the phenylalanine residues: Phe107, Phe111, Phe118, Phe209 and Phe480, which stabilise the compact structure of the enzyme and reduce the volume of the active site. These aromatic residues also promote the protein binding to aromatic ligands through π-π stacking and edge to face interaction (Yano et al., 2005; Yano et al., 2006). The hydrophobic amino acids at the CYP2A6 active site dictate its catalytic activity as demonstrated in mutagenesis studies. For instance, coumarin 7-hydroxylation activity is significantly reduced after mutation of Val117 to Ala (He et al., 2004). Additionally, mutation of residue Asn297 changed the Km and Ks value of many substrates, such as coumarin or 7-methoxycoumarin (Kim et al., 2005). These observations suggest that

alteration of the residue size and polarity in the active site modified the interaction between protein and substrate, which in turn affect substrate binding and orientation.

Figure 2.1: Tertiary structure of CYP2A6 protein. α-helices and β-sheets are shown in red and light blue respectively. Coumarin (dark blue) is above of haem (dark grey) at active site (centre of the protein). Image is adapted from (Abu-Bakar et al., 2013).

2.2.3 Tissue specific expression and CYP2A6 polymorphism

CYP2A6 is predominantly expressed in the liver and commonly found in sex steroid- responsive tissues such as breast, ovary, uterus, testis, and adrenal gland (Nakajima et al., 2006), lung, nasal mucosa, oesophagus, trachea and skin (Su et al., 1996; Koskela et al., 1999; Janmohamed et al., 2001). The gene is highly polymorphic with over 37 allelic variants identified (see http://www.cypalleles.ki.se/cyp2a6.htm for a regularly updated list). The genetic variations are known to alter the expression, stability, and function of the CYP2A6 enzyme with regard to the metabolism of a number of its substrates, such as coumarin, nicotine, and tegafur, (reviewed in Di et al., 2009). For example, CYP2A6*1 has been identified as an extensive phenotype to catalyse coumarin and nicotine (Peamkrasatam et al., 2006). Asians have a lower frequency of CYP2A6*1 expression (50%-60%) than Caucasians (88.8%-97.1%) or black Africans (92.4%) (Gyamfi et al., 2005; Peamkrasatam et al., 2006), indicating that Asians on average may have a lower CYP2A6 enzyme activity compared to Caucasians and black Africans. Some CYP2A6 gene variants have shown decreased

enzymatic activities. For example, CYP2A6*4A and CYP2A6*2A have a complete loss of function or maintain an enzymatic activity less than 50%. CYP2A6*9A and CYP2A6 *12A have shown an averaged enzymatic activity around 75% compared with wildtype CYP2A6*1A (Akrodou, 2015).

2.2.4 CYP2A6 in drug metabolism

Although CYP2A6 participates in the metabolism of several therapeutics drugs and toxic chemicals, it catalyses a minor metabolic pathway for the majority of these compounds (Raunio et al., 2008), often with a high Km and a low Vmax. This indicates that CYP2A6 plays a minor role in terms of the overall metabolism of the particular drugs at relevant in vivo concentrations. A series of substrates, such as coumarin, nicotine, AFB1, methoxyflurane, and halothane that are metabolised by CYP2A6 have been reviewed by Abu-Bakar et al (2013). Most of the substrates are detoxified but some of them are activated by the enzyme. For example, the tobacco-specific nitrosamine, 4-(methy1nitrosamio)-1-(3-pyridyl)-1-butanone (NNK) and AFB1 can be activated by CYP2A6 to genotoxic intermediates known to form DNA-adducts associated with cancer (Miyazaki et al., 2005). The most selective substrates for CYP2A6 are coumarin and nicotine. Coumarin is a natural plant component present in a number of herbal medicinal products used for various disorders in some European countries. The CYP2A6 enzyme specifically metabolise coumarin to 7-hydroxycoumarin. Thus, coumarin is used as a diagnostic substrate for phenotyping CYP2A6 activity both in vivo and in vitro (Pelkonen et al., 2000). With regard to nicotine, CYP2A6 accounts for 70% to 80% nicotine metabolism to cotinine, which is further metabolised to trans-3-hydroxycotinine (Hukkanen et al., 2005; Raunio et al., 2008). The endogenous substrate for CYP2A6 has only recently been identified (Abu-Bakar et al., 2012). In a study with recombinant CYP2A6, bilirubin (BR) — a breakdown product of pro-oxidant haem — was oxidised to biliverdin (BV). The affinity of BR to CYP2A6 is in the same range as the diagnostic substrate, coumarin (Km = 1 - 2 µM) (Abu-Bakar et al., 2012). Molecular docking analyses with the crystal structure of CYP2A6 demonstrated that BR interacts with the key amino acid residues of the CYP2A6's active site (Figure 2.2). The interaction promotes stabilisation of bilirubin into a conformation that favours BV formation

(Abu-Bakar et al., 2012). This study shows that BR is a high affinity endogenous substrate for the CYP2A6.

Figure 2.2: Simulation of bilirubin docking on the CYP2A6 active site. Bilirubin (BR) interacts with amino acid residues Phe107, Phe111, Val117, Phe118, Asn297, Ile300, Thr305, Leu370, Ala371, and Phe480. The propionic acid groups of BR form hydrogen bonds with Asn297 and Thr305. The central methylene bridge of BR coordinated towards haem iron (Black Square on the right side). Molecules in red represent BR. Adapted from (Abu-Bakar et al., 2013). Importantly, BR a potent antioxidant at physiological concentrations (< 10µM) and a cyto-toxin at concentrations above 10 µM, is a regulator of the CYP2A6 (Abu-Bakar et al., 2012). It was demonstrated that treatment of HepG2 cells with 5 µM BR increased the CYP2A6 protein and activity levels up to 12 h, with no effect on the corresponding mRNA. Co-treatment with cycloheximide (CHX), a protein synthesis inhibitor, resulted in increased half-life of the CYP2A6 compared to cells treated only with CHX (Abu-Bakar et al., 2012). These observations indicate that the induction of CYP2A6 by BR is via protein stabilisation.

2.2.5 Cyp2a5 deficient mouse model

The in vivo role of CYP2A5/CYP2A6 in drug metabolism, pharmacokinetics, as well as subsequent effect on drug efficacy and toxicity is well elucidated by using Cyp2a5 deficient mouse model. It has been shown that the Cyp2a5 null mice have a lower metabolic rate of many CYP2A5 substrates such as the carcinogen NNK (Zhou et al., 2012), antithyroid drug methimazole (MMZ) (Xie et al., 2011), environmental pollutant naphthalene (NA) (Hu

et al., 2014), nicotine and cotinine (Zhou et al., 2010), indicating an essential role of CYP2A5 in metabolism of these chemicals. The loss of this gene in mouse has also led to a significant decrease of testosterone hydroxylation in various tissues such as olfactory mucosa, lung, liver and brain (Wei et al., 2013). Notably, the role of CYP2A5 in cellular defense against toxic chemical exposures has been addressed by the recent studies. Acetaminophen (APAP), a model compound to study the mechanisms of chemical toxicity has been found to be metabolised to a toxic intermediate, N-acetyl-p-benzoquinoneimine, which can be detoxified via conjugation with cellular antioxidant glutathione (GSH) (Hinson et al., 2004). The Cyp2a5 null mice have shown a reduced level of APAP-GSH conjugation in lateral nasal gland, suggesting a role of CYP2A5 in maintaining GSH mediated APAP detoxification (Zhou et al., 2011). It has been reported that thioacetamide (TAA) induced a more severe liver injury in Cyp2a5 null mice than that observed in wildtype mice. This suggests that CYP2A5 may protect against TAA induced liver injury (Hong et al., 2016). In addition, ethanol has been found to induce CYP2A5 expression in wildtype mice but not in Cyp2a5 null mice, and that ethanol induced oxidative stress was significantly higher in the knockout mice than the wildtypes (Hong et al., 2015). Collectively, these studies seem to imply a substantial role of CYP2A5 in cellular defense against toxic chemical exposures. However, the underlying mechanisms by which the enzyme is regulated in cells still remain largely unanswered.

2.3 Current knowledge of the CYP2A6 gene regulatory pathways

The expression of CYP2A6 can be regulated by both transcription and post- transcription pathways. The transcription factors Oct-1, C/EBP and HNF-4α have been found to govern CYP2A6 basal expression through the mediation by the related response elements present on the proximal CYP2A6 promoter region (Pitarque et al., 2005). Xenobiotic induction of CYP2A6 has been identified to be regulated at transcriptional level. For instance, the induction of CYP2A6 by phenobarbital and rifampicin was found to be mediated through the PXR and CAR pathways (Itoh et al., 2006), and via estrogen receptor by estrogen (Higashi et al., 2007). The induced CYP enzyme has a significant role in the metabolism and clearance of the substrate/inducer itself and some other co-administered drugs. However, sometimes more toxic metabolites can be produced during the metabolic oxidation, which may alter the

cellular redox balance and enhance oxidative stress. A variety of chemicals of unrelated structures, as well as some heavy metals were found to induce CYP2A6 expression (reviewed in Abu-Bakar et al., 2013). It seems that the induction of CYP2A6 in these cases may be activated through the mediation of “stress responding” element(s) present in the promoter region of the CYP2A6. More specifically, the oxidative stress activated transcription factor Nrf-2 has been found to participate in the regulation of CYP2A6 gene expression by binding of Nrf-2 to the ARE on the CYP2A6 promoter region (Yokota et al., 2011). Additionally, CYP2A6 mRNA was found to be stabilised by the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) binding to the 3’-UTR of CYP2A6 mRNA thus upregulating the gene (Christian et al., 2004). Interestingly, hnRNPA1 a multifunctional stress activated gene regulator seems to contribute to strong and fast upregulation of the CYP2A5 during cellular stress (Glisovic et al., 2003). A recent study has also shown that the microRNA-126 binds to the 3’-UTR of CYP2A6 mRNA leading the translational repression of CYP2A6 expression (Nakano et al., 2015). Overall, regulation of the CYP2A6 by transcriptional and post-transcriptional mechanisms serves as a common cellular defense mechanism partly by detoxifying toxicants and more importantly, by alleviating oxidative stress by maintaining BR homeostasis (as discussed in section 2.2.4). A schematic depiction of the CYP2A6 gene regulation in response to different stresses and xenobiotic substances is illustrated in Figure 2.3.

Figure 2.3: A schematic depiction of current knowledge on xenobiotic and stress activated CYP2A6 gene regulatory pathways. CYP2A6 is transcriptionally regulated by the liver enriched transcription factors C/EBPs and HNF-4α, ubiquitously expressed factor Oct-1, stress activated Nrf-2 and xenobiotic activated PXR CAR and ER. HnRNPA1 post- transcriptionally regulates CYP2A6 gene expression by stabilising CYP2A6 mRNA. Micro RNA-126 binds to the 3’-UTR of CYP2A6 mRNA blocking CYP2A6 translation. The abbreviations used in the diagram include: PXR (Pregnane X receptor); RXR (Retinoid X receptor); hsp90 (heat shock protein 90); CAR (Constitutive androstane receptor); CCRP (Cytoplasmic CAR Retention Protein); PP2A (protein phosphatase 2A); PGC1(Peroxisome

proliferator-activated receptor-gamma coactivator-1); E2 (Estradiol); ERα (Estrogen Receptor α); Nrf-2 (Nuclear factor (erythroid-derived 2)-like 2); Keap-1 (Kelch-like ECH- associated protein 1); Maf (Muscle aponeurosis fibromatosis); p53 (transcription factor p53); Hdm-2 (Human double minute-2); C/EBP (CCAAT/enhancer binding protein); Oct-1 (Octamer-1); HNF-4α (Hepatocyte nuclear factor 4α); HnRNPA1 (Heterogeneous nuclear ribonucleoprotein A1); miRNA (microRNA), DR-4RE (Direct repeat-4 response element); ERE (Estrogen response element); ARE (Antioxidant response element); C/EBPRE (C/EBP response element); Oct-1RE (Oct-1 response element); HNF-4αRE (HNF-4α response element);TSS (Transcription start site); S (protein stabiliser).

2.3.1 Transcriptional regulation of CYP2A6 by CAR, Oct-1, C/EBPs, HNF-4α

The proximal promoter region of the CYP2A6 gene has been found to be essential in mediating the constitutive CYP2A6 gene expression. The region spanning -122 to -60 bp contains overlapping response elements for CAR, C/EBPα, C/EBPβ, Oct-1, and HNF-4α. The liver enriched transcription factors HNF-4α, C/EBPα, and the ubiquitously expressed factor Oct-1 have been found to cooperatively mediate CYP2A6 transactivation. However, the C/EBPβ has been shown to inhibit CYP2A6 promoter activity (Pitarque et al., 2005). A DR-4 like element was identified at the proximal region, where it locates at the position -112 of the CYP2A6 gene, showing a weak binding of the transcription factor CAR (Pitarque et al., 2005). These response elements on the proximal CYP2A6 promoter region seem to play an essential role in constitutive CYP2A6 transactivation. Despite their roles in maintaining the constitutive expression of the CYP2A6, it has been shown that transcription factors CAR, C/EBPβ and Oct-1 can be activated by different forms of stress. Under serum starvation, the CAR has been found to be induced in HepG2 and SW480 cells via the stress-activated protein kinase (SAPK) signalling pathway (Osabe et al., 2009). The endoplasmic reticulum (ER) stress has been found to induce C/EBPβ expression in both mouse and human cell models (Li et al., 2008; Meir et al., 2010). The C/EBPβ mRNA can be translated into two forms of full length transcriptional activators (LAP) and a truncated variant of transcriptional repressor (LIP). During the early phase of ER stress, LAP is highly expressed to attenuate ER stress triggered cell death. However, when the ER stress is strengthened, LIP is dominantly expressed to augment ER stress triggered cell death (Li et al., 2008). Notably, it has been shown that increased production of ROS and activation of

Nrf-2 induces the C/EBPβ (both LAP and LIP) expression in mouse 3T3-L1 cells (Hou et al., 2012). The induction of Oct-1 by several DNA damaging agents has been found to activate GADD45 gene expression, involved in the control of cell cycle check point, apoptosis and DNA repair (Jin et al., 2001). It is still unclear whether these factors regulating constitutive expression of the CYP2A6 gene also contribute to its upregulation during cellular stress.

2.3.2 Transcriptional regulation of CYP2A6 by PXR/CAR, ER

Even though CYP2A6 is not a major enzyme involved in the metabolism and detoxification of xenobiotics, several of them may serve as its substrates, reviewed in (Abu- Bakar et al., 2013). CAR and PXR are major transcription factors regulating xenobiotic metabolism. They can be activated by numerous ligands including drugs and other xenobiotics such as rifampicin, phenobarbital and 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime. Ligand binding causes their translocation to nucleus and dimerization with retinoid X receptor (RXR)-α. The heterodimer of CAR/RXRα or PXR/RXRα binds to the enhancing region of the target genes, which triggers recruitment of nuclear receptor coactivators such as peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1) or glucocorticoid receptor-interaction protein-1(GRIP-1). The formed multi-protein complex then drives the initiation of gene transcription (Kliewer et al., 1998; Lehmann et al., 1998; Itoh et al., 2006). CYP2A6 was shown to be induced via PXR and PGC-1α through the DR4-like elements at the distal response region. These elements are located at the positions -6698, -5476 and -4618 of the CYP2A6 promoter. Although both CAR and PXR dimerize with the retinoid X receptor and bind to these elements, only PXR/RXR dimer complex together with PGC-1α was found to trigger CYP2A6 gene transcription (Itoh et al., 2006). In addition, CYP2A6 expression was found to be induced by the estradiol. An estrogen response element (ERE) was identified at the position -2436 on the CYP2A6 promoter region (Higashi et al., 2007). It should be noted that the pesticide isoproturon, chlorfluzuron and hexaflunuron induce CYP2A6 expression but do not activate either CAR or PXR (Abass et al., 2012), and that some other structurally unrelated compounds such as heavy metals, carbon tetrachloride, chloroform, cocaine, ethanol, and pyrazole up-regulate the CYP2A6 expression as well (Abu-

Bakar et al., 2013). This indicates that mechanisms independent of CAR and PXR may contribute to the induction.

2.3.3 Post-transcriptional regulation of CYP2A6 by hnRNPA1

In addition to regulation at the transcriptional level, regulation at the post- transcriptional level by heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) has been observed. HnRNPA1 is a multifunctional protein, with a substantial role in various stages of mRNA metabolism (Krecic and Swanson, 1999; Lau et al., 2000). The hnRNPA1 is located in both cytosol and nucleus. However, certain form of stress such as transcription inhibition, inflammation or UV irritation, may cause its subcellular relocalisation (van der Houven van Oordt et al., 2000; Glisovic et al., 2003). The hnRNPA1 has been shown to bind to AG-rich motifs of the 3’UTR of HIV1, TAT and H-ras pre-mRNAs, exerting an essential role in the stabilisation of the RNAs (Damgaard et al., 2002; Guil et al., 2003). The sequence alignments between the 3’UTRs of CYP2A5 and CYP2A6 mRNAs have shown two highly conserved 12- to 14-nt long AG-rich motifs that can be targeted by the hnRNPA1 (Christian et al., 2004). Similarly to its mouse ortholog CYP2A5, the human hnRNPA1 regulated CYP2A6 expression was found to be mediated through a post-transcriptional pathway. The interaction of hnRNPA1 with the 3’UTR of the CYP2A6 mRNA stabilises the transcript when transcription is impaired (Christian et al., 2004). This mechanism enables the CYP2A6 mRNA translation during transcriptional arrest, and helps to maintain cellular CYP2A6 expression levels. The elevated CYP2A6 has an important role in the maintenance of cellular redox homeostasis as a response to oxidative stress.

2.3.4 Post-transcriptional regulation of CYP2A6 by micro-RNA 126

Since the discovery of miRNA, its role in regulating gene expression has been extensively studied (Ambros, 2004). The miRNAs are 20- to 22- nucleotide duplex bearing two nucleotide single-stranded 3’ extensions, which regulate the expression of a gene by binding to the 3’-UTR of mRNA as a miRNA/RISC complex (RNA Induced Silencing Complex). Eventually, the binding blocks translation and leads to mRNA degradation (Bartel, 2004; Molnar et al., 2008). miRNA/RISC complexes have been found to repress many cytochrome P450 proteins through directly binding to the 3’-UTR of CYP mRNAs or

16 indirectly through binding to the MRE (miRNA response element) sequences of xenosensor mRNA. For instance, miRNA-27b has been found to regulate the translation of CYP3A4 and CYP1B1 proteins by directly binding to the 3’UTR of their mRNAs (Tsuchiya et al., 2006; Pan et al., 2009). miRNA-378 has also been found to repress CYP2E1 translation (Mohri et al., 2010). As the expression of several CYPs is regulated by xenosensors such as VDR, RXR and PXR, some miRNAs such as the miRNA-27b and miRNA-148a block translation of those xenosensors by binding to MREs of related mRNAs, resulting in indirect repressive effect on CYPs proteins (Takagi et al., 2008; Pan et al., 2009). Recent findings have demonstrated that CYP2A6 is a direct target of miRNA-126, where it binds to 3’-UTR of CYP2A6 mRNA and inhibits CYP2A6 translation (Nakano et al., 2015). Whether or not miRNA regulates the CYP2A6 in response to oxidative stress is not known.

2.3.5 Transcriptional regulation of CYP2A6 by Nrf-2

Recent studies have demonstrated that the CYP2A6 gene, like the mouse Cyp2a5, is regulated by the Nrf2 pathway (Yokota et al., 2011; Jin et al., 2012). The Nrf2 is a member of the Cap 'n' collar/basic leucine zipper (CNC/bZIP) family. It is ubiquitously expressed in a wide range of tissues and cell types (Moi et al., 1994; McMahon et al., 2001). Nrf2 is a 68 kDa protein (Moi et al., 1994), but the cellular and in vitro translated Nrf2 have been shown to run at 100 kDa in SDS-PAGE (Moi et al., 1994). Nrf2 is activated by changes in cellular redox state, and the activity is controlled by Kelch-like ECH associated protein 1 (Keap1): a sensor of oxidative stress (Kansanen et al., 2013). Under balanced redox condition, Keap1 forms a complex with Nrf2, which is targeted for ubiquitination, and recognised by the cullin 3-Rbx 1 (Ring box protein 1) E3 ubiquitin ligase complex for proteosomal degradation. Degradation of Nrf2 is dependent on several reactive cysteine residues at the Keap1 protein (Kansanen et al., 2013). Under oxidative stress, the reactive cysteine residues of Keap1 are modified, decreasing the rate of ubiquitination and degradation of Nrf2. The active Nrf2 then translocates to the nucleus (Kansanen et al., 2013) where it forms heterodimers with small Maf (muscle aponeurosis fibromatosis) proteins. The heterodimers bind to the AREs of target genes and activate transcription (Hayes et al., 2010). Interestingly, a putative Antioxidant Response Element (ARE) — the Nrf2 binding site — was identified in the CYP2A6 promoter region at position -1212 to -1193 (Yokota et

al., 2011). In exploring the functionality of this site, Nrf2 expression plasmid was co- transfected with the CYP2A6 promoter spanning the Nrf2 binding site in HepG2 cells. The co-transfection did not activate transcription of the promoter. By contrast, in vivo transfection experiment in the mouse liver demonstrated that CYP2A6 promoter activation is mediated by the Nrf2 pathway (Yokota et al., 2011). Together these observations indicate that: (a) Nrf2 potentially binds to the ARE of the CYP2A6 promoter to mediate the expression of CYP2A6; (b) the CYP2A6 promoter may contain response elements for negative regulatory factors in response to Nrf2; and (c) HepG2 cells may lack some critical transcription factors for the activation of CYP2A6 transcription. The Nrf2-mediated induction of CYP2A6 was also demonstrated in the U937 monocytic cell line (Jin et al., 2012). Ethanol significantly increased ROS formation, induced nucleotranslocation of Nrf2, and induced CYP2A6 mRNA and protein in U937 cells. Induction of CYP2A6 and ROS formation were completely blocked by the treatment with vitamin C (an antioxidant). Additionally, butylated hydroxyanisole, a stabiliser of nuclear Nrf2, increased CYP2A6 levels by 200% (Jin et al., 2012). These observations confirmed the earlier findings of Yokota et al (2011) that the CYP2A6 expression is regulated by the Nrf2 pathway. Importantly, the study indicates that ethanol-induction of CYP2A6 is a secondary response to increased ROS formation by ethanol. It is important to note that regulation of CYP2A6 by the Nrf2 pathway is not confined to the hepatocytes only, emphasising importance of CYP2A6s’ response to oxidative stress.

2.4 The role of CYP2A6 against oxidative stress

As discussed in the section 2.3, the CYP2A6 enzyme is induced by multiple forms of stress and pathophysiological conditions such as microorganism infections, inflamed and cirrhotic livers, harmful alcohol consumption, and many structurally unrelated toxic chemicals (Kirby et al., 1996; Satarug et al., 1996; Raunio et al., 1998; Niemela et al., 2000; Fisher et al., 2009). The enzyme is highly expressed in the liver (Nakajima et al., 2006), and parts of lung, nasal mucosa, oesophagus, trachea and skin (Su et al., 1996; Koskela et al., 1999; Janmohamed et al., 2001): sites typically exposed to high levels of oxygen and chemicals. Importantly, several studies have demonstrated that the CYP2A6 is regulated by a group of stress activated transcription factors (Christian et al., 2004; Pitarque et al., 2005; Yokota et al., 2011). This together with a recent finding that CYP2A6 regulates intracellular

BR levels (Abu-Bakar et al., 2012) suggest that the CYP2A6 may play a significant role in the cellular defense against oxidative stress.

2.4.1 Oxidative stress

Cellular oxidative stress occurs when ROS levels overwhelm endogenous antioxidant defense systems, which leads to direct or indirect ROS-mediated damage of nucleic acids, proteins and lipids (Ray et al., 2012). ROS generation in mammalian cells is often mediated by their response to toxicants. During continuous metabolism of xenobiotics, the uncoupling process between substrates and CYP enzymes will emerge, leading to significant ROS generation in cells. The catalytic cycle of cytochrome P450s is illustrated in Figure 2.4. Binding of the substrate (SH) to a resting state of the low-spin ferric (Fe3+) enzyme (A) changes the spin state to a high-spin substrate bound complex (B). The Fe3+SH is reduced to a ferrous (Fe2+) state (C) by accepting the first electron from NADPH cytochrome P450 reductase (CPR). An oxy-P450 complex (D) is formed after oxygen binding to the ferrous state, which is the last relatively stable intermediate in this cycle. A peroxo-ferric intermediate (E) is formed after the reduction of the oxy-P450 by receiving a second electron from CPR. This introduction of protons in the peroxo-ferric intermediate (E) splits the O-O bond and forms “oxenoid” compound (F) and water. The oxygenated substrate SOH is formed by insertion of the heam bound activated oxygen atom from the “oxenoid” compound (F) into the substrate, returning the enzyme to its initial state. In addition to the main reaction cycle, there are at least three side reactions occurring under physiological conditions. Firstly, the autoxidation of the oxy-ferrous enzyme (D) turns it back to its resting state and produces superoxide anion. Secondly, the coordinated peroxide or hydrogen-peroxide anion is dissociated from the iron to form hydrogen peroxide and thereby completing the unproductive (in relation to substrate turnover) two-electron reduction of oxygen. Thirdly, instead of oxygenation of the substrate, the ferryl-oxo intermediate (F) is oxidised to its ferric state through an oxidase uncoupling process (Denisov et al., 2005). A large amount of ROS is formed during this process.

Figure 2.4: Catalytic cycle of cytochrome P450 (CYP). Fe represents the iron atom of the prosthetic group of CYP; Substrate and its oxygenated product are shown as SH and SOH, respectively; ROS production in the cycle is indicated by red arrows (Adapted from Denisov et al., 2005).

In addition to xenobiotic metabolism, ROS can be produced through some other mechanisms depending on the tissue and cell types. It has been well demonstrated that the nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (containing 7 distinct isoforms) catalyse the transfer of electrons from NADPH to molecular oxygen across the plasma membrane thereby generating superoxide and other downstream ROS (Bedard and Krause, 2007). Some other oxidoreductases have also been found to contribute ROS generation in mammalian cells, which include (i) nicotinamide adenine dinucleotide (NADH): ubiquinone oxidoreductase, an enzyme involved in mitochondrial electron transport chain (ETC) (Lambert and Brand, 2004); (ii) nitric-oxide synthase, the catalyst for intracellular nitric oxide production (Förstermann and Sessa, 2012); and (iii) cyclooxygenase, an enzyme involved in biosynthesis of prostaglandins (Ricciotti and FitzGerald, 2011). Moreover, clearance of superoxide also produces ROS in cells. Superoxide has been found to be converted into hydrogen peroxide by superoxide dismutase (SOD) first, and is further metabolised by catalase and glutathione peroxidase (GPX) to water (Culotta, 2001). The

formed hydrogen peroxide and superoxide can generate a highly reactive hydroxyl radical through the Haber-Weiss reaction, which is another source of cellular oxidative stress (Kehrer, 2000).

2.4.2 Bilirubin oxidase as part of an anti-oxidant complex against intracellular oxidative stress

The recent discovery of BR acting as a high affinity endogenous substrate for the CYP2A6 together with its regulation by several stress ─ activated signalling pathways has led to the hypothesis that CYP2A6 is a player in cellular defense against oxidative stress (Abu-Bakar et al., 2012). It has been well demonstrated that BR production is enhanced in response to oxidative stress. Haem oxygenase 1 (HMOX1), the enzyme that catalyses the first step in BR production from haem, is highly induced by a variety of physiological and non- physiological stimuli that generate oxidative stress (Maines, 2005). These stimuli include inflammatory cytokines, bacterial endotoxin, ultraviolet-A radiation, sodium arsenite, ethanol, and cadmium (Alam et al., 1989; Keyse and Tyrrell, 1989; Cantoni et al., 1991; Rizzardini et al., 1994; Gomes et al., 2010; Yeligar et al., 2010). Given that some of these agents are also known to induce CYP2A6 (Abu-Bakar et al., 2013) and that BR is an inducer and a substrate of CYP2A6 with a Km approximately one tenth of the cytotoxic concentration (Abu-Bakar et al., 2012), it is plausible that induction of CYP2A6 in response to oxidative stress is to mitigate oxidative damage by maintaining BR homeostasis. This hypothesis has been well supported by studies on Cyp2a5 (mouse orthologue of human CYP2A6) gene regulation. The expression of CYP2A5 is regulated through both transcriptional and post-transcriptional mechanisms. Three oxidative stress related transcription factors ─ the AhR, Nrf-2 and hnRNPA1 ─ have been found to regulate the transcription of Cyp2a5 gene under oxidative stress conditions (Glisovic et al., 2003; Abu- Bakar et al., 2007; Arpiainen et al., 2007). Alterations in cellular redox state by chemicals activate these factors, leading in their translocation and accumulation in nucleus, where they bind to their respective response elements and drive the transcription of the Cyp2a5 gene. Additionally, the Cyp2a5 gene can be regulated at post-transcriptional level. The CYP2A5 mRNA can be stabilised by hnRNPA1 interacting with the 71 nucleotide long putative hairpin loop at the 3’-UTR of CYP2A5 transcript (Glisovic et al., 2003). The transcriptional and post-transcriptional mechanisms seem to be coordinated to induce

CYP2A5 in response to oxidative stress. Evidence suggest that the induced CYP2A5 is essential in the maintenance of cellular BR homeostasis and regulation of cellular redox balance. The “stress responding” cluster on the Cyp2a5 promoter region (Figure 2.5) plays a key role in the regulation of CYP2A5 expression (reviewed in Abu-Bakar et al., 2013).

Figure 2.5: “Stress responding” cluster present on Cyp2a5 promoter region. The Cyp2a5 gene expression is regulated by three stress activated transcription factors binding to its promoter region, including AhR, Nrf-2 and hnRNPA1. The abbreviations used in the diagram include: AhR (Aryl hydrocarbon receptor); Arnt (Aryl hydrocarbon receptor nuclear translocator); USF (Upstream stimulatory factor); Nrf-2 (Nuclear factor (erythroid-derived 2)-like 2); PGC1 (Peroxisome proliferator-activated receptor-gamma coactivator-1); HNF-4α (Hepatocyte nuclear factor 4α); hnRNPA1 (Heterogeneous nuclear ribonucleoprotein A1); XRE (Xenobiotic responsive element); E-box (Enhancer box); ARE (Antioxidant response element); HNF-4αRE (HNF-4α response element); HnRNPA1RE (Heterogeneous nuclear ribonucleoprotein A1response element); TSS (Transcription start site).

2.5 The p53 protein

Another important transcription factor that activates major signalling pathways in response to oxidative stress is the p53, a protein that has both pro- and anti-oxidant functions. Depending on the degree of cellular stress, p53 regulates genes that are important in the regulation of redox homeostasis, normal cell growth, cell death, and tumorigenesis (reviewed in Bensaad and Vousden, 2007). As the CYP2A6 has been suggested to play a role in cellular defense by contributing to bilirubin homeostasis (as discussed in section 2.2.4), and because its expression in response to oxidative stress is regulated by the Nrf2 and other stress activated TFs, it is plausible that p53 may be involved in the regulation of the CYP2A6 gene as well. This thesis will investigate the role of p53 in the regulation of CYP2A6 gene expression.

2.5.1 Structure and regulation of p53 protein

The tumour suppressor protein, p53, consists of 393 amino acid residues, and is encoded by the TP53 gene that resides on chromosome 17 p13.1 in humans. It is the most frequent target for mutation in human cancers (Olivier et al., 2010). The basic unit of p53 is a monomer, which contains an intrinsically disordered N-terminal transactivation domain (Met1-Asp42), a proline rich domain with multiple copies of PXXP sequence (Asp61-ser94), a central DNA binding core domain (Thr102-Lys292) and a C terminal domain (Pro301- Asp393) including a tetramerization domain. The functional state of p53 is homo-tetramer (Saha et al., 2015). The functional p53 tetramer has been shown to bind its target duplex DNA in a sequence-specific manner (Weinberg et al., 2004). The consensus p53 binding sequence is RRRCWWGYYY (R=A, G; W=A, T; Y=C, T), which can form a decameric motif (half- site). Two decameric motifs separated by a spacer containing 0-13 base pairs are shown to act as a functional p53 binding element (el-Deiry et al., 1992). More recently, a genome-wide mapping of p53 binding sites found that most p53 response elements have consecutive half sites (Wei et al., 2006). It has been shown that an increase in spacer length between the decamer half sites correlates with a decline in p53 affinity and transactivation, as also shown for the TIGAR, Noxa and p21-5’ response elements (Jordan et al., 2008). The distance between a p53RE and the transcription start site (TSS) also has a significant impact on the p53- mediated gene transactivation. For example, inserting an additional 200 base pair segment between a p53RE and the TATA box significantly reduced the p53- mediated induction (Cook et al., 1995). The presence of cofactor sites and the p53RE occlusion by other proteins seem to have an essential role in regulating p53- mediated gene expression as well. It has been reported that p53 ─ dependent activation of human pro-apoptotic bcl-2 associated X (BAX) and p53-up-regulated mediator of apoptosis (PUMA) genes require adjacent cofactor REs, Sp (specificity protein) families of transcription factors on their promoter regions. Mutations of the Sp response elements on their promoter regions totally wipe out the p53 ─ mediated gene transactivation but did not affect p53/DNA binding affinity (Thornborrow and Manfredi, 2001; Koutsodontis et al., 2005). This suggests that binding of p53 to DNA alone is not sufficient for p53 to activate a gene. The intracellular expression of p53 is tightly regulated by posttranscriptional mechanisms (Xu, 2003). When cells are in a balanced stress condition, p53 is unstable and inactivated through its interaction with the p53 suppressor Mdm-2. Mdm-2 functions as an E3

ligase that ubiquitinates p53 for proteasome degradation (Haupt et al., 1997). However, when cells are in an unbalanced stress condition, p53 is modified post-translationally through methylation, acetylation, phosphorylation and sumoylation, which disrupts its binding to Mdm-2, and results in its activation and accumulation (Lu and Levine, 1995; Scolnick et al., 1997; Neilsen et al., 2008).

2.5.2 P53 activated signalling pathways

P53 has been found to regulate a host of processes within the cell. It can interact directly with pro-apoptotic factors to induce mitochondrial-dependent apoptosis or function as a transcription factor to regulate various genes on cellular processes (reviewed in Wakabayashi et al., 2010). Differential activation of p53 target genes is dependent on the different stages of oxidative stress (Liu and Chen, 2006). Generally speaking, p53 activates two broad categories of responses: anti-oxidant and pro-oxidant depending on the state of cells (Bensaad and Vousden, 2005). During low levels of oxidative stress, p53 exerts primarily anti-oxidant role, in order to re-establish cellular homeostasis. Some of the p53 target genes, such as sestrin, aldehyde dehydrogenase (ALDH) and glutathione peroxidise (GPX) are induced under low oxidative stress to eliminate cellular ROS level. For instance, p53-regulated sestrins can generate peroxiredoxins, which protect cells from hydrogen peroxide induced damage (Budanov et al., 2004). A p53 binding sequence has been identified on ALDH4 gene. GPX acts as a primary antioxidant enzyme, which scavenges organic hydroperoxides and hydrogen peroxide (Tan et al., 1999). Additionally, p53 was found to reduce intracellular ROS generation through the regulation of cellular metabolism. The expression of TP53-induced glycolysis and apoptosis regulator (TIGAR) is induced via p53, which directs glycolysis to an alternative pathway, the pentose phosphate pathway (PPP). PPP is a major source of NAPDH, which is needed for the formation of antioxidant glutathione (GSH) thereby reducing ROS levels (Tian et al., 1999). The expression of PGM (phosphoglyceratemutase), an antioxidant gene can be suppressed by p53, that enhances the glycolysis and decreases the requirement for mitochondrial respiration, resulting in less ROS production (Bensaad and Vousden, 2007). When cells suffer from severe oxidative stress, p53 activates the expression of several genes that increase intracellular ROS levels (Polyak et al., 1997), thereby acting as pro-oxidant inducer. These genes include proline oxidase and p53 inducible gene-3 (PIG3)

(Polyak et al., 1997; Rivera and Maxwell, 2005). Overexpression of these proteins results in high levels of oxidative stress in cells. Moreover, BAX and PUMA are induced by the mediation of p53. This leads in the release of cytochrome C from mitochondrial which then triggers apoptosis (Macip et al., 2003; Liu et al., 2005). P53 is also known to inhibit the expression of several antioxidant genes, which leads to increased intracellular ROS and triggers apoptosis. Accordingly, p53 has been found to suppress the expression of SOD-2 and Nrf-2, triggering apoptotic process (Drane et al., 2001; Faraonio et al., 2006).

