DOCSLIB.ORG

Data Supplement

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Data Supplement JPET#173179 1 SUPPLEMENTAL DATA Manuscript title: Naturally occurring variants of human aldo-keto reductases with reduced in vitro metabolism of daunorubicin and doxorubicin Authors: Onkar S. Bains, Thomas A. Grigliatti, Ronald E. Reid, and K. Wayne Riggs Journal name: Journal of Pharmacology and Experimental Therapeutics TABLES Supplemental Table 1—Primers for creating non-synonymous single nucleotide polymorphic variants of human AKRs and CBR4 using site-directed mutagenesis. The base pair mutation is given beneath each variant [in square brackets]. Also, the mutated base pair is underlined in the forward and reverse primer sequences. ENZYME VARIANT FORWARD PRIMER (5'3') REVERSE PRIMER (5'3') I15F CAAGATGCCCTTCCTGGGGTT CCAACCCCAGGAAGGGCATC AKR1B1 [AT] GG TTG H42L CGGGTACCGCCTCATCGACTG GGGCACAGTCGATGAGGCGG [AT] TGCCC TACCCG L73V GCGTGAGGAGGTCTTCATCGT GCTGACGATGAAGACCTCCTC [CG] CAGC ACGC K90E GGGCCTGGTGGAAGGAGCCTG GGCAGGCTCCTTCCACCAGGC [AG] CC CC G204S GCCAGTCCAAAAGCATCGTGG GTCACCACGATGCTTTTGGAC [GA] TGAC TGGC T288I CCAGGATATGACCATCTTACTC GTAGCTGAGTAAGATGGTCAT [CT] AGCTAC ATCCTGG P87S CACTTTCTTTGAGAGATCCCTT CTTTCCTCACAAGGGATCTCT AKR1B10 [CT] GTGAGGAAAG CAAAGAAAGTG M286T GTGATGAGGAGACGGCAACCA GAGTATGGTTGCCGTCTCCTC [TC] TACTC ATCAC N313D GACTATCCCTTCGATGCAGAA CAATATTCTGCATCGAAGGGA [AG] TATTG TAGTC R170H CCAACTTCAACCACAGGCAGC CTCCAGCTGCCTGTGGTTGAA AKR1C1 [GA] TGGAG GTTGG Q172L CTTCAACCGCAGGCTGCTGGA GGATCATCTCCAGCAGCCTGC [AT] GATGATCC GGTTGAAG F46Y CAATAGAAGCCGGGTACCACC GAATCAATATGGTGGTACCCG AKR1C2 [TA] ATATTTGATTC GCTTCTATTG JPET#173179 2 H5Q GGAAGAATGGATTCCAAACAG CATTTAGCTTTACACACTGCT AKR1C3 [CG] CAGTGTGTAAAGCTAAATG GTTTGGAATCCATTCTTCC R66Q GGTTGGACTGGCCATCCAAAG CATCTGCAATCTTGCTTTGGA [GA] CAAGATTGCAGATG TGGCCAGTCCAACC A106T GGAAAACTCACTGAAAAAAAC GTCAACATAGTCCAATTGAGT [GA] TCAATTGGACTATGTTGAC TTTTTTCAGTGAGTTTTCC R170C GGGTGTCAAACTTCAACTGCA CATCTCCAGCTGCCTGCAGTT [CT] GGCAGCTGGAGATG GAAGTTTGACACCC P180S GAGATGATCCTCAACAAGTCA GCTTGTACTTAAGTCCTGACT [CT] GGACTTAAGTACAAGC TGTTGAGGATCATCTC GCCACTACCAAAAGATGAAAA CCACTGTGTCGAATATTACTT G135E AKR1C4 TGAAAAAGTAATATTCGACAC TTTCATTTTCATCTTTTGGTAG [GA] AGTGG TGGC S145C CAGTGGATCTCTGTGCCACAT CTCCCATGTGGCACAGAGATC [CG] GGGAG CACTG L311V GATATGTTGTCATGGATTTTGT GATAATCAGGATGGTCCATAA [CG] TATGGACCATCCTGATTATC CAAAATCCATGACAACATATC V135M CTGCAGTGTCCCCAAATGGAC GGTAGAAGAGGTCCATTTGG AKR7A2 [GA] CTCTTCTACC GGACACTGCAG Q157H GCATGCCTGCCACCGGCTGCA CTGGTGCAGCCGGTGGCAGG [GC] CCAG CATGC E180K GCTGGGAAGTGGCCAAGATCT GAGGGTACAGATCTTGGCCAC [GA] GTACCCTC TTCCCAGC G198S CCACTGTGTACCAGAGCATGT GGCGTTGTACATGCTCTGGTA [GA] ACAACGCC CACAGTGG S255N CGCTTCTTTGGGAATAACTGG GTAGGTCTCAGCCCAGTTATT [GA] GCTGAGACCTAC CCCAAAGAAGCG L70M CATTTGAAGAGATGGAGAAAC CTCGACCTAAATGTTTCTCCA CBR4 [CA] ATTTAGGTCGAG TCTCTTCAAATG JPET#173179 3 FIGURES Supplemental Fig. 1—Purification of human recombinant 6x-His tagged (A) AKR1B1, (B) AKR1B10, (C) AKR1C1, (D) AKR1C2, (E) AKR1C3, (F) AKR1C4, (G) AKR7A2, and (H) CBR4 wild-type enzymes. (Left) Gels stained with SYPRO® Ruby following SDS-PAGE showing purified protein samples (lane 3; 3 µg), free of contaminating proteins from bacterial lysates (lane 1; 10 µg total protein). Removal of contaminating proteins is observed in fractions from Qiagen purification procedures [Ni-NTA column flow through (lane 2; 10 µg total protein)]. (Right) Western blot detection of transformed lysates (lane 6) and purified protein samples (lane 8), confirms expression of the desired AKR protein with mobility at expected molecular weight (41.9 kDa for AKR1C3, 39.7 kDa for AKR1C4 and 39.3 kDa for AKR7A2). Little immunoreactivity was detected in the flow through samples (lane 7) suggesting that majority of the enzymes were bound to the Ni-NTA resin prior to their elution. GST-tagged AKR recombinant proteins (Abnova Corporation) were used as a positive controls for antibody immunoreactivity (lane 5; 1 μg). No antibody immunoreactivity is observed for untransformed bacterial lysate (lane 4; 10 μg total protein). M refers to the molecular weight markers. JPET#173179 4 Supplemental Fig. 2—Representative Western blot detection of purified 6x-His tagged AKR proteins [(A) AKR1C3, (B) AKR1C4, and (C) AKR7A2 wild-type enzymes; lane 2; 3 µg] and native AKR proteins (lane 3; 3 µg). The 6x-His tagged proteins were incubated with Factor Xa for 6 hrs at 23oC to allow for removal of the tag and linker from the amino terminus. GST- tagged AKR recombinant proteins (Abnova Corporation) were used as a positive controls for antibody immunoreactivity (lane 1; 1 μg). M refers to the molecular weight markers. JPET#173179 5 Supplemental Fig. 3—Representative Western blot detection of cytosolic AKR and CBR proteins in pooled human liver (L) and human heart (H) lysates (20 μg total protein). Lysates were run on 18% SDS-PAGE gels and subjected to Western blotting for detection of AKR1A1, AKR1B1, AKR1B10, AKR1C1, AKR1C2, AKR1C3, AKR1C4, AKR7A2, CBR1, and CBR3 proteins (ranging from 30 to 38 kDa). In addition to the reductase enzymes, β-tubulin band was also detected using Western blotting (~55 kDa). The 6x-His tagged purified proteins were used as positive controls (PCs) for antibody immunoreactivity for these enzymes. M refers to the molecular weight markers. .
