Original Article Utilizing Network Pharmacology to Explore the Scientific Connotation of Processing Technology About Rehmanniae Radix Praeparata

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Int J Clin Exp Med 2019;12(12):13504-13513 www.ijcem.com /ISSN:1940-5901/IJCEM0100588 Original Article Utilizing network pharmacology to explore the scientific connotation of processing technology about Rehmanniae Radix Praeparata Ruoqi Li, Guowei Zhou, Tianwei Xia, Yuxuan Wang, Chaoqun Ma, Jirong Shen Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing 210029, Jiangsu, China Received August 5, 2019; Accepted October 8, 2019; Epub December 15, 2019; Published December 30, 2019 Abstract: Objective: Network pharmacology method was adopted in this study to establish differential component- target network of Rehmanniae Radix Praeparata before and after “steamed for nine times and dried for nine times”, explore the mechanism of the difference of pharmacological effect, reveal the scientific connotation of the process- ing method. Methods: The different components of Rehmanniae Radix Praeparata before and after “steamed for nine times and dried for nine times” were detected by consulting and screening the literature. PubChem database was used to convert all compounds to standard Canonical SMILES format. SMILES format files were imported into Swiss Target Prediction platform to predict potential targets for different components (possibility > 0). Targets with the highest confidence (score 0.900) were screened from STRING database to construct protein-protein interaction network. GO enrichment and KEGG pathway enrichment were analyzed by ClusterProfiler package in R language. Results: A total of 12 different components (catalpol, ajugol, Rehmannioside A, Acteoside, 5-hydroxymethy lfurfu- ral, Isoacteoside, stachyose, D(+)-Sucrose, raffinose, fructose, glucose and Manninotriose) were screened through literature review, and 101 potential targets were predicted. The GO analysis contained a total of 113 enrichment results. A total of 15 pathways were enriched by KEGG. Conclusion: The changes of glucoses (stachyose, raffinose and Manninotriose) in Rehmanniae Radix Praeparata may be the main reason for the enhancement of the tonifying effect (such as Notch signaling pathway, neuroactive ligand receptor interaction, etc.) after “steamed for nine times and dried for nine times”. The changes of iridoid terpenoids (catalpol, ajugol, rehmannin A, etc.) and carbohydrates (D(+)-Sucrose, raffinose, glucose, Manninotriose, etc.) may be the reasons for the loss of the hypoglycemic effect of Rehmanniae Radix Praeparata after “steamed for nine times and dried for nine times”. The change of pharmaco- logical action is the result from chemical composition interaction of Rehmanniae Radix Praeparata. Keywords: Rehmanniae Radix Praeparata, network pharmacology, steamed for nine times and dried for nine times, differential components, efficacy Introduction manniae Radix Praeparata before and after “steamed for nine times and dried for nine Rehmannia glutinosa is root of Rehmannia glu- times”, but the specific mechanism is unclear. tinosa. The Rehmanniae Radix can be divided into fresh Rehmanniae Radix, Rehmanniae Ra- Network pharmacology abolish the traditional dix, Rehmanniae Radix Praeparata. “Rehman- research mode of “one target, one disease, one niae Radix Praeparata” and its processing drug” [1]. The strategy resonates well with the method are first recorded in “prepared qianjin holistic view of traditional Chinese medicine yaofang” and “qianjin yifang” written by Simiao (TCM), which is referred to as “multi-ingredient, Sun. Although processing technology of Re- multi-pathway and multi-target synergy”. In re- hmanniae Radix Praeparata is controversial, cent years, many related research reports indi- herbalists regard “steamed for nine times and cate that exploring the molecular mechanism of dried for nine times” as processing criteria. Sci- TCM efficacy will become possible. This study entists have discovered the differences of the retrieved the difference of composition and content and pharmacological effects of Reh- its targets of Rehmanniae Radix Praeparata Processing technology and Rehmanniae Radix Praeparata ncbi.nlm.nih.gov/pu), and fil- tered out the components th- at have been verified the con- tent of Rehmanniae Radix Pr- aeparata before and after “st- eamed for nine times and dri- ed for nine times”. All acti- ve compounds in Rehmanni- ae Radix Praeparata were input to the Pubchem data- base (https://pubchem.ncbi. nlm.nih.gov/) [4] to obtain the Canonical SMILES. Prediction of potential targets of different components and construction of compound- target network Swiss Target Prediction (ht- tp://www.swisstarge tpredic- tion.ch/) is a network platform that can predict small mole- cule targets on the basis of the 2D and 3D similarity mea- Figure 1. Flowchart of utilizing