2.6 Potential interplay among transcription factors in mediating CYP2A6 gene expression

As discussed in section 2.3, the CYP2A6 transactivation is governed by a group of transcription factors binding to the promoter region. Many of them are stress activated. It is well known that transcriptional regulation of a gene often involves a complex interaction between the TFs and other factors such as cofactors or coactivators. Such interaction is essential for cells to maintain their optimal protein expressions. A crosstalk has been shown between the stress activated transcription factors Nrf-2 and p53 in their regulation of some stress responsive genes such as the X-CT, NQO-1 and GST1α1 (Faraonio et al., 2006). Similar interactions have been observed in the regulation of other genes. Therefore, it is plausible that an interplay among transcription factors may have a role in regulating the CYP2A6 as well, possibly to maintain its optimal expression when cells response to different degrees of stress.

2.6.1 Nrf-2 and p53 cross talk in regulating stress responsive genes

Given the dual role of p53 in cellular response to oxidative stress and the fact that the Nrf2 primarily regulates antioxidant pathways, these transcription factors may interact in regulating cellular protection against oxidative damage. For example, in response to mild oxidative stress, p53 enhanced the transcription of three Nrf2 target genes (X-CT, NQO-1 and GST1α1) through stabilisation of Nrf-2 binding to their AREs (Faraonio et al., 2006). These genes exert their anti-oxidative properties through

neutralising ROS. It has been hypothesised that in these conditions, a p53 target gene, p21 is activated and stabilises the Nrf2 by binding to Keap1 (Chen et al., 2009), which interferes with Keap1 ability to promote Nrf2 ubiquitylation and proteasomal degradation (Chen et al., 2009). The disruption of Nrf2 turnover allows its nuclear translocation and subsequent transcription of ARE-driven genes, which then leads to a general cyto-protective response (Figure 2.6). This hypothesis is supported by in vivo observations that: (i) the presence of p21 within cells is associated with prolonged Nrf-2 half-life (Chen et al., 2009); (ii) both the basal and induced Nrf2 expression levels are higher in the wild-type mice than in the p21-null mice (Chen et al., 2009); and (iii) the expressions of Nrf2 target genes, such as Nqo1 and Hmox1 are higher in the wild-type mice than in the p21-null mice (Chen et al., 2009). By contrast, Nrf2 was shown to reduce p53 by regulating the basal expression of the murine double minute 2 (Mdm2), a protein that promotes proteasomal degradation of p53 (You et al., 2011). Collectively, these observations imply that the net result of the crosstalk between Nrf2 and p53 in response to mild oxidative stress is to promote transactivation of antioxidant genes and to maintain p53 at basal level in order to re-establish redox homeostasis and dampen apoptosis.

Figure 2.6: Network of p53 and Nrf-2 in response to cellular stress. Exposure of cells to a low level of stress, p53 triggers cytoprotective mechanisms, which activate antioxidant gene expressions thereby removing intracellular ROS. Exposure of cells to a severe stress, leads p53 to act in a proapoptotic fashion, which inhibits the expression of antioxidant genes such as Nrf-2 and promotes pro-apoptotic gene expressions. This then leads ROS accumulation and apoptosis.

On the other hand, in response to severe oxidative stress, cells invoke the strongest possible cell death signal by enhancing the expression of p53 and intracellular ROS generation (Figure 2.6). As suggested mechanism p53 directly interacts with ARE, the promoter element activated by Nrf2, displacing Nrf2 thus repressing Nrf2 target genes, such as Mdm2, NQO-1 and GST1α1 (Faraonio et al., 2006; You et al., 2011; Wang et al., 2012). Suppression of Mdm2 basal expression inhibits p53 proteasomal degradation, which leads to p53 accumulation (You et al., 2011). This, in turn results in the upregulation of proapoptotic genes, which enhance the intracellular ROS generation thereby inducing cell apoptosis (Pandhare et al., 2006). The excess ROS generated is not neutralised by Nrf2 target genes, NQO-1 and GST1a1 because of transcriptional interference by p53 (Faraonio et al., 2006).

2.6.2 Interplay among transcription factors in mediating gene expression

Even though the stress related transcription factors Nrf-2 and p53 have been well demonstrated to interact in mediating some stress activated gene expressions, the potential mechanism(s) of crosstalk in mediating CYP2A6 gene expression is not clear. The interactions of other transcription factors that mediate CYP2A6 transactivation cannot be ignored. It has been shown that the constitutive CYP2A6 gene expression is governed by a group of transcription factors binding to the proximal CYP2A6 promoter region, including CAR, C/EBPα, C/EBPβ, Oct-1 and HNF-4α (Pitarque et al., 2005). Indeed, the CAR, C/EBPα and Oct-1 can be activated by different forms of stresses, as discussed in section 2.3.1. It is likely that the stress activated p53 may also interact with these transcription factors in mediating the CYP2A6 gene expression.

Recent evidence have also shown that oxidative stress activated Nrf-2 overexpression in 3T3-L1 mouse pre-adipocytes has led to immediate induction of C/EBP-α and C/EBP-β proteins during the early events of adipogenesis (Hou et al., 2012). Human CYP2B6 expression in HepG2 cells has been demonstrated to be regulated by the transcription factors C/EBP-α, HNF-4α and CAR in a synergistic regulatory pattern (Benet et al., 2010). Expression of CAR inhibits HNF-4α transactivation of CYP7A1 by competing with HNF-4α for binding to the DR-1 motif and to the common coactivator PGC-1α and GRIP-1 (Miao et al., 2006). Furthermore, ectopic expression of p53 in HepG2 cells has been found to repress HNF-4α expression through the binding of p53 to the HNF-4α P1 promoter, as well as by preventing HNF-6α (HNF-4α activator) binding to the HNF-4α P1 promoter (Maeda et al.,

2006). Therefore, it is plausible that such interplay among transcription factors mediates CYP2A6 transactivation. The interplay of transcription factors that drive the proximal CYP2A6 gene expression will be addressed in this thesis.

3. RESEARCH PROBLEMS

As illustrated in the previous sections, CYP2A6 enzyme has been found to play a role not only in xenobiotic metabolism but also in cellular defense against various cellular stresses. This is supported by the following observations: (i) CYP2A6 expression is highly induced by a large number of structurally unrelated toxic insults or pathophysiological conditions (reviewed in Abu-Bakar et al., 2013); (ii) a group of stress activated transcription factors including Nrf-2, CAR, C/EBPβ and Oct-1 has been found to regulate CYP2A6 gene expression (Pitarque et al., 2005; Yokota et al., 2011); (iii) BR, a potent antioxidant, is enzymatically metabolised by CYP2A6 to biliverdin (BV), and back to bilirubin by biliverdin reductase (BVR) when needed (Abu-Bakar et al., 2012); (iv) CYP2A6 has been found to be highly expressed in the liver (Nakajima et al., 2006), bronchial epithelium, lung, nasal mucosa, oesophagus, trachea and skin (Su et al., 1996; Koskela et al., 1999; Janmohamed et al., 2001; Oyama et al., 2006), where these organs often suffer a high level of oxygen and chemical exposures. Why CYP2A6 is highly expressed in these organs? Could it be that the purpose is to maintain BR homeostasis and thereby a balanced cellular redox state? In other words, could the high expression of the enzyme in these organs plays a role in maintaining a suitable intracellular redox level?

Importantly, the stress activated transcription factor, p53 has also been found to regulate some hepatic CYP genes involved in various metabolic pathways (Goldstein et al., 2013; Wohak et al., 2014). Eleven members from five different CYP subfamilies were induced by p53 (Goldstein et al., 2013). These include CYP4Fs and CYP19A1, enzymes that metabolise lipids and sex steroids, respectively (Goldstein et al., 2013); and CYP21A2, a catalyst of glucocorticoid synthesis (Goldstein et al., 2013). These findings align with recent advancement in p53 research that acknowledges a critical role for p53 in regulating metabolism and maintaining cellular homeostasis (Meek, 2015). P53 role in regulating drug metabolism was acknowledged in a recent work demonstrating direct p53 interaction on the p53REs of the CYP3A4 promoter, leading to transactivation of the gene (Goldstein et al., 2013). The p53-dependent activation of CYP3A4, the main enzyme responsible for clearing chemotherapeutics, was heightened following a chemotherapeutic stimulus (Goldstein et al., 2013). This observation indicates a systemic role for p53 in response to chemotherapy.

Intriguingly, the sequence analysis of CYP2A6 promoter region has revealed several putative p53 response elements, which suggest a potential role for p53 in regulating CYP2A6 (Figure 3.1). As CYP2A6 is not a major drug metabolising enzyme, what is the physiological significance of the possible p53-mediated transactivation of CYP2A6? Could the elevated p53 levels by chemical exposures under stresses form a part of cyto-protective machinery to induce the CYP2A6 expression in order to maintain BR homeostasis?

Figure 3.1: Putative p53REs and the functional ARE present on the CYP2A6 promoter regions from -2901 to +9.

3.1 Research questions

Preliminary sequence analysis of the CYP2A6 promoter revealed several putative p53 binding sites for p53. Five of them were identified on the distal CYP2A6 promoter region spaning from -2901 to -437bp. One putative p53RE with the highest sequence similarity compared to the consensus p53RE was detected at the proximal CYP2A6 promoter region at - 122 bp (Figure 3.1). However, it is unclear whether these putative p53REs are functional or not. As discussed in section 2.3, a group of stress activated transcription factors has been found to regulate the CYP2A6 gene expression, and its basal expression is governed by the interplay between HNF-4α, C/EBPα, C/EBPβ and Oct-1 binding to the proximal CYP2A6 promoter (Pitarque et al., 2005; Yokota et al., 2011). Interestingly, the putative p53RE at the proximal promoter is only five base pair upstream of the TFs that govern the constitutive CYP2A6 gene expression. It is plausible that these TFs may interact in mediating CYP2A6 transactivation. Yokota et al., (2011) demonstrated that Nrf-2 has a role in mediating CYP2A6 gene expression when cells suffer from unbalanced oxidative stress. They found that the basal expression of the distal CYP2A6 promoter was significantly weaker than that of proximal CYP2A6 promoter (Yokota et al., 2011), which is in accordance with previous findings on potential suppressor region(s) upstream the CYP2A6 promoter (Pitarque et al., 2005; Itoh et

al., 2006; Higashi et al., 2007). However, the potential suppressor(s) region in blocking CYP2A6 transactivation and the significance of the suppressive effect in response to cellular stresses are currently unknown. A cross-talk between Nrf-2 and p53 in regulating stress responsive genes when cells deal with the different levels of oxidative stresses has been elucidated (as discussed in section 2.6.1). Notably, the functional ARE (Nrf-2 binding site) on the CYP2A6 promoter is in close proximity to one of the putative p53RE (Figure 3.1), suggesting a potential interaction between p53 and Nrf-2 in regulation of CYP2A6 gene expression. To investigate the underlying mechanisms of the CYP2A6 gene regulation, especially at stress conditions, some specific questions have been raised, including:

(1) If the p53 is also involved in the regulation of CYP2A6 gene expression, in what conditions is the p53 activated? (2) How does the p53 drive the CYP2A6 gene expression? (3) Are other (co-)factors required for p53- mediated CYP2A6 transactivation? (4) Are there any interactions between these transcription factors in mediating CYP2A6 gene expression? (5) What is the significance of the p53- mediated CYP2A6 gene expression? (6) What types of suppressor factors may be present on CYP2A6 promoter to mediate the CYP2A6 downregulation? (7) What is the significance of the CYP2A6 downregulation in term of cellular defense against cellular stresses? (8) Could there be interaction between Nrf-2 and p53, which may mediate the observed downregulation of CYP2A6 gene expression?

3.2 Working hypotheses

Owing to the current advancement on the CYP2A6 gene regulatory mechanisms and the recent finding of BR as a high affinity endogenous substrate of CYP2A6, the enzyme now is recognised as a stress responsive gene, which may exert a role in regulating cellular stress through the regulation of BR-BV pathway. Importantly, several putative binding sites responsive to the stress activated p53 have been identified on the CYP2A6 promoter region. However, it is not well understood how the enzyme is regulated by these sites during cellular

31 perturbations. To have an insight into the stress activated transcription factor mediated CYP2A6 transactivation, several hypotheses have been established, including:

(1) Bilirubin oxidase CYP2A6 is an immediate target gene of the stress activated transcription factor p53; (2) Chemically induced p53 expression activates CYP2A6 gene expression; (3) CYP2A6 gene transactivation is achieved through an interplay between transcription factors binding to the promoter region; (4) Stress activated transcription factors - Nrf-2 and p53 interact in regulating CYP2A6 gene expression. (5) Presence of suppressive element(s) on the distal CYP2A6 promoter region block(s) CYP2A6 gene transactivation;

Addressing these hypotheses will help to better understand the mechanism behind previous observations where the CYP2A6 is induced by a multitude of seemingly unrelated external insults. Finally, it has been shown that elevated serum bilirubin levels negatively associate with the incidence of many chronic diseases including diabetes, aging, neurodegenerative disorder, cardiovascular disease, ischemic heart disease and cancer (Vitek et al., 2002; Rao et al., 2006; Kim and Park, 2012; Boland et al., 2014; Jorgensen et al., 2014; Jung et al., 2014). Given that the CYP2A6 plays an essential role in maintaining intracellular BR homeostasis, understating the mechanisms of CYP2A6 induction may possibly open new strategies for intervention. In addition, as the CYP2A6 can be induced by a large number of toxic insults, understanding the underlying mechanisms may offer a possibility for applying the CYP2A6 promoter as an intracellular stress sensor to assess the biological response of toxic chemicals, and to develop in vitro bioassays for monitoring of toxic side effects of drugs under development.

3.3 Research strategies

In order to address the hypotheses, the following research strategies have been adapted:

A) Study on the role of p53 in mediating CYP2A6 gene expression

Aim i) Identification of region(s) on the CYP2A6 promoter mediating p53 transactivation; ii) Establishment of cell models; iii) Verification of the functionality of the putative p53REs on the CYP2A6 promoter region.

Experimental procedures: Two cell models were established: the human hepatoma derived cell line (C3A) and human breast adenocarcinoma cell line (MCF-7). A series of 5’-truncated CYP2A6 promoter constructs were amplified through PCR technique and were inserted into a vector plasmid pGL3-Basic respectively. The generated pGL3-CYP2A6-Luc promoter constructs together with pcDNA3-hp53/pcDNA3 and pMAX-GFP were co- transfected into C3A cells respectively to detect the possible p53 responsive region on the CYP2A6 promoter. The detected p53RE on the CYP2A6 promoter region was mutated by a site directed mutagenesis method. The p53RE mutated CYP2A6-Luc constructs were co-transfected with pcDNA3-hp53/pcDNA3 and pMAX-GFP into C3A cells to confirm the functionality of the putative p53RE. Luciferase activities of these CYP2A6-Luc constructs were normalised by internal control GFP activities. The p53 expression levels in both the pcDNA3-hp53 transfected cells and the empty vector (pcDNA3) transfected cells were detected by Western Immunoblotting. Detailed procedures are discussed in Chapter 4.

B) Study on binding of p53 to its response element on CYP2A6 promoter region

Aim i) To harvest the recombinant p53 from the nuclear fraction of pcDNA3-hp53 transfected C3A cells for EMSA analysis; ii) To synthesise probes containing the putative p53RE for EMSA analysis;

iii) To verify whether the p53 induced CYP2A6 transactivation is through direct binding of p53 to p53RE on CYP2A6 promoter region.

Experimental procedures: A recombinant p53 protein was produced by transfecting pcDNA3-hp53 into the C3A cells, which was then extracted from the nuclei of the transfected cells by using a pre- established method. The harvested recombinant p53 was subjected for EMSA study. A series of CYP2A6 probes containing the putative p53RE were synthesised by PCR technique. EMSA analysis by incubations of the CYP2A6 probes with the recombinant p53 was used to detect the direct binding of p53 to p53RE on CYP2A6 promoter region. The specificity of the binding was demonstrated by using a monoclonal p53 antibody that specifically recognises the formed DNA-protein complex. Excess unlabelled CYP2A6 probe and unlabelled consensus p53 oligonucleotides were used in competition assays to compete out the formed DNA- protein complex (outlined in Chapter 4).

C) Study on BaP induced p53 in activation of CYP2A6 and HMOX1 gene expressions in MCF-7 and C3A cells

Aim i) To detect whether the BaP treatment can induce the endogenous p53 expression in MCF-7 cells; ii) To detect whether the endogenous p53 induced by BaP has a regulatory role in activation of the proximal CYP2A6 promoter in MCF-7 cells; iii) To evaluate potential effects of BaP on hepatic expression of p53, HMOX1 and CYP2A6 mRNA and protein.

Experimental procedures: MCF-7 and C3A cells were treated by using various concentrations of BaP respectively. Cytosolic and nuclear fractions were extracted from treated and non- treated cells by using a pre-established method. Total RNA was extracted from treated and non-treated C3A cells. Specific proteins and mRNA contents were detected by Western Immunoblotting and qRT-PCR techniques respectively. P53RE positive

control construct, intact CYP2A6-Luc construct and putative p53RE mutated CYP2A6- Luc constructs were transfected into MCF-7 cells respectively followed by BaP treatments. Luciferase activities driven by the p53RE positive control, intact CYP2A6 promoter and p53RE mutated CYP2A6 promoter were measured after normalisation with internal control GFP activities. Detailed procedures are described in Chapter 4.

D) Study on transcription factor interactions in mediating CYP2A6 transactivation

Aim

i) To verify direct binding of transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α to the proximal CYP2A6 promoter region; ii) To determine the role of transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α in regulating the proximal CYP2A6 gene transactivation; iii) To evaluate the role of each RE on the proximal CYP2A6 promoter in mediating the CYP2A6 gene transactivation; iv) To investigate whether the p53 ─ mediated CYP2A6 transactivation involves interactions with the other factors; v) To explore the potential crosstalk between p53 and Nrf-2 in regulating CYP2A6 gene expression.

Experimental procedures: Binding of transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α to the proximal CYP2A6 promoter was confirmed by EMSA analysis. CYP2A6-160/+9-Luc construct was co-transfected with p53, C/EBPα, Oct-1 and HNF-4α expression plasmids respectively into C3A cells to validate their roles in regulation of CYP2A6 transactivation. The expression of these TFs in transfected cells was detected by Western Immunoblotting. The REs on proximal CYP2A6 promoter were mutated individually and in combination followed by transfection of the RE mutated constructs into C3A cells to detect the role of each RE in mediating CYP2A6 transactivation. The involvement of other factors in p53- mediated CYP2A6 transactivation and the potential crosstalk between p53 and Nrf-2 in regulating

CYP2A6 gene expression was demonstrated by a series of co-transfection experiments, which are described in Chapter 4.

E) Exploring the potential suppressor region(s) on distal CYP2A6 promoter

Aim To explore potential suppressor region(s) on the CYP2A6 promoter.

Experimental procedures: A series of 5’-truncated CYP2A6-Luc constructs with 200-300bp intervals were generated by using PCR technique and inserted into pGL3-Basic plasmid respectively. The basal expression profile of each CYP2A6-Luc construct was assessed by co-transfection of each CYP2A6-Luc construct together with pMAX-GFP plasmid (transfection control) into C3A cells. Detailed procedures are shown in Chapter 4.

4. MATERIALS AND METHODS

4.1 List of materials and instruments

A list of materials and instruments is in Appendix A

4.2 Cell culture and maintenance

Human hepatocellular carcinoma cells (C3A and HepG2) and human breast adenocarcinoma cells (MCF-7) were selected for gene regulation studies. The cells were propagated in T75 flasks in William’s Medium E containing 10% FBS, 1% Glutamax and 1% Penicillin-Streptomycin. The MCF-7 cells were grown in Dulbecco's Modified Eagle Medium supplemented with 10% FBS, 1% Glutamax and 1% Penicillin-Streptomycin. The cells were maintained in a humidifier incubator at 37°C in 5% CO2 and were sub-cultured at least two times per week. Cells with passage number between 5 and 15 were used in all studies.

4.3 Molecular biological techniques

4.3.1 Computer based promoter analysis

A computer based software “MatInspector” (http://www.genomatix.de/) was used to predict the putative TF binding sites on the CYP2A6 promoter region. Several regions of the CYP2A6 promoter containing high sequence similarity with the 10 bp consensus p53RE [5’- RRRC(A/T)(T/A)GYYY-3’] were found, where “R” represents purine and “Y” represents pyrimidine (el-Deiry et al., 1992). Five putative distal sites were identified at positions -2582, -2461, -2208, -1617, -1056, and one putative proximal site at position -122 (Figure 3.1).

4.3.2 5’-truncated CYP2A6 promoter constructions

The CYP2A6 5’-flanking region -2901/+9 was amplified from a human DNA sample using high-fidelity PCR polymerase and cloned in front of the luciferase cDNA in pGL3- Basic vector (Promega, Madison, WI). A series of 5’-truncated fragments of the CYP2A6 promoter was produced by PCR amplification using the cloned longer construct as template and were cloned in front of the luciferase cDNA in pGL3-Basic vector (Appendix E). The primers used for amplification are listed in Appendix H. The generated 5’-truncated CYP2A6 promoter constructs were transformed into XL-1 blue competent cell (Agilent technologies Inc., CA, USA). Detailed procedures can be found in Appendix B. The propagated plasmids were purified by using QIAGEN Plasmid Midi Kit according to manufacturer’s instructions (QIAGEN, Hilden, Germany) and were dissolved in UltraPure RNAse and DNAse free water (Thermo Fisher Scientific, Australia). DNA sequences of all constructed plasmids were verified by using gene sequencing facility at Australian Genome Research Facility (AGRF, Brisbane, Australia) (Appendix C). Plasmid concentrations were measured by NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Australia) according to manufacturer’s instructions.

4.3.3 Site directed Mutagenesis

In paper I, the putative p53 site on the proximal CYP2A6 promoter was analysed by site-directed mutagenesis. The core sequence of the site 5’- ATTCATGGTGGGGCATGTAG-3’ (core sequences, bold) was mutated to 5’- ATTACCAGTGGGGATCCTAG-3’ (mutated sequences, underlined) by the two steps PCR. The CYP2A6 constructs from -2901 or -250 to the p53RE mutated sites were amplified from the template plasmid CYP2A6 5’ -2901/+9 and CYP2A6 5’ -437/+9 by priming with the forward primers CYP2A6 5’-2901 FW or CYP2A6 5’-250 FW and reverse primer CYP2A6- p53mut RV (Appendix H). The CYP2A6 construct from p53RE mutated site to +9 was amplified from the template plasmid CYP2A6 5’ -437/+9 by priming with the forward primer CYP2A6-p53mut FW and the reverse primer CYP2A6 5’+9 NheI RV (Appendix H). Equal amount of PCR products from the two reactions were mixed together to be used as a template to amplify the mutated p53RE. The CYP2A6-160/+9 construct containing the mutated p53RE was generated by priming with forward CYP2A6 5’ -160 KpnI FW and reverse primer

CYP2A6 5’+9 NheI RV (Appendix H). The CYP2A6-2901/+9 construct containing the mutated p53RE was generated by priming with forward CYP2A6 5’ -2901 KpnI FW and reverse primer CYP2A6 5’+9 NheI RV (Appendix H). The CYP2A6 constructs containing the mutated p53RE were ligated to the pGL3-Basic plasmid, respectively (Appendix E). In paper II, the same method was applied to generate DR-4RE, C/EBP-Oct-1RE and HNF-4αRE mutated proximal CYP2A6 promoter constructs (Appendix E), where the DR- 4RE (5’-AGGTGAAATGAGGTAA-3’) was mutated to 5’-CCCCGAAATGAGGTAA-3’, the C/EBP-Oct-1RE (5’-GTAATTATGTAAT-3’) to 5’-GTAACACGAATTC-3’ and the HNF-4αRE (5’-CAGCCAAAGTCCA-3’) to 5’-CAGCCAACGTCTC-3’(mutated bases underlined, Appendix D). Additionally, the putative p53RE (5’- ATTCATGGTGGGGCATGTAG-3’) was mutated to a consensus p53RE (5’- AGACATGCCTAGACATGCCT-3’) on the proximal CYP2A6 promoter (mutated based underlined, Appendix D). The validity of these mutated REs on the CYP2A6 5’- promoter constructs was confirmed by gene sequencing (Appendix C). The primers used for site directed mutagenesis of these CYP2A6 promoters were obtained from Sigma-Genosys (Sydney, Australia), and are shown in Appendix H.

4.3.4 Transient transfection assays

In paper I, the generated CYP2A6-5’-Luc and p53RE mutated CYP2A6-5’-Luc constructs were transiently transfected into C3A cells, either alone or co-transfected with the human p53 expression plasmid (pcDNA3-hp53) (Christian et al., 2008) or the empty expression plasmid pcDNA3. In paper II, the expression plasmids including p53, CAR, C/EBPα, Oct-1 and HNF-4α were co-transfected with CYP2A6 -160/+9-Luc construct respectively into C3A cells. A series of RE mutated CYP2A6 -160/+9-Luc constructs were transiently transfected into C3A cells. They were also co-transfected with either the pcDNA3-hp53 or pcDNA3 into C3A cells. The pGL3-Basic containing a SV-40 promoter was used as a control for transfection. The pGL4.38 [luc2P/p53 RE/Hygro] vector containing consensus p53RE (Promega, Madison, WI) was used as a positive control to indicate the ectopically expressed p53 in C3A cells (Paper I & II). Polyethylenimine (PEI) (Polysciences Inc., PA, USA) was used to transiently transfect cultured cells with the various promoter constructs. PEI stock solution (1 μg/μl) was prepared

by dissolving 100 mg of PEI in 100 ml of sterilised water at 50°C and pH adjusted to 7 with HCl. The solution was passed through a 0.22 μm filter (Millipore, USA) and stored at -80°C. The PEI solution was warmed up to room temperature before being added to DNA plasmid solution at DNA:PEI ratios of 1:2 for C3A cells. The DNA-PEI mixture was then incubated at room temperature for 15 min before being added to each well of the 24-well plates. Cells were seeded in 24-well plates (1.2 × 105 cells/well) for 24 h. Thereafter, the cells were washed once in 500 µl PBS, followed by addition of 500 µl of fresh FBS-free medium to each well. 0.3 µg of CYP2A6-5’-Luc constructs and 0.1 µg of pMAX-GFP (transfection control) were co-transfected into C3A cells (Paper II). The cells were also co-transfected with 0.1 µg of pMAX-GFP, 0.1 µg of pcDNA3 or transcription factor expression plasmids, and 0.3 µg of CYP2A6-5’-Luc constructs (Paper I & II). The transfected cells were incubated for

24h in a humidifier incubator at 37°C in 5% CO2. Thereafter, the luciferase activity was measured (BriteliteTMplus Reporter Gene Assay System, PerkinElmer, USA). Transfection under each condition was performed in quadruplets. The fluorescence and luminescence signals were captured on a FLUOstar Omega multimode microplate reader with automatic gain settings.

4.3.5 Synthesis of digoxigenin labelled probes

In paper I, double-stranded DNA corresponding to the region between -149 and -55 bp of the 5’-flanking CYP2A6 promoter was generated by PCR technique. The probe was amplified by the primer 1 and primer 2 (Appendix H). The primers, double-stranded oligonucleotides of putative and consensus p53RE and of the -127 to -98 bp region of the 5’- flanking CYP2A6 promoter (Probe 2) were obtained from Sigma-Genosys (Sydney, Australia). CYP2A6 promoter probes used in paper I are illustrated in Figure 4.2 and listed in Appendix H. In paper II, a series of probes corresponding to the response elements that govern the proximal CYP2A6 gene expression were obtained from Sigma-Genosys (Sydney, Australia). Those include CYP2A6-5’-127/-98, CYP2A6-5’-103/-80, CYP2A6-5’-92/-65 and CYP2A6-5’- 77/-53 (Appendix H). The probes used both in paper I and paper II were labelled with digoxigenin on the 3’ end of the oligonucleotide by using DIG gel shift kit (Roche, Germany).

Figure 4.1: Schematic representation of synthesised CYP2A6 promoter probes used in EMSA (Paper I). Solid arrows indicate the synthesised probe1 and probe 2. Open box represents putative p53RE on CYP2A6 promoter region.

4.3.6 Electrophoretic mobility shift assay

In paper I and paper II, 32 fmol/µl of digoxigenin-labelled probe was incubated with

16 µl of binding buffer (20 mM Hepes pH 7.6, 1 mM EDTA, 10 mM (NH4)2SO4, 1 mM DTT, 0.2% Tween 20, 30 mM KCl) and 4 µg of nuclear protein for 15 min at room temperature. The nuclear proteins were extracted from C3A cells transfected with p53, CAR, C/EBPα, Oct-1 and HNF-4α expression plasmids, respectively. In antibody shift assay, 1 µl of anti-p53, CAR, C/EBPα, Oct-1, HNF-4α or Nrf2 antibody was added to their respective reaction mixtures and was incubated for 15 min. The samples were loaded to a pre- electrophoresed, non-denaturing 4-15% polyacrylamide gel in 0.5 × TBE buffer (44 mM Tris-HCl, pH 8, 44 mM boric acid, 1 mM EDTA). Samples were separated electrophoretically at 80V for 1 h and transferred onto a positive-charged nylon membrane Hybond-N (Amersham Biosciences, UK, Ltd) by an electro-blotting device (Bio-Rad Laboratories, USA) set at 1 h at 30V, 300 mA. Thereafter, the membrane was baked at 140oC for 15 min and crosslinked in a UV StratalinkerTM 1800 (Integrated Sciences, Australia) at 120 mJ. The membrane was briefly rinsed for 3 min in washing buffer (0.1 M Maleic acid, 0.15 NaCl, pH 7.5, 0.3% Tween 20) and was blocked in blocking solution for 30 min before immunological detection. The digoxigenin-labelled probes on the membrane were detected by incubating the membrane with an anti-digoxigenin-AP antibody (1:10,000). The chemiluminescence signals of the labelled probes were captured by ChemiDoc™ MP

imaging system after applying the alkaline phosphatase substrate CSPD on the membrane. In paper I, competition binding assay was performed to validate the specificity of protein–DNA interactions. 125-fold molar excess of unlabelled CYP2A6 probe I and increasing concentrations of unlabelled consensus p53 oligonucleotides were added to their respective incubation mixtures. The double-stranded consensus p53 oligonucleotide 5’AGACATGCCTAGACATGCCT 3’ (core sequences underlined) was used as positive control for p53 specific binding.

4.4 Biochemical procedures

4.4.1 BaP treatment of the transfected MCF-7 cells

In paper I, the MCF-7 cells were seeded in 24-well plates at 1.2 × 105 cells/well and 100 mm culture dish (Corning, USA) at 3 × 106 cells/well for 24 h. Cells in the 24-well plates were co-transfected with pMAX-GFP and pGL4.38 [luc2P/p53 RE/Hygro] or CYP2A6-5’- Luc constructs at a fixed DNA:PEI ratio of 1:8. Each plasmid used was at 100 ng per well or 2.5 µg per dish. The cells were transfected for 4 h before being treated with various concentrations of BaP dissolved in DMEM containing 10% charcoal stripped FBS, 1% Glutamax, 1% Penicillin-Streptomycin, and 0.1% DMSO. Twenty four hours after treatment luciferase activity was measured and nuclear proteins extracted.

4.4.2 Protein analysis

In paper I and paper II, endogenous expression of p53 and HNF-4α in MCF-7 cells, endogenous expression of p53, CYP2A6 and HMOX1 in C3A cells, and over-expression of p53, CAR, C/EBPα, Oct-1 and HNF-4α in C3A cells was assessed by Western blotting. Nuclear and cytoplasmic extracts from cultured cells were prepared as described previously (Abu-Bakar et al., 2007). Cultured cells were harvested in ice cold PBS. Cell fractions were isolated by using cell separation buffers and centrifugation techniques, and were stored at - 80oC (Appendix F). Protein concentrations of the subcellular fractions were measured by using the DC protein assay kit (Bio-Rad Laboratories, USA); A 30 µg protein sample was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The

proteins were electrophoretically transferred onto a Hybond ECL nitrocellulose membrane. The proteins were immunoblotted by specific antibodies, including mouse monoclonal anti- p53, anti-HMOX1, anti-CYP2A6, anti-C/EBPα, anti-Oct-1 antibodies, and rabbit polyclonal anti-HNF-4α and anti-CAR antibodies. The formed protein-antibody complexes were visualised by a chemiluminescent substrate (Appendix G).

4.4.3 RNA extraction and mRNA analysis

In paper I, total cellular RNA was extracted from C3A cells with TRIzol reagent (Gibco, Australia) in accordance with the manufacturer’s protocol. RNA was resuspended in 20 µl DEPC-treated water, and its concentration was determined by NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Australia) at wavelength 260 and 280 nm. Total RNA was treated with RNA-free DNase prior to mRNA measurement by quantitative real time RT-PCR. One microgram of total RNA from the control and treated C3A cells was used to synthesise first-strand cDNA with the Invitrogen SuperScript®III First-Strand Synthesis kit (Life Technologies, Vic, Australia). Two microliters of the cDNA solution was used as template in 20 µl PCR mixture containing 10 µl of the 2 X iQ SYBR Green Supermix (Bio-Rad Laboratories, USA) and 2 µl of each reverse and forward primers (0.2 µM final concentration) (Appendix H). The PCR mixtures were incubated at 95oC for 3 min, followed by 40 cycles of 95oC for 20s and 63.2oC (for CYP2A6 primers), 65.7oC (for HMOX1 primers), or 60.4oC (for GAPDH primers) for 1 min in Corbett RotorGene 3000 (QIAGEN, Germany). The specificity of the PCR products was confirmed by melt curve analysis and amplicon size (2.5% agarose gel electrophoresis).

4.5 Statistical analysis

Densitometric analysis of protein expression levels was conducted by using the software NIH imageJ 1.49. Two group comparisons were conducted by Student’s t test. Multiple group comparisons were done with one-way analysis of variance (ANOVA) followed by the least significant difference post hoc test. Differences were considered significant when p < 0.05.