Load more

Recommended publications
  • Upregulation of Peroxisome Proliferator-Activated Receptor-Α And
    Upregulation of peroxisome proliferator-activated receptor-α and the lipid metabolism pathway promotes carcinogenesis of ampullary cancer Chih-Yang Wang, Ying-Jui Chao, Yi-Ling Chen, Tzu-Wen Wang, Nam Nhut Phan, Hui-Ping Hsu, Yan-Shen Shan, Ming-Derg Lai 1 Supplementary Table 1. Demographics and clinical outcomes of five patients with ampullary cancer Time of Tumor Time to Age Differentia survival/ Sex Staging size Morphology Recurrence recurrence Condition (years) tion expired (cm) (months) (months) T2N0, 51 F 211 Polypoid Unknown No -- Survived 193 stage Ib T2N0, 2.41.5 58 F Mixed Good Yes 14 Expired 17 stage Ib 0.6 T3N0, 4.53.5 68 M Polypoid Good No -- Survived 162 stage IIA 1.2 T3N0, 66 M 110.8 Ulcerative Good Yes 64 Expired 227 stage IIA T3N0, 60 M 21.81 Mixed Moderate Yes 5.6 Expired 16.7 stage IIA 2 Supplementary Table 2. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of an ampullary cancer microarray using the Database for Annotation, Visualization and Integrated Discovery (DAVID). This table contains only pathways with p values that ranged 0.0001~0.05. KEGG Pathway p value Genes Pentose and 1.50E-04 UGT1A6, CRYL1, UGT1A8, AKR1B1, UGT2B11, UGT2A3, glucuronate UGT2B10, UGT2B7, XYLB interconversions Drug metabolism 1.63E-04 CYP3A4, XDH, UGT1A6, CYP3A5, CES2, CYP3A7, UGT1A8, NAT2, UGT2B11, DPYD, UGT2A3, UGT2B10, UGT2B7 Maturity-onset 2.43E-04 HNF1A, HNF4A, SLC2A2, PKLR, NEUROD1, HNF4G, diabetes of the PDX1, NR5A2, NKX2-2 young Starch and sucrose 6.03E-04 GBA3, UGT1A6, G6PC, UGT1A8, ENPP3, MGAM, SI, metabolism
    [Show full text]
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • Enzyme DHRS7
    Toward the identification of a function of the “orphan” enzyme DHRS7 Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Selene Araya, aus Lugano, Tessin Basel, 2018 Originaldokument gespeichert auf dem Dokumentenserver der Universität Basel edoc.unibas.ch Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Alex Odermatt (Fakultätsverantwortlicher) und Prof. Dr. Michael Arand (Korreferent) Basel, den 26.6.2018 ________________________ Dekan Prof. Dr. Martin Spiess I. List of Abbreviations 3α/βAdiol 3α/β-Androstanediol (5α-Androstane-3α/β,17β-diol) 3α/βHSD 3α/β-hydroxysteroid dehydrogenase 17β-HSD 17β-Hydroxysteroid Dehydrogenase 17αOHProg 17α-Hydroxyprogesterone 20α/βOHProg 20α/β-Hydroxyprogesterone 17α,20α/βdiOHProg 20α/βdihydroxyprogesterone ADT Androgen deprivation therapy ANOVA Analysis of variance AR Androgen Receptor AKR Aldo-Keto Reductase ATCC American Type Culture Collection CAM Cell Adhesion Molecule CYP Cytochrome P450 CBR1 Carbonyl reductase 1 CRPC Castration resistant prostate cancer Ct-value Cycle threshold-value DHRS7 (B/C) Dehydrogenase/Reductase Short Chain Dehydrogenase Family Member 7 (B/C) DHEA Dehydroepiandrosterone DHP Dehydroprogesterone DHT 5α-Dihydrotestosterone DMEM Dulbecco's Modified Eagle's Medium DMSO Dimethyl Sulfoxide DTT Dithiothreitol E1 Estrone E2 Estradiol ECM Extracellular Membrane EDTA Ethylenediaminetetraacetic acid EMT Epithelial-mesenchymal transition ER Endoplasmic Reticulum ERα/β Estrogen Receptor α/β FBS Fetal Bovine Serum 3 FDR False discovery rate FGF Fibroblast growth factor HEPES 4-(2-Hydroxyethyl)-1-Piperazineethanesulfonic Acid HMDB Human Metabolome Database HPLC High Performance Liquid Chromatography HSD Hydroxysteroid Dehydrogenase IC50 Half-Maximal Inhibitory Concentration LNCaP Lymph node carcinoma of the prostate mRNA Messenger Ribonucleic Acid n.d.