network pharmacology to explore the scien- surements of ligands [5]. Fir- tific connotation of “steamed for nine times and dried for nine times” about stly, the Canonical SMILES of Rehmanniae Radix Praeparata. compounds were submitted to the platform. Then, the prop- before and after “steamed for nine times and erty was set to “Homo Sapiens” to obtain the dried for nine times”, used bioinformatics meth- predicted targets (Possibility > 0). The results ods to explore the scientific connotation of pro- are visualized using Cytoscape 3.2.1. cessing methods, “steamed for nine times and dried for nine times”, in order to provide a basis Construction of protein-protein interaction for further research and wide application in (PPI) network clinic. The workflow of this study was shown in STRING database (http://string-db.org) can as- Figure 1. sess and integrate direct (physical) and indirect Methods (chemical) associations among proteins [6]. The target data were uploaded to the STRING Screening of different components of database, the attribute was set to “Homo Sa- Rehmanniae Radix Praeparata before and af- piens”, the confidence score was set to the highest confidence (score 0.900), and the pro- ter “steamed for nine times and dried for nine tein-protein interaction network (PPI) was con- times” structed. We consulted the literature related to the meth- Enrichment analysis of the GO function and od “steamed for nine times and dried for nine KEGG pathway times” about Rehmanniae Radix Praeparata (by the end of June 1, 2019, and removed the We used the org.Hs.eg.db packet in the R lan- non-“steamed for nine times and dried for ni- guage to convert the gene name to Entirez IDs, ne times” processing methods) in the China then used the ClusterProfiler packet to enrich National Knowledge Infrastructure (Http:// the network with GO enrichment and KEGG www.cnki.net/) and PubMed (Https://www. enrichment pathways [7]. The pathways whose 13505 Int J Clin Exp Med 2019;12(12):13504-13513 Processing technology and Rehmanniae Radix Praeparata P-values were less than 0.05 were considered Enrichment analysis of the GO function and statistically significant. KEGG pathway Results A total of 113 enrichment results were ana- lyzed in the GO analysis. 15 results were relat- Screening of different components of ed to cellular component (CC), 23 results were Rehmanniae Radix Praeparata before and af- related to molecular function (MF), 75 results ter “steamed for nine times and dried for nine were related to biological process (BP). The top times” 20 results were listed in Table 2 according to P value from low to high. Most of them were relat- The results showed the content of Catalpol, ed to the biological processes, such as Notch Acteoside, ajugol, stachyose, D(+)-Sucrose, Raf- receptor processing, adenylate cyclase-activat- finose decreased, and the content of Rehman- ing adrenergic receptor signaling pathway, ade- nioside_A, 5-hydroxymethylfurfural, Isoacteosi- nosine receptor signaling pathway, release of de, Fructose, glucose, Manninotriose in Rehm- sequestered calcium ion into cytosol, one-car- anniae Radix Praeparata increased after “stea- bon metabolic process, glycogen catabolic pro- med for nine times and dried for nine times” cess, and so on. Cell composition included inte- [8-10]. Cycloenedoid terpenoids D was not gral component of plasma membrane, gamma- included in the study due to the content re- secretase complex, extracellular matrix, and so mained controversial. on. G-protein coupled adenosine receptor activity, adrenergic receptor activity, endopepti- Prediction of potential targets of different dase activity, neurotransmitter receptor activi- components and construction of composition- ty, etc. were related to molecular functions. target network A total of 15 pathways were enriched by KEGG After obtaining the Canonical SMILES format of (Figure 4). Most of them were related to metab- the compound, the Swiss Target Prediction da- olism, such as starch and sucrose metabolism, tabase predicted a total of 280 potential tar- galactose metabolism, fructose and mannose gets and 101 potential targets (Table 1) after metabolism, nitrogen metabolism, and so on. removing duplication. All 101 potential targets In addition, many genes were enriched in ner- were used to build a component-target network vous system-related pathways, such as neuro- (Figure 2). There were a total of 113 nodes and active ligand-receptor interaction, Notch signal- 280 edges in the network. The green rectangle ing pathway, calcium signaling pathway, and so represented the difference between the ingre- on. dients before and after “steamed for nine times and dried for nine times”, the yellow oval repre- Discussion sented the predicted targets, and the edges between nodes represented the relationships
Recommended publications
  • Upregulation of Peroxisome Proliferator-Activated Receptor-Α And