5. RESULTS AND DISCUSSION

5.1 Cell models for gene regulatory study (Paper I & Paper II)

The use of immortalised cell lines as in vitro models has been invaluable in studying gene regulation mechanisms because cell lines have unlimited life span, are always available and have a more stable phenotype than primary culture cells. Despite the obvious advantages, perturbations in gene expression pattern as compared to primary cells cannot be ignored. For instance, the expression pattern of CYP enzymes in hepatoma cells is significantly altered compared to that of primary hepatocytes. The alterations in the expression of key transcription factors dramatically reduced the expression of some CYP enzymes in hepatoma cell lines (Rodriguez-Antona et al., 2002). Therefore, selecting suitable cell lines for gene regulation studies should be carefully considered depending on the research purposes. CYP2A6 enzyme has been found to be highly expressed in liver and sex steroid-responsive tissues such as breast, ovary, uterus, testis, and adrenal gland (Nakajima et al., 2006). It is reasonably expressed in human hepatocarcinoma cell lines HepG2 and C3A and in human breast adenocarcinoma cell line MCF-7 (Higashi et al., 2007). Therefore, these cell lines were selected for the studies. The p53 responsiveness of the CYP2A6 promoter was assessed by co-transfection of pcDNA3-hp53 together with CYP2A6-Luc constructs in the three cell lines. The positive p53 responsiveness of the CYP2A6 promoter was clearly observed in all three (Figure 5.1), suggesting that the p53 has a role in regulating CYP2A6 transactivation, and that the p53- mediated CYP2A6 transactivation is not cell specific. The C3A cells were chosen for further regulatory studies because p53 overexpression was the strongest in them, and because it was challenging to achieve consistent induction of the CYP2A6-Luc constructs in HepG2 cells.

Figure 5.1 Effect of p53 co-transfection on CYP2A6 distal and proximal promoter driven luciferase activities in MCF-7, C3A and HepG2 cells. Both the distal and the proximal CYP2A6 promoters were co-transfected with either pcDNA3-hp53 or pcDNA3 empty vector, and pMAX-GFP into the three human cell lines. pGL4.38-p53RE containing consensus p53RE served as positive control to indicate p53 overexpression in these cell lines. Promoter less pGL3-Basic plasmid was used as negative control for the cell transfection. The firefly luciferase activities were measured 24 h after transfection. The measured activites were normalised against pMAX-GFP activity (transfection control plasmid) = RLA. The values (n = 4) represent means ± S.D. Fold induction of RLA = RLA of p53 co-transfected cells/ RLA of transfected cells.

5.2 Bilirubin oxidase CYP2A6 is regulated by the stress activated transcription factor p53 (Paper I)

5.2.1 CYP2A6 putative p53REs are responsive to p53

Sequence analysis of the CYP2A6 promoter to detect putative p53RE

Sequence analysis of the CYP2A6 promoter region by a computer based program MatInspector (https://www.genomatix.de) revealed several putative p53REs (Figure 5.2A). These sites appear to be similar to the 10 bp consensus p53RE [5’-RRRC(A/T)(A/T)GYYY-

3’], where “R” represents purine and “Y” represents pyrimidine. A functional p53RE in the genomes of many organisms is composed by two copies of half site 5’- RRRC(A/T)(A/T)GYYY-3’, separated by a 0-21 base pairs spacer (el-Deiry et al., 1992). It has also been shown that a repeated 5’-RRRCATGYYY-3’ motif is favourable for p53 binding (Osada et al., 2005). X-ray crystallography studies of the p53/p53RE DNA interaction indicated that the central core sequences “C(A/T)(A/T)G” are important for interactions with p53 (Cho et al., 1994). Five distal putative p53REs containing single “C(A/T)(A/T)G” sequences were identified at positions -2582, -2461, -2208, -1617 and -1056 of the CYP2A6 promoter (Figure 5.2B). In addition, one proximal putative p53RE with the highest sequence similarity compared to the consensus p53RE was identified at position -122 (Figure 5.2B). This site is adjacent to the REs that govern the constitutive CYP2A6 gene expression (Figure 5.2A). Therefore, in this thesis, the role of p53 in regulating CYP2A6 gene expression via the proximal site and its interactions with the other transcription factors was investigated in detail. A)

Figure 5.2: Schematic representation of putative p53 REs on CYP2A6 promoter region. (A) Schematic diagram of the 2.9 kb CYP2A6 promoter indicating the putative p53RE sites. The region spanning from -122 to -60 bp contains overlapping response elements for CAR, C/EBPα, C/EBPβ, Oct-1 and HNF-4α (Pitarque et al., 2005). (B) The six putative p53 binding sites identified by MatInspector (https://www.genomatix.de) and the p53 consensus sequence. Putative p53RE core sequences are shown in bold. R = Purine; Y = pyrimidine.

Activation of CYP2A6 promoter byp53

P53 responsiveness of the CYP2A6 promoter was illustrated by co-transfection of pcDNA3-hp53, pGL3-CYP2A6-Luc and pMAX-GFP plasmids into C3A cells. The p53

protein expression levels in cells co-transfected with the pcDNA3-hp53 plasmid were substantially higher than in the cells co-transfected with the empty vector expression plasmid (pcDNA3) (Figure 5.3A), suggesting that the p53 protein was highly expressed in the C3A cells transfected with pcDNA3-hp53 expression plasmid. The p53 co-transfection induced the distal CYP2A6-5’-2901/+9-Luc construct by ~4- fold relative to the control, which is similar to the fold induction observed in the positive control cells (transfection with consensus p53RE-Luc construct) (Figure 5.3B). The induction was weaker with the proximal CYP2A6-5’-437/+9-Luc construct: by about 2.4-fold relative to the control (due partly to the elevated control levels) (Figure 5.3B). No significant luciferase activity was observed in cells transfected with the pGL3-Basic plasmid (negative control) (Figure 5.3B). These observations suggest that both the proximal and distal regions of the CYP2A6 promoter are responsive to p53. Notably, in normal cells—where p53 was not overexpressed (opened bar)—the luciferase activity driven by the distal promoter was significantly weaker than that driven by the proximal promoter (Figure 5.3B). For this reason and the fact that the luciferase activity of the proximal promoter was almost equal to that of the positive control in p53 overexpressed cells, the functionality of this proximal p53RE site and its significance in the regulation of the CYP2A6 gene was investigated in detail. It is also noted that the activity of the distal promoter (CYP2A6-2901-Luc construct) is substantially lower than the vector control (p53RE-Luc) and the proximal promoter in both normal and p53-overexpressed cells (Figure 5.3B). This suggests the presence of suppressor region(s) upstream the CYP2A6 promoter, which is in agreement with previous studies suggesting such potential regions from -1013 to -185bp of the promoter (Pitarque et al., 2005; Itoh et al., 2006; Higashi et al., 2007).

Figure 5.3: Effect of p53 co-transfection on CYP2A6-5’-Luc construct activities in C3A cells. (A) Western blotting and densitometry of p53 and β-actin (loading control) in C3A cells transfected with p53 expression plasmid (pcDNA-hp53) and empty expression plasmid

(pcDNA3). Each transfection was done in triplicate. Positive controls (+) = A-431 whole cell lysate for p53 and β-actin peptide. Relative p53 expression (bar graph) = the intensity of p53 band relative to the intensity of β-actin band. (B) Effect of p53 co-transfection (pcDNA-hp53) on CYP2A6 distal and proximal driven luciferase activities. The firefly luciferase activities were measured 24 h after transfection. The measured activites were normalised against pMAX-GFP activity (transfection control plasmid). The values (n = 3) represent means ± S.D. p53 response of each reporter construct is indicated by -fold of activity to control co- transfection with pcDNA3. Mean difference is significant from control group at ***, p < 0.0005; **, p < 0.005; *, p < 0.05 (Student’s t test).

What repressor mechanisms may be present in the upstream region of the CYP2A6 promoter? A conclusive explanation cannot be discerned from the present findings. However, previous studies together with the present findings suggest that an interaction between p53 and Nrf-2 may be responsible for the observed suppressive effect. For example, a functional Nrf-2 binding site identified on the distal CYP2A6 promoter region (Yokota et al., 2011), is in close proximity to one of the distal putative p53REs discovered in this work (Figure 3.1). Importantly, direct interaction of p53 with Nrf-2 response elements have been shown to suppress the expression of stress responding genes including the Phase II metabolising gene, NQO-1 and GST-1 (Faraonio et al., 2006; Wakabayashi et al., 2010). It is thus plausible that interplay between p53 and Nrf-2 at the distal promoter mediates the suppression of CYP2A6 gene expression. On the other hand, the observed suppressive effect of the distal CYP2A6 promoter may not be via direct interaction between Nrf-2 and p53. Instead, it has been reported that distal p53RE may attract p53 proteins away from the p53RE near the TSS thereby leading to repression of gene expression (Burns et al., 2003). This possibility is supported by an observation that the distal p53RE of Polo-like kinase-2 (PLK-2) acts as suppressor, whereas the proximal p53REs are activators (Burns et al., 2003). Further work is warranted to determine how these distal p53REs regulate CYP2A6 gene expression, especially in the context of cellular perturbations.

5.2.2 P53- mediated CYP2A6 transactivation is through the proximal p53RE

Functional validation of the proximal p53RE on CYP2A6 promoter

In order to illuminate the role of the proximal p53RE in mediating CYP2A6 transactivation, a series of 5’-truncated proximal CYP2A6 promoter-luciferase reporter plasmids were constructed and transfected into the C3A cells. The cells were then co- transfected with p53 expression plasmid (pcDNA-hp53) or empty control plasmid (pcDNA3). P53 co-transfection up-regulated the CYP2A6-5’-437/+9-Luc construct 2.5-fold relative to control (Figure 5.4A). A similar response was detected with the series of constructs equal to or longer than -160 bp but not with the shorter construct (-74 bp) (Figure 5.4A). This suggests that the p53RE is located in the region from -160 to -74, which is in agreement with the MatInspector TF binding site search that revealed one putative p53RE at position -122 (Figure 5.2A). This putative p53RE contains the two copies of p53 binding core sequence of the consensus p53RE, “CATG” (Figure 5.4B, bold letters), however, the satellite sequence of the putative p53RE is different from that of the consensus p53RE (Fiigure. 5.4B) A)

Figure 5.4 Functionality test of the p53RE site on the proximal CYP2A6 promoter. (A) C3A cells were co-transfeceted with a series of 5’-truncated proximal CYP2A6 promoter- luciferase reporter plasmids and p53 expression plasmid (pcDNA3-hp53) or empty expression plasmid (pcDNA3). (B) The difference between putative and the consensus p53RE sequence. The boxed region contains the p53 binding core sequence.

Functional significance of the proximal p53RE on the CYP2A6 promoter

To investigate the functional significance of the putative binding site, the core sequence, CATG, critical for p53 binding was mutated at the -122 site of the CYP2A6-5’- 160/+9-Luc and CYP2A6-5’-2901/+9-Luc constructs to ACCA. The mutant constructs were then co-transfected with the p53 expression plasmid into the C3A cells. As expected, p53 co- transfection induced luciferase expression driven by the two constructs by about 2.6- to 3.9- fold relative to control (Figure 5.5). Point mutation at the core binding sequence dramatically reduced the p53 response of both the proximal and distal promoter activity (Figure 5.5), which suggests that the core binding sequence within the putative p53RE element at the -122 bp site is crucial in mediating the response.

Figure 5.5 Effect of p53 co-transfection on the mutated and wildtype CYP2A6 proximal and distal promoters activities. The potential proximal p53 binding sites were mutated as described: TTCATG → TTACCA and GGCATG → GGATCC in CYP2A6-5’-160/p53mut- Luc, with the mutated bases in bold and the underlined bases representing the core sequence. The mutated and wildtype CYP2A6-5’-Luc constructs were transfected to C3A cells and

luciferase activities were measured 24 h after transfection. The measured luciferase activities were normalised against co-transfected pMAX-GFP control plasmid activities. The values (n = 4) represent the means ± S.D. p53 response of each reporter construct is indicated by -fold of activity to control co-transfection with pcDNA3. Mean difference is significant from control group at ****, p < 0.0001; **, p < 0.005 (Student’s t test).

Binding of p53 to the proximal p53RE on the CYP2A6 promoter

To confirm that the observed response was due to direct interaction of p53 with the putative site, EMSA was performed with nuclei fractions from C3A cells transfected with p53 expression plasmid using three oligonucleotide probes. Probe 1 is a longer oligonucleotide containing the putative binding site from -149 to -55 bp (Figure 5.6A). Probe 2 is a shorter oligonucleotide spanning the putative site from -127 to -98 bp. The third probe (Probe1Mut) is the longer oligonucleotide with the core sequence, CATG, critical for p53 binding, mutated to ACCA. As shown in Figure 5.6B, the transfection produced a substantial amount of p53 in the nucleus. Two distinct DNA-protein complexes were formed when Probe 1 was incubated with the C3A nuclear extract (Figure 5.6C, lane 2). The lower complex (closed arrow) was super-shifted with an anti-p53 antibody (Figure 5.6C, lane 3), indicating that the DNA- protein complex contains p53. In competitive assays, both complexes were competed out by a 125-fold excess of the unlabelled Probe 1 (S) (Figure 5.6C, lane 4, closed and open arrows). However, only the lower complex was competed out by increasing concentrations of the unlabelled consensus p53RE oligonucleotide (C) (Figure 5.6C, lanes 5-7, closed arrow). The results suggest presence of p53 in the lower complex and indicate that a protein other than p53 is forming the higher complex (open arrow) with Probe 1. Indeed, detailed analysis of the probe sequence revealed a putative binding site for hepatocyte nuclear factor 4α (HNF-4α) (Figure 5.6A, open box). Incubation with anti-HNF- 4α antibody shifted the migration of the higher complex (open arrow) (Figure 5.6C, lane 8), confirming the presence of HNF-4α. Two additional controls were included in the analysis to confirm specific binding of p53 and HNF-4α. Migration of the two complexes was not shifted by an anti-Nrf2 antibody (Figure 5.6C, lane 9, closed and open arrows) and the smaller complex was not formed with the mutated Probe 1 (Figure 5.6C, lane 10). To further confirm p53 specific binding, nuclei proteins were incubated with the shorter Probe 2, which contains only the putative p53

binding site. As expected, only one DNA-protein complex was formed with Probe 2 (closed arrow) (Figure 5.6C, lane 12), which (closed arrow) was shifted by anti-p53 antibody but not with anti-HNF-4α antibody (Figure 5.6C, lanes 13 & 14). These observations strongly suggest specific interaction of p53 with the putative site at the proximal CYP2A6 promoter. Collectively, the EMSA analysis and the luciferase reporter gene assays demonstrate that the proximal CYP2A6 gene promoter contains a functional p53RE that potentially mediates transcriptional regulation of the gene. The functional p53RE appears to reside adjacent to the response elements that govern the constitutive CYP2A6 gene expression (Pitarque et al., 2005).

Figure 5.6 EMSA analysis of p53 protein/CYP2A6 promoter interactions. (A) A schematic representation of the -160 to +1 region in the proximal CYP2A6 promoter. The closed arrows indicate orientation of the EMSA probe. The closed box highlights sequence of the potential p53RE that was revealed by the MatInspector transcription factor binding site search (http://www.genomatix.de/). The open box highlights sequence of the HNF-4α response element. (B) Western blot of p53 in the nuclei fractions of C3A cells transfected with p53 expression plasmid (pcDNA3-hp53). Positive control (+) = A-431 whole cell lysate. (C) EMSA blot. Nuclei proteins extracted from C3A cells transfected with pcDNA3- hp53 expression plasmid were incubated with digoxigenin-labelled probe, the orientation of which was shown in (A). Probe 1 = 94 bp oligonucleotide containing the putative binding site from -149 to -55 bp. Probe 2 = 29 bp oligonucleotide spanning the putative binding site from -127 to -98 bp. Probe1Mut = Probe 1 with the core sequence, CATG, critical for p53 binding, mutated to ACCA. Lanes 1 & 11 represent incubation without nuclei proteins. Lanes 3 & 13 represent incubation with nuclei proteins and anti-p53 antibody. Lane 9 represents incubation with nuclei proteins and anti-Nrf2 antibody. Lanes 8 & 14 represent incubation with nuclei proteins and anti- HNF-4α antibody The complexes with nuclear extracts were competed with 125-fold excess of unlabelled probe (S) (lane 4) and descending concentrations of unlabelled consensus p53RE oligonucleotides (C) (lanes 5-7). Lane 10 represents incubation with nuclei proteins digoxigenin-labelled mutated probe. The closed

arrow indicates smaller DNA-protein complex, and the opened arrow indicates bigger complex. The experiment was repeated three times, and similar results were obtained.

5.2.3 Endogenous p53 activates CYP2A6 gene expression

BaP induced p53 in activation of the CYP2A6-5’-160/+9-Luc promoter in MCF-7 cells

To demonstrate that endogenous p53 can mediate the expression of the CYP2A6-5’- 160/+9-Luc construct, and the native CYP2A6 gene, the transfected MCF-7 and C3A cells were treated with different concentrations of BaP, a known inducer of p53 (Biswal et al., 2003) for 24 h. BaP increased p53 protein levels in the nucleus of MCF-7 by 4-fold relative to control (Figure 5.7A and B). BaP also increased luciferase activity dose-dependently in cells transfected with either CYP2A6-5’-160/+9-Luc construct or reporter construct containing the consensus p53RE (pGL4.38-p53RE) (Figure 5.7C). However, the response was totally abolished when the two copies of the CYP2A6 p53RE core sequence were mutated (CYP2A6-5’-160/+9_p53mut-Luc) (Figure 5.7C). These observations align with the results shown in Figure 5.5 and Figure 5.6, and indicate that the proximal CYP2A6 p53RE is responsive to induced endogenous p53. It is unlikely that the induced luciferase activity was mediated by HNF-4α as its level remained constant after BaP treatment (Figure 5.7A and B). This is in agreement with previous observation that HNF-4α regulates basal expression of CYP2A6 (Pitarque et al., 2005), and corresponds with the observation of constant luciferase activity in cells transfected with CYP2A6-5’-160/+9_p53mut-Luc (Figure 5.7C, closed triangle), where the HNF-4α binding site is intact. As BaP also activates AhR leading its nuclear translocation from cytoplasm (Tsuji et al., 2011), the activated AhR could contribute to the transactivation of the recombinant CYP2A6 promoter. However, this possibility has been excluded as the detailed analysis of the proximal CYP2A6 promoter did not show any putative XRE (AhR binding site).

Figure 5.7 Effect of BaP treatment on activation of CYP2A6-5’-160/+9-Luc promoter activity in MCF-7 cells. The cells were transfected with pGL4.38-p53-Luc, CYP2A6-5’- 160/+9-Luc, or CYP2A6-5’-160/p53mut-Luc for 4 h before being treated with various concentrations of BaP. Twenty-four hours after treatment nuclei proteins were extracted and luciferase activities were measured. (A) Western blot of p53, HNF-4α and β-actin (loading control) in MCF-7 cells treated with various concentrations of BaP. Positive controls (+) = A- 431 whole cell lysate for p53, HepG2 whole cell lysate for HNF-4α and β-actin peptide. Each blot represents one of three blots (each blot showed the same pattern of induction). (B) Densitometry analysis of the Western blots. Fold induction = Relative p53 or HNF-4α expression of treated samples / Relative p53 or HNF-4α expression of control (0 µM BaP). Relative p53 or HNF-4α expression = the intensity of p53 or HNF-4α band relative to the intensity of β-actin band. The values (n = 3) represent the means ± S.D. *Mean difference is significant from control group at p < 0.05 (Student’s t test). (C) Effect of BaP treatment on the luciferase activities of the putative CYP2A6 p53RE constructs. The firefly luciferase activities were measured 24 h after BaP treatment. The measured activites were normalised against pMAX-GFP activity (transfection control plasmid). The values (n = 4) represent means ± S.D. *Mean difference is significant from control group at p < 0.05 (Student’s t test).

BaP induced endogenous p53, CYP2A6 and HMOX1expressions in C3A cells

Furthermore, BaP induced p53 dose-dependently in the nucleus of hepatocellular carcinoma cells (C3A) by 4-fold relative to control (Figure 5.8A and C). This confirmed previous observations of BaP-dependent induction of p53 at mRNA and protein levels in human lung adenocarcinoma (A549), mouse hepatoma (Hepa-1c1c7) and fibroblast (NIG3T3) cell lines, as well as in mouse skin (Pei et al., 1999; Serpi and Vähäkangas, 2003; Huang et al., 2012). Importantly, a recent investigation reported that BaP-induced CYP1A1 expression was regulated through p53 binding to a p53 response element in the CYP1A1 promoter region (Wohak et al., 2014). It is noted that p53 induction by BaP aligned with dose-dependent increases of the CYP2A6 mRNA and apoprotein ranging from 2 to 4-fold relative to control (Figure 5.8). Similar pattern of HMOX1 induction at mRNA and protein levels (another p53 target gene) was also observed (Figure 5.8). This confirmed previous observations of BaP-dependent

induction of HMOX1 expression in various human cell lines (Spink et al., 2002; Lee et al., 2009).

Figure 5.8 Effect of BaP treatment on endogenous p53, CYP2A6, and HMOX1 expressions in C3A cells. The cells were treated with various concentrations of BaP for 24 h. Thereafter total RNA, nuclei and cytosolic proteins were extracted. Quantitative real time RT-PCR was used to detect CYP2A6 and HMOX1 mRNA expression. (A) Western blot and densitometry of nuclei p53 and cytosolic CYP2A6 and HMOX1. β-actin was used as loading control. Each blot represents one of three blots (each blot showed the same pattern of induction). Positive controls (+) = A-431 whole cell lysate for p53; peptides for β-actin and HMOX1; and recombinant CYP2A6 yeast microsomes. Fold induction = Relative protein expression of treated samples / Relative protein expression of control (0 µM BaP). Relative protein expression = the intensity of protein band relative to the intensity of β-actin band. (B) Migration of RT-PCR products in 2.5% agarose gel. Lane 1 = 50 bp DNA ladder. Lanes 2, 5 and 8 are products from control cells; lanes 3, 6 and 9 are products from treated cells; and lanes 4, 7 and 10 are non-template control (NTC). GAPDH = housekeeping gene. The sizes of the PCR products align with the amplified regions by the primers. (C) Fold induction of p53 proteins, CYP2A6 and HMOX1 mRNA and protein in control and treated cells.

BaP has been found to act as a AhR agonist triggering the expression of CYP1 enzymes and initiating its own bio-activation (Baird et al., 2005). The formed metabolites such as BaP-quinones have a substantial role in promoting oxidative stress in cells and causing mitochondrial dysfunction (Zhu et al., 1995; Bolton et al., 2000). Formation of 1,6- BPQ, 3,6-BPQ, and 6,12-BPQ (Shimada and Guengerich, 2006) leads to ROS formation, more specifically, superoxide anion, e.g., in human breast epithelial cells (Burdick et al., 2003). A series of cytoprotective mechanisms are triggered as a result to minimise the ROS related cellular damages. For example, stress related transcription factors Nrf2 and p53 are induced by BaP treatment, and may exert a role in activating some antioxidant genes (Pei et al., 1999; Nguyen et al., 2010). In the case of human breast epithelial cells, the stress related transcription factors activated by BaP and its metabolites have been found to induce the expression of redox-homeostasis protective genes such as HMOX1 and some phase II enzyme genes such as NQO1, NQO2, ALDH3A1 (Burchiel et al., 2007), possibly to overwhelm the cellular damages caused by the unbalanced cellular redox. Previous studies have demonstrated that CYP2A6 efficiently metabolises bilirubin (BR), and is a part of a machinery that regulates cellular BR homeostasis (Abu-Bakar et al., 2012). The p53- mediated CYP2A6 transactivation may therefore act as a component of this machinery to protect cells against external stress.

The present observation that BaP — a carcinogen and transactivator of p53 (Pei et al., 1999)—concurrently induced CYP2A6 and HMOX1 expression (Figure 5.8) further suggests a potential role for CYP2A6 in cellular stress management. HMOX1 catalyses haem breakdown to biliverdin (BV), which is reduced to BR by biliverdin reductase. Bilirubin is an efficient scavenger of reactive oxygen and nitrogen species (Liu et al., 2003; Jansen et al., 2010), but apoptotic at highly elevated concentrations (Rodrigues et al., 2002). Hence, activation of HMOX1 by p53 may lead to drastic elevation of BR concentrations, which in turn, may overwhelm BR oxidant scavenging activity. Consequently, there is a need for a protective mechanism where BR is enzymatically oxidised to BV to curb its cytotoxicity (which can be reduced back to BR by biliverdin reductase when needed). It appears that

CYP2A6 may fit well this protective role as its Km for BR is within the subtoxic range (̴ 0.5µM) (Abu-Bakar et al., 2012). Importantly, the proposed role for CYP2A6 in the regulation of BR homeostasis during chemical onslaught is supported by a recent finding that BR elimination through conjugation was not elevated during the initial stage of oxidative stress, where its production was strongly increased (Muhsain et al., 2015), thus suggesting the existence of another pathway for BR elimination.

5.3 Transcriptional control of CYP2A6 by p53 involves complex interaction with CAR, Oct-1/C/EBP and HNF-4α (Paper II)

5.3.1 Role of p53, CAR, C/EBPα, Oct-1 and HNF-4α in the regulation of the CYP2A6 gene expression

Role of p53, CAR, C/EBPα, Oct-1and HNF-4α in CYP2A6 transactivation

The first part of this thesis has demonstrated the role of p53 in the regulation of CYP2A6 transactivation. The CYP2A6 was found to be activated by both the overexpressed p53 and the endogenous p53 (Hu et al., 2015). In addition, transcription factors CAR, C/EBPα, Oct-1 and HNF-4α have been found to interact with the proximal CYP2A6 promoter and may play a role in its regulation (Pitarque et al., 2005). The functional p53RE is only five

base pairs upstream of the REs that govern the constitutive CYP2A6 gene expression (Figure 5.2A and 5.10).

As previous studies have shown that the p53- mediated gene expression often involves interaction with other factors (discussed in section 2.5.1), and that, like p53 the CAR and C/EBP/Oct-1 are also part of the cellular stress ─ responding machinery (discussed in section 2.3.1), a series of experiments were designed to investigate possible interaction between these proteins in mediating the CYP2A6 transactivation.

To this end, the proximal CYP2A6-5’-160/+9 Luc promoter construct was co- transfected with the transcription factor expression plasmids: p53, CAR, C/EBPα, Oct-1 and HNF-4α respectively into the C3A cells. The p53, HNF-4α and Oct-1 co-transfections increased the CYP2A6-5’-160/+9 Luc promoter activities by about 3.2-, 2.6-, and 1.3- fold compared with the empty vector (Figure 5.9A). By comparison, the overexpression of C/EBPα in C3A cells induced the CYP2A6-5’-160/+9 Luc promoter for about 22 fold (Figure 5.9A). Interestingly, co-transfection of CAR in C3A cells had a week inhibitory effect on CYP2A6 gene transactivation (Figure 5.9A). These results indicate that all five transcription factors play a role in the regulation of the CYP2A6 gene but that the roles may differ. Levels of the respective transcription factors in the C3A cells, transfected with expression plasmids or the empty vector were confirmed by Western blotting and by subsequent semi quantitative scanning of the band showing that all five transcription factors were highly expressed in cells transfected with their expression plasmids (Figure 5.9B and C). It is worth noticing that the level of C/EBPα appears to be extremely low in control cells, suggesting a low endogenous C/EBPα expression in C3A cells (Figure 5.9B).

(A)

(B)

(C)

Figure 5.9: Effect of transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α on CYP2A6-5’-160/+9 Luc construct activity in C3A cells. (A) Effect of p53, CAR, C/EBPα, Oct-1 and HNF-4α co-transfections on CYP2A6 promoter driven luciferase activities. C3A cells were co-transfected with either CYP2A6-5’-160/+9 Luc plasmid or pGL3-Basic plasmid together with p53, CAR, C/EBPα, Oct-1 or HNF-4α expression plasmids, or empty cloning vector (pcDNA3) respectively, and pMAX-GFP (transfection control plasmid). The firefly luciferase activities were measured 24 h after transfection. The measured activities were normalised against pMAX-GFP activity, and the expression vector/empty vector ratios were calculated and normalised with regard to the related pGL3-Basic activities. The CYP2A6-5’- 160/+9 Luc construct activity driven by each overexpressed transcription factor is indicated by -fold induction of the Relative Luciferase Activity (RLA) to control co-transfection with pcDNA3. The values (n = 4) represent means ± S.D. Mean difference is significant from control group at ****, p < 0.0001; **, p < 0.005; (Student’s t test). (B) Western blotting and (C) densitometry of p53, CAR, C/EBPα, Oct-1 and HNF-4α expressions in C3A cells transfected with p53, CAR, C/EBPα, Oct-1 and HNF-4α expression plasmids. Each transfection was done in triplicate. Positive controls (+), A-431 whole cell lysate was used to indicate p53, C/EBPα transfected C3A nuclear extract was used to indicate C/EBPα and HepG2 whole cell lysate was used to indicate CAR, Oct-1 and HNF-4α. Protein expression (bar graph) = the intensity of overexpressed bands relative to the intensity of β-actin bands.

The values (n = 3) represent means ± S.D. Mean difference is significant from control group at ****, p < 0.0001; **, p < 0.005; *, p < 0.05 (Student’s t test)

Direct interaction of p53, CAR, C/EBPα, Oct-1and HNF-4α with the proximal CYP2A6 promoter

Direct binding of the transcription factors to the proximal CYP2A6 promoter was demonstrated by a series of EMSA analysis. Sequences covering the respective REs and binding sites of the proteins at the CYP2A6 proximal promoter (Figure 5.10) were used as labelled probes. These probes were incubated with related nuclear proteins that were extracted from the transcription factor expression plasmid transfected C3A cells. The protein/DNA complexes can be recognised by the specific antibodies. Anti Nrf2 antibody was used as control for unspecific binding: (a protein present in the nuclear extract but with no binding site at the promoter).

As can be seen from figure 5.11A, B and C, a protein/DNA complex was formed when each probe was incubated with the nuclear proteins (lane2). The formed protein/DNA complexes were recognised and super-shifted by their specific antibodies, including p53, CAR, RXR (heterodimer of CAR upon binding to the DNA) and Oct-1, which are indicated by arrows. No super-shifted complexes were observed when Nrf-2 antibody was added to the protein/DNA mixtures. This suggests specific binding of transcription factors p53, CAR and Oct-1 to their respective REs. Intriguingly, only a weak and diffuse shift was observed in Figure 5.11D with anti C/EBPα antibody; a pattern nonetheless distinctly different from that obtained with anti Nrf2 antibody (Figure 5.11D, lane 4), where no trace of shift was observed. This could indicate a weak binding of the anti C/EBPα antibody to the protein, possibly due to some interference by the Oct-1 (See figure 5.16). Two complexes were observed when the probe specific to the HNF-4α was incubated with the protein extract (Figure 5.11E, lane 2). A distinct super-shifted band was observed with simultaneous disappearance of the upper band upon addition of the HNF-4α antibody, indicating binding of HNF-4α to the complex (Figure 5.11E, lane 3). Although composition of the lower complex is not obvious, the Nrf2 antibody did not shift the upper band or the lower band suggesting specific binding of HNF-4α to the RE. In conclusion, p53, CAR, C/EBPα, Oct-1 and HNF-4α

64 binding to the proximal CYP2A6 promoter have a significant role in its transactivation, which is in agreement with this study and previous studies (Pitarque et al., 2005; Hu et al., 2015). It is to be noted that the current observations demonstrate a remarkably high C/EBPα mediated CYP2A6 transactivation yet a relatively low binding affinity of C/EBPα to the promoter in comparison with the findings demonstrated by Pitarque et al., 2005. This may be due to cell specific effect on activation of the promoter. A recombinant C/EBPα extracted from transfected C3A cells was used in the study instead of using HepG2 cells and rat liver extract by Pitarque et al., 2005. However, whether these transcription factors interact with each other in regulating the CYP2A6 gene expression is still obscure and will be elucidated in the next section.

Figure 5.10: Schematic representation of the response elements on the CYP2A6-5’- 160/+9 Luc construct. Four REs including p53RE, DR-4RE for CAR binding, C/EBP-Oct- 1RE and HNF-4αRE are underlined.

Figure 5.11: EMSA analysis of the transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α binding to the proximal CYP2A6 promoter. EMSA procedures are shown under Materials and Method. The DNA probes covering the respective REs on the proximal CYP2A6 promoter region and the antibodies used in the assay are shown above the EMSA

blot. The nuclei protein fractions were extracted from the transcription factor expression plasmids transfected C3A cells. The Nrf-2 antibody was used as control for unspecific binding (a protein present in the nuclear extract but with no binding sites at the promoter). (A) The probe CYP2A6-5’-127/-98 corresponding to the p53RE was incubated with p53 overexpressed nuclear extract (lane 2). The formed DNA/protein complex was super-shifted by p53 antibody (lane 3) but not with the Nrf-2 antibody (lane 4). (B) The probe CYP2A6-5’- 103/-80 corresponding to the DR-4RE was incubated with CAR overexpressed nuclear extract (lane 2). The formed DNA/protein complex was recognised by CAR and RXR (heterodimer of CAR) antibodies (lane 3 & lane 4), but not with the Nrf-2 antibody (lane 5). (C) and (D) The probe CYP2A6-5’-92/-65 corresponding to the C/EBPα-Oct-1RE was incubated with Oct-1 or C/EBPα overexpressed nuclear extracts (C and D, lane 2). The formed DNA/protein complex was shifted by Oct-1 antibody (C, lane 3), but only weakly and diffusely shifted by C/EBPα antibody (D, lane 3). No super-shifted complex was observed when the mixtures were incubated with Nrf-2 antibody (C and D, lane 4). (E) The probe CYP2A6-5’-77/-53 corresponding to the HNF-4αRE was incubated with HNF-4α overexpressed nuclear extract, forming two DNA/protein complexes (lane 2). Only the upper complex was totally pulled up by HNF-4α antibody (lane 3). No super-shifted complex was observed with the Nrf-2 antibody (lane 4). Lane 1 in all EMSA blots represents probe incubations without nuclei proteins. The super-shifted DNA-protein complexes are indicated by arrows. The experiment was repeated 3 times with similar results.

5.3.2 Contribution by p53, CAR, C/EBP/Oct-1 and HNF-4α REs to CYP2A6 transactivation

To investigate the contribution of the REs on proximal CYP2A6 promoter region to CYP2A6 gene transactivation, a series of the RE mutated CYP2A6-5’-160/+9 Luc promoters were generated, followed by transfections of these mutated promoter constructs together with pMAX-GFP into the C3A cells. Figure 5.12 shows the locations of the respective binding sites at the CYP2A6 promoter region. These sites were mutated individually and in combination.

Figure 5.12: Site direct mutagenesis of the response elements on proximal CYP2A6 promoter region. Schematic representation of the mutated REs on the CYP2A6-5’-160/+9 Luc construct. The REs were mutated individually and in combination (mutated bases in bold).