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials COMPARATIVE ANALYSIS OF THE TRANSCRIPTOME, PROTEOME AND miRNA PROFILE OF KUPFFER CELLS AND MONOCYTES Andrey Elchaninov1,3*, Anastasiya Lokhonina1,3, Maria Nikitina2, Polina Vishnyakova1,3, Andrey Makarov1, Irina Arutyunyan1, Anastasiya Poltavets1, Evgeniya Kananykhina2, Sergey Kovalchuk4, Evgeny Karpulevich5,6, Galina Bolshakova2, Gennady Sukhikh1, Timur Fatkhudinov2,3 1 Laboratory of Regenerative Medicine, National Medical Research Center for Obstetrics, Gynecology and Perinatology Named after Academician V.I. Kulakov of Ministry of Healthcare of Russian Federation, Moscow, Russia 2 Laboratory of Growth and Development, Scientific Research Institute of Human Morphology, Moscow, Russia 3 Histology Department, Medical Institute, Peoples' Friendship University of Russia, Moscow, Russia 4 Laboratory of Bioinformatic methods for Combinatorial Chemistry and Biology, Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry of the Russian Academy of Sciences, Moscow, Russia 5 Information Systems Department, Ivannikov Institute for System Programming of the Russian Academy of Sciences, Moscow, Russia 6 Genome Engineering Laboratory, Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region, Russia Figure S1. Flow cytometry analysis of unsorted blood sample. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S2. Flow cytometry analysis of unsorted liver stromal cells. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S3. MiRNAs expression analysis in monocytes and Kupffer cells. Full-length of heatmaps are presented.
    [Show full text]
  • The Identification of Human Aldo-Keto Reductase AKR7A2 As a Novel
    Li et al. Cellular & Molecular Biology Letters (2016) 21:25 Cellular & Molecular DOI 10.1186/s11658-016-0026-9 Biology Letters SHORTCOMMUNICATION Open Access The identification of human aldo-keto reductase AKR7A2 as a novel cytoglobin- binding partner Xin Li, Shanshan Zou, Zhen Li, Gaotai Cai, Bohong Chen, Ping Wang and Wenqi Dong* * Correspondence: [email protected] Abstract Department of Biopharmaceutics, School of Laboratory Medicine and Cytoglobin (CYGB), a member of the globin family, is thought to protect cells from Biotechnology, Southern Medical reactive oxygen and nitrogen species and deal with hypoxic conditions and University, 1838 North Guangzhou oxidative stress. However, its molecular mechanisms of action are not clearly Avenue, Guangzhou 510515, China understood. Through immunoprecipitation combined with a two-dimensional electrophoresis–mass spectrometry assay, we identified a CYGB interactor: aldo-keto reductase family 7 member A2 (AKR7A2). The interaction was further confirmed using yeast two-hybrid and co-immunoprecipitation assays. Our results show that AKR7A2 physically interacts with CYGB. Keywords: CYGB, AKR7A2, Protein-protein interactions, Yeast two-hybrid assay, Co-immunoprecipitation, 2-DE, Oxidative stress Introduction Cytoglobin (CYGB), which is a member of the globin family, was discovered more than a decade ago in a proteomic screen of fibrotic liver [1]. It was originally named STAP (stellate activating protein). Human CYGB is a 190-amino acid, 21-kDa protein [2], encoded by a single copy gene mapped at the 17q25.3 chromosomal segment [3]. It has a compact helical conformation, giving it the ability to bind to heme, which allows reversible binding of gaseous, diatomic molecules, including oxygen (O2), nitric oxide (NO) and carbon monoxide (CO), just like hemoglobin (Hb), myoglobin (Mb) and neuroglobin (Ngb) [4].