    Upregulation of Peroxisome Proliferator-Activated Receptor-Α And

    Upregulation of peroxisome proliferator-activated receptor-α and the lipid metabolism pathway promotes carcinogenesis of ampullary cancer Chih-Yang Wang, Ying-Jui Chao, Yi-Ling Chen, Tzu-Wen Wang, Nam Nhut Phan, Hui-Ping Hsu, Yan-Shen Shan, Ming-Derg Lai 1 Supplementary Table 1. Demographics and clinical outcomes of five patients with ampullary cancer Time of Tumor Time to Age Differentia survival/ Sex Staging size Morphology Recurrence recurrence Condition (years) tion expired (cm) (months) (months) T2N0, 51 F 211 Polypoid Unknown No -- Survived 193 stage Ib T2N0, 2.41.5 58 F Mixed Good Yes 14 Expired 17 stage Ib 0.6 T3N0, 4.53.5 68 M Polypoid Good No -- Survived 162 stage IIA 1.2 T3N0, 66 M 110.8 Ulcerative Good Yes 64 Expired 227 stage IIA T3N0, 60 M 21.81 Mixed Moderate Yes 5.6 Expired 16.7 stage IIA 2 Supplementary Table 2. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of an ampullary cancer microarray using the Database for Annotation, Visualization and Integrated Discovery (DAVID). This table contains only pathways with p values that ranged 0.0001~0.05. KEGG Pathway p value Genes Pentose and 1.50E-04 UGT1A6, CRYL1, UGT1A8, AKR1B1, UGT2B11, UGT2A3, glucuronate UGT2B10, UGT2B7, XYLB interconversions Drug metabolism 1.63E-04 CYP3A4, XDH, UGT1A6, CYP3A5, CES2, CYP3A7, UGT1A8, NAT2, UGT2B11, DPYD, UGT2A3, UGT2B10, UGT2B7 Maturity-onset 2.43E-04 HNF1A, HNF4A, SLC2A2, PKLR, NEUROD1, HNF4G, diabetes of the PDX1, NR5A2, NKX2-2 young Starch and sucrose 6.03E-04 GBA3, UGT1A6, G6PC, UGT1A8, ENPP3, MGAM, SI, metabolism
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology

    Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology

    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
  • Identification and Characterization of Genes That Control Fat