Figure 5.13A shows that mutating each of these REs on the CYP2A6-5’-160/+9 Luc promoter significantly reduced the promoter activity by about 40% – 55% compared to the wildtype. The SV-40 promoter driven luc - activity, used as a control, was expressed at about 50% of the activity of the wild type CYP2A6 (Figure 5.13D). As expected, no significant activity was observed in the cells transfected with pGL3-Basic plasmid (negative control). The results demonstrate that each of the four response elements, present on the proximal CYP2A6 promoter, has a role in mediating CYP2A6 gene transactivation essentially confirming results summarised in Figure 5.9 and 5.11. In the case of CAR, apparently opposite effects were found with its overexpression respectively mutation of the RE (Figure 5.9 and 5.13A). It has been shown that p53- mediated gene transactivation often involves complex machinery including recruitment of other cofactors, as discussed in section 2.5.1. Thus, the interplay between p53 and the other four proteins in mediating the CYP2A6 transactivation was investigated. To demonstrate the possible interaction among the transcription factors, a series of multiple RE mutations were introduced, as shown in Figure 5.13B, C and D. The mutated promoters were transfected into the C3A cells respectively. A total abolishment of the activity was observed, when all 4 REs were mutated on the promoter, as could be expected (Figure 5.13D). Intriguingly, when the promoter was triple mutated with the p53RE or HNF-4αRE intact, almost a total abolishment of the promoter activity was observed. However, when either CAR or C/EBP/Oct-1 RE was kept intact, a significant expression at about 40% to 60% from the wild type could be observed (Figure 5.13B). These results suggest that while all the REs on the CYP2A6 promoter are necessary for optimal activity, their respective roles in assembling the transcription complex seem different. The activation of CYP2A6 by p53 and HNF-4α requires the other factors, while CAR and particularly C/EBP/Oct-1 seem to be able to function partially independently although not in their full capacity. When a series of double mutations was introduced an even more complex picture emerged (Figure 5.12C). A zero level activity was observed when only the p53 and HNF-4α REs were intact supporting the observation above that these TFs need the other two proteins

to function. In addition, this result seems to suggest that p53 and HNF-4α do not interact directly with each other to support transcription. On the other hand, when p53RE was kept intact together with either CAR or C/EBP/Oct-1 RE, the expression could partially be restored suggesting an interaction between these proteins and the p53. In conclusion, the results suggest a complex interaction between the five proteins where all of them are needed for optimal transcriptional activity, and where the p53 cannot act alone but needs interaction with the other proteins in regulating the expression of the CYP2A6 gene. The results also suggest a tight interaction between the stress activated p53, CAR, C/EBPα and Oct-1, complemented by the HNF-4α for full activity.

Figure 5.13: Mutational analysis of the CYP2A6-5’-160/+9 Luc construct in C3A cells. (A) Effect of single RE mutations on the proximal CYP2A6 promoter activities in C3A cells. (B) Effect of triple RE mutations on the proximal CYP2A6 promoter activities in C3A cells. (C) Effect of double RE mutations on the proximal CYP2A6 promoter activities in C3A cells.

(D) Effect of all sites mutations on the proximal CYP2A6 promoter activities in C3A cells. The REs on the CYP2A6-5’-160/+9 Luc construct were mutated individually and in combination (Figure 5.12), followed by co-transfection of the mutated promoters and pMAX- GFP into the C3A cells. The negative and positive controls for transfection were indicated by transfections of pGL3-Basic and pGL3 containing SV-40 promoter into the C3A cells respectively. A schematic representation of the mutated CYP2A6-5’-160/+9 Luc construct is shown on the left, where the mutated REs for transcription factors are shown with a cross. The promoter activity of each mutated construct was compared against the pGL3-Basic activity and wildtype proximal CYP2A6 promoter activity, indicated by “*” and “#” respectively. The firefly luciferase activities were measured 24 h after transfection. The measured activities of each mutated construct were normalised against pMAX-GFP activity (transfection control plasmid), and were expressed as arbitrary units relative to the wildtype proximal CYP2A6 promoter activity. The values (n = 4) represent means ± S.D. Mean difference is significant at ****, p < 0.0001; ***; p < 0.0005; ####, p < 0.0001 (one-way analysis of variance (ANOVA) followed by the least significant difference post hoc test).

5.3.3 Over-expression of p53 emphasises its interaction with CAR and C/EBP/Oct-1 in the regulation of CYP2A6

To further demonstrate that p53 interacts with the other proteins in mediating CYP2A6 transactivation, a series of mutated constructs were co-transfected with the p53 expression plasmid into the C3A cells as shown in Figure 5.14. A significant upregulation of the wildtype proximal CYP2A6 promoter activity was observed when the p53 was overexpressed in cells, which is almost as strong as the p53 positive control. As could be expected, mutation of the p53RE either alone or together with the other REs on the promoter dramatically abolished the p53 responsiveness of the promoter, thus demonstrating its role in maintaining the CYP2A6 expression (Figure 5.14). A very weak and non-significant up-regulation was observed with the construct where the p53RE was the only intact one. An equally weak/nonsignificant upregulation was observed with the intact p53RE and pairwise mutations of the CAR/C/EBP/Oct-1/HNF-4α REs respectively (Figure 5.14). The results confirm observations in Figure 5.13 that p53 cannot support CYP2A6 expression alone but needs cooperation with the other factors. And

further that interaction with only one of the other proteins is not sufficient. Interestingly, co- transfections with constructs possessing intact p53RE and a single mutation at one of the three other sites respectively showed that while mutation of the CAR or the C/EBP/Oct-1 RE compromised the expression partially, mutation of the HNF-4α site did not, as compared to the wild type. This result confirms the picture emerging from Figure 5.13 where CAR and C/EBP/Oct-1 are essential partners for p53 in its CYP2A6 regulation while the HNF-4α plays a supportive function.

Figure 5.14: Effect of p53 co-transfection on the REs mutated CYP2A6-5’-160/+9 Luc construct activities in C3A cells. C3A cells were co-transfected with a series of RE mutated CYP2A6-5’-160/+9 Luc construct together with p53 expression plasmid (pcDNA3-hp53) or empty expression plasmid (pcDNA3). The schematic representation of the mutated CYP2A6- 5’-160/+9 Luc constructs is shown on left with a cross for the mutated REs. The pGL4.38- p53RE plasmid containing two copies of consensus p53RE was used as positive control to indicate p53 co-transfection in C3A cells. Promoter less pGL3-Basic was used as negative control to indicate the transfection in C3A cells. The measured luciferase activities were normalised against co-transfected pMAX-GFP control plasmid activities. The values (n = 4) represent the means ± S.D. p53 response of each reporter construct is indicated by -fold induction of the Relative Luciferase Activity (RLA) to control co-transfection with pcDNA3.

Mean difference is significant from control group at ****, p < 0.0001; ***, p < 0.0005; **, p < 0.005; *, p < 0.05 (Student’s t test). ns = no significance.

5.3.4 Replacing the p53RE at the CYP2A6 promoter with consensus p53RE dramatically increases the expression level

A consensus RE has been previously described for the p53. It contains two repeats of [5’-RRRC(A/T)(T/A)GYYY-3’], where “R” represents purine and “Y” represents pyrimidine, as discussed in section 2.5.1. This DNA sequence is characterised by a specific, high affinity interaction with the p53, and has been used in vectors assessing p53 activity levels in in vitro cell assay (Mukudai et al., 2013; Promega, 2015) . The double - repeat p53 consensus sequence vector, pGL4.38 [luc2P/p53 RE/Hygro] has been used as a positive control to assess p53 activation in this study (Figure 5.1, 5.3, 5.4, 5.5, 5.7 and 5.14). When the CYP2A6-specific p53RE was mutated into the p53 consensus sequence (Figure 5.15A, boxed regions) while keeping the promoter otherwise intact, an extremely high expression level (up to 30-40 times higher) as compared to the CYP2A6 wild type or indeed the p53 positive control was achieved (Figure 5.15B). When this construct was co-transfected with the p53 expression plasmid, no further increase in the expression, unlike in the case of the wild type CYP2A6 or the p53 positive control, was achieved (Figure 5.15B). This is an unexpected result, particularly since the p53 positive control contains two copies of the consensus sequence while the modified CYP2A6 promoter contains only one. The result is not easy to explain but it possibly demonstrates the importance of the adjacent transacting factors, present at the CYP2A6 promoter, for p53 to achieve its full gene activating capacity. This would be in accordance with the results obtained throughout the present investigation.

(A)

(B)

Figure 5.15: Effect of p53 co-transfection on the luciferase activity of the proximal CYP2A6 promoter containing a consensus p53RE. (A) The differences between the CYP2A6-5’p53RE and the consensus p53RE sequences are indicated in the boxed regions, showing different satellite sequences. The p53 binding core sequences are shown in bold. (B) The p53RE on the proximal CYP2A6 promoter was mutated into a consensus p53RE as described: 5’-ATTCATGGTGGGGCATGTAG-3’→5’-AGACATGCCTAGACATGCCT- 3’ in CYP2A6-5’-160/+9 Luc construct, with the mutated bases underlined and the core sequences in bold. The C3A cells were co-transfected with the wildtype CYP2A6-5’-Luc construct or the CYP2A6-5’-Luc construct containing consensus p53RE together with p53 expression plasmid (pcDNA3-hp53) or empty plasmid (pcDNA3). The pGL4.38-p53RE plasmid containing two copies of consensus p53RE was used as positive control to indicate p53 co-transfection in C3A cells. Promoter less pGL3-Basic serves as a negative control for the transfection. The luciferase activities were measured 24h after transfection and were normalised against co-transfected pMAX-GFP control plasmid activities. The values (n = 4) represent the means ± S.D. p53 response of each reporter construct is indicated by -fold induction of the Relative Luciferase Activity (RLA) to control co-transfection with pcDNA3. Mean difference is significant from control group at ****, p < 0.0001; **, p < 0.005; *, p < 0.05 (Student’s t test). ns = no significance.

It could be that introducing the consensus sequence into the CYP2A6 promoter has created a template with an extremely high p53 affinity (higher than the consensus sequence alone) binding aggressively all the endogenous p53 (facilitated by the other interacting

proteins) and leaving no place for the overexpressed p53. This could explain why no further upregulation of this construct took place by overexpressing the p53. Such a scenario would agree with a model where the other TFs (CAR, C/EBP/Oct-1) help recruiting the p53 into the complex and facilitate its binding to it’s RE.

5.3.5 A model for the p53- mediated CYP2A6 transactivation

In this study, a “stress cluster” consisting of the stress activated transcription factors p53, CAR, and C/EBP-Oct-1 was described on the proximal CYP2A6 promoter spaning from -122 to -60 bp upstream the TATA box (Figure 5.16A). The CYP2A6 gene expression has been found to be governed by the interaction between these TFs binding to the promoter region. Particularly, the data show that p53 cannot act independently, but needs interaction with the other proteins for its activity. For full activity, the “stress protein cluster” needs to interact with the HNF-4α also binding to the same regulatory region (Figure 5.16B).

It has been previously shown that p53 is a transcriptional activator of the CYP2A6 during oxidative and/or genotoxic stress (Hu et al., 2015); conditions that are known to upregulate the CYP2A6 (Abu-Bakar et al., 2013); indeed to activate the p53 (Meek, 2004; Gambino et al., 2013; Clewell et al., 2014). However, the present study shows that rather than acting alone, the p53 cooperates with other stress activated proteins to exert its regulatory function. The proteins included in the “stress cluster” have been found to be activated by various toxic insults, suggesting that the CYP2A6 induction in cells maybe complex and multifactorial (Jin et al., 2001; Li et al., 2008; Osabe et al., 2009; Hou et al., 2012; Hu et al., 2015).

It should be noted that the CYP2A6 gene expression is also regulated by some other stress activated signalling pathways. Accordingly, the CYP2A6 is induced by the ligand activated transcription factors pregnane-X-receptor (PXR) and estrogen receptor-α (ER-α) (Itoh et al., 2006; Higashi et al., 2007). The transcription factor, Nrf-2 activates CYP2A6 gene expression under oxidative stress (Yokota et al., 2011). Additionally, the multifunctional, stress activated hnRNPA1 (Heterogeneous Nuclear Ribonucleoprotein A1) has been found to upregulate CYP2A6 expression at post-transcriptional level by stabilising

the mRNA and targeting it into the endoplasmic reticulum during transcriptional arrest (Christian et al., 2004).

These observations together with the findings of this study are in agreement with earlier, descriptive evidence on conditions leading to upregulation of the CYP2A6. For instance, it has been shown that viral and parasitic infestations, chronic inflammation, radiation, alcohol caused liver injury and toxic insults by a variety harmful, structurally unrelated chemicals, all can upregulate the gene (Kirby et al., 1994; Donato et al., 2000; Niemela et al., 2000; De-Oliveira et al., 2006; Kirby et al., 2011; Abu-Bakar et al., 2013). Upregulation by such diverse types of insults has led us to hypothesise that, rather than any specific chemical or agent, changes in intracellular conditions such as in redox potential, DNA or other macromolecular damage, maybe the cause of induction. Given the fact that the induction is often observed in tissues or cells such as liver (Nakajima et al., 2006), lung, oesophagus, intestinal, oral and nasal epithelium (Su et al., 1996; Koskela et al., 1999; Janmohamed et al., 2001), which encounter high levels of oxygen and chemical exposures, one can wonder what is the significance with such an CYP2A6 induction? Our recent work has shown that the CYP2A6 and the mouse CYP2A5 play an important role in maintaining optimal cellular BR homeostasis and antioxidant capacity (Abu-Bakar et al., 2011; Abu- Bakar et al., 2012). The present data provide mechanistic insights into the cellular defense system consisting of the HMOX1 and CYP2A6: a machinery that maintains optimal intracellular BR levels for cellular protection (Discussed also in section 5.2.3).

Figure 5.16: Schematic representation of the transcriptional regulation of the proximal CYP2A6 promoter. (A) A “stress cluster” on the proximal CYP2A6 promoter region. Proximal CYP2A6 transactivation is governed by the stress activated transcription factors p53, CAR, C/EBPα, Oct-1 and nuclear factor HNF-4α. (B) A model depicts the interaction between p53 and the other transcription factors in mediating CYP2A6 transactivation. P53- mediated CYP2A6 transactivation is dependent on the interaction with CAR and C/EBP-Oct- 1, and for its full activity it is supported by HNF-4α.

Although the p53 was shown to induce the CYP2A6 gene during stress and that the p53- mediated CYP2A6 transactivation is dependent on the interaction with other stress activated transcription factors that bind to the proximal CYP2A6 promoter region, there are some questions still to be answered. For instance, it is not clear whether other transcription factors interact with the “stress cluster”, especially these activated by stress.

P53 has been found to play a dual role both in regulating cyto-protective pathways and triggering apoptosis (Bensaad and Vousden, 2007). When cells are under a mild stress, p53 induces intracellular antioxidant capacity to scavenge excess ROS and maintain cellular homeostasis. However, severely damaged cells invoke the strongest possible cell death signal by enhancing the expression of p53 and intracellular ROS generation. It is therefore logical to assume that CYP2A6 expression may be downregulated to decrease BR oxidation, which

leads to accumulating of intracellular BR. As BR has been found to induce p53, inhibit cell proliferation, activate cell cycle arrest, and increase apoptosis at concentrations ≥ 25 µM (Ollinger et al., 2007), possible downregulation of CYP2A6 may promote apoptosis to remove the severely damaged cells. Does p53 also have a role in mediating the CYP2A6 downregulation? Could it be that when p53 turns from protective to apoptotic mode, its role in the regulation of the CYP2A6 changes? To explore these questions, a series experiments were designed, which are illustrated in the next section.

5.4 Interaction between p53 and Nrf-2 in mediating CYP2A6 transactivation and identification of potential repressor region(s) on the CYP2A6 promoter

5.4.1 Nrf-2 restrains p53- mediated CYP2A6 transactivation through the C/EBP-Oct- 1RE

It has been well demonstrated that direct binding of p53 to ARE (Nrf-2 binding site) has a suppressive effect on some stress responding genes including the phase II metabolising genes NQO-1 and GST-1 (Faraonio et al., 2006; Wakabayashi et al., 2010). A similar interaction was observed between transcription factors C/EBPβ and Oct-1in regulating the interleukin-8 (IL-8) gene expression (Wu et al., 1997), a known neutrophil chemoattractant which has been found to induce ROS production in human umbilical vein endothelial cells (HUVECs) (Miyoshi et al., 2010). In the absence of immune activation, Oct-1 binds independently to an element overlapping that of C/EBP, repressing IL-8 promoter transactivation (Wu et al., 1997), suggesting that activation of a stress responsive gene may involve complex interactions with other transcription factors, possibly for cells to deal with different levels of cellular perturbations. Notably, it has been reported that, under oxidative stress, the activated Nrf-2 expression induces C/EBPβ (LAP) and its truncated form LIP in 3T3-L1 mouse pre-adipocytes (Hou et al., 2012). The LIP forms heterodimers with the other C/EBPs, which has been found to negatively regulate CYP2A6 gene expression (Pitarque et al., 2005). As the present “stress cluster” on the proximal CYP2A6 promoter contains a

p53RE and C/EBP-Oct-1RE, it is plausible that the Nrf-2 may interact with these proteins, and play a role in its expression.

A series of CYP2A6 promoter constructs were co-transfected with p53 alone, Nrf-2 alone, p53 and Nrf-2 in combination or empty vector expression plasmid (pcDNA3) into the C3A cells to detect possible interaction between Nrf-2 and p53 in regulating the CYP2A6 gene. As shown in Figure 5.17, p53 and Nrf-2 co-transfections induced the luciferase activity of both the pGL3-ARE-TK plasmid and pGL4.38-p53RE plasmid compared to empty plasmid (pcDNA3) transfected cells, which indicate Nrf-2 and p53 over-expression in the transfected cells. Interestingly, p53 over-expression dramatically inhibited the Nrf-2 mediated activation of pGL3-ARE-TK plasmid, whereas Nrf-2 co-expression did not affect the p53- mediated activation of pGL4.38-p53RE plasmid (Figure 5.17). These results are accordance with the previous observations that p53 overexpression interferes with the Nrf-2 mediated induction of ARE containing gene promoters (Faraonio et al., 2006). In contrast, an opposite effect was observed with both the wildtype distal and the wildtype proximal CYP2A6 promoters, where Nrf-2 overexpression significant hampers the p53- mediated CYP2A6 transactivation for both the distal and proximal promoters (Figure 5.17). This result indicates that Nrf-2 somehow blocks the p53- mediated CYP2A6 transactivation through the REs present on the proximal promoter region (Figure 5.17). Furthermore, this inhibitory effect by Nrf-2 disappeared when the DR-4RE, C/EBP-Oct-1RE and HNF-4αRE of the “stress cluster” were replaced with a TK promoter, suggesting that the Nrf-2 may supress the p53- mediated CYP2A6 transactivation through the interaction of these REs (Figure 5.17). In accordance with this, when the C/EBP-Oct-1RE was mutated on the proximal CYP2A6 promoter region, the inhibitory effect by Nrf-2 was totally abolished (Figure 5.17).

Figure 5.17: Effect of p53 and Nrf-2 co-expression on the luciferase activity of the CYP2A6 promoter constructs. The CYP2A6 promoter constructs together with pcDNA3- Nrf-2 alone, pcDNA3-hp53 alone, pcDNA3-Nrf-2 and pcDNA3-hp53 in combination or empty expression plasmid (pcDNA3) alone were co-transfected into the C3A cells. The luciferase activities were measured 24h after transfection and were normalised against co- transfected pMAX-GFP control plasmid activities. The values (n = 4) represent the means ± S.D. Mean difference is significant from control group at ****, p < 0.0001; **, p < 0.005 (Student’s t test). ns = no significance.

The observed results suggest that the Nrf-2 restrains p53- mediated CYP2A6 gene expression through the C/EBP-Oct-1RE on the proximal CYP2A6 promoter region. It could be that Nrf-2 overexpression may induce the truncated C/EBPβ form, LIP in C3A cells. It is known that the LIP heterodimers with other C/EBPs binding to the C/EBP-Oct-1RE on the proximal CYP2A6 promoter (Pitarque et al., 2005), which may restrain the p53- mediated CYP2A6 transactivation. In any case the results further strengthen the proposed hypothesis that the induction of CYP2A6 is complex and multifactorial. How do the stress activated transcription factors interact in regulating CYP2A6 gene expression when cells cope with different types of cellular perturbations? What is the significance of such interactions in

regulating CYP2A6 gene expression? Further research is warranted to answer these questions. It has been shown that high intracellular BR levels (≥ 50 µM) significantly induce Nrf2 expression in primary hepatocytes (Kim et al., 2013). Constrained induction of CYP2A6 in cells under stress may cause accumulation of BR, which may turn it from antioxidant to a pro-apoptotic. Could it be that in extreme stress, BR potentially downregulates its own oxidation by suppressing p53-dependent transcription of CYP2A6 to ensure sufficient supply to maintain apoptosis once the cells are severly damgaged?

5.4.2 Potential repressor region(s) at CYP2A6 promoter

As discussed in section 3.1 and 5.2.1, it is likely that suppressive element(s) may exist on the CYP2A6 promoter to repress the CYP2A6 gene. The reasons for this are not known but could be related to an adaptive mechanism to external stress possibly to promote cell apoptosis. This is supported by the previous evidence suggesting the presence of potential suppressor(s) upstream the CYP2A6 promoter (Pitarque et al., 2005; Itoh et al., 2006; Higashi et al., 2007).

To investigate the potential suppressor region(s) on the CYP2A6 promoter, a series of stepwise 5’-truncated CYP2A6 promoter constructs with 200 - 300bp intervals were generated from the distal CYP2A6-5’-2901/+9 Luc construct, followed by their transfection of the constructs into the C3A cells. As shown in Figure 5.18, the region from -250bp to TSS containing the “stress cluster” plays an essential role in mediating CYP2A6 gene expression. Interestingly, deletion of the sequence from -2253 to -1955bp totally abolished the promoter activity compared to the previous longer promoter, while further deletion of the promoter from -1955 to -1700bp resulted in a substantial recovery of the activity. This result suggests the presence of a negative regulatory region between -2253bp and -1700bp. It could be that deletion of the region from -2253 to -1955bp may have created a space for binding of a repressor to the promoter, blocking the transcription. Further deletion from -1955 to -1700bp may have resulted in a loss of the suppressor, and recovery of the promoter activity. It is also worth noticing that deletion of the sequences from -688 to -437 and further to -250bp significantly enhances the promoter activity in a stepwise manner compared to the previous longer CYP2A6 promoter constructs. This result suggests the existence of other repressor regions at the promoter from -250bp further upstream.

Figure 5.18: Luciferase activities driven by the 5’-truncated proximal CYP2A6 promoters in C3A cells. A series of 5’-truncated CYP2A6 promoter constructs were generated with 200-300bp intervals. The generated CYP2A6 promoter constructs together with pMAX-GFP were co-transfected into the C3A cells. The promoter activity of a certain CYP2A6 promoter construct was compared to the promoter activity of the previous longer CYP2A6 promoter construct. The values (n = 4) represent means ± S.D. Mean difference is significant at ****, p < 0.0001; *, p < 0.05 (one-way analysis of variance (ANOVA) followed by the least significant difference post hoc test).

It has previously been shown that distal p53REs may play a suppressive role in mediating Polo-like kinase-2 (PLK-2) gene expression, whereas the proximal p53RE functions as a gene activator (Burns et al., 2003). Up to five putative p53REs were detected upstream TATA box at the CYP2A6 promoter within the 3k bp region (Figure 5.2). It is not clear whether these p53REs have a role in regulating CYP2A6 gene expression. Interestingly, however, one putative p53RE was identified between -2253bp and -1700bp of the CYP2A6 promoter (Figure 4.1 and 5.2): the region which was shown to contain repressor activity (Figure 5.18). Could the putative p53RE residing in this region functions as a gene repressor, negatively regulating the CYP2A6 gene? And could other repressor elements exist further downstream between -1700 and -437bp. Further investigations should be undertaken to

82 identify the possible repressor(s) regulating CYP2A6 gene expression, and to understand their biological significance.

5.5 Conclusions

While the CYP2A6 has been shown to play only a minor role in xenobiotic metabolism, it has been recognised as a stress responsive enzyme, with an important role in maintaining BR homeostasis for cell protection (Abu-Bakar et al., 2005; Abu-Bakar et al., 2012). In contrast to other CYP enzymes, the CYP2A6 is induced in various stress conditions such as viral and parasitic infestations, chronic inflammation, radiation, alcohol caused liver injury and structurally unrelated toxic insults (Kirby et al., 1994; Donato et al., 2000; Niemela et al., 2000; De-Oliveira et al., 2006; Kirby et al., 2011). Furthermore, the induction is typically observed in tissues or cells which suffer from high level of oxygen and chemical exposures.

Recent studies have shown that the CYP2A6 is regulated by a group of stress activated proteins including the PXR, CAR, Nrf-2, C/EBP, Oct-1 and hnRNPA1 (Christian et al., 2004; Pitarque et al., 2005; Itoh et al., 2006; Yokota et al., 2011). While the Nrf-2, C/EBP/Oct-1 and hnRNPA1 are non-ligand binding, activated by divers cellular disturbances (Jin et al., 2001; Christian et al., 2004; Li et al., 2008; Riley et al., 2008; Ma, 2013), the PXR and CAR are activated by a multitude of ligands including toxins, drugs and other diverse chemicals and xenobiotics (Kliewer et al., 2002; Timsit and Negishi, 2007; Kachaylo et al., 2011).

In this work, sequence analysis of the CYP2A6 promoter revealed six putative p53REs, suggesting a potential role for the p53 in regulating CYP2A6 transactivation. A series of experiments were designed to investigate the role of p53 in CYP2A6 regulation with a special emphasis in understanding its interaction with the other stress activated proteins. The results presented in the thesis are obtained from a series of in vitro transfections in human immortalised cell lines, which may not direct reflect the situation in vivo. Hence, chromatin immunoprecipitation (ChIP) of TFs on the CYP2A6 promoter in human primary hepatocytes might further strengthen the extrapolations that are elaborated in the thesis. Such approach would also suit for the future toxicological studies on toxic substances in activation

of CYP2A6 gene expression in human cells. In relation to the study of TFs interaction in mediating CYP2A6 transactivation, a protein immunoprecipitation assay between p53 and the other TFs would have provided a direct evidence of such interaction. Considering the complex binding of these TFs on the restricted region of the proximal promoter, it may however be difficult to reach the detection limit required by the assay. A computational simulation of the TFs binding to the CYP2A6 promoter together with the current observations on the promoter mutational and transfection studies could offer further valuable interpretation for the CYP2A6 transactivation mediated by the TFs interaction. Although there is a limitation of the approaches used in the study, the findings demonstrated that:

i) Stress activated transcription factor p53 has a role in regulating CYP2A6 gene expression.

ii) P53- mediated CYP2A6 transactivation takes place through the proximal p53RE on the CYP2A6 promoter region.

iii) BaP induced endogenous p53 activates CYP2A6 transactivation in MCF-7 cells.

iv) BaP activates native CYP2A6 and HMOX1 gene expressions in a dose dependent manner along with the elevation of the p53 expression in C3A cells, suggesting a key role for p53 in the regulation.

v) Proximal CYP2A6 gene promoter transactivation is regulated by a complex interaction between transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α binding to this region.

vi) P53- mediated CYP2A6 transactivation requires interaction with CAR and C/EBP/Oct-1, with a support function by HNF-4α.

vii) Replacing the p53RE at the proximal CYP2A6 promoter region with a consensus p53RE dramatically enhances the CYP2A6 promoter activity.

viii) Nrf-2 restrains p53 induced CYP2A6 transactivation probably through interfering with C/EBP-Oct-1RE binding to the proximal promoter region.

ix) The presence of suppressor regions further upstream on the CYP2A6 promoter may have a role in mediating CYP2A6 downregulation.

Collectively, these results provide a mechanistic explanation for the earlier, descriptive observations where the CYP2A6 was found to be up-regulated by a multitude of seemingly unrelated toxic insults.

6. GENERAL CONCLUSIONS AND FUTURE DIRECTIONS

6.1 General conclusions

The findings presented in this thesis have helped to understand the underlying mechanisms by which the CYP2A6 gene is regulated during diverse toxic insults. The study demonstrated in particular that:

i) The bilirubin oxidase CYP2A6 gene is an immediate target of the stress activated transcription factor p53.

ii) The transcriptional activation of the CYP2A6 gene by p53 involves complex interaction with CAR, C/EBP/Oct-1 and HNF-4α.

CYP2A6 has been demonstrated to play an important role in maintaining intracellular BR homeostasis (Abu-Bakar et al., 2005; Abu-Bakar et al., 2012). Bilirubin is an efficient scavenger of reactive oxygen and nitrogen species at intracellular concentrations ranging from 0.01 to 20 µM (Liu et al., 2003; Jansen et al., 2010). However, at concentrations ≥ 20 µM, toxicity of BR overrides the beneficial effects, disrupting mitochondria membrane permeability amongst other things and promoting apoptosis (Rodrigues et al., 2002). Therefore, a system should be in place to efficiently maintain an optimal intracellular BR level.

When cells are under acute stress, the stress activated TFs have been found to induce the CYP2A6 gene. The gene product enzymatically metabolises BR to BV to curb BR cytotoxicity. Once cells suffer from depletion of intracellular BR, it can be efficiently reduced back by biliverdin reductase (BVR). This hypothesis is supported by the recent finding that in cells under stress, the induced CYP2A6 together with the HMOX1 producing BR are targeted to mitochondria to adjust the BR levels locally according to needs, probably to protect the organelle (Muhsain et al., 2015). On the other hand, it is known that when cells are under chronic stress, it leads them to trigger apoptosis pathway eventually. It is tempting to speculate that instead of upregulation of the CYP2A6, a downregulation may occur in these conditions to decrease the BR oxidation thereby rapidly accumulating intracellular BR

to its toxic levels. The elevated intracellular BR in turn can enhance apoptosis to remove the severely damaged cells. It is plausible that the CYP2A6 downregulation may be activated through the repressor element(s) present on CYP2A6 promoter. Could it be that under chronic oxidative stress, the repressor(s) is activated to mediate CYP2A6 downregulation? In addition, interplay among the stress activated TFs in regulation of CYP2A6 gene expression has been demonstrated, which may act as a sensitive control system to cope with different types of cellular stress. Such mechanisms of CYP2A6 gene regulation may form an essential part of the cell defense system against different levels of cellular stress either in strengthening cell antioxidant capacity or promoting apoptosis.

6.2 Future directions

Compared with several xenobiotic metabolising CYP enzymes, the unique way the CYP2A6 responds to cellular perturbations by various stressors has attracted researcher’s attention. Understanding the fundamental gene regulatory mechanisms of the CYP2A6 promoter is critical for explaining the observed upregulation in perturbed cells, which may also provide potential targets for studying diseases in relation to gene polymorphisms or in vitro bioassay developments.

In addition to the findings in this thesis, some questions remain to be answered; these include:

(a) How does Nrf-2 and p53 interact in regulating CYP2A6 and HMOX1expressions when cells are exposed to different levels of cellular perturbations?

(b) How does the potential suppressor(s) on the promoter region block CYP2A6 transactivation?

(c) Are the stress activated transcription factors binding to the CYP2A6 promoter acting in a coordinated way in regulating CYP2A6 gene during multiple forms of stresses?

(d) How is the CYP2A6 gene expression regulated in different organs or cell systems?

(e) When cells are under stress, and the p53 is attacking the mitochondria, are the CYP2A6 and HMOX1 still targeted into mitochondria?

(f) How is the CYP2A6 gene expression affected by the polymorphism of the regulatory regions on the CYP2A6 promoter?

(g) Could the CYP2A6 induction by multiple forms of stress be applied in an in vitro bioassay system to assess the biological response to toxic agents?

Addressing these questions would provide a systematic theoretical explanation for the previously observed CYP2A6 induction by various stress conditions, and would significantly improve our understanding of the cell defense system against cellular perturbations. In addition, as the CYP2A6 is a regulator of BR - and may play a dual role in either scavenging intracellular ROS or promoting apoptosis, understanding the fundamental mechanisms of CYP2A6 regulation may help identifying a target to maintain the intracellular BR concentration within a therapeutic range thereby exerting a role in reducing risk for some ROS related chronic diseases such as cardiovascular disease, neurodegenerative disorder and cancer. The characteristics of CYP2A6 induction by various toxic insults may also indicate a role of CYP2A6 as a delicate, intracellular stress sensor to assess the intracellular stress levels.

7. BIBLIOGRAPHY

Abass, K., Lamsa, V., Reponen, P., Kublbeck, J., Honkakoski, P., Mattila, S., Pelkonen, O., Hakkola, J., 2012. Characterization of human cytochrome P450 induction by pesticides. Toxicology 294, 17-26.

Abu-Bakar, A., Arthur, D.M., Aganovic, S., Ng, J.C., Lang, M.A., 2011. Inducible bilirubin oxidase: a novel function for the mouse cytochrome P450 2A5. Toxicology and applied pharmacology 257, 14-22.

Abu-Bakar, A., Arthur, D.M., Wikman, A.S., Rahnasto, M., Juvonen, R.O., Vepsalainen, J., Raunio, H., Ng, J.C., Lang, M.A., 2012. Metabolism of bilirubin by human cytochrome P450 2A6. Toxicology and applied pharmacology 261, 50-58.

Abu-Bakar, A., Hakkola, J., Juvonen, R., Rahnasto-Rilla, M., Raunio, H., Lang, M.A., 2013. Function and regulation of the Cyp2a5/CYP2A6 genes in response to toxic insults in the liver. Current drug metabolism 14, 137-150.

Abu-Bakar, A., Lamsa, V., Arpiainen, S., Moore, M.R., Lang, M.A., Hakkola, J., 2007. Regulation of CYP2A5 gene by the transcription factor nuclear factor (erythroid- derived 2)-like 2. Drug metabolism and disposition: the biological fate of chemicals 35, 787-794.

Abu-Bakar, A., Moore, M.R., Lang, M.A., 2005. Evidence for induced microsomal bilirubin degradation by cytochrome P450 2A5. Biochemical pharmacology 70, 1527-1535.

Abu-Bakar, A., Satarug, S., Marks, G.C., Lang, M.A., Moore, M.R., 2004. Acute cadmium chloride administration induces hepatic and renal CYP2A5 mRNA, protein and activity in the mouse: involvement of transcription factor NRF2. Toxicol Lett 148, 199-210.

Aitken, A.E., Lee, C.M., Morgan, E.T., 2008. Roles of nitric oxide in inflammatory downregulation of human cytochromes P450. Free radical biology & medicine 44, 1161-1168.

Akrodou, Y.M., 2015. CYP2A6 Polymorphisms May Strengthen Individualized Treatment for Nicotine Dependence. Scientifica 2015, 7.

Alam, J., Shibahara, S., Smith, A., 1989. Transcriptional activation of the heme oxygenase gene by heme and cadmium in mouse hepatoma cells. Journal of Biological Chemistry 264, 6371-6375.

Alam, J., Stewart, D., Touchard, C., Bionapally, S., Choi, A.M.K., Cook, J.L., 1999. Nrf2,a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene. Journal of Biological Chemistry 274, 26071-26078.

Ambros, V., 2004. The functions of animal microRNAs. Nature 431, 350-355.

Arpiainen, S., Lamsa, V., Pelkonen, O., Yim, S.H., Gonzalez, F.J., Hakkola, J., 2007. Aryl hydrocarbon receptor nuclear translocator and upstream stimulatory factor regulate Cytochrome P450 2a5 transcription through a common E-box site. Journal of molecular biology 369, 640-652.

Baird, L., Dinkova-Kostova, A.T., 2011. The cytoprotective role of the keap1-Nrf2 pathway. Arch Toxicol 84, 241-272.

Baird, W.M., Hooven, L.A., Mahadevan, B., 2005. Carcinogenic polycyclic aromatic hydrocarbon-DNA adducts and mechanism of action. Environmental and molecular mutagenesis 45, 106-114.

Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.

Bedard, K., Krause, K.H., 2007. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev 87, 245-313.