    [Show full text]
  • Gene-Expression Signature Regulated by the KEAP1-NRF2-CUL3 Axis Is Associated with a Poor Prognosis in Head and Neck Squamous Cell Cancer Akhileshwar Namani1†, Md
    Namani et al. BMC Cancer (2018) 18:46 DOI 10.1186/s12885-017-3907-z RESEARCH ARTICLE Open Access Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer Akhileshwar Namani1†, Md. Matiur Rahaman2†, Ming Chen2* and Xiuwen Tang1* Abstract Background: NRF2 is the key regulator of oxidative stress in normal cells and aberrant expression of the NRF2 pathway due to genetic alterations in the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (nuclear factor erythroid 2 like 2)-CUL3 (cullin 3) axis leads to tumorigenesis and drug resistance in many cancers including head and neck squamous cell cancer (HNSCC). The main goal of this study was to identify specific genes regulated by the KEAP1-NRF2-CUL3 axis in HNSCC patients, to assess the prognostic value of this gene signature in different cohorts, and to reveal potential biomarkers. Methods: RNA-Seq V2 level 3 data from 279 tumor samples along with 37 adjacent normal samples from patients enrolled in the The Cancer Genome Atlas (TCGA)-HNSCC study were used to identify upregulated genes using two methods (altered KEAP1-NRF2-CUL3 versus normal, and altered KEAP1-NRF2-CUL3 versus wild-type). We then used a new approach to identify the combined gene signature by integrating both datasets and subsequently tested this signature in 4 independent HNSCC datasets to assess its prognostic value. In addition, functional annotation using the DAVID v6.8 database and protein-protein interaction (PPI) analysis using the STRING v10 databasewereperformedonthesignature. Results: A signature composed of a subset of 17 genes regulated by the KEAP1-NRF2-CUL3 axis was identified by overlapping both the upregulated genes of altered versus normal (251 genes) and altered versus wild-type (25 genes) datasets.
    [Show full text]
  • Identification and Characterization of Genes That Control Fat
    Claire D’Andre et al. Journal of Animal Science and Biotechnology 2013, 4:43 http://www.jasbsci.com/content/4/1/43 JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY RESEARCH Open Access Identification and characterization of genes that control fat deposition in chickens Hirwa Claire D’Andre1,3*, Wallace Paul2, Xu Shen3, Xinzheng Jia3, Rong Zhang3, Liang Sun3 and Xiquan Zhang3 Abstract Background: Fat deposits in chickens contribute significantly to meat quality attributes such as juiciness, flavor, taste and other organoleptic properties. The quantity of fat deposited increases faster and earlier in the fast- growing chickens than in slow-growing chickens. In this study, Affymetrix Genechip® Chicken Genome Arrays 32773 transcripts were used to compare gene expression profiles in liver and hypothalamus tissues of fast-growing and slow-growing chicken at 8 wk of age. Real-time RT-PCR was used to validate the differential expression of genes selected from the microarray analysis. The mRNA expression of the genes was further examined in fat tissues. The association of single nucleotide polymorphisms of four lipid-related genes with fat traits was examined in a F2 resource population. Results: Four hundred genes in the liver tissues and 220 genes hypothalamus tissues, respectively, were identified to be differentially expressed in fast-growing chickens and slow-growing chickens. Expression levels of genes for lipid metabolism (SULT1B1, ACSBG2, PNPLA3, LPL, AOAH) carbohydrate metabolism (MGAT4B, XYLB, GBE1, PGM1, HKDC1)cholesttrol biosynthesis (FDPS, LSS, HMGCR, NSDHL, DHCR24, IDI1, ME1) HSD17B7 and other reaction or pro- cesses (CYP1A4, CYP1A1, AKR1B1, CYP4V2, DDO) were higher in the fast-growing White Recessive Rock chickens than in the slow-growing Xinghua chickens.