    Identification and Characterization of Genes That Control Fat

    Claire D’Andre et al. Journal of Animal Science and Biotechnology 2013, 4:43 http://www.jasbsci.com/content/4/1/43 JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY RESEARCH Open Access Identification and characterization of genes that control fat deposition in chickens Hirwa Claire D’Andre1,3*, Wallace Paul2, Xu Shen3, Xinzheng Jia3, Rong Zhang3, Liang Sun3 and Xiquan Zhang3 Abstract Background: Fat deposits in chickens contribute significantly to meat quality attributes such as juiciness, flavor, taste and other organoleptic properties. The quantity of fat deposited increases faster and earlier in the fast- growing chickens than in slow-growing chickens. In this study, Affymetrix Genechip® Chicken Genome Arrays 32773 transcripts were used to compare gene expression profiles in liver and hypothalamus tissues of fast-growing and slow-growing chicken at 8 wk of age. Real-time RT-PCR was used to validate the differential expression of genes selected from the microarray analysis. The mRNA expression of the genes was further examined in fat tissues. The association of single nucleotide polymorphisms of four lipid-related genes with fat traits was examined in a F2 resource population. Results: Four hundred genes in the liver tissues and 220 genes hypothalamus tissues, respectively, were identified to be differentially expressed in fast-growing chickens and slow-growing chickens. Expression levels of genes for lipid metabolism (SULT1B1, ACSBG2, PNPLA3, LPL, AOAH) carbohydrate metabolism (MGAT4B, XYLB, GBE1, PGM1, HKDC1)cholesttrol biosynthesis (FDPS, LSS, HMGCR, NSDHL, DHCR24, IDI1, ME1) HSD17B7 and other reaction or pro- cesses (CYP1A4, CYP1A1, AKR1B1, CYP4V2, DDO) were higher in the fast-growing White Recessive Rock chickens than in the slow-growing Xinghua chickens.
  • MMP-25 Metalloprotease Regulates Innate Immune Response Through NF- Κb Signaling Clara Soria-Valles, Ana Gutiérrez-Fernández, Fernando G

    MMP-25 Metalloprotease Regulates Innate Immune Response Through NF- Κb Signaling Clara Soria-Valles, Ana Gutiérrez-Fernández, Fernando G

    MMP-25 Metalloprotease Regulates Innate Immune Response through NF- κB Signaling Clara Soria-Valles, Ana Gutiérrez-Fernández, Fernando G. Osorio, Dido Carrero, Adolfo A. Ferrando, Enrique Colado, This information is current as M. Soledad Fernández-García, Elena Bonzon-Kulichenko, of September 27, 2021. Jesús Vázquez, Antonio Fueyo and Carlos López-Otín J Immunol 2016; 197:296-302; Prepublished online 3 June 2016; doi: 10.4049/jimmunol.1600094 Downloaded from http://www.jimmunol.org/content/197/1/296 Supplementary http://www.jimmunol.org/content/suppl/2016/06/01/jimmunol.160009 Material 4.DCSupplemental http://www.jimmunol.org/ References This article cites 41 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/197/1/296.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology MMP-25 Metalloprotease Regulates Innate Immune Response through NF-kB Signaling Clara Soria-Valles,* Ana Gutie´rrez-Ferna´ndez,* Fernando G.
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Supplementary Methods

    Supplementary Methods

    Supplementary methods Human lung tissues and tissue microarray (TMA) All human tissues were obtained from the Lung Cancer Specialized Program of Research Excellence (SPORE) Tissue Bank at the M.D. Anderson Cancer Center (Houston, TX). A collection of 26 lung adenocarcinomas and 24 non-tumoral paired tissues were snap-frozen and preserved in liquid nitrogen for total RNA extraction. For each tissue sample, the percentage of malignant tissue was calculated and the cellular composition of specimens was determined by histological examination (I.I.W.) following Hematoxylin-Eosin (H&E) staining. All malignant samples retained contained more than 50% tumor cells. Specimens resected from NSCLC stages I-IV patients who had no prior chemotherapy or radiotherapy were used for TMA analysis by immunohistochemistry. Patients who had smoked at least 100 cigarettes in their lifetime were defined as smokers. Samples were fixed in formalin, embedded in paraffin, stained with H&E, and reviewed by an experienced pathologist (I.I.W.). The 413 tissue specimens collected from 283 patients included 62 normal bronchial epithelia, 61 bronchial hyperplasias (Hyp), 15 squamous metaplasias (SqM), 9 squamous dysplasias (Dys), 26 carcinomas in situ (CIS), as well as 98 squamous cell carcinomas (SCC) and 141 adenocarcinomas. Normal bronchial epithelia, hyperplasia, squamous metaplasia, dysplasia, CIS, and SCC were considered to represent different steps in the development of SCCs. All tumors and lesions were classified according to the World Health Organization (WHO) 2004 criteria. The TMAs were prepared with a manual tissue arrayer (Advanced Tissue Arrayer ATA100, Chemicon International, Temecula, CA) using 1-mm-diameter cores in triplicate for tumors and 1.5 to 2-mm cores for normal epithelial and premalignant lesions.
  • Efficient Entry to Both Enantiomers of Α-Halohydrins Employing Two