Benet, M., Lahoz, A., Guzman, C., Castell, J.V., Jover, R., 2010. CCAAT/enhancer-binding protein alpha (C/EBPalpha) and hepatocyte nuclear factor 4alpha (HNF4alpha) synergistically cooperate with constitutive androstane receptor to transactivate the human cytochrome P450 2B6 (CYP2B6) gene: application to the development of a metabolically competent human hepatic cell model. The Journal of biological chemistry 285, 28457-28471.

Bensaad, K., Vousden, K.H., 2005. Savior and slayer: the two faces of p53. Nat Med 11, 1278-1279.

Bensaad, K., Vousden, K.H., 2007. p53: new roles in metabolism. Trends in cell biology 17, 286-291.

Bhagwat, S.V., Mullick, J., Raza, H., Avadhani, N.G., 1999. Constitutive and inducible cytochromes P450 in rat lung mitochondria: xenobiotic induction, relative abundance, and catalytic properties. Toxicology and applied pharmacology 156, 231-240.

Biswal, S., Maxwell, T., Rangasamy, T., Kehrer, J.P., 2003. Modulation of benzo[a]pyrene- induced p53 DNA activity by acrolein. Carcinogenesis 24, 1401-1406.

Boland, B.S., Dong, M.H., Bettencourt, R., Barrett-Connor, E., Loomba, R., 2014. Association of serum bilirubin with aging and mortality. Journal of clinical and experimental hepatology 4, 1-7.

Bolton, J.L., Trush, M.A., Penning, T.M., Dryhurst, G., Monks, T.J., 2000. Role of quinones in toxicology. Chem Res Toxicol 13, 135-160.

Budanov, A.V., Sablina, A.A., Feinstein, E., Koonin, E.V., Chumakov, P.M., 2004. Regeneration of peroxiredoxins by p53-regulated sestrins, homologs of bacterial AhpD. Science 304, 596-600.

Burchiel, S.W., Thompson, T.A., Lauer, F.T., Oprea, T.I., 2007. Activation of dioxin response element (DRE)-associated genes by benzo[a]pyrene 3,6-quinone and benzo[a]pyrene 1,6-quinone in MCF-10A human mammary epithelal cells Toxicology and applied pharmacology 221, 203-214.

Burdick, A.D., Davis, J.W., 2nd, Liu, K.J., Hudson, L.G., Shi, H., Monske, M.L., Burchiel, S.W., 2003. Benzo(a)pyrene quinones increase cell proliferation, generate reactive oxygen species, and transactivate the epidermal growth factor receptor in breast epithelial cells. Cancer research 63, 7825-7833.

Burns, T.F., Fei, P., Scata, K.A., Dicker, D.T., El-Deiry, W.S., 2003. Silencing of the novel p53 target gene Snk/Plk2 leads to mitotic catastrophe in paclitaxel (taxol)-exposed cells. Molecular and cellular biology 23, 5556-5571.

Cantoni, L., Rossi, C., Rizzardini, M., Gadina, M., Ghezzi, P., 1991. Interleukin-1 and tumour necrosis factor induce hepatic haem oxygenase. Feedback regulation by glucocorticoids. Biochemical Journal . 279, 891-894.

Chen, W., Sun, Z., Wang, X.J., Jiang, T., Huang, Z., Fang, D., Zhang, D.D., 2009. Direct interaction between Nrf2 and p21(Cip1/WAF1) upregulates the Nrf2-mediated antioxidant response. Molecular cell 34, 663-673.

Cho, Y., Gorina, S., Jeffrey, P.D., Pavletich, N.P., 1994. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 265, 346- 355.

Christian, K., Lang, M., Maurel, P., Raffalli-Mathieu, F., 2004. Interaction of heterogeneous nuclear ribonucleoprotein A1 with cytochrome P450 2A6 mRNA: implications for post-transcriptional regulation of the CYP2A6 gene. Mol Pharmacol 65, 1405-1414.

Clewell, R.A., Sun, B., Adeleye, Y., Carmichael, P., Efremenko, A., McMullen, P.D., Pendse, S., Trask, O.J., White, A., Andersen, M.E., 2014. Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage. Toxicological Sciences 142, 56-73.

Cook, J.L., Re, R.N., Giardina, J.F., Fontenot, F.E., Cheng, D.Y., Alam, J., 1995. Distance constraints and stereospecific alignment requirements characteristic of p53 DNA- binding consensus sequence homologies. Oncogene 11, 723-733.

Culotta, V.C., 2001. Superoxide dismutase, oxidative stress, and cell metabolism. In Earl, R.S., Chock, P.B., (Eds.), Current Topics in Cellular Regulation. Academic Press, pp. 117-132.

Damgaard, C.K., Tange, T.O., Kjems, J., 2002. hnRNP A1 controls HIV-1 mRNA splicing through cooperative binding to intron and exon splicing silencers in the context of a conserved secondary structure. RNA (New York, N.Y.) 8, 1401-1415.

De-Oliveira, A.C., Da-Matta, A.C., Paumgartten, F.J., 2006. Plasmodium berghei (ANKA): infection induces CYP2A5 and 2E1 while depressing other CYP isoforms in the mouse liver. Exp Parasitol 113, 256-261.

Denisov, I.G., Makris, T.M., Sligar, S.G., Schlichting, I., 2005. Structure and chemistry of cytochrome P450. Chemical reviews 105, 2253-2277.

Di, Y.M., Chow, V.D.-W., Yang, L.-P., Zhou, S.-F., 2009. Structure, function, regulation and polymorphism of human cytochroem P450 2A6. Current drug metabolism 10, 754- 780.

Ding, X., Lichti, K., Kim, I., Gonzalez, F.J., Staudinger, J.L., 2006. Regulation of constitutive androstane receptor and its target genes by fasting, cAMP, hepatocyte nuclear factor alpha, and the coactivator peroxisome proliferator-activated receptor gamma coactivator-1alpha. The Journal of biological chemistry 281, 26540-26551.

Donato, M.T., Viitala, P., Rodriguez-Antona, C., Lindfors, A., Castell, J.V., Raunio, H., Gomez-Lechon, M.J., Pelkonen, O., 2000. Cyp2a5/2a6 expression in mouse and human hepatocytes treated with various in vivo inducers. Drug Metabolism and Disposition. 28, 1321-1326.

Drane, P., Bravard, A., Bouvard, V., May, E., 2001. Reciprocal down-regulation of p53 and SOD2 gene expression-implication in p53 mediated apoptosis. Oncogene 20, 430- 439. el-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., Vogelstein, B., 1992. Definition of a consensus binding site for p53. Nat Genet 1, 45-49.

Faraonio, R., Vergara, P., Di Marzo, D., Pierantoni, M.G., Napolitano, M., Russo, T., Cimino, F., 2006. p53 suppresses the Nrf2-dependent transcription of antioxidant response genes. The Journal of biological chemistry 281, 39776-39784.

Fernandez-Salguero, P., Gonzalez, F.J., 1995. The CYP2A gene subfamily: species differences, regulation, catalytic activities and role in chemical carcinogenesis. Pharmacogenetics 5 Spec No, S123-128.

Fisher, C.D., Lickteig, A.J., Augustine, L.M., Ranger-Moore, J., Jackson, J.P., Ferguson, S.S., Cherrington, N.J., 2009. Hepatic cytochrome P450 enzyme alterations in humans with progressive stages of nonalcoholic fatty liver disease. Drug metabolism and disposition: the biological fate of chemicals 37, 2087-2094.

Förstermann, U., Sessa, W.C., 2012. Nitric oxide synthases: regulation and function. European Heart Journal 33, 829-837.

Fujii-Kuriyama, Y., Mimura, J., 2005. Molecular mechanisms of AhR functions in the regulation of cytochrome P450 genes. Biochemical and biophysical research communications 338, 311-317.

Gambino, V., De Michele, G., Venezia, O., Migliaccio, P., Dall'Olio, V., Bernard, L., Minardi, S.P., Della Fazia, M.A., Bartoli, D., Servillo, G., Alcalay, M., Luzi, L., Giorgio, M., Scrable, H., Pelicci, P.G., Migliaccio, E., 2013. Oxidative stress activates a specific p53 transcriptional response that regulates cellular senescence and aging. Aging cell 12, 435-445.

Glisovic, T., Soderberg, M., Christian, K., Lang, M., Raffalli-Mathieu, F., 2003. Interplay between transcriptional and post-transcriptional regulation of Cyp2a5 expression. Biochemical pharmacology 65, 1653-1661.

Goldstein, I., Rivlin, N., Shoshana, O.Y., Ezra, O., Madar, S., Goldfinger, N., Rotter, V., 2013. Chemotherapeutic agents induce the expression and activity of their clearing enzyme CYP3A4 by activating p53. Carcinogenesis 34, 190-198.

Gomes, A.S., Gadelha, G.G., Lima, S.J., Garcia, J.A., Medeiros, J.V., Havt, A., Lima, A.A., Ribeiro, R.A., Brito, G.A., Cunha, F.Q., Souza, M.H., 2010. Gastroprotective effect of heme-oxygenase 1/biliverdin/CO pathway in ethanol-induced gastric damage in mice. European journal of pharmacology 642, 140-145.

Guil, S., Gattoni, R., Carrascal, M., Abian, J., Stevenin, J., Bach-Elias, M., 2003. Roles of hnRNP A1, SR proteins, and p68 helicase in c-H-ras alternative splicing regulation. Molecular and cellular biology 23, 2927-2941.

Gyamfi, M.A., Fujieda, M., Kiyotani, K., Yamazaki, H., Kamataki, T., 2005. High prevalence of cytochrome P450 2A6*1A alleles in a black African population of Ghana. European journal of clinical pharmacology 60, 855-857.

Haupt, Y., Maya, R., Kazaz, A., Oren, M., 1997. Mdm2 promotes the rapid degradation of p53. Nature 387, 296-299.

Hayes, J.D., McMahon, M., Chowdhry, S., Dinkova-Kostova, A.T., 2010. Cancer chemoprevention mechanisms mediated through the Keap1-Nrf2 pathway. Antioxid. Redox Signal. 13, 1713-1748.

He, X.Y., Shen, J., Hu, W.Y., Ding, X., Lu, A.Y., Hong, J.Y., 2004. Identification of Val117 and Arg372 as critical amino acid residues for the activity difference between human CYP2A6 and CYP2A13 in coumarin 7-hydroxylation. . Arch Biochem Biophys 427, 143-153.

Higashi, E., Fukami, T., Itoh, M., Kyo, S., Inoue, M., Yokoi, T., Nakajima, M., 2007. Human CYP2A6 is induced by estrogen via estrogen receptor. Drug metabolism and disposition: the biological fate of chemicals 35, 1935-1941.

Hinson, J.A., Reid, A.B., McCullough, S.S., James, L.P., 2004. Acetaminophen-induced hepatotoxicity: role of metabolic activation, reactive oxygen/nitrogen species, and mitochondrial permeability transition. Drug metabolism reviews 36, 805-822.

Hoffman, S.M., Nelson, D.R., Keeney, D.S., 2001. Organization, structure and evolution of the CYP2 gene cluster on human chromosome 19. Pharmacogenetics 11, 687-698.

Hong, F., Liu, X., Ward, S.S., Xiong, H., Cederbaum, A.I., Lu, Y., 2015. Absence of cytochrome P450 2A5 enhances alcohol-induced liver injury in mice. Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver 47, 470-477.

Hong, F., Si, C., Gao, P., Cederbaum, A.I., Xiong, H., Lu, Y., 2016. The role of CYP2A5 in liver injury and fibrosis: chemical-specific difference. Naunyn-Schmiedeberg's archives of pharmacology 389, 33-43.

Hou, Y., Xue, P., Bai, Y., Liu, D., Woods, C.G., Yarborough, K., Fu, J., Zhang, Q., Sun, G., Collins, S., Chan, J.Y., Yamamoto, M., Andersen, M.E., Pi, J., 2012. Nuclear factor erythroid-derived factor 2-related factor 2 regulates transcription of CCAAT/enhancer-binding protein beta during adipogenesis. Free radical biology & medicine 52, 462-472.

Hu, J., Sheng, L., Li, L., Zhou, X., Xie, F., D'Agostino, J., Li, Y., Ding, X., 2014. Essential role of the cytochrome P450 enzyme CYP2A5 in olfactory mucosal toxicity of naphthalene. Drug metabolism and disposition: the biological fate of chemicals 42, 23-27.

Huang, M.C., Chen, F.Y., Chou, M.T., Su, J.G., 2012. Fluoranthene enhances p53 expression and decreases mutagenesis induced by benzo[a]pyrene. Toxicol Lett 208, 214-224.

Hukkanen, J., Jacob, P., 3rd, Benowitz, N.L., 2005. Metabolism and disposition kinetics of nicotine. Pharmacological reviews 57, 79-115.

Ioannides, C., 2008. Cytochromes P450: role in the metabolism and toxicity of drugs and other xenobiotics. royal society of chemistry.

Itoh, M., Nakajima, M., Higashi, E., Yoshida, R., Nagata, K., Yamazoe, Y., Yokoi, T., 2006. Induction of human CYP2A6 is mediated by the pregnane X receptor with peroxisome proliferator-activated receptor-gamma coactivator 1alpha. The Journal of pharmacology and experimental therapeutics 319, 693-702.

Janmohamed, A., Dolphin, C.T., Phillips, I.R., Shephard, E.A., 2001. Quantification and cellular localization of expression in human skin of genes encoding flavin-containing monooxygenases and cytochromes P450. Biochemical pharmacology 62, 777-786.

Jansen, T., Hortmann, M., Oelze, M., Opitz, B., Steven, S., Schell, R., Knorr, M., Karbach, S., Schuhmacher, S., Wenzel, P., Münzel, T., Daiber, A., 2010. Conversion of biliverdin to bilirubin by biliverdin reductase contributes to endothelial cell protection by heme oxygenase-1-evidence for direct and indirect antioxidant actions of bilirubin. Journal of molecular and cellular cardiology 49, 186-195.

Jin, M., Kumar, A., Kumar, S., 2012. Ethanol-mediated regulation of cytochrome P450 2A6 expression in monocytes: role of oxidative stress-mediated PKC/MEK/Nrf2 pathway. PloS one 7, e35505.

Jin, S., Fan, F., Fan, W., Zhao, H., Tong, T., Blanck, P., Alomo, I., Rajasekaran, B., Zhan, Q., 2001. Transcription factors Oct-1 and NF-YA regulate the p53-independent induction of the GADD45 following DNA damage. Oncogene 20, 2683-2690.

Jordan, J.J., Menendez, D., Inga, A., Nourredine, M., Bell, D., Resnick, M.A., 2008. Noncanonical DNA Motifs as Transactivation Targets by Wild Type and Mutant p53. PLoS Genetics 4, e1000104.

Jorgensen, M.E., Torp-Pedersen, C., Finer, N., Caterson, I., James, W.P., Legler, U.F., Andersson, C., 2014. Association between serum bilirubin and cardiovascular disease in an overweight high risk population from the SCOUT trial. Nutrition, metabolism, and cardiovascular diseases : NMCD 24, 656-662.

Jung, C.H., Lee, M.J., Kang, Y.M., Hwang, J.Y., Jang, J.E., Leem, J., Park, J.Y., Kim, H.K., Lee, W.J., 2014. Higher serum bilirubin level as a protective factor for the development of diabetes in healthy Korean men: a 4 year retrospective longitudinal study. Metabolism: clinical and experimental 63, 87-93.

Kachaylo, E.M., Pustylnyak, V.O., Lyakhovich, V.V., Gulyaeva, L.F., 2011. Constitutive androstane receptor (CAR) is a xenosensor and target for therapy. Biochemistry. Biokhimiia 76, 1087-1097.

Kansanen, E., Kuosmanen, S.M., Leinonen, H., Levonen, A.L., 2013. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox biology 1, 45- 49.

Kehrer, J.P., 2000. The Haber-Weiss reaction and mechanisms of toxicity. Toxicology 149, 43-50.

Keyse, S.M., Tyrrell, R.M., 1989. Haem oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite. Proceedings of the National Academy of Sciences of the United States of America 86, 99-103.

Kim, D., Wu, Z.L., Guengerich, F.P., 2005. Analysis of coumarin 7-hydroxylation activity of cytochrome P450 2A6 using random mutagenesis. . The Journal of biological chemistry 280, 40319-40327.

Kim, S.D., Antenos, M., Squires, E.J., Kirby, G.M., 2013. Cytochrome P450 2A5 and bilirubin: Mechanisms of gene regulation and cytoprotection. Toxicology and applied pharmacology 270, 129-138.

Kim, S.Y., Park, S.C., 2012. Physiological Antioxidative Network of the Bilirubin System in Aging and Age-Related Diseases. Frontiers in pharmacology 3, 45.

Kirby, G.M., Batist, G., Alpert, L., Lamoureux, E., Cameron, R.G., Alaoui-Jamali, M.A., 1996. Overexpression of cytochrome P-450 isoforms involved in aflatoxin B1 bioactivation in human liver with cirrhosis and hepatitis. Toxicologic pathology 24, 458-467.

Kirby, G.M., Chemin, I., Montesano, R., Chisari, F.V., Lang, M.A., Wild, C.P., 1994. Induction of specific cytochrome P450 involved in aflatoxin B1 metabolism in hepatitis B virus transgenic mice. Molecular carcinogenesis 11, 74-80.

Kirby, G.M., Nichols, K.D., Antenos, M., 2011. CYP2A5 induction and hepatocellular stress: An adaptive response to perturbation of heme homeostasis. Current drug metabolism 12, 186-197.

Kirby, G.M., Wolf, C.R., Neal, G.E., Judah, D.J., Henderson, C.J., Srivatanakul, P., Wild, C.P., 1993. In vitro metabolism of aflatoxin B1 by normal and tumorous liver tissue from Thailand. Carcinogenesis 14, 2613-2620.

Kliewer, S.A., Goodwin, B., Willson, T.M., 2002. The nuclear pregnane X receptor: a key regulator of xenobiotic metabolism. Endocr Rev 23, 687-702.

Kliewer, S.A., Moore, J.T., Wade, L., Staudinger, J.L., Watson, M.A., Jones, S.A., McKee, D.D., Oliver, B.B., Willson, T.M., Zetterstrom, R.H., Perlmann, T., Lehmann, J.M., 1998. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 92, 73-82.

Koskela, S., Hakkola, J., Hukkanen, J., Pelkonen, O., Sorri, M., Saranen, A., Anttila, S., Fernandez-Salguero, P., Gonzalez, F., Raunio, H., 1999. Expression of CYP2A genes in human liver and extrahepatic tissue. Biochemical pharmacology 57, 1407-1413.

Koutsodontis, G., Vasilaki, E., Chou, W.C., Papakosta, P., Kardassis, D., 2005. Physical and functional interactions between members of the tumour suppressor p53 and the Sp families of transcription factors: importance for the regulation of genes involved in cell-cycle arrest and apoptosis. The Biochemical journal 389, 443-455.

Krecic, A.M., Swanson, M.S., 1999. hnRNP complexes: composition, structure, and function. Current opinion in cell biology 11, 363-371.

Lambert, A.J., Brand, M.D., 2004. Superoxide production by NADH:ubiquinone oxidoreductase (complex I) depends on the pH gradient across the mitochondrial inner membrane. The Biochemical journal 382, 511-517.

Lamsa, V., Levonen, A.L., Leinonen, H., Yla-Herttuala, S., Yamamoto, M., Hakkola, J., 2010. Cytochrome P450 2A5 constitutive expression and induction by heavy metals is dependent on redox-sensitive transcription factor Nrf2 in liver. Chem Res Toxicol 23, 977-985.

Lamsa, V., Levonen, A.L., Sormunen, R., Yamamoto, M., Hakkola, J., 2012. Heme and heme biosynthesis intermediates induce Heme oxygenase-1 and Cytochrome P450 2A5, enzymes with putative sequential roles in heme and bilirubin metabolism: Different requirement for transcription factor Nuclear factor erythroid-derived 2-like 2. Toxicological sciences : an official journal of the Society of Toxicology, aheadofprint.

Lau, J.S., Baumeister, P., Kim, E., Roy, B., Hsieh, T.Y., Lai, M., Lee, A.S., 2000. Heterogeneous nuclear ribonucleoproteins as regulators of gene expression through interactions with the human thymidine kinase promoter. Journal of cellular biochemistry 79, 395-406.

Lee, S.H., Lee, S.E., Ahn, H.-J., Park, C.-S., Cho, J.-J., Park, Y.S., 2009. Identification of atherosclerosis related gene expression profiles by treatment of benzo (a) pyrene in human umbilical vein endothelial cells. Mol Cell Toxicol 5, 113-119.

Lehmann, J.M., McKee, D.D., Watson, M.A., Willson, T.M., Moore, J.T., Kliewer, S.A., 1998. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. The Journal of clinical investigation 102, 1016-1023.

Li, Y., Bevilacqua, E., Chiribau, C.B., Majumder, M., Wang, C., Croniger, C.M., Snider, M.D., Johnson, P.F., Hatzoglou, M., 2008. Differential control of the CCAAT/enhancer-binding protein beta (C/EBPbeta) products liver-enriched transcriptional activating protein (LAP) and liver-enriched transcriptional inhibitory protein (LIP) and the regulation of gene expression during the response to endoplasmic reticulum stress. The Journal of biological chemistry 283, 22443-22456.

Ling, G., Gu, J., Genter, M.B., Zhuo, X., Ding, X., 2004. Regulation of cytochrome P450 gene expression in the olfactory mucosa. Chemico-biological interactions 147, 247- 258.

Liu, G., Chen, X., 2006. Regulation of the p53 transcriptional activity. Journal of cellular biochemistry 97, 448-458.

Liu, Y., Zhu, B., Wang, X., Luo, L., Li, P., Paty, D.W., Cynader, M.S., 2003. Bilirubin as a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications for the role of oxidative stress in the development of multiple sclerosis. Journal of neuroimmunology 139, 27-35.

Liu, Z., Lu, H., Shi, H., Du, Y., Yu, J., Gu, S., Chen, X., Liu, K.J., Hu, C.A., 2005. PUMA overexpression induces reactive oxygen species generation and proteasome-mediated stathmin degradation in colorectal cancer cells. Cancer research 65, 1647-1654.

Lohr, J.W., Willsky, G.R., Acara, M.A., 1998. Renal drug metabolism. Pharmacological reviews 50, 107-142.

Lu, H., Levine, A.J., 1995. Human TAFII31 protein is a transcriptional coactivator of the p53 protein. Proc Natl Acad Sci U S A 92, 5154-5158.

Ma, Q., 2013. Role of nrf2 in oxidative stress and toxicity. Annual review of pharmacology and toxicology 53, 401-426.

Macip, S., Igarashi, M., Berggren, P., Yu, J., Lee, S.W., Aaronson, S.A., 2003. Influence of induced reactive oxygen species in p53-mediated cell fate decisions. Molecular and cellular biology 23, 8576-8585.

Maeda, Y., Hwang-Verslues, Wendy W., Wei, G., Fukazawa, T., Durbin, Mary L., Owen, Laurie B., Liu, X., Sladek, Frances M., 2006. Tumour suppressor p53 down-regulates the expression of the human hepatocyte nuclear factor 4α (HNF4α) gene. Biochemical Journal 400, 303-313.

Maines, M.D., 2005. The heme oxygenase system: update 2005. Antioxidants & redox signaling 7, 1761-1766.

McMahon, M., Itoh, K., Yamamoto, M., Chanas, S.A., Henderson, C.J., 2001. The cap 'n' collar basic leucine zipper transcription factor Nrf2 (NF-E2 p45-related factor 2) controls both constitutive and inducible expression of intestinal detoxification and glutathione biosynthetic enzymes. Cancer Research . 61, 3299-3307.

Meek, D.W., 2004. The p53 response to DNA damage. DNA repair 3, 1049-1056.

Meek, D.W., 2015. Regulation of the p53 response and its relationship to cancer. The Biochemical journal 469, 325-346.

Meir, O., Dvash, E., Werman, A., Rubinstein, M., 2010. C/EBP-beta regulates endoplasmic reticulum stress-triggered cell death in mouse and human models. PloS one 5, e9516.

Meunier, B., de Visser, S.P., Shaik, S., 2004. Mechanism of oxidation reactions catalyzed by cytochrome p450 enzymes. Chemical reviews 104, 3947-3980.

Miao, J., Fang, S., Bae, Y., Kemper, J.K., 2006. Functional inhibitory cross-talk between constitutive androstane receptor and hepatic nuclear factor-4 in hepatic lipid/glucose metabolism is mediated by competition for binding to the DR1 motif and to the common coactivators, GRIP-1 and PGC-1alpha. The Journal of biological chemistry 281, 14537-14546.

Miyazaki, M., Yamazaki, H., Takeuchi, H., Saoo, K., Yokohira, M., Masumura, K., Nohmi, T., Funae, Y., Imaida, K., Kamataki, T., 2005. Mechanisms of chemopreventive effects of 8-methoxypsoralen against 4-(methylnitrosamino)-1-(3-pyridyl)-1- butanone-induced mouse lung adenomas. Carcinogenesis 26, 1947-1955.

Miyoshi, T., Yamashita, K., Arai, T., Yamamoto, K., Mizugishi, K., Uchiyama, T., 2010. The role of endothelial interleukin-8/NADPH oxidase 1 axis in sepsis. Immunology 131, 331-339.

Mohri, T., Nakajima, M., Fukami, T., Takamiya, M., Aoki, Y., Yokoi, T., 2010. Human CYP2E1 is regulated by miR-378. Biochemical pharmacology 79, 1045-1052.

Moi, P., Chan, K., Asunis, I., Cao, A., Khan, Y.W., 1994. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proceedings of the National Academy of Sciences of the United States of America 91, 9926-9930.

Molnar, V., Tamasi, V., Bakos, B., Wiener, Z., Falus, A., 2008. Changes in miRNA expression in solid tumors: an miRNA profiling in melanomas. Seminars in cancer biology 18, 111-122.

Morel, Y., Barouki, R., 1998. Down-regulation of cytochrome P450 1A1 gene promoter by oxidative stress. Critical contribution of nuclear factor 1. The Journal of biological chemistry 273, 26969-26976.

Morel, Y., de Waziers, I., Barouki, R., 2000. A repressive cross-regulation between catalytic and promoter activities of the CYP1A1 and CYP2E1 genes: role of H(2)O(2). Mol Pharmacol 57, 1158-1164.

Morgan, E.T., 1997. Regulation of cytochromes P450 during inflammation and infection. Drug Metabolism Reviews 29, 1129-1188.

Muhsain, S.N.F., Lang, M.A., Abu-Bakar, A.e., 2015. Mitochondrial targeting of bilirubin regulatory enzymes: An adaptive response to oxidative stress. Toxicology and applied pharmacology 282, 77-89.

Mukudai, Y., Kondo, S., Shiogama, S., Koyama, T., Li, C., Yazawa, K., Shintani, S., 2013. Root bark extracts of Juncus effusus and Paeonia suffruticosa protect salivary gland acinar cells from apoptotic cell death induced by cis-platinum (II) diammine dichloride. Oncology reports 30, 2665-2671.

Nakajima, M., Itoh, M., Sakai, H., Fukami, T., Katoh, M., Yamazaki, H., Kadlubar, F.F., Imaoka, S., Funae, Y., Yokoi, T., 2006. CYP2A13 expressed in human bladder metabolically activates 4-aminobiphenyl. International journal of cancer. Journal international du cancer 119, 2520-2526.

Nakano, M., Fukushima, Y., Yokota, S., Fukami, T., Takamiya, M., Aoki, Y., Yokoi, T., Nakajima, M., 2015. CYP2A7 pseudogene transcript affects CYP2A6 expression in human liver by acting as a decoy for miR-126. Drug metabolism and disposition: the biological fate of chemicals 43, 703-712.

Nebert, D.W., Adesnik, M., Coon, M.J., Estabrook, R.W., Gonzalez, F.J., Guengerich, F.P., Gunsalus, I.C., Johnson, E.F., Kemper, B., Levin, W., et al., 1987. The P450 gene superfamily: recommended nomenclature. DNA (Mary Ann Liebert, Inc.) 6, 1-11.

Nebert, D.W., Dalton, T.P., 2006. The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nature reviews. Cancer 6, 947-960.

Nebert, D.W., Eisen, H.J., Hankinson, O., 1984. The Ah receptor: binding specificity only for foreign chemicals? Biochemical pharmacology 33, 917-924.

Nebert, D.W., Wikvall, K., Miller, W.L., 2013. Human cytochromes P450 in health and disease. Philosophical Transactions of the Royal Society B-Biological Sciences 368.

Neilsen, P.M., Cheney, K.M., Li, C.W., Chen, J.D., Cawrse, J.E., Schulz, R.B., Powell, J.A., Kumar, R., Callen, D.F., 2008. Identification of ANKRD11 as a p53 coactivator. Journal of cell science 121, 3541-3552.

Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C., Nebert, D.W., 1996. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1-42.

Nguyen, P.M., Park, M.S., Chow, M., Chang, J.H., Wrischnik, L., Chan, W.K., 2010. Benzo[a]pyrene increases the Nrf2 content by downregulating the Keap1 message. Toxicological sciences : an official journal of the Society of Toxicology 116, 549- 561.

Niemela, O., Parkkila, S., Juvonen, R.O., Viitala, K., Gelboin, H.V., Pasanen, M., 2000. Cytochromes P450 2A6, 2E1, and 3A and production of protein-aldehyde adducts in the liver of patients with alcoholic and non-alcoholic liver diseases. J Hepatol 33, 893-901.

Olivier, M., Hollstein, M., Hainaut, P., 2010. TP53 mutations in human cancers: origins, consequences, and clinical use. Cold Spring Harbor perspectives in biology 2, a001008.

Ollinger, R., Kogler, P., Troppmair, J., Hermann, M., Wurm, M., Drasche, A., Konigsrainer, I., Amberger, A., Weiss, H., Ofner, D., Bach, F.H., Margreiter, R., 2007. Bilirubin inhibits tumor cell growth via activation of ERK. Cell cycle (Georgetown, Tex.) 6, 3078-3085.

Osabe, M., Sugatani, J., Takemura, A., Kurosawa, M., Yamazaki, Y., Ikari, A., Miwa, M., 2009. Up-regulation of CAR expression through Elk-1 in HepG2 and SW480 cells by serum starvation stress. FEBS letters 583, 885-889.

Osada, M., Park, H.L., Nagakawa, Y., Yamashita, K., Fomenkov, A., Kim, M.S., Wu, G., Nomoto, S., Trink, B., Sidransky, D., 2005. Differential recognition of response elements determines target gene specificity for p53 and p63. Molecular and cellular biology 25, 6077-6089.

Otyepka, M., Skopalík, J., Anzenbacherová, E., Anzenbacher, P., 2007. What common structural features and variations of mammalian P450s are known to date? Biochimica et biophysica acta 1770, 376-389.

Oyama, T., Isse, T., Murakami, T., Suzuki-Narai, R., Ogawa, M., Yamaguchi, T., Kinaga, T., Yashima, Y., Ozaki, S., Kim, Y.D., Kim, H., Kawamoto, T., 2006. Evidence-based prevention (EBP): A review of cytochrome P450 expression in the bronchial epithelium and new approach to lung cancer prevention. Environmental health and preventive medicine 11, 97-101.

Pan, Y.Z., Gao, W., Yu, A.M., 2009. MicroRNAs regulate CYP3A4 expression via direct and indirect targeting. Drug metabolism and disposition: the biological fate of chemicals 37, 2112-2117.

Pandhare, J., Cooper, S.K., Phang, J.M., 2006. Proline oxidase, a proapoptotic gene, is induced by troglitazone: evidence for both peroxisome proliferator-activated receptor gamma-dependent and -independent mechanisms. The Journal of biological chemistry 281, 2044-2052.

Peamkrasatam, S., Sriwatanakul, K., Kiyotani, K., Fujieda, M., Yamazaki, H., Kamataki, T., Yoovathaworn, K., 2006. In vivo evaluation of coumarin and nicotine as probe drugs

100

to predict the metabolic capacity of CYP2A6 due to genetic polymorphism in Thais. Drug metabolism and pharmacokinetics 21, 475-484.

Pei, X.H., Nakanishi, Y., Takayama, K., Bai, F., Hara, N., 1999. Benzo[a]pyrene activates the human p53 gene through induction of nuclear factor kappaB activity. The Journal of biological chemistry 274, 35240-35246.

Pelkonen, O., Rautio, A., Raunio, H., Pasanen, M., 2000. CYP2A6: a human coumarin 7- hydroxylase. Toxicology 144, 139-147.

Pelkonen, P., Lang, M.A., Negishi, M., Wild, C.P., Juvonen, R.O., 1997. Interaction of aflatoxin B1 with cytochorme P450 2A5 and its mutants: correaltion with metabolic activation and toxicity. Chem. Res. Toxicol. 10, 85-90.

Pelkonen, P., Lang, M.A., Wild, C.P., Negishi, M., Juvonen, R.O., 1994. Activation of aflatoxin B1 by mouse CYP2A enzymes and cytotoxicity in recombinant yeast cells. European journal of pharmacology 292, 67-73.

Pitarque, M., Rodriguez-Antona, C., Oscarson, M., Ingelman-Sundberg, M., 2005. Transcriptional regulation of the human CYP2A6 gene. The Journal of pharmacology and experimental therapeutics 313, 814-822.

Polyak, K., Xia, Y., Zweier, J.L., Kinzler, K.W., Vogelstein, B., 1997. A model for p53- induced apoptosis. Nature 389, 300-305.

Promega, 2015. pGL4.38[luc2P/p53 RE/Hygro] Vector Product Information. Promega Corporation, Madison, WI, USA, pp.

Raffalli-Mathieu, F., Glisovic, T., Ben-David, Y., Lang, M.A., 2002. Heterogeneous nuclear ribonucleoprotein A1 and regulation of the xenobiotic-inducible gene Cyp2a5. Mol Pharmacol 61, 795-799.

Rao, P., Suzuki, R., Mizobuchi, S., Yamaguchi, T., Sasaguri, S., 2006. Bilirubin exhibits a novel anti-cancer effect on human adenocarcinoma. Biochemical and biophysical research communications 342, 1279-1283.

Raunio, H., Hakkola, J., Pelkonen, O., 2008. Role in Metabolism and Toxicity of Drugs and Other Xenobiotics. In Ioannides, C., (Ed.), Cytochrome P450 The Royal Society of Chemistry, Cambridge, pp. 151-171.

Raunio, H., Juvonen, R., Pasanen, M., Pelkonen, O., Paakko, P., Soini, Y., 1998. Cytochrome P4502A6 (CYP2A6) expression in human hepatocellular carcinoma. Hepatology (Baltimore, Md.) 27, 427-432.

Ray, P.D., Huang, B.W., Tsuji, Y., 2012. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cellular signalling 24, 981-990.

Ricciotti, E., FitzGerald, G.A., 2011. Prostaglandins and Inflammation. Arteriosclerosis, thrombosis, and vascular biology 31, 986-1000.

101

Riley, T., Sontag, E., Chen, P., Levine, A., 2008. Transcriptional control of human p53- regulated genes. Nat Rev Mol Cell Biol 9, 402-412.

Rivera, A., Maxwell, S.A., 2005. The p53-induced gene-6 (proline oxidase) mediates apoptosis through a calcineurin-dependent pathway. The Journal of biological chemistry 280, 29346-29354.

Rizzardini, M., Carelli, M., Cabello Porras, M.R., Cantoni, L., 1994. Mechanisms of endotoxin-induced haem oxygenase mRNA accumulation in mouse liver: synergism by glutathione depletion and protection by N-acetylcysteine. Biochemical Journal 304, 477-483.