    [Show full text]
  • MMP-25 Metalloprotease Regulates Innate Immune Response Through NF- Κb Signaling Clara Soria-Valles, Ana Gutiérrez-Fernández, Fernando G
    MMP-25 Metalloprotease Regulates Innate Immune Response through NF- κB Signaling Clara Soria-Valles, Ana Gutiérrez-Fernández, Fernando G. Osorio, Dido Carrero, Adolfo A. Ferrando, Enrique Colado, This information is current as M. Soledad Fernández-García, Elena Bonzon-Kulichenko, of September 27, 2021. Jesús Vázquez, Antonio Fueyo and Carlos López-Otín J Immunol 2016; 197:296-302; Prepublished online 3 June 2016; doi: 10.4049/jimmunol.1600094 Downloaded from http://www.jimmunol.org/content/197/1/296 Supplementary http://www.jimmunol.org/content/suppl/2016/06/01/jimmunol.160009 Material 4.DCSupplemental http://www.jimmunol.org/ References This article cites 41 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/197/1/296.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology MMP-25 Metalloprotease Regulates Innate Immune Response through NF-kB Signaling Clara Soria-Valles,* Ana Gutie´rrez-Ferna´ndez,* Fernando G.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • AKR7A2 (NM 003689) Human Tagged ORF Clone Lentiviral Particle Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214673L4V AKR7A2 (NM_003689) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: AKR7A2 (NM_003689) Human Tagged ORF Clone Lentiviral Particle Symbol: AKR7A2 Synonyms: AFAR; AFAR1; AFB1-AR1; AKR7 Vector: pLenti-C-mGFP-P2A-Puro (PS100093) ACCN: NM_003689 ORF Size: 1077 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC214673). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_003689.2 RefSeq Size: 1377 bp RefSeq ORF: 1080 bp Locus ID: 8574 UniProt ID: O43488, V9HWA2 Domains: aldo_ket_red Protein Families: Druggable Genome MW: 39.4 kDa This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 AKR7A2 (NM_003689) Human Tagged ORF Clone Lentiviral Particle – RC214673L4V Gene Summary: The protein encoded by this gene belongs to the aldo/keto reductase (AKR) superfamily and AKR7 family, which are involved in the detoxification of aldehydes and ketones.
    [Show full text]
  • Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell
    Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Ibrahim Halil Polat ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través del Dipòsit Digital de la UB (diposit.ub.edu) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB (diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR o al Repositorio Digital de la UB.
    [Show full text]
  • Supplementary Methods
    Supplementary methods Human lung tissues and tissue microarray (TMA) All human tissues were obtained from the Lung Cancer Specialized Program of Research Excellence (SPORE) Tissue Bank at the M.D. Anderson Cancer Center (Houston, TX). A collection of 26 lung adenocarcinomas and 24 non-tumoral paired tissues were snap-frozen and preserved in liquid nitrogen for total RNA extraction. For each tissue sample, the percentage of malignant tissue was calculated and the cellular composition of specimens was determined by histological examination (I.I.W.) following Hematoxylin-Eosin (H&E) staining. All malignant samples retained contained more than 50% tumor cells. Specimens resected from NSCLC stages I-IV patients who had no prior chemotherapy or radiotherapy were used for TMA analysis by immunohistochemistry. Patients who had smoked at least 100 cigarettes in their lifetime were defined as smokers. Samples were fixed in formalin, embedded in paraffin, stained with H&E, and reviewed by an experienced pathologist (I.I.W.). The 413 tissue specimens collected from 283 patients included 62 normal bronchial epithelia, 61 bronchial hyperplasias (Hyp), 15 squamous metaplasias (SqM), 9 squamous dysplasias (Dys), 26 carcinomas in situ (CIS), as well as 98 squamous cell carcinomas (SCC) and 141 adenocarcinomas. Normal bronchial epithelia, hyperplasia, squamous metaplasia, dysplasia, CIS, and SCC were considered to represent different steps in the development of SCCs. All tumors and lesions were classified according to the World Health Organization (WHO) 2004 criteria. The TMAs were prepared with a manual tissue arrayer (Advanced Tissue Arrayer ATA100, Chemicon International, Temecula, CA) using 1-mm-diameter cores in triplicate for tumors and 1.5 to 2-mm cores for normal epithelial and premalignant lesions.
    [Show full text]