    Efficient Entry to Both Enantiomers of Α-Halohydrins Employing Two

    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2015 Supporting information Enantioselectively bioreductive preparation of chiral halohydrins employing two newly identified stererocomplementary reductases Guo-chao Xu,1,2 Hui-lei Yu,1,* Yue-peng Shang,1 Jian-he Xu1 1 State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, and Shanghai Collaborative Innovation Center for Biomanufacturing Technology, Shanghai 200237, China. 2 The Key Laboratory of Industrial Biotechnology, Ministry of Education, School of Biotechnology, Jiangnan University, Wuxi 214122, China. *Corresponding authors. E-mail: [email protected]; [email protected]. Table S1 Typical sequence motifs of SDR and AKR superfamily found in DhCR and CgCR..........2 Table S2 The secondary structure elements motif in ‘classical’ SDR, ‘extended’ SDR and DhCR.3 Table S3 Steady-state kinetic constants of stererocomplementary DhCR and CgCR......................4 Table S4 Substrate specificities of stererocomplementary DhCR and CgCR. ...................................5 Table S5 Concentrations of NAD+ and NADP+ in the fresh wet cells and dry cells. ..........................6 Table S6 Optimization of DhCR and CgCR catalyzed asymmetric reduction of COBE....................7 Table S7 Comparison of the characteristics of reported enzymes that produce optically active CHBE. ............................................................................................................................................................8
  • Development of Potent and Selective Inhibitors of Aldo−Keto Reductase

    Development of Potent and Selective Inhibitors of Aldo−Keto Reductase

    Article pubs.acs.org/jmc Development of Potent and Selective Inhibitors of Aldo−Keto Reductase 1C3 (Type 5 17β-Hydroxysteroid Dehydrogenase) Based on N-Phenyl-Aminobenzoates and Their Structure−Activity Relationships † § ‡ § † † † ‡ Adegoke O. Adeniji, , Barry M. Twenter, , Michael C. Byrns, Yi Jin, Mo Chen, Jeffrey D. Winkler,*, † and Trevor M. Penning*, † Department of Pharmacology and Center of Excellence in Environmental Toxicology, Perelman School of Medicine, University of Pennsylvania, 130C John Morgan Building, 3620 Hamilton Walk, Philadelphia, Pennsylvania 19104-6084, United States ‡ Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104, United States *S Supporting Information ABSTRACT: Aldo−keto reductase 1C3 (AKR1C3; type 5 17β-hydroxy- steroid dehydrogenase) is overexpressed in castration resistant prostate cancer (CRPC) and is implicated in the intratumoral biosynthesis of testosterone and 5α-dihydrotestosterone. Selective AKR1C3 inhibitors are required because compounds should not inhibit the highly related AKR1C1 and AKR1C2 isoforms which are involved in the inactivation of 5α-dihydrotestosterone. NSAIDs, N-phenylanthranilates in particular, are potent but nonselective AKR1C3 inhibitors. Using flufenamic acid, 2-{[3-(trifluoromethyl)phenyl]amino}- benzoic acid, as lead compound, five classes of structural analogues were synthesized and evaluated for AKR1C3 inhibitory potency and selectivity. Structure−activity relationship (SAR) studies revealed that a meta-carboxylic acid group relative to the amine conferred pronounced AKR1C3 selectivity without loss of potency, while electron withdrawing groups on the phenylamino B-ring were optimal for AKR1C3 inhibition. Lead compounds did not inhibit COX-1 or COX-2 but blocked the AKR1C3 mediated production of testosterone in LNCaP-AKR1C3 cells. These compounds offer promising leads toward new therapeutics for CRPC.
  • Transcriptome Analysis of Different Multidrug-Resistant Gastric Carcinoma Cells