Rodrigues, C.M., Sola, S., Brito, M.A., Brites, D., Moura, J.J., 2002. Bilirubin directly disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat mitochondria. J Hepatol 36, 335-341.

Rodriguez-Antona, C., Donato, M.T., Boobis, A., Edwards, R.J., Watts, P.S., Castell, J.V., Gomez-Lechon, M.J., 2002. Cytochrome P450 expression in human hepatocytes and hepatoma cell lines: molecular mechanisms that determine lower expression in cultured cells. Xenobiotica; the fate of foreign compounds in biological systems 32, 505-520.

Saha, T., Kar, R.K., Sa, G., 2015. Structural and sequential context of p53: A review of experimental and theoretical evidence. Progress in biophysics and molecular biology 117, 250-263.

Satarug, S., Lang, M.A., Yongvanit, P., Sithithaworn, P., Mairiang, E., Mairiang, P., Pelkonen, P., Bartsch, H., Haswell-Elkins, M.R., 1996. Induction of cytochrome P450 2A6 expression in humans by the carcinogenic parasite infection, opisthorchiasis viverrini. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 5, 795-800.

Schrem, H., Klempnauer, J., Borlak, J., 2002. Liver-enriched transcription factors in liver function and development. Part I: the hepatocyte nuclear factor network and liver- specific gene expression. Pharmacological reviews 54, 129-158.

Scolnick, D.M., Chehab, N.H., Stavridi, E.S., Lien, M.C., Caruso, L., Moran, E., Berger, S.L., Halazonetis, T.D., 1997. CREB-binding protein and p300/CBP-associated factor are transcriptional coactivators of the p53 tumor suppressor protein. Cancer research 57, 3693-3696.

Serpi, R., Vähäkangas, K., 2003. Benzo(a)pyrene-Induced Changes in p53 and Related Proteins in Mouse Skin. Pharmacology & Toxicology 92, 242-245.

Shimada, T., Guengerich, F.P., 2006. Inhibition of human cytochrome P450 1A1-, 1A2-, and 1B1-mediated activation of procarcinogens to genotoxic metabolites by polycyclic aromatic hydrocarbons. Chem Res Toxicol 19, 288-294.

102

Spink, D.C., Katz, B.H., Hussain, M.M., Spink, B.C., Wu, S.J., Liu, N., Pause, R., Kaminsky, L.S., 2002. Induction of CYP1A1 and CYP1B1 in T-47D human breast cancer cells by benzo [a] pyrene is diminished by arsenite. Drug metabolism and disposition 30, 262-269.

Su, T., He, W., Gu, J., Lipinskas, T.W., Ding, X., 1998. Differential xenobiotic induction of CYP2A5 in mouse liver, kidney, lung, and olfactory mucosa. Drug metabolism and disposition: the biological fate of chemicals 26, 822-824.

Su, T., Sheng, J.J., Lipinskas, T.W., Ding, X., 1996. Expression of CYP2A genes in rodent and human nasal mucosa. Drug Metabolism and Disposition. 24, 884-890.

Takagi, S., Nakajima, M., Mohri, T., Yokoi, T., 2008. Post-transcriptional regulation of human pregnane X receptor by micro-RNA affects the expression of cytochrome P450 3A4. The Journal of biological chemistry 283, 9674-9680.

Tan, M., Li, S., Swaroop, M., Guan, K., Oberley, L.W., Sun, Y., 1999. Transcriptional activation of the human glutathione peroxidase promoter by p53. The Journal of biological chemistry 274, 12061-12066.

Thornborrow, E.C., Manfredi, J.J., 2001. The tumor suppressor protein p53 requires a cofactor to activate transcriptionally the human BAX promoter. The Journal of biological chemistry 276, 15598-15608.

Tian, W.N., Braunstein, L.D., Apse, K., Pang, J., Rose, M., Tian, X., Stanton, R.C., 1999. Importance of glucose-6-phosphate dehydrogenase activity in cell death. The American journal of physiology 276, C1121-1131.

Timsit, Y.E., Negishi, M., 2007. CAR and PXR: The Xenobiotic-Sensing Receptors. Steroids 72, 231-246.

Tsuchiya, Y., Nakajima, M., Takagi, S., Taniya, T., Yokoi, T., 2006. MicroRNA regulates the expression of human cytochrome P450 1B1. Cancer research 66, 9090-9098.

Tsuji, G., Takahara, M., Uchi, H., Takeuchi, S., Mitoma, C., Moroi, Y., Furue, M., 2011. An environmental contaminant, benzo(a)pyrene, induces oxidative stress-mediated interleukin-8 production in human keratinocytes via the aryl hydrocarbon receptor signaling pathway. Journal of dermatological science 62, 42-49. van der Houven van Oordt, W., Diaz-Meco, M.T., Lozano, J., Krainer, A.R., Moscat, J., Caceres, J.F., 2000. The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. The Journal of cell biology 149, 307-316.

Vitek, L., Jirsa, M., Brodanova, M., Kalab, M., Marecek, Z., Danzig, V., Novotny, L., Kotal, P., 2002. Gilbert syndrome and ischemic heart disease: a protective effect of elevated bilirubin levels. Atherosclerosis 160, 449-456.

Wakabayashi, N., Slocum, S.L., Skoko, J.J., Shin, S., Kensler, T.W., 2010. When NRF2 talks, who's listening? Antioxidants & redox signaling 13, 1649-1663.

103

Wang, H.J., Lee, E.Y., Han, S.J., Kim, S.H., Lee, B.W., Ahn, C.W., Cha, B.S., Lee, H.C., 2012. Dual pathways of p53 mediated glucolipotoxicity-induced apoptosis of rat cardiomyoblast cell: activation of p53 proapoptosis and inhibition of Nrf2-NQO1 antiapoptosis. Metabolism: clinical and experimental 61, 496-503.

Wei, C.L., Wu, Q., Vega, V.B., Chiu, K.P., Ng, P., Zhang, T., Shahab, A., Yong, H.C., Fu, Y., Weng, Z., Liu, J., Zhao, X.D., Chew, J.L., Lee, Y.L., Kuznetsov, V.A., Sung, W.K., Miller, L.D., Lim, B., Liu, E.T., Yu, Q., Ng, H.H., Ruan, Y., 2006. A global map of p53 transcription-factor binding sites in the human genome. Cell 124, 207- 219.

Wei, Y., Li, L., Zhou, X., Zhang, Q.Y., Dunbar, A., Liu, F., Kluetzman, K., Yang, W., Ding, X., 2013. Generation and characterization of a novel Cyp2a(4/5)bgs-null mouse model. Drug metabolism and disposition: the biological fate of chemicals 41, 132- 140.

Weinberg, R.L., Veprintsev, D.B., Fersht, A.R., 2004. Cooperative binding of tetrameric p53 to DNA. Journal of molecular biology 341, 1145-1159.

Wohak, L.E., Krais, A.M., Kucab, J.E., Stertmann, J., Ovrebo, S., Seidel, A., Phillips, D.H., Arlt, V.M., 2014. Carcinogenic polycyclic aromatic hydrocarbons induce CYP1A1 in human cells via a p53-dependent mechanism. Archives of toxicology.

Wu, G.D., Lai, E.J., Huang, N., Wen, X., 1997. Oct-1 and CCAAT/enhancer-binding protein (C/EBP) bind to overlapping elements within the interleukin-8 promoter. The role of Oct-1 as a transcriptional repressor. The Journal of biological chemistry 272, 2396- 2403.

Xie, F., Zhou, X., Genter, M.B., Behr, M., Gu, J., Ding, X., 2011. The tissue-specific toxicity of methimazole in the mouse olfactory mucosa is partly mediated through target- tissue metabolic activation by CYP2A5. Drug metabolism and disposition: the biological fate of chemicals 39, 947-951.

Xu, Y., 2003. Regulation of p53 responses by post-translational modifications. Cell death and differentiation 10, 400-403.

Yano, J.K., Denton, T.T., Cerny, M.A., Zhang, X., Johnson, E.F., Cashman, J.R., 2006. Synthetic inhibitors of cytochrome P-450 2A6: inhibitory activity, difference spectra, mechanism of inhibition, and protein cocrystallization. Journal of medicinal chemistry 49, 6987-7001.

Yano, J.K., Hsu, M.H., Griffin, K.J., Stout, C.D., Johnson, E.F., 2005. Structures of human microsomal cytochrome P450 2A6 complexed with coumarin and methoxsalen. Nat Struct Mol Biol 12, 822-823.

Yeligar, S.M., Machida, K., Kalra, V.K., 2010. Ethanol-induced HO-1 and NQO1 are differentially regulated by HIF-1alpha and Nrf2 to attenuate inflammatory cytokine expression. The Journal of biological chemistry 285, 35359-35373.

104

Yokota, S., Higashi, E., Fukami, T., Yokoi, T., Nakajima, M., 2011. Human CYP2A6 is regulated by nuclear factor-erythroid 2 related factor 2. Biochemical pharmacology 81, 289-294.

You, A., Nam, C.W., Wakabayashi, N., Yamamoto, M., Kensler, T.W., Kwak, M.K., 2011. Transcription factor Nrf2 maintains the basal expression of Mdm2: An implication of the regulation of p53 signaling by Nrf2. Archives of biochemistry and biophysics 507, 356-364.

Zangar, R.C., Davydov, D.R., Verma, S. , 2004. Mechanisms that regulate production of reactive oxygen species by cytochrome P450. Toxicology and Applied Pharmacology . 199, 316-331.

Zhao, H., Jin, S., Fan, F., Fan, W., Tong, T., Zhan, Q., 2000. Activation of the Transcription Factor Oct-1 in Response to DNA Damage. Cancer research 60, 6276-6280.

Zhou, X., D'Agostino, J., Xie, F., Ding, X., 2012. Role of CYP2A5 in the bioactivation of the lung carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in mice. The Journal of pharmacology and experimental therapeutics 341, 233-241.

Zhou, X., Wei, Y., Xie, F., Laukaitis, C.M., Karn, R.C., Kluetzman, K., Gu, J., Zhang, Q.Y., Roberts, D.W., Ding, X., 2011. A novel defensive mechanism against acetaminophen toxicity in the mouse lateral nasal gland: role of CYP2A5-mediated regulation of testosterone homeostasis and salivary androgen-binding protein expression. Mol Pharmacol 79, 710-723.

Zhou, X., Zhuo, X., Xie, F., Kluetzman, K., Shu, Y.Z., Humphreys, W.G., Ding, X., 2010. Role of CYP2A5 in the clearance of nicotine and cotinine: insights from studies on a Cyp2a5-null mouse model. The Journal of pharmacology and experimental therapeutics 332, 578-587.

Zhu, H., Li, Y., Trush, M.A., 1995. Characterization of benzo[a]pyrene quinone-induced toxicity to primary cultured bone marrow stromal cells from DBA/2 mice: potential role of mitochondrial dysfunction. Toxicology and applied pharmacology 130, 108- 120.

105

8. APPENDICES

Appendix A: List of materials and instruments

Chemicals/ reagents Manufacturers/ supplier Benzo[α]pyrene (BaP), DMSO, Methanol, Sigma-Aldrich, Sydney, Australia Ethanol, 2-propanol, Chloroform, PBS, phenylmethylsulfonyl fluoride (PMSF), MgCl2, KCl, KOH, NaCl, HCl, H2PO4, NaOH, Hepes, EDTA, IGEPAL, glacial acetic acid (CH3COOH), sodium dodecyl sulfate (SDS), cyclohexanediamine tetraacetic acid (CDTA), saline sodium citrate (SSC), Triton X-100, 2-mercaptoethanol, sucrose, glycerol, glycine, leupeptin, bovine serum albumin (BSA), p-coumaric acid, luminol, ampicillin, kanamycin, biological agar, Tween-20, RIPA buffer, RNAse and DNAse free water

William’s Medium E, Fetal Bovine Serum Life Technologies, Vic, Australia (FBS), Glutamax, Penicillin-Streptomycin, Dulbecco's Modified Eagle Medium (DMEM), TrypleTM, Trizol Reagent

Boric acid Merck, Germany

Dithiothreitol (DTT), Applichem, Germany

Ethidium bromide, laemmli buffer, western C Bio-Rad Laboratories Pty. marker, iQTM SYBR® Green Supermix Ltd.,Sydney Australia

BactoTM yeast extract, BactoTM Tryptone Becton Dickison, Australia

O’ Gene RulerTM 50bp DNA ladder, O’ Gene Thermo Fisher Scientific Inc. Melbourne, RulerTM 1kb DNA ladder, 6x loading dye Victoria, Australia solution, Trizol Reagent

Polyethylenimine (PEI) Polysciences Inc., PA, USA

Agarose PROGEN Biosciences Ltd, Brisbane, Australia

Restriction enzymes Manufacturers/ supplier Fast digest KpnI, Fast digest NheI, Fast Thermo Fisher Scientific Inc. Melbourne,

106 digest BamHI, Fast digest ApaI, Fast digest Victoria, Australia EcoRI, Fast digest BsmBI

Cell lines Supplier Human hepatocellular carcinoma HepG2 cell ATCC, Manassas, VA, USA

Human hepatocellular carcinoma C3A cell

Human breast adenocarcinoma MCF-7 cell Kind gift from Dr Greg Monteith, Pharmacy Australia Centre of Excellence, University of Queensland

XL-1 blue competent cell Agilent technologies Inc., CA, USA

Antibodies /cell lysates Manufacturers/ supplier Mouse monoclonal anti-p53 antibody Santa Cruz Biotechnology Inc. Dallas, Texas, USA Mouse monoclonal anti-C/EBPα antibody

Mouse monoclonal anti-Oct-1 antibody

Rabbit polyclonal anti-HNF4α antibody

Rabbit polyclonal anti-RXR antibody

A-431 whole cell lysate

HepG2 whole cell lysate

Mouse monoclonal anti-CYP2A6 antibody Abcam, Cambridge, UK

Mouse anti-HMOX1 antibody

Rabbit polyclonal anti -β-actin antibody

Rabbit polyclonal anti-CAR antibody

Rabbit polyclonal anti-digoxigenin-AP Roche Diagnostics, Sydney, Australia

Goat anti-mouse antibody conjugated with Thermo Fisher Scientific Inc. Melbourne, horseradish-peroxidase Victoria, Australia

Goat anti-rabbit antibody conjugated with horseradish-peroxidase

Plasmids /cDNAs Manufacturers/ supplier pGL4.38-p53RE Promega, Madison, WI, USA pGL3-Basic, pGL3-CYP2A6-2901/+9, Kind gift from Dr Jukka Hakkola, Institute of

107

pGL3-ARE-TK, pCB6-HNF4α Biomedicine, University of Oulu, Finland

pcDNA3.1/V5-His-C/EBPα Kind gift from Dr. Masahiko Negishi, Laboratory of Reproductive and Developmental Toxicology, National Institute of Environmental Health Sciences, Research Triangle, NC.

pSG5-hCAR Kind gift from Dr. P. Honkakoski, University of Kuopio, Finland

Human Oct-1 expression plasmid Kind gift from Dr. Peter Mackenzie , School of Medicine, Flinders Medical Centre, Flinders University, Bedford Park SA, Australia

pMAX-GFP Lonza group Ltd, Sydney, Australia

pcDNA3-basic,pcDNA3-hp53, pcDNA-Nrf-2 Dr Matti Lang, Entox, Faculty of Health and Behavioural Sciences, The University of Queensland, Australia

GAPDH cDNA CLONTECH, Palo Alto, CA, USA

Lab consumables Manufacturers/ supplier 0.22 μm filter Merck Millipore Ltd, Germany

Hybond ECL nitrocellulose membrane Amersham Biosciences UK, Ltd Hybond-N nylon membrane

0.2µm PVDF membrane Bio-Rad Laboratories, USA

25cm2 cell culture flask greiner bio-one, Germany 75cm2 cell culture flask 96-well, F-Bottom white microplate

10mm × 20mm cell culture dish Corning, NY, USA 96-well cell culture plate

NunclonTM Delta surface 6-well plate Thermo Fisher Scientific Inc. Melbourne, NunclonTM Delta surface 24-well plate Victoria, Australia

Lazy-L spreaders Sigma-Aldrich, Sydney, Australia

Inoculation loops Sarstedt AG & Co, Germany

Kits Manufacturers/ supplier QIAGEN Plasmid Midi Kit (25) QIAGEN, Hilden, Germany

108

QIA quick PCR purification kit

Trans-Blot® Turbo™ RTA Mini Bio-Rad Laboratories, USA Nitrocellulose Transfer Kit

4-15% Mini-PROTEANTM TGX Stain- FreeTM Protein Gels

DC protein assay kit

BriteliteTMplus Reporter Gene Assay System PerkinElmer, USA

GenElute™ Plasmid Miniprep Kit Sigma-Aldrich, Sydney, Australia

DIG gel shift kit Roche Diagnostics, Sydney, Australia

SuperScript®III First-Strand Synthesis kit Life Technologies, Vic, Australia

Ligase kit Thermo Fisher Scientific Inc. Melbourne, Victoria, Australia

Instruments Manufacturers/ supplier Pellet PESTLE® cordless motor Sigma-Aldrich, Sydney, Australia

HERA cell 150i CO2 Incubator Thermo Fisher Scientific Inc. Melbourne, Victoria, Australia Orbital shaker incubator

NanoDrop 1000 Spectrophotometer

SpeedVas concentrator SPD 1010

Eppendorf centrifuge 5810R

PC700 pH meter

Mini incubator Labnet International, Inc, NJ, USA

GELAIRE® class II biological safety cabinet The Kelly Company, Pty, Ltd, Sydney, Australia

Nikon, ECLIPSE, TS100 microscope Nikon, Japan

EXPLORER, Semi-micro Balance® OHAUS, Melbourne, Australia

Corbett RotorGene 3000 QIAGEN, Hilden, Germany

Allegra X-15R Centrifuge Beckman Coulter Inc, USA

109 xMark™ Microplate Bio-Rad Laboratories Pty. Spectrophotometer Ltd, USA

TC20TMCell counter

My CyclerTM thermal cycler

ChemiDocTM MP imaging system

Trans-blot® Turbo™ Transfer system

FLUOstar Omega multimode microplate reader

UV StratalinkerTM 1800 Integrated Sciences, Australia

110

Appendix B: Transformation of CYP2A6 promoter constructs into the XL- 1 blue competent cell

The generated CYP2A6 promoter constructs were propagated in the XL-1 blue competent cell (Agilent technologies Inc., CA, USA). In brief, 50 µl of XL-1 blue competent cell was thawed on ice just before use. 10 ng of generated CYP2A6 promoter construct was added to the competent cell with gentle mixes. The plasmid DNA and competent cell mixtures were incubated on ice for 30 min before being heat activated for 90 seconds at 420C. The plasmid DNA and competent cell mixtures were returned to ice for 1-2 min followed by adding 300 µl of Luria-Bertani (LB) broth (1% of tryptone, 0.5% of yeast extract, 0.5% of NaCl) into the mixtures. The mixtures were then incubated in a 370C orbital shaker incubator (Thermo Fisher Scientific Inc. Melbourne, Victoria, Australia) by shaking at 250 rpm for 1 hour. The transformed competent cell culture was plated to a selective LB medium (1% of tryptone, 0.5% of yeast extract, 0.5% of NaCl, 2% of agar, 100µg/ml ampicillin) plate and was incubated in a 370C mini incubator (Labnet International, Inc, NJ, USA) for 12-16 hours. The colonies were selected and were subcultured in 3 ml of selective LB broth (1% of tryptone, 0.5% of yeast extract, 0.5% of NaCl, 100µg/ml ampicillin) respectively. The selected cell cultures were incubated in a 370C orbital shaker incubator by shaking at 250 rpm for 12-16 hours before harvest. The propagated CYP2A6 promoter constructs in the XL-1 blue competent cells were purified by using the GenElute™ Plasmid Miniprep Kit (Sigma- Aldrich, Sydney, Australia) according to manufacturer’s instructions.

111

Appendix C: Gene sequencing procedures

The generated pGL3-CYP2A6 promoter constructs were sequenced by using BigDye ® Terminator V3.1 Cycle sequencing Kit (Applied Biosystems, CA, USA). Briefly, a reaction mixtures was prepared containing 500 ng of plasmid sample, 8 µl of Terminator Ready Reaction mix and 3.2 pmol forward primer that amplify CYP2A6 promoter gene in a total volume of 20 µl. Plasmid DNA fragment was amplified by incubating the reaction mixture in a thermal cycler (Bio-Rad, Sydney, Australia) at the following conditions: initial denaturation at 960C for 1 min, 25 cycles of sample at 960C for 10 seconds, 500C for 5 seconds and 600C for 4 min. The samples were hold at 40C before purification. They were transferred to 1.5ml microcentrifuge tubes and 5ul of 125 mM EDTA was added to each sample. 60 µl of 100% ethanol were added to each sample and were incubated at room temperature for 15 min. DNA pellets were harvested by spinning the samples at maximum speed followed by washing with 250 µl of 70% ethanol. Air dries the washed pellet in a laminar flow hood. The DNA samples were sequenced by using the facilities at AGRF (Australian Genome Research Facility Ltd, Brisbane, Australia). Plasmid DNA sequences were analysed by using software Chromas Lite 2.4.

112

Appendix D: Generation of mutated CYP2A6 promoter constructs

Mutated CYP2A6 promoters were generated by introducing four restriction enzyme cutting sites (BamHI, ApaI, EcoRI and BsmBI) into the proximal CYP2A6 promoter region. The mutated sequences on the proximal CYP2A6 promoter region are shown in the table below. The RE mutated CYP2A6 promoters were generated by using the forward and reversed primers that are shown in Appendix H. They were inserted into pGL3-Basic vector by a ligase reaction. Detailed procedures are shown in Materials and Methods, section 4.3.3. The correctness of the mutated proximal CYP2A6 promoters were verified by cutting the related restriction enzyme cutting sites followed by applying the digested plasmid DNAs to agarose gel electrophoresis. 0.5 µg of each pGL3-CYP2A6mut plasmid was digested by 1 µl of BamHI, ApaI, EcoRI and BsmBI restriction enzymes (Thermo Fisher Scientific Inc. Melbourne, Victoria, Australia) respectively. 1% of agarose (PROGEN Biosciences Ltd, Brisbane, Australia) gel was prepared by dissolving 0.4 g of agarose to 40 ml of 1 × TAE buffer (40 mM Tris, 20 mM acetic acid, 1mM EDTA, pH 7.6). The digested plasmid DNAs were separated by agarose gel electrophoresis at the conditions of voltage 100V for 1 hour. The digested plasmid DNA products were visualised by the ChemiDocTM MP imaging system (Bio-Rad Laboratories, USA).

Putative Putative RE sequences Mutated RE sequences Restriction REs 5’to 3’ 5’ to 3’ cutting sites p53RE ATTCATGGTGGGGCATG ATTACCAGTGGGGATCC GGATCC TAG TAG (BamHI)

DR-4RE GGGAGGTGAAATGAGG GGGCCCCGAAATGAGGT GGGCCC TAA AA (ApaI)

C/EBP RE GTAATTATGTAAT GTAACACGAATTC GAATCC (EcoRI)

HNF-4α RE CAGCCAAAGTCCA CAGCCAACGTCTC CGTCTC (BsmBI)

113

Appendix E: List of CYP2A6 promoter constructs in the thesis

Constructs Schematic diagram 5’-truncated -2901 LUC CYP2A6 promoters -2541 LUC

-2253 LUC

-1955 LUC

-1700 LUC

-1463 LUC

-1246 LUC

-942 LUC

-688 LUC

-437 LUC

-367 LUC

-308 LUC

-250 LUC

-160 LUC

-74 LUC

Mutated distal CYP2A6 promoters p53RE -2901 LUC × -2901 × TK LUC

114

Mutated proximal -160 CYP2A6 promoters P53 Cons LUC Oct-1 p53 CAR C/EBP HNF-4α -160 × LUC -160 × LUC -160 × LUC -160 × LUC -160 × × LUC -160 × × LUC -160 × × LUC -160 LUC × × -160 LUC × × -160 LUC × × -160 LUC × × × -160 LUC × × × -160 LUC × × × -160 LUC × × × -160 LUC × × × ×

115

Appendix F: Preparation nuclear and cytosolic extracts from cultured cells

5 × 106 cells in a 100 mm culture dish were washed and resuspended in 5 ml cold PBS. The cell suspension was centrifuged at 1600 × g for 10 min at 4oC. The resulting pellet was

resuspended in 200 µl of buffer A (10 mM Hepes-KOH, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.2 mM PMSF, 10µg/ml leupeptine, 0.4% IGEPAL) and kept on ice for 1 h. Thereafter, the cell suspension was vortexed, homogenised and centrifuged at 12,000 × g for 10 min at 4oC. The supernatant containing cytoplasmic proteins was aliquoted and stored at -80oC. The pellet containing nuclei was resuspended in 50 µl of cold buffer B (20 mM

Hepes-KOH, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF, 0.4% IGEPAL) and gently agitated with magnetic stirrer for 30 min at 4oC. The suspension was homogenised and centrifuged at 15,000 × g for 15 min, at 4oC. The supernatant containing nuclear proteins was diluted 1:1 with the dilution buffer (20 mM Hepes-KOH, pH 7.9, 15% glycerol, 0.2 mM EDTA, 0.5 mM DTT, 0.2mM PMSF), aliquoted and stored at -80oC.

116

Appendix G: Western blotting procedures

The p53, CYP2A6 apoprotein, HMOX1, CAR, C/EBPα, Oct-1 and HNF-4α protein levels in the subcellular fractions were assessed by Western Immunoblotting. In brief, 30 µg of cytosolic or nuclei proteins were separated by 4%-15% SDS-polyacrylamide gel (Bio-Rad Laboratories, USA) electrophoresis. The p53 protein was electrophoretically transferred onto a Hybond ECL nitrocellulose membrane (Amersham Biosciences UK, Ltd), and the CYP2A6 apoprotein, HMOX1, CAR, C/EBPα, Oct-1 and HNF-4α proteins were transferred onto a 0.2 µm PVDF membrane, and blocked overnight in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) and 5% non-fat milk. The membranes were then incubated with the anti-p53, anti-CYP2A6, anti-HNF-4α antibodies (1:500 dilution), anti-HMOX1, anti-CAR, anti- C/EBPα, anti-Oct-1 and anti-beta actin antibodies (1:1000) respectively for 2 h, washed with TBS-T, and incubated for 1 h with horseradish peroxidase-conjugated goat anti-mouse IgG (1:3000 dilution). After further washing with TBS-T, the membrane was incubated with luminol solution (1 M Tris pH 8.5, 90 mM p-coumaric acid, 250 mM luminol, and 3% H2O2) for 5 min and immunoreactive bands were visualised and captured by the ChemiDocTM MP imaging system (Bio-Rad Laboratories, USA).

117

Appendix H: List of primers, probes and oligonucleotides used in the thesis

Primers Sequences

PCR Amplification:

CYP2A6 5’ -2901KpnI FW 5’-GACGGTACCCATCCATCCGCTTCATCCTACAG-3’

CYP2A6 5’ -2541KpnI FW 5’-GACGGTACCACCATTCTCTCACTCCATGCTC-3’

CYP2A6 5’ -2253KpnI FW 5’-GACGGTACCGTGCTAATCTTCCTTCCCACCTC-3’

CYP2A6 5’ -1955KpnI FW 5’-GACGGTACCATATCAGCACCTGCCTCATGC-3’

CYP2A6 5’ -1700KpnI FW 5’-GACGGTACCGGCCATACCTGATGCTGATATC-3’

CYP2A6 5’ -1463KpnI FW 5’-GACGGTACCGGATGATCATGATGAACCAACC-3’

CYP2A6 5’ -1246KpnI FW 5’-GACGGTACCCCAATCTCTTCTGCCACTGTTC-3’

CYP2A6 5’ -942KpnI FW 5’-GACGGTACCCAATCTAGTGGGTTTCCCTG-3’

CYP2A6 5’ -688KpnI FW 5’-GACGGTACCCTGAGGTTCCAATGAGGATTC-3’

CYP2A6 5’ -437KpnI FW 5’-GACGGTACCCCTAAATGCACAGCCACACTTTG-3’

CYP2A6 5’ -368KpnI FW 5’-GACGGTACCCCCCCAGATCCACAACTTTG-3’

CYP2A6 5’ -308KpnI FW 5’-GACGGTACCGTGCTCCCCTATGCAAATATTC-3’

CYP2A6 5’ -250KpnI FW 5’-GACGGTACCTCCTAAATCCACAGCCCTGC-3’

CYP2A6 5’ -160KpnI FW 5’-GACGGTACCTTATCCTCCCTTGCTGGCTG-3’

CYP2A6 5’ -74KpnI FW 5’-GACGGTACCATCAGCCAAAGTCCATCCCTC-3’

CYP2A6 5’ +9NheI RV 5’-GACGCTAGCGGTGGTAGTGGGATGATAGATG-3’

EMSA

Primer 1 5’-TGCTGGCTGTGTCCCAAGCTAG-3’

Primer 2 5’-GGGATGGACTTTGGCTGATTAC-3’

CYP2A6-5’-127/-98-FW 5’-CAGGATTCATGGTGGGGCATGTAGTTGGGA-3’

CYP2A6-5’-127/-98-RV 5’-TCCCAACTACATGCCCCACCATGAATCCTG-3’

118

CYP2A6-5’-103/-80-FW 5’-GTTGGGAGGTGAAATGAGGTAATT-3’

CYP2A6-5’-103/-80-RV 5’-AATTACCTCATTTCACCTCCCAAC-3’

CYP2A6-5’-92/-65-FW 5’-AAATGAGGTAATTATGTAATCAGCCAAA-3’

CYP2A6-5’-92/-65-RV 5’-TTTGGCTGATTACATAATTACCTCATTT-3’

CYP2A6-5’-77/-53-FW 5’-GTAATCAGCCAAAGTCCATCCCTCT-3’

CYP2A6-5’-77/-53-RV 5’-AGAGGGATGGACTTTGGCTGATTAC-3’

Consensus p53RE-FW 5’-AGACATGCCTAGACATGCCT-3’

Consensus p53RE-RV 5’-AGGCATGACTAGGCATGTCT-3’

Site directed mutagenesis

CYP2A6-p53mut FW1 5’-ACCAGTGGGGATCCTAGTTGGGAGGTGAAATG-3’

CYP2A6-p53mut FW2 5’-ACCAGTGGGGATCCTAGTTGGGCCCCGAAATG-3’

CYP2A6-p53mut FW3 5’-GACATGCCTAGACATGCCTTTGGGAGGTGAAATGAG-3’

CYP2A6-DR4mut FW1 5’-GGGCCCCGAAATGAGGTAATTATGTAATCAGCC-3’

CYP2A6-DR4mut FW2 5’-GGGCCCCGAAATGAGGTAACACGAATTCCAG-3’

CYP2A6-C/EBPmut FW1 5’-GTAACACGAATTCCAGCCAAAGTCCATCCCTC-3’

CYP2A6-C/EBPmut FW2 5’-GTAACACGAATTCCAGCCAACGTCTCTCCCTC-3’

CYP2A6-HNF4αmut FW1 5’-CAGCCAACGTCTCTCCCTCTTTTTCAGGCAGT-3’

CYP2A6-p53mut RV1 5’-TAGGATCCCCACTGGTAATCCTGCCTAGCTTGG-3’

CYP2A6-p53mut RV2 5’-AGGCATGTCTAGGCATGTCTCCTGCCTAGCTTGGGA-3’

CYP2A6-DR4mut RV1 5’-CCTCATTTCGGGGCCCAACTACATGCCCCA-3’

CYP2A6-DR4mut RV2 5’-CCTCATTTCGGGGCCCAACTAGGATCCCCA-3’

CYP2A6-C/EBPmut RV1 5’-CTGGAATTCGTGTTACCTCATTTCACCTCCC-3’

CYP2A6-C/EBPmut RV2 5’-CTGGAATTCGTGTTACCTCATTTCGGGGC-3’

CYP2A6-HNF4αmut RV1 5’-GGGAGAGACGTTGGCTGATTACATAATTACCTC-3’

CYP2A6-HNF4αmut RV2 5’-GGGAGAGACGTTGGCTGGAATTCGTGTTAC-3’

119 mRNA Analysis

CYP2A6 NM_000762 F: 5’-AAGATCAGTGAGCGC TATGG-3’ R: 5’-TGAATACCACGCATAGCCT-3’ Amplicon size: 178 bp GAPDH NM_002046 F: 5’- CATGAGAAGTATGACAACAGCCT-3’ R: 5’-AGTCCTTCCACGATACCAAAGT-3’ Amplicon size: 113 bp HMOX1 NM_002133 F: 5’- CAGTGCCACCAAGTTCAAGC-3' R: 5’-GTTGAGCAGGAACGCAGTCTT-3' Amplicon size: 112 bp

120

Appendix I: Paper I

Click here to download the original publication of paper I

121

Appendix J: Paper II (manuscript)

122

1 Transcriptional Control of the Human CYP2A6 Gene by p53

2 Involves Complex Interaction with CAR, Oct-1/ C/EBP and HNF-

3 4α

a* a, b a a 4 Hao Hu , A’edah Abu Bakar Ting Yu and Matti A Lang

5 6 aThe University of Queensland, National Research Centre for Environmental Toxicology 7 (Entox), 4072 Brisbane, Queensland, Australia. [email protected]; 8 [email protected]; [email protected].

9 bPharmacology and Toxicology Research Laboratory, Faculty of Pharmacy, University 10 Technology MARA (UiTM), 42300 Bandar Puncak Alam, Selangor Darul Ehsan, Malaysia. 11 [email protected]. 12 13 *Address correspondence to: Hao Hu, Entox, The University of Queensland, 39 Kessels 14 Road, Coopers Plains, 4108 Queensland, Australia. Phone: +617 0419 301 740; Fax: +617 15 3274 9003; E-mail: [email protected]; 16 17 Abbreviations used: BR, bilirubin; CYP, cytochrome P450; CYP2A5, cytochrome P450 2A5; 18 CYP2A6, cytochrome P450 2A6; CAR, constitutive androstane receptor; C/EBP, CCAAT- 19 enhancer-binding protein; Oct-1, Octamer-1; HNF-4α, hepatocyte nuclear factor-4α; TF, 20 transcription factor; RE, response element. 21 22 23 24 25 26 27 28 29 30 31

32 Abstract

33 The Cytochrome P450 (CYP) 2A6 hemoprotein plays an important role in regulating 34 intracellular antioxidant capacity (Abu-Bakar et al., 2012), and is induced by toxic insults 35 including oxidative stress. This paper describes the mechanism by which stress activated 36 transcription factors: CAR, C/EBPα/ Oct-1 and the p53, together with the HNF-4α, regulate 37 the encoding CYP2A6 gene. Overexpression of these proteins individually in the human 38 hepatocellular carcinoma cell line C3A, upregulated (with the exception of CAR) a 39 recombinant gene consisting of proximal promoter of the CYP2A6 including all the RE:s of 40 the regulatory proteins. Mutations introduced at the RE:s respectively preventing the proteins 41 from binding, reduced the gene expression levels as compared to the wild type, thus 42 suggesting a role for all five proteins in the regulation. Introducing a series of triple mutations 43 leaving only one of the four RE:s intact, demonstrated that only the CAR and the 44 C/EBPα/Oct-1 could support the gene expression partially independently form the other 45 proteins. For the HNF-4α and p53 interaction with the other proteins was necessary to exert 46 their regulatory function. A series of pairwise mutations revealed a complex interaction 47 between the proteins including a close cooperation between the stress-activated proteins: p53, 48 Oct-1/ C/EBPα and CAR, supported by the HNF-4α for full activation of the gene. An EMSA 49 analysis was performed to confirm specific binding of the regulatory proteins to their 50 respective RE:s at the CYP2A6 promoter. Replacement of the p53RE at the CYP2A6 51 promoter with p53 consensus sequence resulted in an extremely high expression of the 52 recombinant gene upon overexpression of the p53. While unexpected, this result agrees with 53 the rest of the evidence and supports a model where the stress activated proteins form a 54 compact cluster, assisted by the liver specific HNF-4α for full activity. The significance of 55 this model in cellular defense against toxic insults is discussed.

62 Introduction 63 The human cytochrome P450 (CYP) 2A6 enzyme is a key catalyst for the metabolism of 64 nicotine (Nakajima et al., 1996), several nitrosamines (Yamazaki et al., 1992) and other 65 toxins (Abu-Bakar et al., 2013). Unlike most other CYP:s, the CYP2A6 gene is known to be 66 upregulated by diverse toxic insults such as oxidative stress, radiation, chronic inflammation, 67 cellular perturbation and transcriptional arrest, as well as by a variety of structurally unrelated 68 chemicals (Kirby et al., 1994; Donato et al., 2000; Niemela et al., 2000; Christian et al., 69 2004; De-Oliveira et al., 2006; Kirby et al., 2011). Such mode of regulation which seems to 70 be related to cellular events or processes, caused by external toxic agents, rather than by any 71 specific ligand or chemical per se (Donato et al., 2000; Onica et al., 2008; Jin et al., 2012), 72 has led us to believe that the gene product may have a protective function (Christian et al., 73 2004; Yokota et al., 2011). The observed up-regulation of the CYP2A6 following toxic 74 insults is reflected in the complex regulation of encoding gene by several stress activated 75 transcriptional and post-transcriptionally signaling pathways each contributing to its 76 expression depending on the nature of perturbations. Accordingly, the transcriptional 77 regulation is mediated by transcription factors (TFs) involved in cellular homeostasis and 78 cyto-protection, such as bile acid/steroid homeostasis and energy metabolism by pregnane-X- 79 receptor (PXR), peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) and 80 oestrogen receptor α (ERα) (Staudinger et al., 2001; Xie et al., 2001; Goodwin et al., 2003) 81 by interacting with the relevant response elements on the 5′-flanking region of CYP2A6 gene 82 (>−2400 bp) (Itoh et al., 2006; Higashi et al., 2007). Similarly, stress activated nuclear factor 83 (erythroid-derived 2)-like 2 (Nrf2) mediates transcriptional activation of CYP2A6 by direct 84 interaction with the antioxidant response element (ARE) at position −1212 of the gene’s 85 distal promoter (Yokota et al., 2011). In addition, we have shown that the multifunctional, 86 stress activated hnRNPA1 involved in nucleocytoplasmic mRNA transport and mRNA 87 stabilization, contributes to the gene upregulation through stabilizing the CYP2A6 mRNA 88 during transcriptional arrests (Christian et al., 2004). It is noteworthy that some of the critical 89 regulatory proteins involved in the regulation, such as the Nrf-2 and the hnRNPA1 are not 90 ligand activated. 91 Recently, we have demonstrated that the CYP2A6 plays a role in regulating the 92 intracellular antioxidant capacity by optimizing the bilirubin levels (BR, one of the most 93 potent endogenous antioxidants), together with the Heme-Oxygenase 1(HO-1) (Hu et al., 94 2015). During toxic insults the CYP2A6 and the HO-1 are upregulated in a coordinated 95 fashion leading to increased BR production and antioxidant capacity in cells under stress. We

96 have also shown that in cells under stress the mouse CYP2A5,and HO-1 are targeted into 97 mitochondria, to regulate the local BR levels (Abu-Bakar et al., 2011; Muhsain et al., 2015). 98 These observations are well in accordance with our earlier evidence showing that the 99 CYP2A6 is induced by various external insults causing cellular perturbations, and the 100 hypothesis that the CYP2A6 is somehow involved in adaptive response to the stress 101 (reviewed in Abu-Bakar et al., 2013). 102 In our recent paper we reported that the stress activated transcription factor, p53, is a 103 regulator of the CYP2A6 gene (Hu et al., 2015). The p53, induced by various forms of stress 104 such as chemical insults, radiation, oxidative stress, DNA damage and transcriptional arrest 105 (Latonen et al., 2001; Meek, 2004; Riley et al., 2008; Gambino et al., 2013; Clewell et al., 106 2014) upregulated the CYP2A6 gene by interacting with its response element (RE) on the 107 proximal CYP2A6 promoter region (Hu et al., 2015). Interestingly, the functional p53RE is 108 only five base pairs upstream of an RE cluster consisting of functional binding sites for HNF- 109 4α, CAR, C/EBPα, C/EBPβ, and Oct-1 (Pitarque et al., 2005), of which three are activated by 110 chemical or oxidative stress. 111 In the present study we demonstrate a close cooperation between the four stress- 112 activated TF:s: the CAR, C/EBPα, Oct-1 and p53, in the regulation of the CYP2A6 gene, 113 complemented by the liver enriched TF, HNF-4α for full activity. 114 The results are in accordance with, earlier observations on the upregulation of the 115 CYP2A6 by various toxic insults and with its protective role in the cells. Together with the 116 earlier identified, stress activated proteins and regulators of the CYP2A6 gene, the proximal 117 promoter binding stress- protein cluster, identified in this paper, suggest a machinery of 118 extreme complexity on CYP2A6 regulation by various stress related signaling pathways and 119 may suggest a role for the gene product as a delicate, intracellular stress sensor. 120 121 Materials and methods

122 Chemicals and antibodies 123 Ampicillin, kanamycin, biological agar, Tween-20, saline sodium citrate, 2- 124 mercaptoethanol, sucrose, glycerol, glycine, leupeptin, bovine serum albumin (BSA), DMSO,

125 PBS, dithiothreitol (DTT), phenylmethylsulfonyl fluoride (PMSF), MgCl2, KCl, KOH, NaCl, 126 Hepes, EDTA, IGEPAL, boric acid, cyclohexanediamine tetraacetic acid, Triton X-100, p- 127 coumaric acid and luminol were purchased from Sigma-Aldrich (Sydney, NSW, Australia). 128 Agarose were obtained from PROGEN Biosciences (Brisbane, QLD, Australia). BactoTM

129 yeast extract and BactoTM Tryptone were purchased from Becton Dickison (Sydney, NSW, 130 Australia), Polyethylenimine (PEI) was purchased from Polysciences Inc. (PA, USA). Mouse 131 monoclonal antibodies anti-p53 (sc-126X), anti-C/EBPα (sc-365318X), anti-Oct-1(sc- 132 8024X), rabbit polyclonal antibodies anti-HNF-4α (sc-8987), anti-RXR (sc-774X), A-431 133 whole cell lysate (sc-2201) and HepG2 whole cell lysate (sc-2227) were obtained from Santa 134 Cruz Biotechnology Inc. (Dallas, Texas, USA). Rabbit polyclonal antibodies anti-CAR 135 (ab186869) and anti -β-actin (ab8227) were sourced from Abcam (Cambridge, UK). Goat 136 anti-mouse and goat anti-rabbit antibodies conjugated with horseradish-peroxidase were from 137 Thermo Fisher Scientific Inc. (Melbourne, Victoria, Australia). All cell culture consumables 138 were sourced from Invitrogen (Scoresby, Victoria, Australia). 139 140 C3A cell culture maintenance 141 The C3A human hepatocellular carcinoma cells (ATCC, Manassas, VA, USA) were 142 propagated in T75 flasks in William’s Medium E containing 10% FBS, 1% Glutamax and 1% 143 Penicillin-Streptomycin. The cells were maintained in a humidifier incubator at 37°C in 5% 144 CO2 and were sub-cultured at least two times per week. Cells were washed twice by 1× PBS 145 and were detached by TrypLE Express Enzyme (1×) before sub-culturing. Cells with passage 146 number between 5 and 15 were used in all studies. 147 148 Site-directed mutagenesis 149 Previous studies have shown that the CYP2A6 gene expression is mediated by a 150 cluster of transcription factor binding sites including one for p53 spanning from -122 to -60 151 bp on the proximal CYP2A6 promoter region (Pitarque et al., 2005; Hu et al., 2015). To 152 investigate possible interplay between factors binding to these sites in mediating CYP2A6 153 gene transactivation, a series of response element- mutated, proximal CYP2A6 promoter 154 constructs were generated as follows, (mutated region underlined); the p53RE 5’- 155 ATTCATGGTGGGGCATGTAG-3’ was mutated to 5’-ATTACCAGTGGGGATCCTAG- 156 3’; CAR/DR-4RE 5’-AGGTGAAATGAGGTAA-3’ to 5’-CCCCGAAATGAGGTAA-3’; 157 C/EBP-Oct-1RE 5’-GTAATTATGTAAT-3 to 5’-GTAACACGAATTC-3’ and the HNF- 158 4αRE 5’-CAGCCAAAGTCCA-3 to 5’-CAGCCAACGTCTC-3’. The four response elements 159 were mutated individually and in combination by the two steps PCR. Firstly, individual RE 160 mutations were introduced. The mutated constructs were amplified from the template plasmid 161 CYP2A6 5’ -160/+9 by priming with the forward primer CYP2A6 5’-160 FW and reverse

162 primers CYP2A6-p53mut RV1, CYP2A6-DR-4mut RV1, CYP2A6-C/EBPmut RV1 or 163 CYP2A6-HNF4αmut RV1 respectively (Table1). The CYP2A6 constructs from RE mutated 164 sites to +9 were amplified from the template plasmid CYP2A6 5’ -160/+9 by priming with 165 the forward primer CYP2A6-p53mut FW1, CYP2A6-DR4mut FW1, CYP2A6-C/EBPmut 166 FW1 or CYP2A6-HNF4αmut FW1 (Table1) and the reverse primer CYP2A6 5’+9 NheI RV 167 respectively (Table 1). Equal amount of PCR products from the two reactions were mixed 168 together, which acted as a template to amplify the mutated p53RE, DR-4RE, C/EBP-Oct- 169 1RE, HNF-4αRE respectively. The CYP2A6-160/+9 constructs containing the mutated 170 p53RE, DR-4RE, C/EBP-Oct-1RE or HNF-4αRE were generated by priming with the 171 forward CYP2A6 5’ -160 KpnI FW and the reverse primer CYP2A6 5’+9 NheI RV (Table1). 172 The constructs were ligated to the pGL3-Basic plasmid respectively. The same method was 173 applied to generate multiple RE- mutated constructs which were amplified from the 174 previously generated single RE mutated CYP2A6 constructs by using the primers listed in 175 Table 1. Similarly, the CYP2A6 p53RE: 5’-ATTCATGGTGGGGCATGTAG-3’ was 176 mutated into a “consensus p53RE”: 5’-AGACATGCCTAGACATGCCT-3’ (mutated 177 sequences, underlined) in the proximal CYP2A6 promoter construct by forward primer 178 CYP2A6-p53mut FW3 and reverse primer CYP2A6-p53mut RV2 (Table 1). The generated 179 CYP2A6 promoter constructs were transformed in XL-1 blue competent cells for expansion 180 (Agilent technologies, CA, USA) and were purified by using QIAGEN plasmid midi kit 181 (QIAGEN, Hilden, Germany). The validity of the mutations was confirmed by gene 182 sequencing. The primers used for site directed mutagenesis were obtained from Sigma- 183 Genosys (Sydney, Australia), which were shown in table 1. 184 185 Plasmids and transient transfection assays 186 The CYP2A6 5’ promoter region -160/+9 was amplified using high-fidelity PCR 187 polymerase and cloned in front of the luciferase cDNA in pGL3-Basic vector (Promega, 188 Madison, WI). Thereafter, a series of site mutations of the REs on the CYP2A6-5’-160/+9 189 Luc plasmids were generated by the site directed mutagenesis method. Empty expression 190 plasmid (pcDNA3) and transcription factor expression plasmids including the pcDNA3-hp53, 191 pSG5-hCAR, pcDNA3.1/V5-His-C/EBPα, pCB6-HNF-4α and Oct-1 expression plasmids 192 were used for co-transfection experiments. Promoterless pGL3-Basic and pGL3-Basic 193 containing a SV-40 promoter were used as negative and positive controls for cell transfection 194 respectively. The pGL4.38 [luc2P/p53 RE/Hygro] vector (Promega, Madison, WI) was used 195 as the positive control for p53 co-transfection in C3A cells. 6

196 Polyethylenimine (PEI) (Polysciences Inc., PA, USA) was used to transiently transfect 197 cultured cells with the various promoter constructs, as previously described in (Hu et al., 198 2015). The optimized PEI:DNA ratio was set at 1:2 for C3A cell transfection. The DNA-PEI 199 mixture was then incubated at room temperature for 15 min before being added to each well 200 of the 24-well plates or the 100 mm dishes. 201 Cells were seeded in 24-well plates (1.2 × 105 cells/well) for 24 h. Thereafter, the cells 202 were washed once in 500 µl PBS, followed by addition of 500 µl of fresh FBS-free medium 203 to each well. The cells were then transfected with 0.5 µg of CYP2A6-5’-Luc constructs. In the 204 co-transfection experiments, the cells were co-transfected with 0.3 µg of CYP2A6-5’-Luc 205 constructs, 0.1 µg of each transcription factor expression plasmid or empty expression 206 plasmid pcDNA3 and 0.1 µg of pMAX-GFP (transfection control). The same co-transfections 207 were scaled up by 25 times in 100 mm dishes for protein extraction and analysis. The

208 transfected cells were incubated for 24 h in a humidifier incubator at 37°C in 5% CO2. 209 Thereafter, the transfected cells were harvested and lysates used for measuring luciferase 210 activity (BriteliteTMplus Reporter Gene Assay System, PerkinElmer, USA). Transfections 211 under each condition were performed in quadruplets. The fluorescence and luminescence 212 signals were captured on a FLUOstar Omega multimode microplate reader with automatic 213 gain settings. 214 215 Isolation of nuclear and cytoplasmic proteins 216 Nuclear and cytoplasmic extracts from cultured cells were prepared as described 217 previously (Abu-Bakar et al., 2007). Briefly, 3 × 106 cells in a 100 mm dish were washed and 218 resuspended in 5 ml cold PBS. The cell suspension was centrifuged at 1600 × g for 10 min at 219 4oC. The resulting pellet was resuspended in 200 µl of buffer A (10 mM Hepes-KOH, pH

220 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.2 mM PMSF, 10µg/ml leupeptine, 0.4% 221 IGEPAL) and kept on ice for 1 h. Thereafter, the cell suspension was vortexed, homogenized 222 and centrifuged at 12,000 × g for 10 min at 4oC. The supernatant containing cytoplasmic 223 proteins was aliquoted and stored at -80oC. The pellet containing nuclei was resuspended in

224 50 µl of cold buffer B (20 mM Hepes-KOH, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 420 mM 225 NaCl, 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF, 0.4% IGEPAL) and gently agitated 226 with magnetic stirrer for 30 min at 4oC. The suspension was homogenized and centrifuged at 227 15,000 × g for 15 min, at 4oC. The supernatant containing nuclear proteins was diluted 1:1 228 with the dilution buffer (20 mM Hepes-KOH, pH 7.9, 15% glycerol, 0.2 mM EDTA, 0.5 mM 229 DTT, 0.2mM PMSF), aliquoted and stored at -80oC.

230 Protein analysis 231 Protein concentrations of the subcellular fractions were measured by the DC protein 232 assay kit (Bio-Rad Laboratories, USA). The expression levels of transcription factors p53, 233 CAR, C/EBP-α, Oct-1, and HNF-4α were assessed by Western immunoblotting. Briefly, 30 234 µg nuclei proteins were separated by 4%-15% SDS-polyacrylamide gel (Bio-Rad 235 Laboratories, USA) electrophoresis. The proteins were electrophoretically transferred onto a 236 0.2 µm PVDF membrane (Bio-Rad Laboratories, USA) and blocked overnight in Tris- 237 buffered saline containing 0.1% Tween 20 (TBS-T) and 5% non-fat milk. The membrane was 238 then incubated with the relevant antibody (1:500 dilution) for 2 h, washed with TBS-T, and 239 incubated for 1 h with horseradish peroxidase-conjugated goat anti-mouse IgG (1:3000 240 dilution). After further washing with TBS-T, the membrane was incubated with luminol

241 solution (1 M Tris pH 8.5, 90 mM p-coumaric acid, 250 mM luminol, and 3% H2O2) for 5 242 min and immunoreactive bands were visualized and captured by the ChemiDocTM MP 243 imaging system (Bio-Rad Laboratories, USA). Densitometry analysis of protein expression 244 levels was performed by using the software NIH imageJ 1.49. 245 246 Electrophoretic mobility shift assay 247 Four double stranded probes used for EMSA analysis were obtained from Sigma- 248 Genosys (Sydney, Australia). The probes containing respective p53RE, DR-4RE, C/EBP- 249 Oct-1RE, and HNF-4αRE spanning from -122 to -60 bp on the proximal CYP2A6 promoter 250 were listed in table 1. These probes were labelled with digoxigenin on the 3’ end of the 251 oligonucleotide using DIG gel shift kit (Roche, Germany). Thereafter, 32 fmol of each 252 digoxigenin-labelled probe was incubated with 16 µl of binding buffer and 4 µg of nuclei 253 proteins for 15 min at room temperature. The nuclei proteins were extracted from C3A cells 254 transfected with pcDNA3-hp53, pSG5-hCAR, pcDNA3.1/V5-His-C/EBPα, pCB6-HNF-4α 255 and Oct-1 expression plasmids respectively. In antibody shift assay, 1 µl of anti-p53, CAR, 256 RXR, C/EBPα, Oct-1, HNF4α or Nrf2 antibody was added to the reaction mixture and was 257 incubated for 15 min. The samples were loaded to a pre-electrophoresed, non-denaturing 4- 258 15% polyacrylamide gel in 0.5 × TBE buffer (44 mM Tris-HCl, pH 8, 44 mM boric acid, 1 259 mM EDTA). Samples were separated electrophoretically at 80V for 1 h and transferred to a 260 positive-charged nylon membrane Hybond-N (Amersham Biosciences, UK, Ltd) by an 261 electro-blotting device (Bio-Rad Laboratories, USA) set at 1 h at 30V, 300mA. Thereafter, 262 the membrane was baked at 140oC for 15 min and crosslinked in a UV StratalinkerTM 1800

263 (Integrated Sciences, Australia) at 120 mJ. The membrane was briefly rinsed for 3 min in 264 washing buffer and was blocked in blocking solution for 30 min before immunological 265 detection. The digoxigenin-labelled probes on the membrane were detected by incubating the 266 membrane with an anti-digoxigenin-AP antibody (1:10,000). The chemiluminescence signal 267 of the labelled probes was captured by ChemiDoc™ MP imaging system after applying the 268 alkaline phosphatase substrate CSPD on the membrane. A longer probe covering all intact 269 REs of the proximal CYP2A6 promoter was also used for EMSA analysis, which was 270 amplified from the wildtype CYP2A6 promoter construct by priming with the CYP2A6 5’- 271 141-FW forward primer and CYP2A6 5’+9-RV primer (Table 1). 272 273 Statistical analysis 274 Two group comparisons were analyzed by Student’s t test. Multiple group comparisons were 275 done with one-way analysis of variance (ANOVA) followed by the least significant 276 difference post hoc test. Differences were considered significant when p < 0.05. 277 278 Results 279 Role p53, CAR, C/EBPα, Oct-1 and HNF-4α in the regulation of the CYP2A6 gene 280 Our recent studies have demonstrated that transactivation of the human CYP2A6 is 281 mediated by the stress activated transcription factor p53 (Hu et al., 2015). In addition, we and 282 others have shown that also the CAR, C/EBPα/ Oct-1 and HNF-4α interact with the proximal 283 promoter of the CYP2A6 and may thus play a role in its regulation (Pitarque et al., 2005; Hu 284 et al., 2015). Interestingly, like p53 also the CAR and C/EBPα/Oct-1 are part of the cellular 285 stress – responding machinery (Jin et al., 2001; Li et al., 2008; Osabe et al., 2009; Hou et al., 286 2012). Therefore, a series of experiments were designed in order to investigate possible 287 interaction between these proteins in mediating the CYP2A6 gene transactivation. The 288 CYP2A6-5’-160/+9 Luc promoter construct was first co-transfected with the transcription 289 factor expression plasmids p53, CAR, C/EBPα, Oct-1 and HNF-4α respectively, into the C3A 290 cells. As shown in Figure 1A, the p53, Oct-1 and HNF-4α all increased the expression 291 significantly. A very strong increase in the expression was achieved by overexpression of the 292 liver enriched transcription factor C/EBPα (Fig. 1A). By contrast, co-transfection of CAR 293 downregulated the CYP2A6 gene expression compared to the control (Fig. 1A). These results 294 indicate that all five transcription factors play a role in the regulation of the CYP2A6 gene but 295 that the roles may differ. Levels of the respective transcription factors in the C3A cells,

296 transfected with expression plasmids or the empty vector were confirmed by Western blotting 297 and subsequent semi quantitative scanning of the band. As shown in Figure 1B and 1C, all 298 transcription factors were highly expressed in expression plasmid transfected cells compared 299 to the control. It is worth noticing that the level of C/EBPα appears to be extremely low in 300 control cells but is highly expressed in expression plasmid transfected cells. 301 Next, roles of these transcription factors in the CYP2A6 regulation were confirmed by 302 mutating the corresponding response elements on the proximal CYP2A6 promoter. The RE 303 mutated CYP2A6-5’-160/+9 Luc constructs were co-transfected together with pMAX-GFP 304 into the C3A cells. Figure 2A shows the locations of the respective binding sites at the 305 CYP2A6 promoter region. These sites were mutated individually and in combination (Fig. 306 2B). Figure 3A shows the impact of single mutations on the expression levels. A significant 307 reduction by about 40-55% was observed in each case, as compared to the wild type promoter 308 (Fig. 3D). The SV-40 promoter driven Luc-activity, used as a control, was expressed at about 309 50% of the activity of the wild type CYP2A6 (Fig. 3D). As expected, no significant activity 310 was observed in the cells transfected with pGL3-Basic plasmid (negative control). The results 311 demonstrate that each of the four response elements, present on the proximal CYP2A6 312 promoter, has a role in mediating CYP2A6 gene transactivation essentially confirming results 313 summarized in Figure 1. In the case of CAR, apparently opposite effects were found with its 314 overexpression respectively mutation of the RE (Fig. 1 and 3A). The results are in agreement 315 with previous studies by (Pitarque et al., 2005; Hu et al., 2015). 316 Next, in order to investigate possible interplay between p53 and the four other proteins, 317 in the regulation the CYP2A6 expression, a series of multiple mutations were introduced as 318 shown in Figure 3B, C and D. The mutated constructs were transfected into C3A cells 319 respectively. When all four RE:s were mutated, the expression was totally abolished, as could 320 be expected. Interestingly, almost a zero level activity was also observed with triple 321 mutations where only the p53 or HNF-4αRE was left intact (Fig. 3B). On the other hand, 322 when either CAR or C/EBP/Oct-1 RE was kept intact, a significant expression at about 40 to 323 60% from the wild type could be observed (Fig. 3B). These results suggest that, while all four 324 proteins are needed for the optimal activity, their respective roles in assembling the 325 transcription complex seem different: While for the HNF-4α and the p53 interaction with the 326 other proteins appears necessary, in order to contribute to the transcriptional activity, the 327 CAR and especially the C/EBPα seem to be able to function partially independently although 328 not in their full capacity.

329 When a series of double mutations was introduced an even more complex picture 330 emerged (Fig. 3C): A zero level activity was observed when only the p53 and HNF-4αRE:s 331 were intact supporting the observation above that these TF:s need the other two proteins to 332 function. In addition, this result seems to suggest that p53 and HNF-4α do not interact 333 directly with each other to support transcription. On the other hand, when p53RE was kept 334 intact together with either CAR or C/EBP/Oct-1 RE, the expression could partially be 335 restored suggesting an interaction between these proteins and the p53. 336 In conclusion, the results suggest complex interaction between the four/five proteins 337 where all of them are needed for optimal transcriptional activity, and where the p53 cannot 338 act alone but needs interaction with the other proteins in regulating the expression of the 339 CYP2A6 gene. The results also suggest a tight interaction between the stress activated p53, 340 CAR and Oct-1, complemented by the HNF-4α for full activity. 341 342 Over-expression of p53 emphasizes its interaction with CAR and C/EBP/Oct-1 in the 343 regulation of CYP2A6 344 To further investigate the interaction of p53 with the other transcription factors, a series 345 of mutated constructs were co-transfected with the p53 expression plasmid into the C3A cells 346 as shown in Figure 4. As expected a strong upregulation of the wild type gene took place 347 which was almost as strong as with the positive control. Also expected was the absence of 348 upregulation with constructs where the p53RE was mutated, either alone or together with the 349 other RE:s, thus demonstrating its role in maintaining the CYP2A6 expression (Fig. 4). A 350 very weak and non-significant up-regulation was observed with the construct where the 351 p53RE was the only intact one. An equally weak/nonsignificant upregulation was observed 352 with the intact p53RE and pairwise mutations of the CAR/C/EBP/Oct-1/HNF-4α RE:s 353 respectively (Fig. 4). The results confirm observations in Figure 3 that p53 cannot support 354 CYP2A6 expression alone but needs cooperation with the other factors. And further that 355 interaction with only one of the other proteins is not sufficient. Interestingly, co-transfections 356 with constructs possessing intact p53RE and single mutations at the three other sites 357 respectively showed that while mutation of the CAR or the C/EBP/Oct-1 RE compromised 358 the expression partially, mutation of the HNF-4α site did not, as compared to the wild type. 359 This result confirms the picture emerging from Figure 3 where CAR and C/EBP/Oct-1 are 360 essential partners for p53 in its CYP2A6 regulation while the HNF-4α plays a supportive 361 function. 362

363 Electrophoresis Mobility Shift Assay (EMSA) confirms binding of CAR, C/EBPα, Oct-1 364 and HNF-4a to the CYP2A6 proximal promoter 365 A series of EMSA analysis was performed to demonstrate binding of p53, CAR, 366 C/EBPα, Oct-1 and HNF-4α to the CYP2A6 promoter. Direct interaction of p53 with the 367 promoter has been shown previously (Hu et al., 2015). Sequences covering the respective 368 RE:s and binding sites of the proteins at the CYP2A6 proximal promoter (Fig. 3A) were used 369 as labelled probes and specific antibodies raised against each of these proteins were added to 370 the incubation mixtures. Anti Nrf-2 antibody was used as control for unspecific binding: (a 371 protein present in the nuclear extract but with no binding site at the promoter). 372 A protein/DNA complex was supershifted by the p53 ab, but the formed complex did 373 not recognized by the Nrf-2 ab, indicating the specific binding of p53 to the RE (Fig. 5A). 374 Figure 5B shows a gel-shifted band specific to the CAR and the RXR: (a protein forming a 375 heterodimer with the CAR upon binding to the DNA), however, no complex was observed 376 with the anti Nrf-2 ab. Similarly, a gel-shifted band is seen in Figure 5C with Oct-1 ab but not 377 with the Nrf2 ab, suggesting specific binding of the protein to it’s RE. Only a weak and 378 diffuse shift was observed in Figure 5D with anti C/EBPα ab, nonetheless, a pattern distinctly 379 different from that obtained with anti-Nrf2 antibody, where no trace of shift were observed. 380 This could indicate a weak binding of the anti-C/EBPα antibody to the protein, possibly due 381 to some interference by the Oct-1 (See Figure 7). Two bands appeared on the gel when the 382 probe specific to the HNF-4α was incubated with the protein extract (Fig. 5E). A distinct, gel- 383 shifted band appeared with simultaneous disappearance of the upper band upon addition of 384 the anti-HNF-4α to the incubation mixture, suggesting that the upper band represents the 385 HNF-4α. We do not know what the lower band is, but at least it is not the Nrf2 as antibody 386 against it caused no changes in the migration of the protein DNA complexes on the gel (Fig. 387 5E). 388 Finally, the entire proximal promoter region of the CYP2A6 gene including all binding 389 sequences of the investigated proteins was used as a probe. A complex appears when this 390 probe is incubated with nuclear proteins containing all five TF:s but no antibody (Suppl. Fig. 391 1, complex indicated by arrow). Same size of complex also appears in the presence of Nrf2 392 antibody but disappears when ab:s against the other five proteins were used respectively 393 (Suppl. Fig. 1). However, no obvious, gel shifted, antibody specific complexes could be 394 identified on the gel. 395 Using excessively large probes in EMSA assays is known to be challenging for several 396 reasons: for example unpredictable and diffuse migration of huge DNA–protein complexes

397 on the gel and conformations formed interfering with antibody binding. Nevertheless, 398 disappearance of the characteristic band seen in the absence of Ab:s or in the presence of the 399 anti Nrf2 antibody, when specific antibodies were used, seems to support results obtained 400 with the smaller, specific probes suggesting that all five proteins seem to interact with the 401 large probe as well. 402 403 Replacing the p53RE at the CYP2A6 promoter with consensus p53RE dramatically 404 increases the expression level. 405 A consensus RE has been previously described for the p53. It contains two repeats of 406 [5’-RRRC(A/T)(T/A)GYYY-3’], where “R” represents purine and “Y” represents pyrimidine 407 (el-Deiry et al., 1992). This DNA sequence is characterized by a specific, high affinity 408 interaction with the p53, and has been used in vectors assessing p53 activity levels in in vitro 409 cell assay (Mukudai et al., 2013; Promega, 2015) . 410 In our present and previous studies we have used a double - repeat p53 consensus 411 sequence vector, pGL4.38 [luc2P/p53 RE/Hygro], as a positive control to assess p53 412 activation (Fig. 4 and 6, Hu et al., 2015). When the CYP2A6 specific p53RE was mutated 413 into the p53 consensus sequence (Fig. 6A, boxed region) while keeping the promoter 414 otherwise intact, an extremely high expression level (up to 30-40 times higher) as compared 415 to the CYP2A6 wild type or indeed the p53 positive control was achieved (Fig. 6B). When 416 this construct was co-transfected with the p53 expression plasmid, no further increase in the 417 expression, unlike in the case of the wild type CYP2A6 or the p53 positive control, was 418 achieved (Fig. 6B). This is an unexpected result, particularly since the p53 positive control 419 contains two copies of the consensus sequence while the modified CYP2A6 promoter 420 contains only one. The result is not easy to explain but it possibly demonstrates the 421 importance of the adjacent transacting factors, present at the CYP2A6 promoter, for p53 to 422 achieve its full gene activating capacity. Such explanation is in accordance with the results 423 obtained throughout this investigation. 424 It could be that introducing the consensus sequence into the CYP2A6 promoter has 425 created a template with an extremely high p53 affinity (higher than the consensus sequence 426 alone) binding aggressively all the endogenous p53 (facilitated by the other interacting 427 proteins) and leaving no place for the overexpressed p53. This could explain why not further 428 upregulation of this construct took place by overexpressing the p53. Such a scenario would 429 agree with a model where the other TF:s (CAR, C/EBP/Oct-1) help recruiting the p53 into the 430 complex and facilitate its binding to its RE.

431 Discussion

432 This study demonstrated that stress activated transcription factors: the p53, CAR and 433 C/EBP/Oct-1 form a cluster at the proximal promoter of the CYP2A6 gene; - 61 - 122 bp 434 upstream the TATA box. And that the cluster formation appears to be necessary for the 435 proteins to exert their regulatory function. For full activity the “stress cluster” needs to 436 interact with the HNF-4α, also binding to the same regulatory region. Based on the results a 437 model is proposed for the “stress cluster” formation and protein - protein interactions at the 438 CYP2A6 promoter (Fig. 7).

439 In a recent study (Hu et al., 2015) we demonstrated that p53 is a transcriptional activator 440 of the CYP2A6 contributing to its upregulation during oxidative and/or genotoxic stress 441 (Abu-Bakar et al., 2013); condition known to activate the p53 (Meek, 2004; Gambino et al., 442 2013; Clewell et al., 2014). However, the present study shows that, rather than acting alone 443 the p53 cooperates with other stress activated proteins to exert its regulatory function. Given 444 the various toxic insults that are known to activate the proteins included in the “stress cluster” 445 it seems that conditions and cellular processes leading to upregulation of the CYP2A6 gene 446 maybe complex and multifactorial (Jin et al., 2001; Clewell et al., 2014; Kobayashi et al., 447 2015).

448 Earlier studies have identified other stress-activated signaling pathways up- or 449 downstream the gene-expression pathway contributing to the expression of the CYP2A6 gene. 450 Accordingly, the “pregnane-X-receptor (PXR), estrogen receptor-α (ER-α), and stress 451 activated nuclear factor (erythroid-derived2) like2 (Nrf-2) (Itoh et al., 2006; Higashi et al., 452 2007; Yokota et al., 2011) have shown to be regulators of the gene. In addition, we have 453 shown that the multifunctional, stress activated hnRNPA1 (Heterogeneous Nuclear 454 Ribonucleoprotein A1) mediating nucleo-cytoplasmic mRNA transport and mRNA 455 stabilization, upregulates the CYP2A6 by stabilizing the mRNA and targeting it in the 456 endoplasmic reticulum during transcriptional arrests (Glisovic et al., 2003; Christian et al., 457 2004).

458 Based on sequence alignment analysis we have found up to five putative p53 binding 459 sites further upstream the CYP2A6 promoter within the 3k bp region upstream TATA box 460 (Hu et al., 2015). Some of these sites seem to overlap with an Nrf-2 binging site (Yokota et 461 al., 2011; Hu et al., 2015). We do not know whether all these sites are functional but our

462 preliminary studies have shown that some of them may contribute to the regulation of the 463 CYP2A6 gene. We made an intriguing observation suggesting that the Nrf-2 and p53 interact 464 at some of these sites in a way where the Nrf-2 seems to contain upregulation by p53. Such 465 interaction between the p53 and Nrf-2 has been observed for other genes including the phase 466 II metabolizing genes, NQO-1 and GST-1 (Faraonio et al., 2006; Wakabayashi et al., 2010) 467 and maybe related to optimizing cellular response to stress.

468 Four of the six stress-activated proteins now known to be involved in the CYP2A6 469 regulation: the hnRNPA1, Nrf-2, C/EBPα/Oct-1 and p53 are non-ligand binding proteins, 470 activated by divers cellular disturbances such as oxidative stress, macromolecular damage 471 and transcriptional arrests (Jin et al., 2001; Christian et al., 2004; Li et al., 2008; Riley et al., 472 2008; Ma, 2013). The PXR and CAR, on the other hand are activated by a multitude of 473 ligands including toxins, drugs and other diverse chemicals and xenobiotics (Kliewer et al., 474 2002; Timsit and Negishi, 2007; Kachaylo et al., 2011). The mechanisms of regulation of the 475 CYP2A6 gene by these proteins include both transcriptional and post-transcriptional 476 processes. For instance, during extreme form of stress leading to major disturbances in 477 cellular processes including transcriptional arrest, the CYP2A6 and its mouse analogue the 478 CYP2A5 are upregulated through posttranscriptional mechanisms including mRNA ( by 479 hnRNPA1) and protein (by substrate) stabilization (Glisovic et al., 2003; Christian et al., 480 2004; Abu-Bakar et al., 2012). Such mode of regulation is characteristic for genes vital for 481 cell survival.