    Transcriptome Analysis of Different Multidrug-Resistant Gastric Carcinoma Cells

    in vivo 19: 583-590 (2005) Transcriptome Analysis of Different Multidrug-resistant Gastric Carcinoma Cells STEFFEN HEIM1 and HERMANN LAGE2 1Europroteome AG, Berlin-Hennigsdorf; 2Institute of Pathology, Charité Campus Mitte, Schumannstr. 20/21, D-10117 Berlin, Germany Abstract. Multidrug resistance (MDR) of human cancers is advanced cancer. These therapeutic protocols produce an the major cause of failure of chemotherapy. To better overall response rate of about 20% at best using a single- understand the molecular events associated with the agent, and up to 50% using combination chemotherapy. development of different types of MDR, two different multidrug- Thus, a large number of malignancies are incurable. resistant gastric carcinoma cell lines, the MDR1/P-glycoprotein- Generally, gastrointestinal cancers, including gastric expressing cell line EPG85-257RDB and the MDR1/P- carcinoma, are naturally resistant to many anticancer drugs. glycoprotein-negative cell variant EPG85-257RNOV, as well as Additionally, these tumors are able to develop acquired the corresponding drug-sensitive parental cell line EPG85-257P, drug resistance phenotypes, which include the multidrug were used for analyses of the mRNA expression profiles by resistance (MDR) phenomenon. cDNA array hybridization. Of more than 12,000 genes spotted The MDR phenotype is characterized by simultaneous on the arrays, 156 genes were detected as being significantly resistance of tumor cells to various antineoplastic agents regulated in the cell line EPG85-257RDB in comparison to the which are structurally and functionally unrelated. Besides non-resistant cell variant, and 61 genes were found to be the classical MDR phenotype, mediated by the enhanced differentially expressed in the cell line EPG85-257RNOV.
  • Data Supplement

    Data Supplement

    JPET#173179 1 SUPPLEMENTAL DATA Manuscript title: Naturally occurring variants of human aldo-keto reductases with reduced in vitro metabolism of daunorubicin and doxorubicin Authors: Onkar S. Bains, Thomas A. Grigliatti, Ronald E. Reid, and K. Wayne Riggs Journal name: Journal of Pharmacology and Experimental Therapeutics TABLES Supplemental Table 1—Primers for creating non-synonymous single nucleotide polymorphic variants of human AKRs and CBR4 using site-directed mutagenesis. The base pair mutation is given beneath each variant [in square brackets]. Also, the mutated base pair is underlined in the forward and reverse primer sequences. ENZYME VARIANT FORWARD PRIMER (5'3') REVERSE PRIMER (5'3') I15F CAAGATGCCCTTCCTGGGGTT CCAACCCCAGGAAGGGCATC AKR1B1 [AT] GG TTG H42L CGGGTACCGCCTCATCGACTG GGGCACAGTCGATGAGGCGG [AT] TGCCC TACCCG L73V GCGTGAGGAGGTCTTCATCGT GCTGACGATGAAGACCTCCTC [CG] CAGC ACGC K90E GGGCCTGGTGGAAGGAGCCTG GGCAGGCTCCTTCCACCAGGC [AG] CC CC G204S GCCAGTCCAAAAGCATCGTGG GTCACCACGATGCTTTTGGAC [GA] TGAC TGGC T288I CCAGGATATGACCATCTTACTC GTAGCTGAGTAAGATGGTCAT [CT] AGCTAC ATCCTGG P87S CACTTTCTTTGAGAGATCCCTT CTTTCCTCACAAGGGATCTCT AKR1B10 [CT] GTGAGGAAAG CAAAGAAAGTG M286T GTGATGAGGAGACGGCAACCA GAGTATGGTTGCCGTCTCCTC [TC] TACTC ATCAC N313D GACTATCCCTTCGATGCAGAA CAATATTCTGCATCGAAGGGA [AG] TATTG TAGTC R170H CCAACTTCAACCACAGGCAGC CTCCAGCTGCCTGTGGTTGAA AKR1C1 [GA] TGGAG GTTGG Q172L CTTCAACCGCAGGCTGCTGGA GGATCATCTCCAGCAGCCTGC [AT] GATGATCC GGTTGAAG F46Y CAATAGAAGCCGGGTACCACC GAATCAATATGGTGGTACCCG AKR1C2 [TA] ATATTTGATTC GCTTCTATTG JPET#173179
  • Metabolic Enzyme/Protease