482 In conclusion, it appears that the expression of the human CYP2A6 gene is controlled by 483 multiple, stress activated signaling pathways including ligand activated and non-ligand 484 activated TF:s. This could provide an explanation for the earlier observations where the 485 CYP2A6 was found to be up-regulated by a multitude of seemingly unrelated external insults. 486 Accordingly, viral and parasitic infestations, chronic inflammation, radiation, alcohol caused 487 liver injury and toxic insults by a variety structurally unrelated chemicals, are all known to 488 upregulate the gene (Kirby et al., 1994; Niemela et al., 2000; Glisovic et al., 2003; De- 489 Oliveira et al., 2006; Kirby et al., 2011). Such diversity of activators has led us to 490 hypothesize that, rather than any specific chemical or agent, changes in intracellular 491 conditions such as in redox potential, DNA or other macromolecular damage, maybe 492 important causes of the CYP2A6 induction. Indeed our recent findings that several, non- 493 ligand activated TF:s are involved in the regulation support this view.

494 In a series of investigations we have demonstrated that the CYP2A6 and its mouse 495 analogue, play an important role in maintaining optimal cellular homeostasis, besides 496 contributing to xenobiotic metabolism (Raunio et al., 2008; Miyazawa et al., 2011). The 497 enzymes have been shown to act as Bilirubin (BR) oxidases and, together with the HO-1 498 build a machinery that maintains optimal intracellular BR levels for cellular protection (Abu- 499 Bakar et al., 2011; Abu-Bakar et al., 2012; Abu-Bakar et al., 2013). BR is one of the most 500 potent antioxidants and because of its high lipophilicity, attaches to hydrophobic cellular 501 structures, such as membranes, lipids and protein surfaces (Stocker et al., 1987). Its 502 production in cells is known to increase during stress conditions and its crucial role in 503 protecting macromolecules against toxic insults is increasingly appreciated (Liu et al., 2003; 504 Jansen et al., 2010). On the other hand BR is toxic at high concentrations (Rodrigues et al., 505 2002). Therefore, a system needs to be in place to efficiently maintain its concentrations 506 within the therapeutic range. We have demonstrated that the two enzymes: CYP2A6/HO-1, 507 are upregulated in a coordinated fashion by similar stress stimuli and by similar mechanisms 508 to optimize the BR levels according to needs (Abu-Bakar et al., 2005; Muhsain et al., 2015). 509 We have also shown that in cells under stress, these enzymes are targeted to mitochondria to 510 adjust the BR levels locally according to needs. Probably, in order to protect the organelle 511 (Muhsain et al., 2015).

512 This crucial role of the CYP2A6 in cellular and mitochondrial protection may explain 513 its complex regulation by multiple, stress activated transcription factors and signaling 514 pathways. Some important questions remain to be answered regarding the role of the 515 CYP2A6 in cell protection. We have used the liver derived C3A cells as a model because the 516 CYP2A6 gene is highly expressed in the liver (Nakajima et al., 2006) and because most of the 517 transcription factors were expressed in these cells at rather high levels (Rodriguez-Antona et 518 al., 2002). How does the regulatory system work in other organs and/or cell types? This is 519 poorly understood, however, it is interesting to note that, in addition to the liver, the CYP2A6 520 or its close analogues are highly expressed in tissues or layers of cells, heavily exposed to 521 chemical or oxidative stress including the esophagus, lung, intestinal oral and nasal epithelia 522 (Su et al., 1996; Koskela et al., 1999; Janmohamed et al., 2001).

523 Another intriguing aspect of the CYP2A6 regulation is the contribution by p53: this 524 protein plays a dual role in cellular protection and apoptosis (Bensaad and Vousden, 2007).

525 Could it be that when p53 turns from protective to apoptotic mode, its role in regulation of 526 the CYP2A6 also changes? Our current work is focused on these challenging questions.

527

528 Conflict of interest statement 529 The authors declare that they have no conflict of interest in this work. 530 531 Acknowledgements 532 The authors would like to thank Professor Jukka Hakkola for HNF-4α expression plasmid, 533 Professor Paavo Honkakoski for CAR expression plasmid, Professor Masahiko Negishi for 534 C/EBPα expression plasmid and Professor Peter Mackenzie for Oct-1 expression plasmid. 535 This work was supported by the Cooperative Research Centre for Contamination and 536 Remediation of the Environment (CRC-CARE), Australia [2.1.04.11/12] and the University 537 of Queensland Early Career Researcher Grants Scheme [UQECR2013002328]. HH is a 538 recipient of the CRC-CARE PhD scholarship [2.1.04.11/12]. The Queensland Alliance for 539 Environmental Health Science (QAEHS) is a partnership between Queensland Health and the 540 University of Queensland. 541

542 References

543 Abu-Bakar, A., Arthur, D.M., Aganovic, S., Ng, J.C., Lang, M.A., 2011. Inducible bilirubin 544 oxidase: a novel function for the mouse cytochrome P450 2A5. Toxicology and 545 applied pharmacology 257, 14-22. 546 Abu-Bakar, A., Arthur, D.M., Wikman, A.S., Rahnasto, M., Juvonen, R.O., Vepsalainen, J., 547 Raunio, H., Ng, J.C., Lang, M.A., 2012. Metabolism of bilirubin by human 548 cytochrome P450 2A6. Toxicology and applied pharmacology 261, 50-58. 549 Abu-Bakar, A., Hakkola, J., Juvonen, R., Rahnasto-Rilla, M., Raunio, H., Lang, M.A., 2013. 550 Function and regulation of the Cyp2a5/CYP2A6 genes in response to toxic insults in 551 the liver. Current drug metabolism 14, 137-150. 552 Abu-Bakar, A., Lamsa, V., Arpiainen, S., Moore, M.R., Lang, M.A., Hakkola, J., 2007. 553 Regulation of CYP2A5 gene by the transcription factor nuclear factor (erythroid- 554 derived 2)-like 2. Drug metabolism and disposition: the biological fate of chemicals 555 35, 787-794. 556 Abu-Bakar, A., Moore, M.R., Lang, M.A., 2005. Evidence for induced microsomal bilirubin 557 degradation by cytochrome P450 2A5. Biochemical pharmacology 70, 1527-1535. 558 Bensaad, K., Vousden, K.H., 2007. p53: new roles in metabolism. Trends in cell biology 17, 559 286-291. 560 Christian, K., Lang, M., Maurel, P., Raffalli-Mathieu, F., 2004. Interaction of heterogeneous 561 nuclear ribonucleoprotein A1 with cytochrome P450 2A6 mRNA: implications for 562 post-transcriptional regulation of the CYP2A6 gene. Mol Pharmacol 65, 1405-1414.

563 Clewell, R.A., Sun, B., Adeleye, Y., Carmichael, P., Efremenko, A., McMullen, P.D., 564 Pendse, S., Trask, O.J., White, A., Andersen, M.E., 2014. Profiling Dose-Dependent 565 Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct 566 Mechanisms of DNA Damage. Toxicological Sciences 142, 56-73. 567 De-Oliveira, A.C., Da-Matta, A.C., Paumgartten, F.J., 2006. Plasmodium berghei (ANKA): 568 infection induces CYP2A5 and 2E1 while depressing other CYP isoforms in the 569 mouse liver. Exp Parasitol 113, 256-261. 570 Donato, M.T., Viitala, P., Rodriguez-Antona, C., Lindfors, A., Castell, J.V., Raunio, H., 571 Gomez-Lechon, M.J., Pelkonen, O., 2000. Cyp2a5/2a6 expression in mouse and 572 human hepatocytes treated with various in vivo inducers. Drug Metabolism and 573 Disposition. 28, 1321-1326. 574 el-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., Vogelstein, B., 1992. Definition of 575 a consensus binding site for p53. Nat Genet 1, 45-49. 576 Faraonio, R., Vergara, P., Di Marzo, D., Pierantoni, M.G., Napolitano, M., Russo, T., 577 Cimino, F., 2006. p53 suppresses the Nrf2-dependent transcription of antioxidant 578 response genes. The Journal of biological chemistry 281, 39776-39784. 579 Gambino, V., De Michele, G., Venezia, O., Migliaccio, P., Dall'Olio, V., Bernard, L., 580 Minardi, S.P., Della Fazia, M.A., Bartoli, D., Servillo, G., Alcalay, M., Luzi, L., 581 Giorgio, M., Scrable, H., Pelicci, P.G., Migliaccio, E., 2013. Oxidative stress activates 582 a specific p53 transcriptional response that regulates cellular senescence and aging. 583 Aging cell 12, 435-445. 584 Glisovic, T., Soderberg, M., Christian, K., Lang, M., Raffalli-Mathieu, F., 2003. Interplay 585 between transcriptional and post-transcriptional regulation of Cyp2a5 expression. 586 Biochemical pharmacology 65, 1653-1661. 587 Goodwin, B., Gauthier, K.C., Umetani, M., Watson, M.A., Lochansky, M.I., Collins, J.L., 588 Leitersdorf, E., Mangelsdorf, D.J., Kliewer, S.A., Repa, J.J., 2003. Identification of 589 bile acid precursors as endogenous ligands for the nuclear xenobiotic pregnane X 590 receptor. PNAS 100. 591 Higashi, E., Fukami, T., Itoh, M., Kyo, S., Inoue, M., Yokoi, T., Nakajima, M., 2007. Human 592 CYP2A6 is induced by estrogen via estrogen receptor. Drug metabolism and 593 disposition: the biological fate of chemicals 35, 1935-1941. 594 Hou, Y., Xue, P., Bai, Y., Liu, D., Woods, C.G., Yarborough, K., Fu, J., Zhang, Q., Sun, G., 595 Collins, S., Chan, J.Y., Yamamoto, M., Andersen, M.E., Pi, J., 2012. Nuclear factor 596 erythroid-derived factor 2-related factor 2 regulates transcription of 597 CCAAT/enhancer-binding protein beta during adipogenesis. Free radical biology & 598 medicine 52, 462-472. 599 Hu, H., Yu, T., Arpiainen, S., Lang, M.A., Hakkola, J., Abu-Bakar, A., 2015. Tumour 600 suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome 601 P450 2A6. Toxicology and applied pharmacology 289, 30-39. 602 Itoh, M., Nakajima, M., Higashi, E., Yoshida, R., Nagata, K., Yamazoe, Y., Yokoi, T., 2006. 603 Induction of human CYP2A6 is mediated by the pregnane X receptor with 604 peroxisome proliferator-activated receptor-gamma coactivator 1alpha. The Journal of 605 pharmacology and experimental therapeutics 319, 693-702. 606 Janmohamed, A., Dolphin, C.T., Phillips, I.R., Shephard, E.A., 2001. Quantification and 607 cellular localization of expression in human skin of genes encoding flavin-containing 608 monooxygenases and cytochromes P450. Biochemical pharmacology 62, 777-786. 609 Jansen, T., Hortmann, M., Oelze, M., Opitz, B., Steven, S., Schell, R., Knorr, M., Karbach, 610 S., Schuhmacher, S., Wenzel, P., Münzel, T., Daiber, A., 2010. Conversion of 611 biliverdin to bilirubin by biliverdin reductase contributes to endothelial cell protection

612 by heme oxygenase-1-evidence for direct and indirect antioxidant actions of bilirubin. 613 Journal of molecular and cellular cardiology 49, 186-195. 614 Jin, M., Kumar, A., Kumar, S., 2012. Ethanol-mediated regulation of cytochrome P450 2A6 615 expression in monocytes: role of oxidative stress-mediated PKC/MEK/Nrf2 pathway. 616 PloS one 7, e35505. 617 Jin, S., Fan, F., Fan, W., Zhao, H., Tong, T., Blanck, P., Alomo, I., Rajasekaran, B., Zhan, Q., 618 2001. Transcription factors Oct-1 and NF-YA regulate the p53-independent induction 619 of the GADD45 following DNA damage. Oncogene 20, 2683-2690. 620 Kachaylo, E.M., Pustylnyak, V.O., Lyakhovich, V.V., Gulyaeva, L.F., 2011. Constitutive 621 androstane receptor (CAR) is a xenosensor and target for therapy. Biochemistry. 622 Biokhimiia 76, 1087-1097. 623 Kirby, G.M., Chemin, I., Montesano, R., Chisari, F.V., Lang, M.A., Wild, C.P., 1994. 624 Induction of specific cytochrome P450 involved in aflatoxin B1 metabolism in 625 hepatitis B virus transgenic mice. Molecular carcinogenesis 11, 74-80. 626 Kirby, G.M., Nichols, K.D., Antenos, M., 2011. CYP2A5 induction and hepatocellular stress: 627 An adaptive response to perturbation of heme homeostasis. Current drug metabolism 628 12, 186-197. 629 Kliewer, S.A., Goodwin, B., Willson, T.M., 2002. The nuclear pregnane X receptor: a key 630 regulator of xenobiotic metabolism. Endocr Rev 23, 687-702. 631 Kobayashi, K., Hashimoto, M., Honkakoski, P., Negishi, M., 2015. Regulation of gene 632 expression by CAR: an update. Archives of toxicology 89, 1045-1055. 633 Koskela, S., Hakkola, J., Hukkanen, J., Pelkonen, O., Sorri, M., Saranen, A., Anttila, S., 634 Fernandez-Salguero, P., Gonzalez, F., Raunio, H., 1999. Expression of CYP2A genes 635 in human liver and extrahepatic tissue. Biochemical pharmacology 57, 1407-1413. 636 Latonen, L., Taya, Y., Laiho, M., 2001. UV-radiation induces dose-dependent regulation of 637 p53 response and modulates p53-HDM2 interaction in human fibroblasts. Oncogene 638 20, 6784-6793. 639 Li, Y., Bevilacqua, E., Chiribau, C.B., Majumder, M., Wang, C., Croniger, C.M., Snider, 640 M.D., Johnson, P.F., Hatzoglou, M., 2008. Differential control of the 641 CCAAT/enhancer-binding protein beta (C/EBPbeta) products liver-enriched 642 transcriptional activating protein (LAP) and liver-enriched transcriptional inhibitory 643 protein (LIP) and the regulation of gene expression during the response to 644 endoplasmic reticulum stress. The Journal of biological chemistry 283, 22443-22456. 645 Liu, Y., Zhu, B., Wang, X., Luo, L., Li, P., Paty, D.W., Cynader, M.S., 2003. Bilirubin as a 646 potent antioxidant suppresses experimental autoimmune encephalomyelitis: 647 implications for the role of oxidative stress in the development of multiple sclerosis. 648 Journal of neuroimmunology 139, 27-35. 649 Ma, Q., 2013. Role of nrf2 in oxidative stress and toxicity. Annual review of pharmacology 650 and toxicology 53, 401-426. 651 Meek, D.W., 2004. The p53 response to DNA damage. DNA repair 3, 1049-1056. 652 Miyazawa, M., Marumoto, S., Takahashi, T., Nakahashi, H., Haigou, R., Nakanishi, K., 653 2011. Metabolism of (+)- and (-)-menthols by CYP2A6 in human liver microsomes. J 654 Oleo Sci 60, 127-132. 655 Muhsain, S.N.F., Lang, M.A., Abu-Bakar, A.e., 2015. Mitochondrial targeting of bilirubin 656 regulatory enzymes: An adaptive response to oxidative stress. Toxicology and applied 657 pharmacology 282, 77-89. 658 Mukudai, Y., Kondo, S., Shiogama, S., Koyama, T., Li, C., Yazawa, K., Shintani, S., 2013. 659 Root bark extracts of Juncus effusus and Paeonia suffruticosa protect salivary gland 660 acinar cells from apoptotic cell death induced by cis-platinum (II) diammine 661 dichloride. Oncology reports 30, 2665-2671.

662 Nakajima, M., Itoh, M., Sakai, H., Fukami, T., Katoh, M., Yamazaki, H., Kadlubar, F.F., 663 Imaoka, S., Funae, Y., Yokoi, T., 2006. CYP2A13 expressed in human bladder 664 metabolically activates 4-aminobiphenyl. International journal of cancer. Journal 665 international du cancer 119, 2520-2526. 666 Nakajima, M., Yamamoto, T., Nunoya, K., Yokoi, T., Nagashima, K., Inoue, K., Funae, Y., 667 Shimada, N., Kamataki, T., Kuroiwa, Y., 1996. Characterization of CYP2A6 involved 668 in 3'-hydroxylation of cotinine in human liver microsomes. The Journal of 669 pharmacology and experimental therapeutics 277, 1010-1015. 670 Niemela, O., Parkkila, S., Juvonen, R.O., Viitala, K., Gelboin, H.V., Pasanen, M., 2000. 671 Cytochromes P450 2A6, 2E1, and 3A and production of protein-aldehyde adducts in 672 the liver of patients with alcoholic and non-alcoholic liver diseases. J Hepatol 33, 673 893-901. 674 Onica, T., Nichols, K., Larin, M., Ng, L., Maslen, A., Dvorak, Z., Pascussi, J.M., Vilarem, 675 M.J., Maurel, P., Kirby, G.M., 2008. Dexamethasone-mediated up-regulation of 676 human CYP2A6 involves the glucocorticoid receptor and increased binding of hepatic 677 nuclear factor 4 alpha to the proximal promoter. Mol Pharmacol 73, 451-460. 678 Osabe, M., Sugatani, J., Takemura, A., Kurosawa, M., Yamazaki, Y., Ikari, A., Miwa, M., 679 2009. Up-regulation of CAR expression through Elk-1 in HepG2 and SW480 cells by 680 serum starvation stress. FEBS letters 583, 885-889. 681 Pitarque, M., Rodriguez-Antona, C., Oscarson, M., Ingelman-Sundberg, M., 2005. 682 Transcriptional regulation of the human CYP2A6 gene. The Journal of pharmacology 683 and experimental therapeutics 313, 814-822. 684 Promega, 2015. pGL4.38[luc2P/p53 RE/Hygro] Vector Product Information. Promega 685 Corporation, Madison, WI, USA, pp. 686 Raunio, H., Hakkola, J., Pelkonen, O., 2008. Role in Metabolism and Toxicity of Drugs and 687 Other Xenobiotics. In Ioannides, C., (Ed.), Cytochrome P450 The Royal Society of 688 Chemistry, Cambridge, pp. 151-171. 689 Riley, T., Sontag, E., Chen, P., Levine, A., 2008. Transcriptional control of human p53- 690 regulated genes. Nat Rev Mol Cell Biol 9, 402-412. 691 Rodrigues, C.M., Sola, S., Brito, M.A., Brites, D., Moura, J.J., 2002. Bilirubin directly 692 disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat 693 mitochondria. J Hepatol 36, 335-341. 694 Rodriguez-Antona, C., Donato, M.T., Boobis, A., Edwards, R.J., Watts, P.S., Castell, J.V., 695 Gomez-Lechon, M.J., 2002. Cytochrome P450 expression in human hepatocytes and 696 hepatoma cell lines: molecular mechanisms that determine lower expression in 697 cultured cells. Xenobiotica; the fate of foreign compounds in biological systems 32, 698 505-520. 699 Staudinger, J.L., Goodwin, B., Jones, S.A., Hawkins-Brown, D., MacKenzie, K.I., LaTour, 700 A., Liu, Y., Klaassen, C.D., Brown, K.K., Reinhard, J., Willson, T.M., Koller, B.H., 701 Kliewer, S.A., 2001. The nuclear receptor PXR is a lithocholic acid sensor that 702 protects against liver toxicity. PNAS 98, 3369-3374. 703 Stocker, R., Yamamoto, Y., McDonagh, A.F., Glazer, A.N., Ames, B.N., 1987. Bilirubin is 704 an antioxidant of possible physiological importance. Science 235, 1043-1046. 705 Su, T., Sheng, J.J., Lipinskas, T.W., Ding, X., 1996. Expression of CYP2A genes in rodent 706 and human nasal mucosa. Drug Metabolism and Disposition. 24, 884-890. 707 Timsit, Y.E., Negishi, M., 2007. CAR and PXR: The Xenobiotic-Sensing Receptors. Steroids 708 72, 231-246. 709 Wakabayashi, N., Slocum, S.L., Skoko, J.J., Shin, S., Kensler, T.W., 2010. When NRF2 710 talks, who's listening? Antioxidants & redox signaling 13, 1649-1663. 711

712 Xie, F., Zhou, X., Genter, M.B., Behr, M., Gu, J., Ding, X., 2011. The tissue-specific toxicity 713 of methimazole in the mouse olfactory mucosa is partly mediated through target- 714 tissue metabolic activation by CYP2A5. Drug metabolism and disposition: the 715 biological fate of chemicals 39, 947-951. 716 Yamazaki, H., Inui, Y., Yun, C.H., Guengerich, F.P., Shimada, T., 1992. Cytochrome P450 717 2E1 and 2A6 enzymes as major catalysts for metabolic activation of N- 718 nitrosodialkylamines and tobacco-related nitrosamines in human liver microsomes. 719 Carcinogenesis 13, 1789-1794. 720 Yokota, S., Higashi, E., Fukami, T., Yokoi, T., Nakajima, M., 2011. Human CYP2A6 is 721 regulated by nuclear factor-erythroid 2 related factor 2. Biochemical pharmacology 722 81, 289-294. 723

724

725

726

727

728

729

730

731

732

733

734

735

736

737

738

739

740

741

742

743

744

745

Primers Sequences Site-directed mutagenesis: CYP2A6-p53mut FW1 5’-ACCAGTGGGGATCCTAGTTGGGAGGTGAAATG-3’ CYP2A6-p53mut FW2 5’-ACCAGTGGGGATCCTAGTTGGGCCCCGAAATG-3’ CYP2A6-p53mut FW3 5’GACATGCCTAGACATGCCTTTGGGAGGTGAAATGAG-3’ CYP2A6-DR-4mut FW1 5’-GGGCCCCGAAATGAGGTAATTATGTAATCAGCC-3’ CYP2A6-DR-4mut FW2 5’-GGGCCCCGAAATGAGGTAACACGAATTCCAG-3’ CYP2A6-C/EBPmut FW1 5’-GTAACACGAATTCCAGCCAAAGTCCATCCCTC-3’ CYP2A6-C/EBPmut FW2 5’-GTAACACGAATTCCAGCCAACGTCTCTCCCTC-3’ CYP2A6-HNF4αmut FW1 5’-CAGCCAACGTCTCTCCCTCTTTTTCAGGCAGT-3’ CYP2A6-p53mut RV1 5’-TAGGATCCCCACTGGTAATCCTGCCTAGCTTGG-3’ CYP2A6-p53mut RV2 5’-AGGCATGTCTAGGCATGTCTCCTGCCTAGCTTGGGA-3’ CYP2A6-DR-4mut RV1 5’-CCTCATTTCGGGGCCCAACTACATGCCCCA-3’ CYP2A6-DR-4mut RV2 5’-CCTCATTTCGGGGCCCAACTAGGATCCCCA-3’ CYP2A6-C/EBPmut RV1 5’-CTGGAATTCGTGTTACCTCATTTCACCTCCC-3’ CYP2A6-C/EBPmut RV2 5’-CTGGAATTCGTGTTACCTCATTTCGGGGC-3’ CYP2A6-HNF4αmut RV1 5’-GGGAGAGACGTTGGCTGATTACATAATTACCTC-3’ CYP2A6-HNF4αmut RV2 5’-GGGAGAGACGTTGGCTGGAATTCGTGTTAC-3’ PCR Amplification CYP2A6 5’ -160KpnI FW 5’-GACGGTACCTTATCCTCCCTTGCTGGCTG-3’ CYP2A6 5’ +9NheI RV 5’-GACGCTAGCGGTGGTAGTGGGATGATAGATG-3’ CYP2A6 5’ -141 FW 5’-TGTGTCCCAAGCTAGGCAG-3’ CYP2A6 5’ +9 RV 5’-GGTGGTAGTGGGATGATAGATG-3’ EMSA CYP2A6-5’-127/-98-FW 5’-CAGGATTCATGGTGGGGCATGTAGTTGGGA-3’ CYP2A6-5’-127/-98-RV 5’-TCCCAACTACATGCCCCACCATGAATCCTG-3’ CYP2A6-5’-103/-80-FW 5’-GTTGGGAGGTGAAATGAGGTAATT-3’ CYP2A6-5’-103/-80-RV 5’-AATTACCTCATTTCACCTCCCAAC-3’ CYP2A6-5’-92/-65-FW 5’-AAATGAGGTAATTATGTAATCAGCCAAA-3’ CYP2A6-5’-92/-65-RV 5’-TTTGGCTGATTACATAATTACCTCATTT-3’ CYP2A6-5’-77/-53-FW 5’-GTAATCAGCCAAAGTCCATCCCTCT-3’ CYP2A6-5’-77/-53-RV 5’-AGAGGGATGGACTTTGGCTGATTAC-3’ 746 Table 1: Oligonucleotides used for amplifications in site directed mutagenesis, Real-time 747 PCR and EMSA experiments.

748

749 Figure legends

750 Figure 1: Effect of transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α on CYP2A6- 751 5’-160/+9 Luc construct activity in C3A cells. (A) Effect of p53, CAR, C/EBPα, Oct-1 and 752 HNF-4α co-transfections on CYP2A6 promoter driven luciferase activities. C3A cells were 753 co-transfected with either CYP2A6-5’-160/+9 Luc plasmid or pGL3-Basic plasmid together 754 with p53, CAR, C/EBPα, Oct-1 or HNF-4α expression plasmids, or empty cloning vector 755 (pcDNA3) respectively, and pMAX-GFP (transfection control plasmid). The firefly 756 luciferase activities were measured 24 h after transfection. The measured activities were 757 normalized against pMAX-GFP activity, and the expression vector/empty vector ratios were 758 calculated and normalized with regard to the related pGL3-Basic activities. The CYP2A6-5’- 759 160/+9 Luc construct activity driven by each overexpressed transcription factor is indicated 760 by -fold induction of the Relative Luciferase activity (RLA) to control co-transfection with 761 pcDNA3. The values (n = 4) represent means ± S.D. Mean difference is significant from 762 control group at ****, p < 0.0001; **, p < 0.005; (Student’s t test). (B) Western blotting and 763 (C) densitometry of p53, CAR, C/EBPα, Oct-1 and HNF-4α expressions in C3A cells 764 transfected with p53, CAR, C/EBPα, Oct-1 and HNF-4α expression plasmids. Each 765 transfection was done in triplicate. Positive controls (+), A-431 whole cell lysate was used to 766 indicate p53, C/EBPα transfected C3A nuclear extract was used to indicate C/EBPα and 767 HepG2 whole cell lysate was used to indicate CAR, Oct-1 and HNF-4α. Relative protein 768 expression (bar graph) = the intensity of overexpressed bands relative to the intensity of β- 769 actin bands. The values (n = 3) represent means ± S.D. Mean difference is significant from 770 control group at ****, p < 0.0001; **, p < 0.005; *, p < 0.05 (Student’s t test).

771

772 Figure 2: Site direct mutagenesis of the response elements on proximal CYP2A6 promoter 773 region. (A) Schematic representation of the response elements on the CYP2A6-5’-160/+9 774 Luc construct. Four REs including p53RE, DR-4RE for CAR binding, C/EBP-Oct-1RE and 775 HNF-4αRE are underlined. (B) Schematic representation of the mutated REs on the CYP2A6- 776 5’-160/+9 Luc construct. The REs were mutated individually and in combination (mutated 777 bases in bold).

778

779 Figure 3: Mutational analysis of the CYP2A6-5’-160/+9 Luc construct in C3A cells. (A) 780 Effect of single RE mutations on the proximal CYP2A6 promoter activities in C3A cells. (B) 781 Effect of triple RE mutations on the proximal CYP2A6 promoter activities in C3A cells. (C) 782 Effect of double RE mutations on the proximal CYP2A6 promoter activities in C3A cells. (D) 783 Effect of all sites mutations on the proximal CYP2A6 promoter activities in C3A cells. The 784 REs on the CYP2A6-5’-160/+9 Luc construct were mutated individually and in combination 785 (figure 2B), followed by co-transfection of the mutated promoters and pMAX-GFP into the 786 C3A cells. The negative and positive controls for transfection were indicated by transfections 787 of pGL3-Basic and pGL3 containing SV-40 promoter into the C3A cells respectively. A 788 schematic representation of the mutated CYP2A6-5’-160/+9 Luc construct is shown on the 789 left, where the mutated REs for transcription factors are shown with a cross. The promoter 790 activity of each mutated construct was compared against the pGL3-Basic activity and 791 wildtype proximal CYP2A6 promoter activity, indicated by “*” and “#” respectively. The 792 firefly luciferase activities were measured 24 h after transfection. The measured activities of 793 each mutated construct were normalized against pMAX-GFP activity (transfection control 794 plasmid), and were expressed as arbitrary units relative to the wildtype proximal CYP2A6 795 promoter activity. The values (n = 4) represent means ± S.D. Mean difference is significant at 796 ****, p < 0.0001; ***; p < 0.0005; ####, p < 0.0001 (one-way analysis of variance 797 (ANOVA) followed by the least significant difference post hoc test).

798

799 Figure 4: Effect of p53 co-transfection on the REs mutated CYP2A6-5’-160/+9 Luc construct 800 activities in C3A cells. C3A cells were co-transfected with a series of RE mutated CYP2A6- 801 5’-160/+9 Luc construct together with p53 expression plasmid (pcDNA3-hp53) or empty 802 expression plasmid (pcDNA3). The schematic representation of the mutated CYP2A6-5’- 803 160/+9 Luc constructs is shown on left with a cross for the mutated REs. The pGL4.38- 804 p53RE plasmid containing two copies of consensus p53RE was used as positive control to 805 indicate p53 co-transfection in C3A cells. Promoter less pGL3-Basic was used as negative 806 control to indicate the transfection in C3A cells. The measured luciferase activities were 807 normalized against co-transfected pMAX-GFP control plasmid activities. The values (n = 4) 808 represent the means ± S.D. p53 response of each reporter construct is indicated by -fold 809 induction of the Relative Luciferase activity (RLA) to control co-transfection with pcDNA3. 810 Mean difference is significant from control group at ****, p < 0.0001; ***, p < 0.0005; **, p 811 < 0.005; *, p < 0.05 (Student’s t test). ns = no significance.

812 Figure 5: EMSA analysis of the transcription factors p53, CAR, C/EBPα, Oct-1 and HNF-4α 813 binding to the proximal CYP2A6 promoter. EMSA procedures are shown under Materials 814 and Method. The DNA probes covering the respective REs on the proximal CYP2A6 815 promoter region and the antibodies used in the assay are shown above the EMSA blot. The 816 nuclei protein fractions were extracted from the transcription factor expression plasmids 817 transfected C3A cells. The Nrf-2 antibody was used as control for unspecific binding (a 818 protein present in the nuclear extract but with no binding sites at the promoter). (A) The 819 probe CYP2A6-5’-127/-98 corresponding to the p53RE was incubated with p53 820 overexpressed nuclear extract (lane 2). The formed DNA/protein complex was supershifted 821 by p53 antibody (lane 3) but not with the Nrf-2 antibody (lane 4). (B) The probe CYP2A6-5’- 822 103/-80 corresponding to the DR-4RE was incubated with CAR overexpressed nuclear 823 extract (lane 2). The formed DNA/protein complex was recognised by CAR and RXR 824 (heterodimer of CAR) antibodies (lane 3 & lane 4), but not with the Nrf-2 antibody (lane 5). 825 (C) And (D) The probe CYP2A6-5’-92/-65 corresponding to the C/EBPα-Oct-1RE was 826 incubated with Oct-1 or C/EBPα overexpressed nuclear extracts (C and D, lane 2). The 827 formed DNA/protein complex was shifted by Oct-1 antibody (C, lane 3), but only weakly and 828 diffusely shifted by C/EBPα antibody (D, lane 3). No supershifted complex was observed 829 when the mixtures were incubated with Nrf-2 antibody (C and D, lane 4). (E) The probe 830 CYP2A6-5’-77/-53 corresponding to the HNF-4αRE was incubated with HNF-4α 831 overexpressed nuclear extract, forming two DNA/protein complexes (lane 2). Only the upper 832 complex was totally pulled up by HNF-4α antibody (lane 3). No supershifted complex was 833 observed with the Nrf-2 antibody (lane 4). Lane 1 in all EMSA blots represents probe 834 incubations without nuclei proteins. The supershifted DNA-protein complexes are indicated 835 by arrows. The experiment was repeated 3 times with similar results.

836

837 Figure 6: Effect of p53 co-transfection on the luciferase activity of the proximal CYP2A6 838 promoter containing a consensus p53RE. (A) The differences between the CYP2A6-5’p53RE 839 and the consensus p53RE sequences are indicated in the boxed regions, showing different 840 satellite sequences. The p53 binding core sequences are shown in bold. (B) The p53RE on the 841 proximal CYP2A6 promoter was mutated into a consensus p53RE as described: 5’- 842 ATTCATGGTGGGGCATGTAG-3’→5’-AGACATGCCTAGACATGCCT-3’ in CYP2A6- 843 5’-160/+9 Luc construct, with the mutated bases underlined and the core sequences in bold. 844 The C3A cells were co-transfected with the wildtype CYP2A6-5’-Luc construct or the

845 CYP2A6-5’-Luc construct containing consensus p53RE together with p53 expression plasmid 846 (pcDNA3-hp53) or empty plasmid (pcDNA3). The pGL4.38-p53RE plasmid containing two 847 copies of consensus p53RE was used as positive control to indicate p53 co-transfection in 848 C3A cells. Promoterless pGL3-Basic serves as a negative control for the transfection. The 849 luciferase activities were measured 24h after transfection and were normalized against co- 850 transfected pMAX-GFP control plasmid activities. The values (n = 4) represent the means ± 851 S.D. p53 response of each reporter construct is indicated by -fold induction of the Relative 852 Luciferase activity (RLA) to control co-transfection with pcDNA3. Mean difference is 853 significant from control group at ****, p < 0.0001; **, p < 0.005; *, p < 0.05 (Student’s t 854 test). ns = no significance. 855 856 Figure 7: Schematic representation of the transcriptional regulation of the proximal CYP2A6 857 promoter. (A) A “stress cluster” on the proximal CYP2A6 promoter region. Proximal 858 CYP2A6 transactivation is governed by the stress activated transcription factors p53, CAR, 859 C/EBPα, Oct-1 and nuclear factor HNF-4α. (B) A model depicts interaction between p53 and 860 the other transcription factors in mediating CYP2A6 transactivation. P53- mediated CYP2A6 861 transactivation is dependent on the interaction with CAR and C/EBP-Oct-1, and for its full 862 activity it is supported by HNF-4α.

863

864

865

866

867

868

869

870

871

872

873 Figure 1

874

875 Figure 2

876

877

878

879

880

881

882

883

884

885

886

887

888

889

890

891 Figure 3

892

893

894

895 Figure 4

896

897

898

899

900

901

902

903

904

905

906

907

908 Figure 5

909

910

911

912 Figure 6

913

914

915

916

917

918

919

920

921

922

923

924

925

926 Figure 7

927

928

929

930

931

932

933

934

935

936

937

938

939

940

941

942

943

944 Suppl. Figure 1: EMSA analysis of transcription factors binding to the proximal CYP2A6 945 promoter. The CYP2A6-5’-149/+9 probe covering all the response elements binding to the 946 proximal CYP2A6 promoter region and the antibodies used in the analysis are indicated 947 above the EMSA blot. Nuclei proteins are the mixture of the nuclear fractions that were 948 extracted from p53, CAR, C/EBPα, Oct-1 or HNF-4α transfected C3A cells. Lane 1 949 represents the probe incubation without nuclei proteins. Lane 2 represents the probe 950 incubation with nuclei proteins. Lanes 3-8 represent the probe incubations with nuclei 951 proteins and respective antibodies. The experiment was repeated 3 times with similar results.