    Metabolic Enzyme/Protease

    Inhibitors, Agonists, Screening Libraries www.MedChemExpress.com Metabolic Enzyme/Protease Metabolic pathways are enzyme-mediated biochemical reactions that lead to biosynthesis (anabolism) or breakdown (catabolism) of natural product small molecules within a cell or tissue. In each pathway, enzymes catalyze the conversion of substrates into structurally similar products. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation. Metabolism maintains the living state of the cells and the organism. Proteases are used throughout an organism for various metabolic processes. Proteases control a great variety of physiological processes that are critical for life, including the immune response, cell cycle, cell death, wound healing, food digestion, and protein and organelle recycling. On the basis of the type of the key amino acid in the active site of the protease and the mechanism of peptide bond cleavage, proteases can be classified into six groups: cysteine, serine, threonine, glutamic acid, aspartate proteases, as well as matrix metalloproteases. Proteases can not only activate proteins such as cytokines, or inactivate them such as numerous repair proteins during apoptosis, but also expose cryptic sites, such as occurs with β-secretase during amyloid precursor protein processing, shed various transmembrane proteins such as occurs with metalloproteases and cysteine proteases, or convert receptor agonists into antagonists and vice versa such as chemokine conversions carried out by metalloproteases, dipeptidyl peptidase IV and some cathepsins. In addition to the catalytic domains, a great number of proteases contain numerous additional domains or modules that substantially increase the complexity of their functions.
  • Orlistat, a Novel Potent Antitumor Agent for Ovarian Cancer: Proteomic Analysis of Ovarian Cancer Cells Treated with Orlistat

    Orlistat, a Novel Potent Antitumor Agent for Ovarian Cancer: Proteomic Analysis of Ovarian Cancer Cells Treated with Orlistat

    INTERNATIONAL JOURNAL OF ONCOLOGY 41: 523-532, 2012 Orlistat, a novel potent antitumor agent for ovarian cancer: proteomic analysis of ovarian cancer cells treated with Orlistat HUI-QIONG HUANG1*, JING TANG1*, SHENG-TAO ZHOU1, TAO YI1, HONG-LING PENG1, GUO-BO SHEN2, NA XIE2, KAI HUANG2, TAO YANG2, JIN-HUA WU2, CAN-HUA HUANG2, YU-QUAN WEI2 and XIA ZHAO1,2 1Gynecological Oncology of Biotherapy Laboratory, Department of Gynecology and Obstetrics, West China Second Hospital, Sichuan University, Chengdu, Sichuan; 2State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University, Chengdu, Sichuan, P.R. China Received February 9, 2012; Accepted March 19, 2012 DOI: 10.3892/ijo.2012.1465 Abstract. Orlistat is an orally administered anti-obesity drug larly PKM2. These changes confirmed our hypothesis that that has shown significant antitumor activity in a variety of Orlistat is a potential inhibitor of ovarian cancer and can be tumor cells. To identify the proteins involved in its antitumor used as a novel adjuvant antitumor agent. activity, we employed a proteomic approach to reveal protein expression changes in the human ovarian cancer cell line Introduction SKOV3, following Orlistat treatment. Protein expression profiles were analyzed by 2-dimensional polyacrylamide In the 1920s, the Nobel Prize winner Otto Warburg observed gel electrophoresis (2-DE) and protein identification was a marked increase in glycolysis and enhanced lactate produc- performed on a MALDI-Q-TOF MS/MS instrument. More tion in tumor cells even when maintained in conditions of high than 110 differentially expressed proteins were visualized oxygen tension (termed Warburg effect), leading to widespread by 2-DE and Coomassie brilliant blue staining.